Full text
UNIVERSIDADE DE SANTIAGO DE COMPOSTELA DEPARTAMENTO DE MEDICINA RELACIÓN ENTRE LA EXPRESIÓN DE ADIPOCITOQUINAS EN EL TEJIDO ADIPOSO EPICÁRDICO Y LA ENFERMEDAD CARDIOVASCULAR MEMORIA Que presenta para optar al Grado de Doctor Elvis Teijeira Fernández ISBN 978-84-9887-623-9 (Edición digital PDF) Santiago de Compostela, octubre de 2010
El Prof. D. José Ramón González Juanatey, Catedrático del Departamento de Medicina de la Universidad de Santiago de Compostela y Jefe de Servicio de Cardiología y Unidad Coronaria del Hospital Clínico Universitario de Santiago, la Dra. Dña. Sonia Eiras Penas, Investigadora del Instituto de Investigaciones Sanitarias (IDIS) del Hospital Clínico Universitario de Santiago, y la Dra. Dña. Lilian Grigorian Shamagian, CERTIFICAN QUE: La presente memoria, titulada ”Relación entre la expresión de adipocitoquinas en el tejido adiposo epicárdico y la enfermedad cardiovascular”, que presenta D. Elvis Teijeira Fernández para optar al Grado de Doctor por la Universidad de Santiago de Compostela, ha sido realizada bajo su dirección en el Servicio de Cardiología y Unidad Coronaria y en el Instituto de Investigaciones Sanitarias del Hospital Clínico Universitario de Santiago, y autorizan su presentación a fin de que pueda ser juzgada por el tribunal correspondiente. Y para que así conste, firman la presente en Santiago de Compostela, a 7 de octubre de 2010. Fdo.: Dra. Dña. Sonia Eiras Penas Fdo.: Dra. Dña. Lilian Grigorian Shamagian Fdo.: Prof. D. José Ramón González Juanatey Fdo.: D. Elvis Teijeira Fernández
A mi madre. A mis hermanos. A Marga.
What we know is a drop, what we don’t know is an ocean. Isaac Newton
ÍNDICE Capítulo 1 Introducción general 1 Capítulo 2 Tamaño de los adipocitos en el TAE y expresión de MCP-1 25 Capítulo 3 Adiponectina e IL-6 en el TAE y extensión de la enfermedad coronaria 39 Capítulo 4 Adiponectina en el TAE e hipertensión arterial 55 Capítulo 5 Adiponectina y leptina en el TAE y diabetes mellitus tipo 2 71 Capítulo 6 Adiponectina en el TAE y síndrome metabólico 89 Capítulo 7 Adiponectina y leptina en el TAE y pronóstico cardiovascular 105 Capítulo 8 Discusión general 121 Capítulo 9 Conclusiones 137 Bibliografía 139 Apéndice 163
CAPÍTULO 1 6 adiponectina presentan alteraciones en la revascularización tras la isquemia, mientras que la sobreexpresión de la hormona la facilita.42 En animales de experimentación se ha demostrado también que el suplemento de adiponectina estimula la angiogénesis. La adiponectina estimula la migración de las células endoteliales y previene la apoptosis in vitro.43, 44 Los ratones deficitarios de adiponectina presentan un número reducido de células endoteliales progenitoras circulantes en condiciones de isquemia. Por otra parte, la incubación de células mononucleares humanas de sangre periférica con adiponectina induce el aumento del número de progenitores circulantes de células endoteliales, y la adiponectina favorece su quimiotaxis y la diferenciación hacia estructuras reticulares.45 En línea con estos hallazgos, se ha observado que la adiponectina estimula la producción de óxido nítrico en las células endoteliales a través de la fosforilación de la óxido nítrico sintasa endotelial (eNOS) tanto por mecanismos dependientes como por mecanismos independientes del enzima AMPK.42 Los ratones con déficit de adiponectina sometidos a una dieta hipersódica presentan mayor presión arterial, una tasa elevada de infarto cerebral tras el daño por isquemia y reperfusión, menor expresión de eNOS en la aorta y menor activación de eNOS en el tejido cerebral isquémico.46, 47 Por tanto, el eje regulador adiponectina-eNOS protege contra el desarrollo de insuficiencia vascular y disfunción endotelial. -Adiponectina y aterosclerosis. La administración de adiponectina a ratones deficitarios de apolipoproteína E reduce el tamaño de la lesión aterosclerótica y la expresión del receptor scavenger clase A, de TNF-α y de la molécula de adhesión vascular celular tipo 1 (VCAM-1).48 Por otra parte, la adiponectina reduce la expresión de VCAM-1 inducida por TNF-α en las células endoteliales, suprimiendo la activación del factor nuclear (NF)-κB.49 En humanos, también suprime la expresión de receptores scavenger clase A y de este modo inhibe la transformación de los macrófagos a células espumosas, reduce la producción de TNF-α estimulada por lipopolisacáridos32 y aumenta la producción de IL-10 por parte de los macrófagos.50 Además, facilita la eliminación de células apoptóticas por los macrófagos y modula los procesos inflamatorios.51 Así, la adiponectina posee propiedades antiaterogénicas y podría ser beneficiosa para el tratamiento y la prevención de enfermedades ateroscleróticas.
Introducción general 7 -Adiponectina y daño miocárdico por isquemia y reperfusión. Recientemente, se ha comprobado que los ratones deficitarios de adiponectina desarrollan infartos de miocardio más extensos tras la inducción de daño por isquemia y reperfusión. En estos animales de experimentación, el daño producido por la isquemia y la reperfusión genera un incremento de la actividad apoptótica del miocardio y de la expresión de TNF-α. Sin embargo, la administración de adiponectina revierte dicho efecto, y de ese modo disminuye el tamaño del infarto y mejora la función cardiaca.52, 53 La protección que confiere la adiponectina contra el daño por isquemia y reperfusión está ligada a la inhibición del exceso de estrés oxidativo y nítrico inducido por peroxinitritos.52 La adiponectina suprime el exceso de producción de especies reactivas de oxígeno en varios tipos celulares, incluidas las células endoteliales.54 La reducción de especies reactivas de oxígeno y de nitrógeno puede contribuir a la acción protectora de la hormona en el infarto de miocardio. Por otra parte, se ha observado que el aumento de la producción de adiponectina debido a la restricción calórica ofrece al miocardio cierta resistencia al daño por isquemia y reperfusión.55 Estos hallazgos sugieren que el tratamiento con adiponectina podría tener utilidad clínica en el manejo de pacientes con infarto agudo de miocardio. El daño miocárdico por isquemia y reperfusión produce un descenso transitorio de la concentración de adiponectina. Además, la administración de adiponectina a ratones deficitarios da lugar a su acumulación en el miocardio de los animales con daño por isquemia y reperfusión, pero no en los que no son sometidos a ese daño.56 Probablemente, la adiponectina se acumula en tejidos sometidos a isquemia y ejerce allí una función cardioprotectora. Se ha observado que adiponectina se expresa en cardiomiocitos,57 y que los niveles locales de la hormona se incrementan en modelos experimentales de daño miocárdico56 y disminuyen en la miocardiopatía dilatada.58 Es posible que la adiponectina producida localmente ejerza una función cardioprotectora, aunque esta hipótesis no ha sido confirmada hasta el momento. En cardiomiocitos cultivados sometidos a hipoxia y reoxigenación, la adiponectina suprime la apoptosis promoviendo la señalización por AMPK. La adiponectina también inhibe la producción de TNF-α inducida por lipopolisacáridos, una acción antiinflamatoria mediada en parte por su capacidad de activar la síntesis de prostaglandina E2 dependiente de ciclooxigenasa (COX)-2. La expresión de COX-2 inducida por la adiponectina disminuye al
CAPÍTULO 1 8 bloquear el enzima esfingosina quinasa-1, y el tratamiento con antagonistas del receptor esfingosina-1-fosfato también disminuye la expresión de COX-2 en respuesta a adiponectina.53 En línea con estas observaciones in vitro, el miocardio de los ratones deficitarios de adiponectina muestra una disminución de la inducción de COX-2 tras el daño por isquemia y reperfusión respecto al de los ratones con fenotipo salvaje. Además, la inhibición de COX-2 revierte parcialmente las acciones inhibitorias de la adiponectina sobre el tamaño del infarto y la producción de TNF-α.53 En conclusión, la adiponectina protege el corazón de la isquemia aguda mediante dos mecanismos independientes: los efectos antiapoptóticos mediados por AMPK y los efectos antiinflamatorios mediados por COX-2. -Adiponectina e hipertrofia miocárdica. Estudios experimentales han demostrado que la adiponectina previene el desarrollo de hipertrofia ventricular izquierda. Los ratones con déficit de adiponectina presentan hipertrofia ventricular concéntrica severa y una mayor mortalidad tras la sobrecarga de presión causada por la constricción aórtica, respecto a los ratones con fenotipo salvaje.59 De manera inversa, la adiponectina atenúa la hipertrofia cardiaca tras la sobrecarga de presión o la administración de angiotensinógeno II.60, 61 En cardiomiocitos cultivados, la adiponectina estimula la fosforilación de AMPK y suprime la activación de las proteín-quinasas reguladas por señales extracelulares (ERKs) y la hipertrofia inducidas por los receptores alfaadrenérgicos o la endotelina-1.60 El efecto inhibitorio de la adiponectina sobre la hipertrofia ventricular está mediado por la activación de la señalización de AMPK. Las interacciones de adiponectina con los receptores adipoR1 y adipoR2 inducen la activación de AMPK y de p38, y facilitan la captación de glucosa y la betaoxidación de los ácidos grasos,36 como se comentó previamente. Ambos receptores se encuentran en el miocardio y median la activación de AMPK por la adiponectina en modelos de hipertrofia in vitro.62 En conjunto, estos hallazgos sugieren que el eje de señalización adiponectina-AMPK en cardiomiocitos limita el remodelado cardiaco patológico. La adiponectina estimula la actividad de los PPAR-α, y esta estimulación disminuye al administrar un inhibidor de AMPK. Por tanto, la adiponectina inhibe la fibrosis cardiaca por lo menos en parte a través de la activación de los PPAR-α dependiente de AMPK.61
Introducción general 9 -Adiponectina y disfunción ventricular. El papel de la adiponectina en el desarrollo de insuficiencia cardiaca se ha estudiado utilizando un modelo de ratón con infarto de miocardio. Respecto a los ratones con fenotipo salvaje, los ratones deficitarios de adiponectina desarrollan mayor dilatación del ventrículo izquierdo, hipertrofia y disfunción contráctil tras el infarto.63 La alteración de la función ventricular izquierda se acompaña de hipertrofia miocitaria, aumento de la apoptosis, fibrosis intersticial y reducción de la densidad capilar en los bordes de la zona infartada. Además, la administración de adiponectina a ratones con fenotipo salvaje disminuye la dilatación ventricular izquierda y mejora la función ventricular, asociada a un incremento de la densidad capilar y una disminución de la hipertrofia, la apoptosis y la fibrosis intersticial tras el infarto. Los ratones con déficit de adiponectina presentan también un mayor grado de insuficiencia cardiaca tras la sobrecarga de presión, respecto a los ratones de fenotipo salvaje.59 En conclusión, la adiponectina parece proteger el corazón frente al remodelado patológico crónico, si bien la interpretación de los datos epidemiológicos resulta compleja, como se verá más adelante. La adiponectinemia y las enfermedades metabólicas y cardiovasculares: estudios epidemiológicos. -Adiponectina y diabetes mellitus tipo 2. La hipoadiponectinemia se asocia al síndrome metabólico y al desarrollo de diabetes mellitus tipo 2,64, 65 y la concentración de adiponectina se correlaciona de forma directa con la sensibilidad a la insulina.66 Los individuos con diabetes mellitus tipo 2 establecida presentan menores concentraciones plasmáticas de adiponectina que los controles no diabéticos,67 y lo mismo ocurre con los pacientes con síndrome metabólico respecto a los controles.68 -Adiponectina y cardiopatía isquémica. Varios estudios muestran que los niveles de adiponectina son menores en los pacientes con manifestaciones clínicas de enfermedad arterial coronaria.69, 70 Sin embargo, la asociación entre la adiponectinemia y la enfermedad arterial coronaria todavía es controvertida, ya que algunos estudios prospectivos no encontraron asociación significativa71, 72 o tan sólo una débil asociación entre los niveles bajos de adiponectina y la enfermedad coronaria.73 La disparidad en los resultados puede deberse a diferencias poblacionales, y por tanto el papel de la
CAPÍTULO 1 10 hipoadiponectinemia como factor independiente asociado a la enfermedad arterial coronaria todavía no está claro. Por otra parte, los pacientes que padecen síndrome coronario agudo presentan menores concentraciones plasmáticas de adiponectina.35 La hipoadiponectinemia se asocia además a un mayor riesgo de infarto agudo de miocardio en varones, independientemente de los niveles de proteína C reactiva o del estatus glucémico.74 Incluso se llegó a proponer como punto de corte de riesgo de síndrome coronario agudo una concentracion de adiponectina inferior a 5,5 μg/mL.75 También se ha observado que un rápido descenso del nivel de la hormona tras el infarto agudo de miocardio76 así como niveles persistentemente bajos predicen el desarrollo de eventos cardiacos en varones con infarto agudo de miocardio.77 Finalmente, resulta muy interesante que los niveles plasmáticos de adiponectina medidos tras el intervencionismo coronario pueden servir como predictor independiente de la mejoría de la función cardiaca durante el seguimiento.78 -Adiponectina e hipertensión arterial. Los resultados de los estudios diseñados para comprobar la relación entre la adiponectina plasmática y la hipertensión arterial no son homogéneos, si bien algunos sí han demostrado que existe asociación entre la hipoadiponectinemia y la hipertensión arterial.79, 80 Por otra parte, se observó que algunos fármacos antihipertensivos ejercen efectos paralelos sobre la concentración plasmática de adiponectina, la presión arterial y la sensibilidad a la insulina.81 -Adiponectina e hipertrofia ventricular izquierda. La hipertrofia ventricular izquierda se relaciona en parte con la obesidad, y algunos estudios clínicos han investigado la posible implicación de los niveles de adiponectina en su patogenia. La hipoadiponectinemia se asocia a la progresión de la hipertrofia ventricular izquierda, que se acompaña con frecuencia de disfunción diastólica,82 y se ha demostrado también que los niveles de adiponectina se correlacionan negativamente con la masa ventricular izquierda.83 Sin embargo, puesto que la hipoadiponectinemia puede incrementar el riesgo de hipertensión arterial,79 su contribución al desarrollo de hipertrofia ventricular podría deberse, por lo menos en parte, a la modulación de la presión sanguínea.
Introducción general 11 -Adiponectina e insuficiencia cardiaca. Varios estudios prospectivos han analizado la asociación entre los niveles de adiponectina y la insuficiencia cardiaca. La hiperadiponectinemia se asocia a una mayor mortalidad y severidad de la enfermedad en pacientes con insuficiencia cardiaca crónica, incluida la miocardiopatía dilatada.84-86 Los pacientes con caquexia presentan niveles elevados de adiponectina respecto a los pacientes no caquécticos,87 y un IMC bajo asociado a niveles elevados de adiponectina puede estar relacionado con el aumento de la mortalidad tras el inicio del cuadro de insuficiencia cardiaca.88 Por el contrario, en pacientes asintomáticos, los niveles plasmáticos de adiponectina parecen carecer de utilidad como predictores pronósticos de insuficiencia cardiaca.89 En pacientes con manifestaciones clínicas de insuficiencia cardiaca, los niveles de adiponectina son elevados y persiste la controversia acerca de la utilidad de la hormona como predictor pronóstico en esta situación. Teniendo en cuenta que la adiponectina ejerce efectos beneficiosos en el remodelado cardiaco patológico, los niveles paradójicos asociados a insuficiencia cardiaca podrían explicarse por la existencia de cierto fenómeno de “resistencia a la adiponectina”,90 comentada previamente en relación a los niveles más elevados de la hormona en individuos de edad avanzada. -Adiponectina y arteriopatía periférica. Los niveles de adiponectina se correlacionan positivamente con el índice tobillo-brazo, con la distancia máxima de marcha y con la distancia de claudicación.91 Sin embargo, en pacientes con arteriopatía periférica sometidos a cirugía de revascularización, la hipoadiponectinemia se asocia a un aumento del riesgo de muerte.92 Por tanto, en estadios tempranos, los niveles de adiponectina plasmática se correlacionan negativamente con la severidad de la arteriopatía periférica, pero no ocurre lo mismo en pacientes con enfermedad avanzada. Intervenciones terapéuticas que aumentan los niveles de adiponectina. -Modificaciones del estilo de vida. Diversas intervenciones terapéuticas han demostrado incrementar los niveles de adiponectina. Por una parte, la pérdida de peso prolongada puede llegar a normalizar los niveles de la hormona.67 La combinación de una dieta hipocalórica y de actividad física moderada conlleva una pérdida de peso significativa e incrementa los niveles de adiponectina plasmática,
CAPÍTULO 1 12 especialmente en los sujetos diabéticos.93 Durante el adelgazamiento, la isoforma de alto peso molecular de adiponectina aumenta significativamente, mientras que los niveles de trímeros y hexámeros disminuyen.44 Por otra parte, en pacientes con enfermedad arterial coronaria, se ha observado que los niveles plasmáticos de adiponectina se asocian negativamente con el tabaquismo.94 En adipocitos murinos cultivados se ha demostrado también que la nicotina y el peróxido de hidrógeno reducen la expresión de ARN y la secreción de adiponectina de forma dosisdependiente.95 -Bloqueo del sistema renina-angiotensina-aldosterona. Los fármacos que bloquean el sistema renina-angiotensina-aldosterona aumentan significativamente los niveles de adiponectina sin modificar el grado de adiposidad. Se ha observado que el tratamiento con losartán o con ramiprilo aumenta los niveles de adiponectina y mejora la sensibilidad a la insulina.96, 97 -Agonistas de PPAR-α. Los agonistas de los PPAR-α mejoran la sensibilidad a la insulina y reducen la adiposidad en animales de experimentación.98 El receptor adipoR2 se induce tanto por PPAR-α como por PPAR-γ. El tratamiento con fenofibrato aumenta la sensibilidad a la insulina en pacientes con hipertrigliceridemia primaria,99 y también se observó que incrementa los niveles de adiponectina sin ejercer influencia sobre el peso corporal.100 -Agonistas de PPAR-γ. Las tiazolidinedionas actúan como agonistas PPAR-γ e inducen la expresión y la secreción de adiponectina en humanos y roedores in vivo e in vitro sin afectar el peso corporal.29 Tras el tratamiento con tiazolidinedionas, los niveles de adiponectina se incrementan de manera uniforme en diabéticos, así como en controles obesos y con normopeso.101 Por el contrario, en un estudio realizado en pacientes diabéticos obesos, se observó que el tratamiento con metformina no modifica los niveles plasmáticos de adiponectina, aun consiguiendo un control glucémico similar.102
Introducción general 13 -Estatinas y betabloqueantes. Los efectos de las estatinas sobre la sensibilidad a la insulina son controvertidos, ya que los resultados de los diferentes estudios al respecto llegan a conclusiones dispares.103, 104 Por otra parte, el aumento de la actividad el sistema nervioso simpático disminuye los niveles plasmáticos de adiponectina, y los agonistas betaadrenérgicos y los análogos de AMP inhiben su expresión genética.105 Por el contrario, los betabloqueantes de nueva generación aumentan los niveles plasmáticos de adiponectina y mejoran la sensibilidad a la insulina.106 -LEPTINA. La leptina es una proteína de 167 aminoácidos codificada por el gen OB (locus 7q 31.3) y secretada sobre todo por los adipocitos. Sus niveles plasmáticos se incrementan en la obesidad y se correlacionan con la proporción de grasa corporal total.107 Los ratones con mutación del gen OB presentan obesidad severa, pero el déficit de leptina es muy raro en humanos. En adultos, dicho déficit produce diversas alteraciones como hiperfagia y obesidad, hiporrespuesta de células T, hiperinsulinemia, resistencia a la insulina, hiperlipidemia, disfunción inmunológica y alteraciones neuroendocrinas.108 Los efectos de la leptina son mediados por receptores localizados principalmente en células del sistema nervioso central, pero también en otros tipos celulares, como los adipocitos y las células endoteliales. El receptor de leptina pertenece a la familia de receptores de citoquinas y está relacionado con la vía del trasductor de señal y activador de la transcripción-3 (STAT-3), entre otras. STAT-3 es esencial en la regulación de la ingesta, la neoglucogénesis hepática y la secreción de gonadotropina,109 pero no influye en el control del metabolismo del tejido adiposo por parte de la leptina.110 Existen diversos factores que estimulan la liberación de leptina, como TNF-α y otras citoquinas proinflamatorias, insulina, glucosa, estrógenos, y probablemente a nivel local angiotensina II y endotelina. La presencia de receptores de leptina en varios órganos sugiere que la hormona participa en múltiples procesos fisiológicos: en el crecimiento, el control metabólico, la regulación inmunológica, la regulación de la sensibilidad a la insulina111 o la reproducción.107 Además, se han descrito otras acciones de la leptina, como la proliferación y diferenciación de monocitos, y la liberación de TNF-α y de IL-6 por los monocitos. El estudio WOSCOPS112 mostró que la leptina es un factor de riesgo de aterosclerosis independiente de la edad, la presión arterial sistólica, los niveles plasmáticos de lípidos, el
CAPÍTULO 1 14 IMC y los niveles de proteína C reactiva (PCR). También se encontró asociación entre los niveles plasmáticos elevados de leptina y el ictus,113 la calcificación de las arterias coronarias y el infarto agudo de miocardio.114 No obstante, en un estudio prospectivo y metaanálisis reciente, solamente se observó una asociación moderada y no estadísticamente significativa entre los niveles de leptina y el desarrollo de enfermedad arterial coronaria, dependiente en parte del IMC.115 El tratamiento con leptina recombinante humana revierte la hiperfagia, la obesidad, el hipogonadismo y las alteraciones inmunológicas asociadas al déficit de leptina,108 y también es un tratamiento prometedor en el manejo de las complicaciones de la lipodistrofia.116 Sin embargo, la utilización de la leptina en el tratamiento de la obesidad típica y de sus complicaciones metabólicas no ha sido exitosa, probablemente por algún mecanismo de resistencia a la hormona.117 Por tanto, es muy probable que la leptina desempeñe un papel crucial en muchos procesos fisiológicos y que actúe como un marcador de la cantidad de grasa corporal, pero su implicación directa en la patología cardiovascular todavía no se ha demostrado de manera consistente. -FACTOR DE NECROSIS TUMORAL ALFA (TNF-α). TNF-α es una citoquina proinflamatoria inicialmente descrita como un factor inducido por endotoxinas, con capacidad de necrosis tumoral. Se trata de una proteína transmembrana de 26 kDa, con un fragmento biológicamente activo de 157 aminoácidos y 17 kDa que ejerce sus efectos mediante su unión a receptores tipo I y II.118 En el tejido adiposo, TNF-α se expresa en los adipocitos y células del estroma vascular,119 pero sobre todo en los macrófagos del estroma. Los adipocitos expresan ambos tipos de receptores de TNF-α, ya sea ligados a la membrana o bien en forma soluble.118 Los ratones con déficit de TNF-α o de sus receptores no presentan resistencia a la insulina inducida por la obesidad.120 Los niveles plasmáticos de TNF-α, así como sus niveles de expresión genética en el tejido adiposo, están elevados en situaciones de resistencia a la insulina.121 Por otra parte, la infusión de TNF-α inhibe la captación de glucosa inducida por la insulina en sujetos sanos.122 Sin embargo, los intentos de neutralizar los efectos de TNF-α para mejorar la resistencia a la insulina en humanos no han resultado satisfactorios, aunque algunos estudios han mostrado una ligera mejoría con la inhibición de esta citoquina.123, 124 Los
Introducción general 15 limitados efectos de TNF-α sobre la resistencia a la insulina podrían explicarse por sus acciones paracrinas, aunque los mecanismos implicados en la sobreexpresión de TNF-α asociada a la obesidad y las señales moleculares que subyacen a las alteraciones metabólicas relacionadas con TNF-α todavía se desconocen. Recientemente, se ha estudiado también el papel de la respuesta inflamatoria en la fisiopatología de la cardiopatía isquémica. TNF-α estimula la expresión de moléculas de adhesión en las células endoteliales, por lo que podría contribuir al inicio del proceso aterosclerótico.125 TNF-α se ha asociado a un aumento del riesgo de reinfarto y de muerte cardiovascular tras un primer infarto agudo de miocardio.126 Los niveles de esta citoquina se correlacionan con el índice tobillo-brazo, que se utiliza para predecir la severidad de la enfermedad arterial periférica,127 y también con la carga de aterosclerosis observada mediante ecocardiografía carotídea en varones sanos de mediana edad.128 Sin embargo, otros investigadores han sugerido que los niveles de receptor de TNF (TNFR) pueden ser un mejor marcador de la carga ateroscleróstica que el propio TNF-α, e incluso se ha observado que son los niveles de TNFR, pero no los de TNF-α, los que se asocian con la aterosclerosis carotídea en individuos menores de 70 años.129 También se ha estudiado la implicación de TNF-α en la fisiopatología de la insuficiencia cardiaca congestiva, pero el ensayo ATTACH no ha demostrado la utilidad de inhibidores de TNF-α en el tratamiento de esta entidad.130 Por otra parte, TNF-α y adiponectina están estrechamente relacionadas. La adiponectina inhibe la adhesión de monocitos y la expresión de moléculas de adhesión inducidas por TNFα69 y disminuye la secreción de TNF-α por los macrófagos,32, 49 mientras que TNF-α tiene la capacidad de reducir la expresión de adiponectina en los adipocitos mediante la supresión de la actividad de su promotor.29 -PROTEÍNA QUIMIOTÁCTICA DE MONOCITOS TIPO 1 (MCP-1). MCP-1 consta de 76 aminoácidos y es una de las principales proteínas que intervienen en los procesos de quimiotaxis y reclutamiento de macrófagos. Se secreta sobre todo por los propios macrófagos, las células endoteliales y los adipocitos,131 y los individuos obesos presentan mayores niveles plasmáticos y sobreexpresión de la citoquina en el tejido adiposo.15 Los ratones con déficit de MCP-1 o de sus receptores presentan una disminución de la infiltración de macrófagos en el tejido adiposo y una mejoría de la función metabólica.12, 131 Sin embargo,
CAPÍTULO 1 22 mayor calcificación coronaria y peores parámetros diastólicos.187-190 El TAE se asocia también a todos los componentes del síndrome metabólico, la resistencia a la insulina, la DM tipo 2 y la aterosclerosis coronaria.191, 192 Se ha observado que los volúmenes de TAE superiores a 75 ml predicen la presencia de enfermedad arterial coronaria con sensibilidad y especificidad en torno al 70%.193 Otro estudio reveló la asociación entre volúmenes excesivamente elevados de TAE (superiores a 300 ml) y la presencia de aterosclerosis coronaria, niveles plasmáticos bajos de adiponectina y de colesterol HDL, y elevados de TNF-α y de PCR ultrasensible.194 Por otra parte, el volumen de TAE se asocia no sólo a ateromatosis coronaria, sino también a la estabilidad de las placas de ateroma,195 y el grosor del TAE se ha relacionado con la presencia de disfunción microvascular.196 Recientemente, se han publicado varios estudios basados en la cohorte de Framingham que pretendían esclarecer el papel de la grasa pericárdica, definida como aquella que se encuentra en el interior del saco pericárdico. Observaron que la cantidad de tejido adiposo pericárdico medido por TC se correlaciona con múltiples medidas de adiposidad y factores de riesgo cardiovascular, pero el tejido adiposo abdominal presenta una correlación más fuerte con la mayoría de factores de riesgo metabólico. De todas formas, tanto el tejido adiposo pericárdico como el intratorácico se asocian con calcificación vascular, lo cual sugiere que estos tejidos adiposos pueden ejercer efectos tóxicos locales en la vasculatura.197 El tejido adiposo pericárdico se asocia especialmente a calcificación arterial coronaria.198 Por el contrario, este tejido, al contrario que la grasa intratorácica, se asocia a la enfermedad cardiovascular de manera independiente respecto a medidas tradicionales de obesidad, pero no al ajustar por factores de riesgo clásicos.199 También se encontró asociación entre el tejido adiposo pericárdico –y también la grasa intratorácica, la visceral, el IMC y el perímetro de la cintura– y la masa del ventrículo izquierdo y de la aurícula izquierda, pero no con la del ventrículo derecho. No obstante, en el análisis multivariado sólo persistía la asociación entre el tejido adiposo pericárdico y el tamaño de la aurícula izquierda. Así, los autores sugerían que los efectos sistémicos de la obesidad en la estructura y función cardiacas podrían sobrepasar los efectos patogénicos de la grasa pericárdica.200 Sin embargo, curiosamente, los sujetos con insuficiencia cardiaca presentan menor cantidad de TAE.185
Introducción general 23 A pesar del creciente interés por el TAE y a la investigación relacionada con la cuantificación de la masa del TAE mediante métodos de imagen, son todavía escasos los estudios diseñados para investigar la expresión de moléculas bioactivas en el TAE. No obstante, se ha demostrado que el TAE produce un perfil patogénico de adipoquinas en pacientes con enfermedad cardiovascular.8, 201 Además, en estos pacientes existe una importante infiltración del TAE por células inflamatorias. Mediante análisis proteómico, nuestro grupo ha observado que el TAE presenta mayor estrés oxidativo que el TAS.202 Los individuos con enfermedad coronaria presentan unos niveles de adiponectina en TAE 40% inferiores a los controles181 y también se observó una menor producción de adrenomedulina, un importante péptido vasodilatador y antioxidante, en el TAE de pacientes con enfermedad arterial coronaria.203 Dada su relación anatómica con el miocardio y las arterias coronarias epicárdicas, el TAE podría interactuar a nivel local mediante la modulación de la actividad paracrina o vasocrina de adipocitoquinas proinflamatorias en las arterias coronarias, pero también a nivel sistémico con la producción de hormonas relevantes en la fisiopatología de las enfermedades cardiovasculares y metabólicas.
CAPÍTULO 1 24 OBJETIVOS El objetivo principal de los trabajos que componen esta memoria es el estudio del papel del TAE en la fisiopatología de las enfermedades cardiovasculares, así como su posible influencia sobre el pronóstico a largo plazo. Secundariamente, se han propuesto los siguientes objetivos concretos: 1. Analizar la relación entre la expresión de citoquinas inflamatorias y el estado hipertrófico adipocitario del TAE y el TAS. 2. Analizar la relación entre la expresión de adipoquinas en el TAE y la cardiopatía isquémica. 3. Analizar los efectos sistémicos de las adipoquinas expresadas en el TAE y su influencia en: a. Hipertensión arterial. b. Diabetes mellitus tipo 2. c. Síndrome metabólico. 4. Analizar la posible influencia pronóstica de las adipoquinas expresadas en el TAE.
Tamaño de los adipocitos en el TAE y expresión de MCP-1 25 CAPÍTULO 2 TAMAÑO DE LOS ADIPOCITOS EN EL TEJIDO ADIPOSO EPICÁRDICO Y EXPRESIÓN DE MCP-1
CAPÍTULO 2 26 RELATIONSHIP BETWEEN EPICARDIAL ADIPOSE TISSUE ADIPOCYTE SIZE AND MCP-1 EXPRESSION. Sonia Eiras,a Elvis Teijeira-Fernández,b,c Antonio Salgado-Somoza,a Elena Couso,d Tomás GarcíaCaballero,e Juan Sierra,f José Ramón González Juanateya,b,c aCardiovascular Division, Sanitary Research Institute, Universitary Clinical Hospital. bCardiology Department and Medicine Department. cDepartment of Medicine, University of Santiago de Compostela. cDepartment of Pathology, University of Santiago de Compostela. dDepartment of Morphological Sciences, University of Santiago de Compostela. eDepartment of Heart Surgery Department, Universitary Clinical Hospital of Santiago de Compostela. Santiago de Compostela, Spain. (Cytokine. 2010 Aug;51:207-12)
Tamaño de los adipocitos en el TAE y expresión de MCP-1 27 ABSTRACT Adipocyte size has been associated to increase in inflammatory cytokines expression that can be related to the cardiovascular risk of obesity. Epicardial adipose tissue (EAT) was discovered to play a key role in cardiovascular diseases by producing several inflammatory adipokines. We sought to study whether EAT and subcutaneous adipose tissue (SAT) mean adipocyte sizes are related to the expression of adipokines in patients with cardiovascular diseases. We collected EAT, SAT and blood samples from 22 patients aged 70.9 (s.d.10.3) undergoing heart surgery. Monocyte chemoattractant protein (MCP)-1, interleukin (IL)-10 and tumor necrosis factor (TNF)-α were analyzed by real time RT-PCR, ELISA or inmunohistochemistry. Hematoxylin-eosin staining was used for adipocyte area calculations. Adipocyte size is negatively correlated to MCP-1 expression (r=-0.475; p=0.034) in EAT and positively correlated in SAT (r=0.438; p=0.047). These trends persisted after stratification for sex and coronary artery disease (CAD), but only the relationship between EAT MCP-1 and adipocyte size reached statistical significance in the larger group of men with CAD. We have observed that SAT adipocyte size is correlated to BMI (r=0.601; p=0.003); whereas only a nonstatistically significant trend was observed in EAT. IL-10 and TNF-α expression were not associated to adipocyte size in EAT nor SAT. Secondarily, we found that EAT IL-10 expression is higher in patients with CAD. These results suggest that adipocyte size is a negative determinant of MCP-1 expression in EAT and a positive determinant in SAT. These data might partly explain the different implications of EAT and SAT in cardiovascular diseases.
CAPÍTULO 2 28 INTRODUCTION Obesity, currently recognized as an inflammatory process,13 confers an increased risk of major cardiovascular events.204 This status is associated to adipocyte enlargement.205 Adipose tissue consists of stromal vascular cells and adipocytes and the ratio between them can also be related to the modulation of several signalling pathways.206 Adipocytes have a dynamic endocrine role by expressing and secreting a wide range of factors, including hormones and cytokines, that depends on cell size.207 Monocyte chemoattractant protein-1 (MCP-1) is mainly produced by macrophages, endothelial cells, adipocytes, and acts a potent chemotactic factor for macrophages in adipose tissue contributing to insulin resistance, hepatic steatosis in obesity131 and atherogenesis.125 Interleukin-10 (IL-10) and TNF-α are other cytokines secreted by adipose tissue and upregulated in the obese state.119 IL-10 suppresses macrophage function and inhibits cytokines production. Contrarily to TNF-α, it is involved in atherogenesis by inducing proinflammatory cytokines and matrix metalloproteinases.208 Moreover, both molecules are regulated by dietary fatty acids, which play an important role in cardiovascular diseases,209 contributing to the inflammatory response.210 Recently, several studies have paid attention to EAT because it is an interesting visceral fat depot located in the atrioventricular and interventricular grooves and its volume is correlated to metabolic risk factors.211 In addition, this tissue expresses and secretes several adipokines with proand anti-inflammatory properties contributing to different cardiovascular conditions. Several studies have shown that EAT and SAT present different behaviours with respect to adipokines expression.8, 181, 212-214 In this way, regional differences in adipocyte hypertrophy and inflammatory function might suggest a different metabolic response in patients with cardiovascular disease. In consequence, for a better understanding of the role of EAT in cardiovascular diseases we aimed to study the possible association between adipocyte size and MCP-1, IL-10 and TNF-α expression in EAT and SAT in patients with cardiovascular disease.
Tamaño de los adipocitos en el TAE y expresión de MCP-1 29 METHODS AND PROCEDURES Patients. Twenty-two patients undergoing heart surgery with sternotomy were included in the study. Exclusion criteria were previous heart surgery or concomitant infective diseases. All participants gave their informed consent. The study protocol was approved by the local ethical committee and carried according to the Declaration of Helsinki. Clinical data were obtained upon admission to hospital before surgery. Diagnosis of coronary artery disease (CAD) was based on previous coronary angiogram. Reductions in luminal coronary artery diameters in excess of 50% were considered significant. Adipose tissue biopsies. EAT (0.1-1g wet weight) and SAT (2g wet weight) biopsies were obtained from upper region of the right ventricle and SAT was obtained from the thorax. Samples (43) were immediately splitted in two pieces. One piece was frozen in liquid nitrogen before storage at -80ºC until use and the other one was formalin-fixed and paraffin-embedded. Blood samples. Blood samples were taken out after overnight fasting before surgery. Plasma was stored at -40ºC. MCP-1 plasma levels were evaluated in duplicate by instant enzyme-linked immunosorbent assay (Bender MedSystems GmbH, Vienna, Austria). The lowest limit of sensitivity was 2.31pg/mL for MCP-1. The intraand inter-assay CV were lower than 10%. mRNA extraction and real time RT-PCR. mRNA was isolated from 50-100 mg of EAT and SAT with the oligotex mRNA Spin-column kit (Quiagen GmbH, Germany). The final concentration was 1 µg tissue/1 µl solution. Then, 4.14 µl of mRNA dilution was transcribed using 200U of MMLV reverse transcriptase (Invitrogen Corp, CA, USA) in 30 µl of a pH 8.4 solution containing 20 mM TrisHCl, 50 mM KCl, 2.5 mM de MgCl2, dNTPs (1 mM each), 20 U of RNase inhibitor and random primers under the following conditions: 50 min at 37 ºC, 10 min 42ºC and 5 min at 95 ºC. Comparative EAT and SAT MCP-1, IL-10 and TNF-α expression levels with respect to GAPDH were analyzed by real time PCR in duplicated using 8 µl of complementary DNA,
CAPÍTULO 2 30 SybrGreen (Roche Diagnostics Corp, IN, USA) as fluorochrome and the primers sequence are shown in Table 2-1. The conditions of amplification were as follows: 40 cycles (30 sec at 95 ºC, 60 sec at 58 ºC for MCP-1 or 56 ºC for IL-10 and TNF-α, and 60 sec at 72 ºC ). Fluorescence curves were analysed using Chromo 4 software (MJ Research, Inc., NV, USA). Melting curves were tested in order to probe the correct amplicon. Gene expression levels were calculated with respect to GAPDH expression and represented in arbitrary units (a.u.). Measurement of adipocyte size. Adipocyte size was determined through light microscopy on formalin-fixed and paraffinembedded biopsies from all 22 patients. After Harris’ hematoxilin staining, the two dimensions (length (r1) and width (r2)) of ten adipocytes per each sample were measured using a graded ocular scale. The area of each adipocyte was calculated using the ellipse formula ( r1r2). For statistical analysis, an average of 10 cells from each sample was considered. Inmunohistochemistry. Sections 3 µm-thick were mounted on FLEX IHC microscope slides (Dako, Glostrup, Denmark) and heated in an oven at 60ºC for 1h. The immunohistochemical technique was automatically performed using AutostainerLink 48 (Dako). After deparaffination and epitope retrieval in EnVision FLEX target retrieval solution, low pH for 20min at 97ºC, the slides were allowed to cool in PT Link to 65ºC and then in Dako wash buffer for 5 min at room temperature. The immunostaining protocol includes incubation in: (1) EnVision FLEX peroxidase-blocking reagent for 5min; (2) primary MCP-1 monoclonal antibody (R&D Gene Primers Accession no. Length (bp) Melting T MCP-1 5’caaactgaagctcgcactctc3’ 5’gctgcagattcttgggttgtg3’ X14768 361 88 IL-10 5’gtgatgccccaagctgaga3’ 5’cacggccttgctcttgtttt3’ AF043333 130 87 TNF-α 5’tcttctcgaaccccgagtga3’ 5’cctctgatggcaccaccag3’ M10988 151 89 GAPDH 5’tccatgacaactttggcatcgtgg3’ 5’gttgctgttgaagtcacaggagac3’ NM_002046.3 365 90 TABLE 2-1. Primers sequences.
Tamaño de los adipocitos en el TAE y expresión de MCP-1 31 Systems Wiesbaden, Germany) at a dilution of 1/20 for 30min; (3) EnVision FLEX + mouse (linker) for 15min; (4) EnVision FLEX/HRP (dextran polymer conjugated with horseradish peroxidase and affinity-isolated goat anti-mouse immunoglobulins) for 20 min; (5) substrate working solution (mix) (3,3’- diaminobenzidine tetrahydrochloride chromogen solution) for 10 min; and (6) EnVision FLEX hematoxylin for 9 min. As positive control we used sections of ductal invasive breast carcinoma. Statistical analysis. All results are shown as mean (s.d.). Pearson’s correlation coefficient (r) was used to analyze the strength and direction of a linear relationship between continuous variables. Statistical significance was defined as p<0.05. All analyses were computed using SPSS 15.0 software for Windows (SPSS, Inc., Chicago, IL, USA). RESULTS EAT and SAT biopsies were obtained from 22 patients (7 women, 15 men) aged 70.9 (s.d.10.3) years with a BMI of 27.5 (s.d. 5.1) kg/m2. In all, 11 patients had CAD, although only 9 underwent coronary artery bypass grafting (CABG) surgery. Two of them also underwent valve surgery and 13 patients valve surgery alone. Sample characteristics are shown in Table 2-2. The sample was split into patients with and without CAD, in order to assess significant differences between both groups. Differences were statistically significant for sex, betablocker intake and HDL cholesterol levels. As regards the prevalence of diabetes, the difference between CAD and non-CAD groups was of borderline significance. When comparing MCP-1, TNF-α and IL-10 plasma levels and their expression levels in EAT and SAT in patients with CAD with respect to those without CAD, no significant differences were found except for EAT IL-10 expression levels, curiously higher in the group of CAD. We found a positive correlation between adipocyte area and BMI (r=0.601; p=0.003) in SAT as Figure 2-1 shows. Also, we have observed a non-significant trend towards a positive correlation between EAT adipocyte area and BMI (r=0.339, p=0.133) (Figure 2-1). On the other hand, a negative correlation was found between adipocytes area from EAT and its MCP1 expression (r=-0.475; p=0.034) as shown Figure 2-2A. Contrarily, SAT adipocytes area was positively associated with MCP-1 expression (r=0.438; p<0.05) (Figure 2-2B).
CAPÍTULO 3 38
Adiponectina e IL-6 en el TAE y extensión de la enfermedad coronaria 39 CAPÍTULO 3 ADIPONECTINA E INTERLEUQUINA-6 EN EL TEJIDO ADIPOSO EPICÁRDICO Y EXTENSIÓN DE LA ENFERMEDAD CORONARIA
CAPÍTULO 3 40 EXTENSION OF CORONARY ARTERY DISEASE IS ASSOCIATED WITH INCREASED IL-6 AND DECREASED ADIPONECTIN GENE EXPRESSION IN EPICARDIAL ADIPOSE TISSUE. Sonia Eiras,a Elvis Teijeira-Fernández,b Lilian Grigorian Shamagian,a Angel Luis Fernandez,c Angel Vazquez-Boquete,d Jose Ramon Gonzalez-Juanateya,b aUnit of Cellular and Molecular Research on Cardiology. bCardiology Department and Coronary Unit. cHeart Surgery Department. dPathology Department. Universitary Clinical Hospital of Santiago de Compostela, Spain. (Cytokine. 2008 Aug;43:174-80)
Adiponectina e IL-6 en el TAE y extensión de la enfermedad coronaria 41 ABSTRACT Objective: Epicardial adipose tissue (EAT) expresses lower levels of adiponectin in patients with CAD and higher levels of inflammatory mediators such as IL-6 and leptin than subcutaneous adipose tissue. This showed one important role of EAT in coronary artery disease. However, the relationship of EAT adiponectin and IL-6 levels to the extension of coronary artery disease has not hitherto been determined. We sought to determine whether the levels of adiponectin and interleukin-6 (IL-6) mRNA in EAT are associated with the extension of coronary artery disease (CAD). Methods: Angiographic and hormones expression were evaluated from epicardial and subcutaneous adipose tissue. 92 patients (58 CAD, 34 non-CAD) who underwent cardiac surgery. Adiponectin and IL-6 mRNA levels were measured by real time RT-PCR in epicardial and subcutaneous adipose tissue (SAT) following angiographic evaluation of their coronary arteries. Results: We found that epicardial adipose tissue of CAD expressed lower levels of adiponectin mRNA and higher levels of IL-6 mRNA than that of non-CAD patients. As the number of injured arteries rose, adiponectin mRNA levels decreased (r=-0.402, p<0.001) and IL-6 mRNA increased (r=0.514, p<0.001) in epicardial adipose tissue. Conclusions: The extension of CAD is significantly associated with the expression of adiponectin and IL-6 mRNA. These findings suggest that low adiponectin and high IL-6 expression by EAT may contribute to CAD extension.
CAPÍTULO 3 42 INTRODUCTION Coronary artery disease (CAD) and other atherosclerotic cardiovascular conditions jointly remain the leading cause of death in industrialized nations. A major, modifiable risk factor is obesity.223 Adipose tissue is now recognized as an active endocrine and paracrine organ that releases several bioactive molecules, known as adipokines, that affect body weight, coagulation, fibrinolysis, insulin resistance, inflammation and atherosclerosis.224 Particular interest has focused on epicardial adipose tissue7 due to its proximity to coronary arteries and the consequent possibility that it may have paracrine effects on them. Moreover, this adipose tissue is related to left ventricular mass, insulin resistance, circulating low-density lipoprotein cholesterol levels, and arterial blood pressure.191, 225 In CAD patients, EAT secretes higher levels of pro-inflammatory agents than SAT; such as IL-1ß, IL-6, TNF-α, IL-6sR and MCP-18 all of which influence energy metabolism, vascular function and immunologic and inflammatory responses.9 Recently, special interest has developed concerning the relationship between CAD and adiponectin, an adipokine with below-normal circulating levels in obese people. It is known that adiponectin has anti-diabetic and anti-atherogenic properties226, 227 and low plasma adiponectin is associated with complex coronary lesions in men with CAD.138 Moreover, EAT secretes less adiponectin in CAD patients than in non-CAD heart surgery patients.181 It has been established that the levels of adiponectin, IL-6 and other adipokines produced by EAT are altered in CAD patients. However, it has not previously been established whether these levels actually correlate with the extension to which CAD has progressed by the number of affected arteries. Here, we report the results of a study about the relationship between the extension of CAD and the levels of adiponectin and IL-6 mRNA in EAT. MATERIALS AND METHODS Subjects. EAT and SAT samples were obtained from 92 patients undergoing elective heart surgery, either for coronary artery bypass grafting or for valve surgery. Biopsies were harvested just before extracorporeal circulation. Only those patients with no previous coronary angiogram or those with insufficient EAT for analysis were excluded. The study was approved by the
Adiponectina e IL-6 en el TAE y extensión de la enfermedad coronaria 43 local Ethics Committee and written informed consent was obtained from each patient before his or her participation. Clinical data. Information on demographics, anthropometric measurement, cardiovascular risk factors and previous medical history was obtained retrospectively from records. Lipid profile data was obtained within 3 months prior to surgery, and all other laboratory data and the medication taken by each patient within the week prior to surgery. Coronary artery disease assessment. The CAD group was defined according to the presence of at least a coronary stenosis ≥ 75% of luminal stenosis. So, this is an angiography classification rather a clinical one. Then, patients were classified as having 0, 1, 2 or 3 injured-coronary arteries (left main coronary was considered as 1 artery). Patients in groups 1, 2 and 3 were defined as CAD patients, and patients in group 0 as non-CAD. Adipose tissue collection and RNA extraction. EAT and SAT from each patient underwent heart surgery. EAT was immediately frozen at - 80ºC pending RNA extraction. RNA was extracted by the Trizol method. The concentration and purity of the sample was estimated from the ratio between absorbances at 260 nm and 280 nm. Contaminated samples with genomic DNA were treated with DNase I. Each 5 µg of RNA was treated with 10U/µl of DNase I and 20U/µl of RNase inhibitor (both products Invitrogen Corp, CA, USA) for 2 h at 37 ºC. Then, proteins and DNA were removed from the samples with phenol, chloroform and isoamylalcohol. Finally, the RNA was precipitated with 96% ethanol and sodium acetate 0.3 M. Reverse transcription and real time PCR. Reverse transcription and real time polymerase chain reaction (RT-PCR) was performed using 1.2 µg of purified RNA and 200 U of MMLV reverse transcriptase (Invitrogen Corp, CA, USA) in 30 µl of a pH 8.4 solution containing 20 mM TrisHCl, 50 mM KCl, 2.5 mM de MgCl2, dNTPs (1 mM each), 20 U of RNase inhibitor and random primers under the following conditions: 50 min at 37 °C, 10 min 42 °C and 5 min at 95 °C.
CAPÍTULO 3 44 The comparative analysis of adiponectin and IL-6 expression with respect to GAPDH in EAT and SAT was analyzed using 2 µl of complementary DNA by real time PCR using SybrGreen (Roche Diagnostics Corp, IN, USA) as fluorochrome and the primers listed in Table 3-1. TABLE 3-1. Specific primers used for PCR amplification of adiponectin, IL-6 and GAPDH. Adiponectin sense antisense 5’-TGGTGAGAAGGGTGAGAA-3 5’-AGATCTTGGTAAAGCGAATG-3’ IL-6 sense antisense 5’-GTGGCTGCAGGACATGACAA-3’ 5’-TGAGGTGCCCATGCTACATTT-3’ GAPDH sense antisense 5’-TCCATGACAACTTTGGCATCGTGG-3’ 5’-GTTGCTGTTGAAGTCACAGGAGAC-3’ Adiponectin and IL-6 amplification was performed as previously described.228, 229 Genomic contamination was ruled out by means of negative controls subjected to retrotranscription conditions without MMLV. Fluorescence curves were analyzed using Chromo 4 software (MJ Research, Inc., NV, USA). Adiponectin and IL-6 mRNA levels are reported as measured levels relative to GAPDH. Immunohistochemistry. Paraffin-embedded tissue sections were deparaffined and rehydrated. Immunostaining was performed with antibodies directed against IL-6 (1:5 dilutions) and adiponectin (1:250) (both from Santa Cruz Biotechnology, Delaware, CA, USA) overnight. Following the protocols LSAB (Dako Diagnostics, Glostrup, Denmark) was used to detection, respectively. Immunodetection was developed with 3,3’-diaminobenzidine tetrahydrochloride kit (Dako Diagnostics, Glostrup, Denmark). Negative controls were carried out omitting the primary antibody. Inflammated appendix and SAT tissue were used as a positive control for IL-6 antibody and adiponectin antibody, respectively. Statistical analyses. Continuous variables are summarized as means±SD. Differences between the means of groups defined by the number of affected arteries was estimated by ANOVA. Categorical variables are expressed as percentages and compared using chi-squared test or Fisher’s exact test. Pearson correlation coefficients were calculated to evaluate unadjusted associations between adiponectin and IL-6 mRNA levels in EAT and SAT and number of injured arteries.
Adiponectina e IL-6 en el TAE y extensión de la enfermedad coronaria 45 Predictors of extension of CAD were identified by means of univariate polynomial logistic regression analyses with the lesion-free group (group 0) as reference, followed by multivariate analyses including variables that had proved significant in the univariate analyses and by stepwise method. Statistical significance was defined as p<0.05. All analyses were performed using SPSS 11.5.1. Software for Windows (SPSS Inc., Tokyo, Japan). RESULTS Adiponectin and IL-6 mRNA expression levels in EAT and SAT. Our sample consisted of 58 patients with CAD and 34 controls without angiographically proved CAD. Adiponectin mRNA levels were significantly lower in EAT of CAD patients than in patients with no CAD [13,0±3,8 as against 15,8±2,8 and IL-6 mRNA levels significantly higher, 8,1±1,5 as against 6,5±1,1 (p<0.001 in both cases; see Figures 3-1A and 3-1B)]. Then, 92 subjects (66 men, 26 women) included in this study were classified in four different groups according the number of affected major epicardial coronary arteries: 0 (n=34), 1 (n=11), 2 (n=18) or 3 (n=29). Table 3-2 shows baseline clinical characteristics of patients. FIGURE 3-1. A. Adiponectin mRNA levels in epicardial adipose tissue (EAT) of 58 patients with coronary artery disease (CAD) and 34 without (Non-CAD) B. IL6 mRNA levels in EAT of 26 patients with CAD and 23 without (Non-CAD). mRNA levels are expressed as amplified cDNA relative to GAPDH. A B
CAPÍTULO 3 46 Group (=number of injured arteries) 0 (n=34) 1(n=11) 2(n=18) 3(n=29) p Male (%) 53 73 89 83 0.016 Age (yr) 70±8 73±4 67±7 67±9 0.076 BMI (kg/m2) 28±4 29±5 28±3 29±4 0.776 LVEF 65±12 67±11 56±16 53±16 0.011 Urea (mg/dL) 56±35 56±24 56±22 56±22 >0.99 Creatinine (mg/dL) 1.3±0.3 1.1±0.4 1.2±0.5 1.1±0.4 0.275 Cholesterol (mg/dL) 184±43 192±40 180±42 172±42 0.605 HDL-c(mg/dL) 36±11 40±11 34±11 36±14 0.340 LDL-c(mg/dL) 106±26 124±42 101±33 101±33 0.647 Triglycerides(mg/dL) 113±46 112±47 125±35 118±47 0.836 HT (%) 56 64 83 72 0.506 Type 2 Diabetes (%) 29 9 28 48 0.120 ACE-inhibitors (%) 32 46 33 35 0.120 Statins (%) 24 46 50 55 0.043 Betablockers (%) 21 18 39 48 0.054 TABLE 3-2. Baseline clinical characteristics of patients with 0, 1, 2 or 3 injured arteries. p-values are for one-way ANOVA among the four groups. BMI: body mass index, LVEF: left ventricular ejection fraction, HDL-c: high-density lipoprotein-cholesterol, LDL-c: low density lipoprotein-cholesterol, HT: arterial hypertension, ACE, angiotensin converting enzyme. Group (=number of injured arteries) 0 (n=34) 1 (n=11) 2 (n=18) 3 (n=29) P EAT adiponectin (a.u.) 15.8±2.8 14.8±3.4 12.7±3.4 14.1±3.8 0.001 SAT adiponectin (a.u.) 17.3±4.8 12.6±5.5 13.1±2.7 14.5±4.8 0.03 EAT IL-6 * (a.u.) 6.5±1.1 7.9±2.1 7.7±1.1 8.4±1.4 0.001 TABLE 3-3. mRNA adiponectin and IL-6 expression levels with respect to GAPDH on EAT of patients with 0, 1, 2 or 3 injured arteries. * EAT IL6 mRNA was only measured in a subset of patients: 27 in group 0, 7 in group 1, 7 in group 2, and 12 in group 3. p-values are for one-way ANOVA among the four groups. EAT: epicardial adipose tissue. SAT: subcutaneous adipose tissue.
Adiponectina e IL-6 en el TAE y extensión de la enfermedad coronaria 47 There were statistically significant between-group differences in the proportion of male patients and the proportion of those taking statins, both increasing with the extension of CAD (p<0.05), while left ventricular ejection fraction (LVEF) diminished (p<0.05). Moreover, adiponectin and IL-6 mRNA levels were associated to the number of injured arteries (Table 3-3). Thus, adiponectin mRNA levels in EAT decreased as number of injured arteries increased (r=-0.402, p<0.001) (Figure 3-2A). The same association was observed in SAT (r=-0.251, p<0.05) (Figure 3-2B). On the contrary, we found a positive association between IL-6 mRNA levels in EAT and number of injured arteries (r=0.514, p<0.001) (Figure 3-3). FIGURE 3-2. A. Association between EAT (A) and SAT (B) adiponectin mRNA levels and the number of injured arteries (0, 1, 2 or 3). FIGURE 3-3. Association between EAT IL-6 mRNA levels and the number of injured arteries (0, 1, 2 or 3). A B r= -0.402 P<0.001 p<0.001 r= -0.251 P<0.05 p<0.001 r= 0.514 P<0.001 p<0.001
CAPÍTULO 4 54
Adiponectina en el TAE e hipertensión arterial 55 CAPÍTULO 4 ADIPONECTINA EN EL TEJIDO ADIPOSO EPICÁRDICO E HIPERTENSIÓN ARTERIAL
CAPÍTULO 4 56 EPICARDIAL ADIPOSE TISSUE EXPRESSION OF ADIPONECTIN IS LOWER IN PATIENTS WITH HYPERTENSION. E Teijeira-Fernandez,a S Eiras,b L Grigorian-Shamagian,a A Fernandez,c B Adrio,c JR GonzalezJuanateya, b aDepartment of Cardiology. bUnit of Cellular and Molecular Research on Cardiology. cDepartment of Heart Surgery. Hospital Clínico Universitario. Santiago de Compostela. Spain. (Journal of Human Hypertension. 2008 Dec;22:856-63)
Adiponectina en el TAE e hipertensión arterial 57 ABSTRACT Low plasma adiponectin levels are related to a higher risk of development of metabolic and cardiovascular disorders, including hypertension (HT). To date, there have been no studies supporting the relationship between epicardial adipose tissue (EAT) expression of adiponectin and HT. We collected samples of EAT from 116 patients undergoing elective cardiac surgery, mostly for coronary artery bypass grafting (n=54), valve surgery (n=49) or both (n=12). Samples of subcutaneous adipose tissue (SAT) were harvested from 85 patients. After RNA isolation, the expression of adiponectin was analysed by real time retrotranscriptase (RT-PCR). Baseline clinical data were obtained from medical records. The diagnosis of HT was established mostly by the patients’ general physicians following current guidelines. We included 84 hypertensive and 32 non-hypertensive patients. Mean (±s.d.) age was 70.3±7.9 years. EAT expression levels of adiponectin were lower in hypertensives (14.0±3.6 vs 15.3±3.6 arbitrary units (a.u.), P=0.06). This difference was statistically significant (odds ratio 0.828 per a.u., P=0.020) after adjustment for age, gender, body mass index, diabetes mellitus, heart failure, coronary artery disease (CAD), total cholesterol and triglyceride levels. However, SAT adiponectin mRNA levels were similar in hypertensive and nonhypertensive patients [15.3±4.2 vs 15.3±5.0 a.u., P>0.99]. Adjustment for potential confounding factors hardly altered this result. Our findings indicate that EAT expression of adiponectin may be associated with HT status independently of CAD or other comorbidities, whereas SAT expression does not. These results support the hypothesis that EAT is actively implicated in global cardiovascular risk, describing its association with HT. Keywords: adiponectin; adipose tissue; blood pressure; hypertension.
CAPÍTULO 4 58 INTRODUCTION Epicardial adipose tissue (EAT) acts as an endocrine organ that produces many biologically active molecules referred to as adipocytokines.8, 181 Most of these molecules, such as leptin, plasminogen-activator inhibitor type 1, tumour necrosis factor-α and interleukin-6, have been recognized as key factors in the pathogenesis of cardiovascular disease.126, 241-243 They have autocrine, paracrine and endocrine effects.244 Interestingly, their paracrine effects might have a special relevance because of the close proximity of EAT to the myocardium and coronary arteries and the absence of an anatomic barrier between EAT and these structures.9 Accordingly, a recent study demonstrated that EAT thickness evaluated by cardiac computed tomography scan was strongly related to vascular risk factors and coronary calcification.190 Besides, EAT is closely related to total visceral adipose tissue, classically more linked to a higher risk of metabolic and cardiovascular disorders than “peripheral” adipose tissue. In this line, the assessment of the amount of EAT by echocardiography is a more reliable method to calculate visceral adiposity than waist circumference measurements.171, 245 Adiponectin is an adipocyte-derived collagen-like protein23, 25, 26, 69 which was shown to have important effects on the cardiovascular system, particularly concerning the development of the metabolic syndrome.68 It is related to glucose metabolism, insulin resistance and lipid metabolism.23, 25, 26, 33, 68, 69 Low circulating adiponectin levels have been associated with diabetes mellitus (DM),67 obesity23 and coronary artery disease (CAD).35, 69, 74, 75 However, in patients with congestive heart failure (CHF) reverse relationship was observed as high plasma adiponectin levels have been associated with poorer prognosis.85, 86 Also age may influence the circulating levels of this hormone; higher levels found in the elderly35 might be due to a phenomenon of “adiponectin resistance”. Lower plasma levels of adiponectin have also been reported in patients with arterial hypertension (HT), regardless of age, body mass index (BMI) and cholesterol levels.79 Moreover, hypoadiponectinaemia is an independent risk factor for HT both in men and women,246 although some studies failed to show such an association.80 A prospective study found that low adiponectin levels at baseline are related to a higher risk of development of HT.247 The effect of some antihypertensive drugs (ramipril and valsartan) on plasma adiponectin levels seems to be parallel to their effects on blood pressure and insulin sensitivity, in patients with metabolic syndrome.81 Hypertension being a prevalent disorder, its impact on
Adiponectina en el TAE e hipertensión arterial 59 cardiovascular diseases is very deep. A better knowledge of its physiopathology and its relationship with other pathological conditions can lead to a proper management of hypertensive patients. Although the association between EAT adiponectin expression levels and gender or CAD has already been described,181, 230 to date, its relationship with the presence of HT has not yet been elucidated. The aim of the present study was to determine whether EAT and subcutaneous adipose tissue (SAT) expression levels of adiponectin are different in hypertensive and nonhypertensive patients. MATERIALS AND METHODS Subjects. Samples of EAT were obtained from 116 consecutive patients (78 men, 38 women) who underwent elective heart surgery at our hospital, for coronary artery bypass grafting (n=54), valve surgery (n=49), both (n=12) or atrial myxoma exeresis (n=1). In 85 patients, we also collected samples of SAT. Only those patients who had undergone a previous heart surgery were excluded. The study was approved by the local IRB and followed the guidelines proposed by the Declaration of Helsinki. Written informed consent was obtained from each patient before study participation. The participation rate was 100%. Clinical data. Clinical data, including the antecedent of HT, were obtained retrospectively by checking medical records. At our clinics, the diagnosis of HT was done by calculating the average of three measurements of blood pressure after a resting period of 10 min, if systolic blood pressure exceeded 140 mmHg and/or diastolic blood pressure was higher than 90 mmHg. The diagnosis of HT was performed by the patients’ general physicians during regular outpatient follow-up before surgery. Non-hypertensive status was also properly assessed prior to surgery. Hypertensive patients were included in the HT group, no matter whether their blood pressure was adequately treated and targets reached at the time of inclusion in the study. Body mass index was obtained from anthropometrical measurements upon admission to hospital. Blood samples were collected up to 1 week before surgery, except for cholesterol
CAPÍTULO 4 60 levels, which were analysed within 6 months prior to surgery. The presence or absence of CAD was assessed by checking coronary angiography studies carried out up to 6 months before surgery. Only angiographically significant stenoses (more than 50% of the luminal diameter) were considered. Collection and treatment of EAT and SAT samples. The SAT and EAT samples were obtained before extracorporeal circulation. EAT biopsies were harvested near the proximal tract of the right coronary artery. SAT samples were obtained from the thorax. All tissues were immediately frozen at -80 °C before RNA extraction. RNA was extracted by Trizol method. Concentration and purity of the samples were estimated by the ratio between absorbances at 260 and 280 nm. Samples contaminated with genomic DNA were treated with DNase I. Each 5 µg of RNA was treated with 10 U/µl of DNase I and 20 U/µl of RNase inhibitor (both products from Invitrogen Ltd, Paisley, UK) for 2 h at 37 °C. Proteins and DNA were removed from the samples with phenol, chloroform and isoamylalcohol. Eventually, RNA was precipitated with 96% ethanol and sodium acetate 0.3 M. Reverse transcription and real time retrotranscriptase PCR. Real time retrotranscriptase (RT)-PCR was performed using 1.2 µg samples of purified RNA and 200 U of MMLV reverse transcriptase (Invitrogen Ltd) in 30 µl of a solution (pH 8.4) containing 20 mM Tris-HCl, 50 mM KCl, 2.5 mM MgCl2, nucleotides (1 mM each), 20 U of RNase inhibitor and random primers under the following conditions: 50 min at 37 °C, 10 min 42 °C and 5 min at 95 °C. The comparative analysis of adiponectin and glyceraldehyde 3-phosphate dehydrogenase expression in EAT was done with real time RT-PCR using SybrGreen (Roche Diagnostics Corp., Indianapolis, IN, USA) as fluorochrome and the primers previously described.230 Adiponectin mRNA amplification was performed: 5 min at 95 °C, followed by 40 cycles of 30 s at 95 °C, 45 s at 60 °C, and 60 s at 72 °C.228 Genomic contamination was ruled out by using negative controls at retrotranscription conditions without MMLV. Fluorescence curves were analysed using Chromo 4 software (MJ Research, Inc., Reno, NV, USA). Adiponectin mRNA was normalized to glyceraldehyde 3-phosphate dehydrogenase mRNA and expressed in arbitrary units (a.u.).
Adiponectina en el TAE e hipertensión arterial 61 Immunohistochemistry. Sections of EAT and SAT from hypertensive and non-hypertensive patients were paraffinembedded and afterward deparaffined and rehydrated. Slides were incubated overnight with antibodies to adiponectin (Santa Cruz Biotechnology, Delaware, CA, USA), dilution 1:250. The LSAB protocol (Dako Diagnostics, Glostrup, Denmark) was followed. Inmunodetection was developed with 3,30-diaminobenzidine tetrahydrochloride kit (Dako Diagnostics). Negative controls were carried out by omitting the primary antibody. Statistical analysis. Normality assumptions of continuous variables were checked with Kolmogorov-Smirnov tests. Non-skewed variables were summarized as mean±s.d. Differences between continuous variables were tested for statistical significance by means of t test. Categorical variables were expressed as percentages and compared using chi-square test. When missing data, we checked that there was no unequal distribution between groups. We used logistic regression models to assess the association of EAT and SAT mRNA expression of adiponectin with HT, including possible confounding factors. Results are presented as ORs together with their 95% confidence intervals. Statistical significance was defined as P<0.05. All analyses were performed using SPSS 15.0 software for Windows (SPSS Inc., Tokyo, Japan). RESULTS Patients characteristics. The study sample included 84 hypertensive and 32 non-hypertensive patients. The main sample characteristics are given in Table 4-1. The mean (±s.d.) age was 70.3±7.9 years. Hypertensive patients were, on average, less than 2 years older than the nonhypertensive patients. The proportion of male was higher than that of female in both groups, notably in that of nonhypertensives, although not statistically different. HT and non-HT groups were quite similar, except for use of calcium channel blockers and triglyceride levels, both significantly higher in the former group.
CAPÍTULO 4 62 All subjects With HT Without HT P* (n=84) (n=32) Demographics Male (%) 67 63 78 0.12 Age (years) 69.8±7.9 70.7±6.9 69.0±10.1 0.30 Comorbidities and risk factors Current smokers (%) 8 10 4 0.23 Body Mass Index (kg/m2) 28.8±4.1 27.6±4.2 29.2±3.9 0.06 Type 2 diabetes (%) 36 41 24 0.13 Coronary Artery Disease (%) 61 66 48 0.10 Heart Failure (%) 30 32 25 0.45 LVEF (%) 60±15 60±14 60±15 0.91 Treatment prior to surgery ACEIs /ARBs (%) 41 43 35 0.63 Statins (%) 40 43 32 0.48 Beta-blockers (%) 36 38 32 0.71 Calcium channel blockers (%) 27 37 3 0.001 Laboratory findings Urea (mg/dL) 57±27 57±23 58±37 0.82 Creatinine (mg/dL) 1.1±0.3 1.1±0.4 1.1±0.3 0.37 Triglycerides (mg/dL) 119±50 126±51 102±42 0.023 Cholesterol (mg/dL) 181±43 178±39 183±44 0.41 HDL cholesterol (mg/dL) 37±13 36±13 38±13 0.58 LDL cholesterol (mg/dL) 108±35 106±36 112±32 0.53 EAT adiponectin mRNA (a.u.) 14.4±3.6 14.0±3.6 15.3±3.6 0.06 SAT adiponectin mRNA (a.u.) (n=85) 15.3±4.4 15.3±4.2 15.3±5.0 0.99 TABLE 4-1. Baseline characteristics of the hypertensive and the non-hypertensive groups. Values expressed as mean±standard deviation. * P-value referred to the comparison between HT and non-HT groups. HT, arterial hypertension; LVEF, left ventricular ejection fraction; ACEIs, angiotensin converter enzyme inhibitors; ARBs, angiotensin receptor blockers; HDL, high density lipoprotein; LDL, low density lipoprotein; EAT, epicardial adipose tissue; mRNA, messenger ribonucleic acid; a.u., arbitrary units; SAT, subcutaneous adipose tissue.
Adiponectina en el TAE e hipertensión arterial 63 8432N = HypertensionNo hypertension EAT mRNA adiponectin/GAPDH (a.u.) 25 20 15 10 5 One third of the patients of the whole group presented DM and one third – CHF. CAD was diagnosed in more than half of the study sample. However, none of these comorbidities differed significantly between both groups. The prevalence of overweight and obesity in our sample was remarkably large, with 51% subjects meeting the criteria for overweight (BMI >25 and <30 kg/m2) and 34% meeting the criteria for obesity (BMI>30 kg/m2). In our sample, BMI was higher in the group of non-hypertensive patients (P=0.06). EAT adiponectin mRNA levels in hypertensive vs. non-hypertensive patients. Hypertensive patients had lower EAT mRNA expression levels of adiponectin than nonhypertensive patients [14.0±3.6 vs. 15.3±3.6], although in this unadjusted analysis, the difference failed to reach statistical significance (P=0.06) (Figure 4-1). However, when the association between EAT expression of adiponectin and HT was explored by means of multivariate logistic regression analysis, we found that the relationship between lower EAT adiponectin mRNA levels and HT achieved statistical significance (OR for adiponectin mRNA 0.828 per a.u., P=0.020) (Table 4-2). Variables considered in the model included possible confounding factors such as age, gender, BMI, DM, CHF, CAD and triglyceride levels. In this analysis, only older age and lower EAT adiponectin mRNA levels were found to be significantly associated with the presence of HT. Further adjustment introducing consumption of calcium channel blockers -distributed differently in both groupsled to a similar result (OR=0,825 per a.u., P=0.031). FIGURE 4-1. Box plot comparing epicardial adipose tissue (EAT) mRNA adiponectin in patients with and without hypertension. Box-and-whiskers plot with mean values, interquartile range and lower and upper values. Outliers/extreme values are represented by the small circular symbols. p-value of the difference of EAT mRNA adiponectin between hypertensive and nonhypertensive patients=0.06 (unadjusted). GAPDH, glyceraldehydes 3-phosphate dehydrogenase; a.u., arbitrary units.
CAPÍTULO 5 70
Adiponectina y leptina en el TAE y diabetes mellitus tipo 2 71 CAPÍTULO 5 ADIPONECTINA Y LEPTINA EN EL TEJIDO ADIPOSO EPICÁRDICO Y DIABETES MELLITUS TIPO 2
CAPÍTULO 5 72 DIABETIC AND NONDIABETIC PATIENTS EXPRESS SIMILAR ADIPOSE TISSUE ADIPONECTIN AND LEPTIN LEVELS. E Teijeira-Fernandez,a S Eiras,b L Grigorian-Shamagian,a A Salgado-Somoza,b JM MartinezComendador,c and JR Gonzalez-Juanateya,b aDepartment of Cardiology. Hospital Clínico Universitario. Santiago de Compostela. Spain. bLaboratory 6. Instituto de Investigaciones Sanitarias. Hospital Clínico Universitario. Santiago de Compostela. Spain. cDepartment of Cardiothoracic Surgery. Hospital Clínico Universitario. Santiago de Compostela. Spain. (International Journal of Obesity. 2010 Jul;34:1200-8)
Adiponectina y leptina en el TAE y diabetes mellitus tipo 2 73 ABSTRACT Objective: Epicardial adipose tissue (EAT) is an interesting visceral fat pad with a particular location. EAT and subcutaneous adipose tissue (SAT) produce a wide range of adipokines. Some of them, including adiponectin and leptin, can influence the risk of development of diabetes and other associated metabolic and cardiovascular conditions. We sought to assess whether EAT and SAT adiponectin and leptin expression levels are different in diabetic patients with respect to nondiabetic subjects. Subjects and methods: We collected samples of EAT from 120 patients and samples of SAT from 88 of the same group of patients undergoing elective cardiac surgery for coronary artery bypass grafting (n=69) or other procedures (n=51). After RNA isolation, adiponectin and leptin expression levels were analyzed by real time reverse transcriptase-PCR. Plasma levels were determined in small subsamples of subjects. Baseline clinical and treatment data were obtained from medical records. Results: A total of 45 diabetic and 75 nondiabetic subjects were included in the study. Mean (s.d.) age was 70.1 (7.8) years and there were 32% women. EAT and SAT adiponectin and leptin mRNA expression levels were similar in the diabetic and the nondiabetic groups (EAT adiponectin 14.4 (4.3) vs 14.6 (3.4) arbitrary units (a.u.), P=0.79; SAT adiponectin 15.6 (4.7) vs 15.1 (3.9), P=0.54; EAT leptin 9.3(interquartile range 2.5) vs 9.5 (1.9) a.u., P=0.72; SAT leptin 9.9 (3.6) vs 10.0 (2.5) a.u., P=0.96). These findings persisted after stratification for sex and coronary artery disease. Logistic regression models including possible confounders and a combination of diabetes and impaired fasting glucose as dependent variable led to similar results. Plasma adiponectin levels were lower in diabetic patients, whereas leptin levels showed a nonsignificant trend. Conclusion: Diabetic and nondiabetic subjects express similar EAT and SAT adiponectin and leptin levels. Counter-regulatory mechanisms of adiponectin and leptin expression in patients with established diabetes might partly account for these findings. Keywords: adiponectin, adipose tissue, leptin, type 2 diabetes.
CAPÍTULO 5 74 INTRODUCTION Diabetes is a leading cause of morbidity and mortality and has become a major health issue worldwide. Inflammatory cytokines, such as tumor necrosis factor-α and interleukin-6, have been found to play a relevant role in its physiopathology.243 Diabetes and metabolic syndrome often present jointly. Adiposity could well be the link between the components of this cluster of pathological conditions. Formerly considered a mere energy depot, adipose tissue has been attributed a most interesting role in the pathogenesis of metabolic and cardiovascular diseases.8 It produces a large amount of antiand pro-inflammatory factors generally referred to as adipokines.201 Classical epidemiological observations found a significant association between visceral adipose tissue –rather than subcutaneous adipose tissue (SAT)– and metabolic and cardiovascular diseases. Thus, the clustering of central obesity with insulin resistance, dyslipidemia and chronic inflammation may account for part of the cardiovascular effects of adiposity.259 In this line, much attention has been focused on epicardial adipose tissue (EAT), an interesting representative of visceral adipose tissue. EAT extends along the major heart grooves with no anatomical fibrous layer, its products also being able to exert direct effects on the main epicardial coronary arteries and the myocardium. As shown by different groups, EAT expresses a pathogenic profile of adipokines.8, 213, 214 In recent years, much attention has been focused on adiponectin, the most abundant protein secreted by adipocytes. Initial investigations showed its positive effects as an insulin sensitizer and a protective cardiovascular hormone.39 Epidemiological and laboratory studies showed a beneficial effect of adiponectin on preventing atherosclerosis and coronary artery disease (CAD).74 However, more recent research and a comprehensive meta-analysis failed to confirm these findings and led to rather different conclusions, namely that baseline adiponectin circulating levels do not affect the risk of development of CAD significantly.73 Diabetic patients, especially those with macroangiopathy, have lower adiponectin plasma levels than control subjects.67 Different studies have shown that lower plasma adiponectin levels are strongly correlated with insulin resistance260 and predict the development of insulin resistance261 and diabetes,260, 262-264 irrespective of baseline measures of obesity.Leptin, mainly secreted by adipocytes,119 is positively correlated to total body fat and has an important role in
Adiponectina y leptina en el TAE y diabetes mellitus tipo 2 75 the regulation of appetite and energy balance. Plasma leptin levels are closely associated with body fat storage and may respond to changes in energy expenditure. Leptin deficiency produces severe obesity and metabolic, immunological and neuroendocrinological dysfunctions.108 Leptin resistance is far more common and virtually present in all obese subjects.265 Leptin is associated with insulin resistance266 and predicts the development of diabetes.111 In vitro research showed that it also exerts some pro-atherosclerotic effects, such as endothelial activation and migration,267, 268 smooth muscle cell proliferation and calcification,269 and activation of monocytes.270 Even though some studies showed an association between high leptin levels and CAD,112 others failed to do so,115 despite finding an association between leptinemia and inflammatory markers.271, 272 The aim of the present study is to explore the relationship between EAT and SAT adiponectin and leptin expression and established type 2 diabetes. SUBJECTS AND METHODS Subjects. Samples of EAT and SAT were collected from 120 patients (82 men, 38 women) who underwent elective cardiac surgery at our hospital, for coronary artery bypass grafting (N=53), valve surgery (N=49), both (N=16), myxoma exeresis (N=1) or repair of atrial septal defect (N=1). Exclusion criteria were: previous cardiothoracic surgery, infective diseases and type 1 diabetes mellitus, because of its demonstrated different relationship to adiponectin levels.273 The study was approved by the local institutional review board and conducted according to the principles of the Declaration of Helsinki. Written informed consent was obtained from every patient before inclusion. The participation rate was 100%. Clinical data. Clinical data were obtained from medical records. The diagnosis of type 2 diabetes was accurately assessed following theAmerican Diabetes Association current criteria.274 Patients were classified as diabetic or nondiabetic. Abnormal fasting glucose, as defined by fasting concentrations ≥ 5.6 mmol/l, was included as dependent variable in the logistic regression
CAPÍTULO 5 76 model, together with diabetes. Oral glucose tolerance testing was not routinely applied and thereby impaired glucose tolerance was not ruled out. Body mass index was calculated from anthropometrical measurements on admission to hospital. Overweight and obesity were defined as body mass index ≥ 25 and ≥ 30 kg/m2, respectively. Blood samples were collected after overnight fasting up to 1 week before surgery and analyzed using standard methods, but cholesterol levels were determined within 6 months before surgery. Significant CAD was discarded or confirmed by noninvasive testing and/or coronary angiogram performed within 6 months before surgery. Cutoff point for angiographically significant coronary artery stenosis was 50% of the lumen diameter. As regards treatment, we included data concerning the drugs that patients were taking during the weeks immediately before sample collection. Former treatments were not considered. Collection of adipose tissue samples. SAT and EAT samples were obtained before starting extracorporeal circulation. EAT biopsies were harvested from the area close to the proximal tract of the right coronary artery. SAT samples were obtained from the thorax, at the sternotomy incision. All tissue samples were immediately frozen and stored at -80 °C until laboratory processing. RNA was extracted and purified by the Trizol method. The concentration and purity of the samples were estimated by the ratio between absorbances at 260 and 280 nm. Samples were treated with DNase I to avoid genomic DNA contamination. Each 5 ug of RNA was treated with 10 U of DNase I and 20 U of RNase inhibitor (both manufactured by Invitrogen Ltd, Paisley, UK) for 2 h at 37 °C. Phenol, chloroform and isoamylalcohol were used to remove proteins and DNA from the samples. RNA was precipitated with 96% ethanol and sodium acetate 0.3 M. Freezing-thawing cycles were avoided whenever possible to ensure maximum quality of the determinations. Reverse transcription and real time PCR. Real-time reverse transcriptase PCR was performed using 1.2 μg samples of purified mRNA and 200 U reverse transcriptase (Malooney Murine Leukemia Virus, MMLV) (Invitrogen Ltd, Paisley, UK) in 30 μl of a pH 8.4 solution containing 20 mM Tris-HCl, 50 mM KCl, 2.5 mM
Adiponectina y leptina en el TAE y diabetes mellitus tipo 2 77 MgCl2, nucleotides (1mM each), 20 U of RNase inhibitor and random primers under the following conditions: 50 min at 37 °C, 10 min 42 °C and 5 min at 95 °C. The comparative analysis of adiponectin and glyceraldehyde 3-phosphate dehydrogenase expression in EAT was performed with real time reverse transcriptase PCR using SYBRGreen (Roche Diagnostics Corp, Indianapolis, IN, USA) as fluorochrome and the primers previously described.230 Adiponectin mRNA amplification was performed as follows: 5 min at 95 °C, then 40 cycles of 30 s at 95 °C, 45 s at 60 °C, and 60 s at 72 °C.228 Genomic contamination was ruled out by using negative controls without MMLV at retrotranscription conditions. Fluorescence curves were analyzed with Chromo 4 software (MJ Research, Inc., Reno, NV, USA). Gene expression levels were obtained by calculating the antilogarithm of the inverse adiponectin/GAPDH ratio and presented in arbitrary units (a.u.). All laboratory measurements were made blind to participants’ disease status, with samples randomly distributed for analysis. Plasma adiponectin and leptin determinations. Plasma levels of adiponectin and leptin were analyzed in duplicate using commercially available human high sensitivity enzyme-linked immunosorbent assay (ELISA) kits (SPI-bio, Montigny le Bretonneux, France; and R&D Systems, Inc., Minneapolis, MN, USA, respectively). The lowest limits of sensitivity were 0.5 ng/ml for adiponectin and 7.8 pg/ml for leptin, and the intraand inter-assay variance coefficients were lower than 10%. Western blot analysis. In all, 100-150 mg of EAT and SAT were rinsed in 5 ml of phosphate saline solution containing 0.5mM EDTA, 5mM KCl, 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic (HEPES) acid, 2mM MgCl2, 10mM NaHCO3, 0.5 mM KH2PO4, 0.5 mM NaH2PO4, 10 mM glucose, 110 mM NaCl and, 0.16 mM CaCl2 at pH=7.4, and then centrifuged at 300 g for 1 min to remove residual blood. Tissues were resuspended (weight/volume) in a lysis buffer (125 mM Tris pH 6.8, 10% glycerol, 2% SDS, 100 mM dithiothreitol, 1 anti-protease cocktail from Sigma-Aldrich, St Louis, MO, USA) and sheared by homogenizer pestle using sample grinding kit (GE Healthcare, Waukesha, WI, USA). Then, the proteins were precipitated with 20% trichloroacetic acid in acetone. Finally, samples were resuspended at a final concentration of 1ug of homogenized tissue per 1ul in Laemmli buffer. Protein
CAPÍTULO 5 78 separation (40ug) was carried out in 12% SDS-polyacrylamide gel electrophoresis gel and transferred on a polyvinylidene fluoride membrane for 45 min at 280mA. Membranes were blocked for 2h at room temperature with 5% of milk in Tris-buffered saline tween-20 containing: 20mM Tris-HCl (pH 7.6), 150 mM NaCl and 0.1% Tween 20. The membranes were then exposed with goat adiponectin antibody (1:500 dilution) and goat GAPDH antibody (1:1000) (Santa Cruz Biotechnology, Delaware, CA, USA) overnight, and then to peroxidase-conjugated rabbit anti-goat IgG. Immunoreactive proteins were visualized using an enhanced chemiluminescence detection system (Amersham Pharmacia Ltd, London, UK) and quantified by densitometry Image J software. Adiponectin protein levels were evaluated in duplicate and quantified with respect to GAPDH. Statistical analysis. Categorical variables are expressed as percentages and compared using χ2-test or Fisher’s exact test. We used the Kolmogorov-Smirnov test to check the normality of continuous variables. Nonskewed variables are summarized as the mean (standard deviation) and those with skewed distribution as the median (interquartile range). Differences between continuous variables were tested for statistical significance by means of Student’s ttest. Mann-Whitney test was performed whenever nonparametrical testing was required. To discard the influence of sex, CAD, hypertension (HT) and statin treatment, we stratified the sample for these variables and repeated the described analysis across strata. Logistic regression models including possible confounders were used to assess the association between EAT and SAT adiponectin and leptin mRNA levels and diabetes or impaired fasting glucose. In case of missing data, we checked that there was no unequal distribution between groups. Statistical significance was defined as P<0.05. All analyses were computed using SPSS 15.0 software for Windows (SPSS, Inc., Chicago, IL, USA).
Adiponectina y leptina en el TAE y diabetes mellitus tipo 2 79 RESULTS Patient characteristics. In all, 45 diabetic patients and 75 nondiabetic western European subjects were included in this study. The prevalence of diabetes was almost 38% in our sample. Table 5-1 presents the main characteristics of the study sample. Mean age was 70.1 years (s.d. 7.7). Diabetic and nondiabetic groups did not differ significantly for most clinical variables. There was a very high prevalence of obesity in both groups, with overall ratios of overweight and obesity of 55 and 30%, respectively. As for other comorbidities, such as HT and heart failure, the prevalence was higher in the diabetic group, though not significant. CAD was more prevalent in the group of diabetics, with borderline statistical significance. Concerning drug intake, there were only slight differences in calcium channel blocker consumption, higher in the group of diabetics, and differences in statin consumption, more prevalent in the same group. In all, 24 diabetic patients were on oral antidiabetic agents, mostly sulfonylureas (n=14) or metformin (n=8), alone or in combination. Fasting glucose levels were higher in the group of diabetics, despite treatment. Diabetic patients had lower cholesterol levels than the nondiabetic group, though the difference was not statistically significant. EAT and SAT adipokine mRNA expression in diabetic vs. nondiabetic subjects. Diabetic patients had similar EAT and SAT mRNA adiponectin (Figure 5-1) and leptin (Figure 5-2) levels than nondiabetic patients. We stratified the sample according to sex and CAD, but no significant differences were found concerning adiponectin (Table 5-2) and leptin (Table 53) mRNA expression in different strata when comparing diabetic and nondiabetic groups. Further stratification for statin consumption or HT led to similar results (data not shown). Conversely, statin treatment did not show a significant effect on adipokine expression in any stratum. As regards the influence of oral antidiabetic drug on EAT and SAT adipokine expression, no significant difference was found when compared with the group of diabetics free from this treatment (EAT adiponectin 14.5 (2.6) vs. 14.0 (5.9) a.u., P=0.68; EAT leptin 9.2 (8.3-10.7) vs. 9.6 (7.6-10.8) a.u., P=0.96; SAT adiponectin 15.3 (5.4) vs. 15.7 (4.1) a.u., P=0.83; SAT leptin 8.9 (7.7-12.6) vs. 10.4 (8.6-11.6) a.u., P=0.77).
CAPÍTULO 5 86 A recent study showed an association between EAT thickness and impaired glucose tolerance.277 Differences in the size of fat pads between diabetic and nondiabetic patients might well be one of the reasons why, despite similar adiponectin and leptin expression levels, plasma levels differ between both groups.67 Although EAT is relatively small in size, it is a representative of visceral adipose tissue278 and its anatomical location suggests a major role in the physiology and physiopathology of cardiovascular diseases. Our group showed lower EAT adiponectin levels in patients with more severe established CAD 213, in line with previous observations.181 Very interestingly, adiponectin levels were decreased in EAT but not in SAT, suggesting a major implication of EAT in the physiopathology of coronary atherosclerosis and CAD. EAT would then act as an endocrine organ directly affecting the underlying coronary arteries. In accordance with previous findings reported,213, 230 women and non-CAD individuals express higher EAT adiponectin and leptin levels. We also described an association between lower EAT adiponectin expression levels in patients with HT, but similar SAT levels.214 SAT could be less involved in the physiopathology of HT than EAT, and very likely a lack of counterregulation in EAT adiponectin expression could occur in HT. In this study, we do not find differences in EAT and SAT leptin expression in diabetics with respect to nondiabetic subjects. Prospective studies focused on plasma levels showed a higher rate of development of diabetes in patients with higher baseline leptin levels.111 We did not find significant differences in leptin plasma levels between diabetic and nondiabetic patients either, but the subsample analyzed was too small to draw any conclusion. However, concerning leptin and atherosclerosis, laboratory and epidemiological research led to heterogeneous results,111, 115, 267-270 suggesting a very complex regulation of the synthesis and secretion of this hormone. Metabolic changes in patients with diabetes might be responsible for the regulation of leptin expression by EAT and SAT. As for the effect of treatment on adiponectin and leptin expression, only statins and obviously oral antidiabetic agents were differently distributed in diabetic and nondiabetic groups. No relevant trends were observed regarding adipokine expression. The similar adiponectin expression levels in patients under statin treatment, though requiring confirmation by larger studies specifically designed for this purpose, can seem controversial. Statins could have a slight effect, not strong enough to increase adiponectin expression and to decrease leptin
Adiponectina y leptina en el TAE y diabetes mellitus tipo 2 87 expression in this set of patients. Or maybe they could have posttranscriptional rather than transcriptional effects. However, should this be correct, adipokine expression levels would probably change as a result of feedback stimulation. Previous studies focused on the effect of statins on insulin sensitivity and adipokine levels are controversial, not allowing any definite reliable conclusions.96, 279-282 It would have been very interesting to check the effect of peroxisome proliferator-activated receptor PPAR-γ inhibitors thiazolidinediones on EAT and SAT adipokine levels, but only one patient was taking them, as the use of these drugs is very limited in our area. Other oral antidiabetic drugs do not seem to have significant effects on EAT and SAT adipokine levels. Inflammatory cytokines, together with leptin and adiponectin, have a crucial role in the pathogenesis of metabolic and cardiovascular diseases. We are starting to understand the importance of these hormones, but their intricate relationship and their accurate effects remain still unclear. Study limitations. This study follows a cross-sectional design, and hence cannot explain causality but only association between variables. Owing to obvious ethical concerns, only patients undergoing elective heart surgery were included in the study. This is the reason why the mean age of the sample is quite high. We assessed fasting glucose impairment but oral glucose tolerance test was not routinely applied and therefore it was not possible to study the whole spectrum of clinical glucose disturbances. This is especially important in the case of CAD patients, as almost one third can present with IGT 283, 284. However, differences in adipokine expression were not found in nonCAD patients, whose prevalence of undiagnosed abnormal glucose regulation is presumably very low. We mostly focused on EAT and SAT mRNA expression levels rather than on protein tissue levels as the latter could have a different origin and not reflect adipose tissue adiponectin and leptin production properly. In any case, no differences were found in adiponectin protein levels between diabetic and nondiabetic patients in the small subsample studied. Leptin protein levels were not determined. Overall, we consider that the findings of this study are still fully valid, especially on the basis of an elderly population.
CAPÍTULO 5 88 CONCLUSIONS EAT and SAT adiponectin and leptin mRNA levels do not differ between diabetic and nondiabetic patients. Counterregulatory mechanisms of adiponectin and leptin expression in patients with diabetes might partly account for these findings. ACKNOWLEDGEMENTS This study was supported by Hospital Clínico Universitario de Santiago de Compostela (Santiago de Compostela, Spain) and a grant from Xunta de Galicia (PGIDIT07PXIB918092PR). Dr S Eiras is a researcher within the Isidro Parga Pondal Program (Xunta de Galicia, Santiago de Compostela, Spain). CONFLICT OF INTEREST The authors declare no conflict of interest.
Adiponectina en el TAE y síndrome metabólico 89 CAPÍTULO 6 ADIPONECTINA EN EL TEJIDO ADIPOSO EPICÁRDICO Y SÍNDROME METABÓLICO
CAPÍTULO 6 90 LOWER EPICARDIAL ADIPOSE TISSUE ADIPONECTIN IN PATIENTS WITH METABOLIC SYNDROME. Elvis Teijeira-Fernandez,a Sonia Eiras,b Lilian Grigorian Shamagian,a Antonio Salgado Somoza,b Cristian Delgado,c Jose R Gonzalez-Juanateya,b aDepartment of Cardiology. Hospital Clínico Universitario. Santiago de Compostela. Spain. bLaboratory 6. Instituto de Investigaciones Sanitarias. Hospital Clínico Universitario. Santiago de Compostela. Spain. cDepartment of Cardiac Surgery. Hospital Clínico Universitario. Santiago de Compostela. Spain. (enviado para publicación)
Adiponectina en el TAE y síndrome metabólico 91 ABSTRACT Background: Adiponectin is an anti-atherogenic insulin-sensitizer hormone whose plasma concentration is lower in patients with metabolic syndrome (MS). Visceral adiposity, including epicardial adipose tissue (EAT), is closely related to the development of MS and coronary artery disease (CAD). We sought to study whether EAT and subcutaneous adipose tissue (SAT) adiponectin mRNA levels are similar in patients with and without MS. Methods: EAT, SAT and blood samples were collected from patients undergoing elective cardiac surgery, for revascularization (n=19) or other procedures (n=27). Plasma adiponectin was measured using ELISA. mRNA was purified and adiponectin mRNA quantified by real time RT-PCR. Results: Mean (SD) age was 71.6 (9.6) years. Patients who met Adult Treatment Panel III MS criteria (n=29) presented lower plasma adiponectin concentrations (11.2 (7.4) vs. 19.6 (8.4) mg/l, P=0.004), lower EAT adiponectin mRNA (12.7 (3.0) vs. 15.1 (3.7) a.u., P=0.029) and similar SAT adiponectin mRNA levels (13.7 (4.2) vs. 15.6 (5.7) a.u., P=0.25) than those without MS. After adjusting for age, sex, CAD and heart failure, the association with MS remained statistically significant for plasma adiponectin (OR 0.862 (0.762-0.974)), was of borderline significance for EAT adiponectin mRNA (OR 0.796 (0.630-1.005)) and not significant for SAT adiponectin mRNA (OR 0.958 (0.818-1.122)). Patients in the lower quartiles of EAT adiponectin mRNA and plasma adiponectin presented a higher mean of components of the MS. Conclusion: Subjects with MS present lower EAT adiponectin mRNA levels than those without MS, whereas SAT adiponectin mRNA levels do not seem to differ between both groups. EAT might be the link between MS and its atherothrombotic cardiac complications.
CAPÍTULO 6 92 INTRODUCTION The metabolic syndrome (MS) is a cluster of well documented risk factors for cardiovascular diseases and diabetes (DM) that frequently present jointly and are associated to proinflammatory pro-atherogenic states.259, 285 Its definition remaining still controversial, MS has become a major health concern worldwide.259 Central obesity is usually regarded as a key component of the MS. Epicardial adipose tissue (EAT) is a very interesting representative of visceral adiposity, due to its anatomical proximity to the coronary arteries and the myocardium. EAT is closely related to total visceral adiposity; in fact, the amount of EAT has been demonstrated to reflect visceral adiposity more accurately than waist circumference measurement.171 EAT thickness as evaluated by cardiac computed tomography scan is associated to vascular risk factors and coronary calcification and to MS.197 EAT produces a large amount of proand anti-inflammatory cytokines8 and the absence of a fibrous layer would likely allow their paracrine effects on the myocardium and coronary arteries. Adiponectin, a collagen-like protein, is mainly produced by adipocytes and represents their most abundant circulating product.23 Adiponectin is an insulin-sensitizer34, 286 adipokine that exhibits diverse protective anti-inflammatory,287 anti-atherogenic32, 288 and vasodilatory effects.289 Lower plasma adiponectin levels are present in men and have also been associated with obesity,23 DM,67, 290 coronary artery disease (CAD),70 hypertension (HT)79 and heart failure (HF).84 However, in patients with established CAD, high plasma adiponectin levels failed to lead to better prognosis.73 The explanation for this paradoxical observation would be that in this set of patients, hyperadiponectinemia is possibly due to counter-regulatory mechanisms and its beneficial effects are unable to reverse such an advanced inflammatory atherogenic process.291 Hypoadiponectinemia has been associated to each defining component of the MS and to the MS itself, independently of other factors.68, 292 This association was much stronger than that of pro-inflammatory markers, such as TNF-alpha, IL-6 and C-reactive protein.293 Adiponectin concentrations can predict the risk of development of the MS and DM.294 Patients with established DM appear to present similar EAT adiponectin levels,295 and these findings raise the possibility of a counter-regulatory mechanism, similar to the one explained above. Recent studies have demonstrated lower EAT adiponectin expression in men230 and in
Adiponectina en el TAE y síndrome metabólico 93 patients with HT,214 and also enhanced IL-6 and decreased adiponectin expression levels in EAT in patients with CAD.181, 213 Interestingly, these levels relate to the extension of CAD as measured by the number of injured arteries.213 However, up to date the relationship between EAT adiponectin levels and MS remained still unknown. We sought to determine whether EAT and SAT adiponectin expression levels are different in patients with MS with respect to those without it. MATERIALS AND METHODS Study population. Fifty Caucasian patients undergoing elective cardiac surgery at our hospital were invited to participate in the study. Exclusion criteria were prior cardiothoracic surgery or concomitant infective or neoplastic diseases. The study was approved by the local Ethics Committee and has been carried out in accordance with the principles of the Declaration of Helsinki as revised in 2000. Participation was voluntary. Forty-six patients gave written informed consent and were recruited for the study. Clinical data. Upon admission to hospital, clinical data were obtained both through direct interview and by checking medical records. Anthropometric measurements were also registered at that time. As for blood pressure, mean of three separate measurements at rest was calculated. Metabolic syndrome was diagnosed following Adult Treatment Panel (ATP) III most recent criteria, and patients were classified as with or without MS. Exclusion/diagnosis of CAD was based on previous ischemia detection tests and/or coronary angiogram. Patients were also classified as with or without HF, irrespective of its cause. Prior treatments were considered only if continued during the week before surgical procedure. Sample collection. Blood samples for lipid profile, urea and creatinine measurements were collected after overnight fasting up to three days before surgery and analyzed using standard methods at the hospital central laboratory.
CAPÍTULO 6 94 Blood samples for adiponectin were collected in EDTA tubes on the same day of surgical procedure and before it early in the morning, then centrifuged to separate plasma and stored at -40ºC until assay. EAT biopsies were harvested near the proximal tract of the right coronary artery, whereas SAT samples were obtained from the thorax. All tissue samples were stored at -80ºC until processing at the research laboratory. Freezing-thawing cycles were avoided whenever possible in order to ensure optimal conditions of preservation. Plasma adiponectin analysis. Plasma levels of adiponectin were analyzed in duplicate using a commercially available human high sensitivity ELISA kit (SPI-bio, Montigny-le-Bretonneux, France). The lowest limit of sensitivity was 0.5 ng/ml, and the intraand inter-assay variance coefficients were lower than 10%. mRNA purification and real time RT-PCR. mRNA was isolated from 50-120 mg of EAT and SAT using the oligotex mRNA spin-column kit (Qiagen GmbH, Germany). Reverse transcription was performed using 4.14 µl of mRNA dilution and 200U of MMLV reverse transcriptase (Invitrogen Corp, CA, USA) in 30 µl of a pH 8.4 solution containing 20 mM Tris-HC, 50 mM KCl, 2.5 mM MgCl2, deoxynucleotides (1 mM each), 20 U of RNase inhibitor and random primers under the following conditions: 50 min at 37ºC, 10 min at 42ºC and 5 min al 95 ºC. The analysis of EAT and SAT adiponectin mRNA expression was performed with respect to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA expression by real time PCR using 8 µl of complementary DNA, 2 µl of SybrGreen (Roche Diagnostics Cor, IN, USA) as fluorochrome and the primers previously described.230 The conditions of amplification were: 5 min at 95 ºC and then 40 cycles of 30 sec at 95ºC, 45 sec at 60 ºC and 60 sec at 72 ºC. Chromo 4 software (MJ Research, inc., NV, USA) was used to analyze fluorescence curves. Melting curves were tested to assess the correct amplicon. Gene expression was calculated using the antilogarithm of inverse adiponectin/GAPDH ratio and presented in arbitrary units (a.u.).
Adiponectina en el TAE y síndrome metabólico 95 Statistical analysis. Categorical variables were expressed as percentages and differences between groups tested using χ2-test or Fisher’s exact test. Kolmogorov-Smirnov method was used to check the normality of continuous variables. Nonskewed variables were summarized as mean (standard deviation) and those with skewed distribution as median (interquartile range). Differences between continuous variables were tested for statistical significance by means of t test. Mann-Whitney test was performed whenever non-parametrical testing was required. Logistic regression models were computed to assess the association between EAT adiponectin mRNA expression, SAT adiponectin mRNA expression and plasma adiponectin concentration levels and MS, independently of other variables. Results are presented as odds ratios (ORs) together with their 95% confidence intervals (CI). Pearson’s test was used to assess correlations between EAT adiponectin mRNA expression, SAT adiponectin mRNA expression and plasma adiponectin concentration levels. Whenever missing data, we checked that there was no unequal distribution between groups. Statistical significance was defined as p<0.05. All analyses were computed using SPSS 15.0 software for Windows (SPSS, Inc., Chicago, IL, USA). RESULTS Patients characteristics. Twenty-nine patients with MS as diagnosed following ATP-III criteria and 17 patients not meeting such criteria were included in the study. Table 6-1 shows main sample characteristics. Mean age was 71.6(9.6). There were 67% male in the whole sample, with a higher ratio in the group with MS. The prevalence of obesity was remarkably high in our sample, as 52% subjects had overweight (BMI >25 kg/m2 and < 30 kg/m2) and 33% obesity (BMI >30 kg/m2). The prevalence of CAD and HF were quite high too. Notably, CAD was more prevalent in patients with MS whereas HF was more prevalent in those without MS, though differences failed to reach statistical significance in both cases.
CAPÍTULO 6 102 with CAD,8 and differences in EAT but not in SAT adiponectin expression are associated to the extension of CAD, as we demonstrated in a different set of patients.213 Therefore, though EAT is a relatively small fat pad, it could be regarded as a crucial organ that might influence heart metabolism and local inflammatory state. ConceRning SAT, a trend was found for adiponectin expression but it did not reach statistical significance, possibly due to the high variability of SAT adiponectin expression. However, we found significant positive correlations between EAT and SAT adiponectin mRNA levels and between EAT adiponectin mRNA levels and plasma adiponectin levels. These findings suggest that all three could be related to MS, the association being less strong for SAT adiponectin and actually non-significant for the correlation between SAT and plasma adiponectin. Overall, these results could very likely reflect a weaker more variable contribution of this tissue to the physiopathology of MS than that of visceral adipose tissue. As regards the role of SAT, it has been postulated that posttranscriptional changes248 could occur in SAT, and if so SAT would possibly have a more direct implication in the physiopathology of MS.Even then, these changes could also be present in visceral adipose tissue and enhance its physiopathologic role as well. Factors clustered in the MS were treated independently so far. The understanding of the physiopathology of the MS can be helpful to develop a comprehensive approach to the MS and new strategies for its management and the prevention of metabolic complications and cardiovascular adverse outcomes. Enhancing adiponectin production in selected patients with hypoadiponectinemia at early stages might be a suitable strategy to prevent the development of the MS and its metabolic and cardiovascular complications. PPAR-gamma agonists29 such as thiazolidinediones and some ARBs might be useful to increase adiponectinemia, although their net beneficial effects in this scenario are yet to be demonstrated. However, though the role of EAT adipokines in the development of MS and CAD seems promising, up to date the accurate functions of EAT and the complex interactions between adiponectin and other cytokines remain still unclear. Future research will surely shed some more light on this exciting field. Limitations. This study follows a cross-sectional design, and hence is hypothesis generating but cannot demonstrate causality. Prospective studies should be carried for this purpose. The mean age of
Adiponectina en el TAE y síndrome metabólico 103 our sample is quite high and cardiovascular diseases were present in all cases, as subjects were recruited from a heart surgery department. However, we consider that the validity of these results could extend at least to similar elderly populations and likely to the whole adult population. As explained above, the influence of CAD, HF and other potential confounders was appropriately ruled out by adjusting for these variables. EAT and SAT adiponectin mRNA expression levels were preferred to tissue adiponectin levels as the latter would reflect EAT and SAT adiponectin production less accurately. ACKNOWLEDGEMENTS The present study was supported by a grant from Xunta de Galicia, Santiago de Compostela, Spain (PGIDIT07PXIB918092R). Dr. Eiras is a researcher within the Isidro Parga Pondal Program, Xunta de Galicia, Santiago de Compostela, Spain. The authors would like to thank the staff of the Departments of Cardiology and Heart Surgery for their kind contribution to this work. CONFLICTS OF INTEREST/DISCLOSURES STATEMENT None.
CAPÍTULO 7 104
Adiponectina y leptina en el TAE y pronóstico cardiovascular 105 CAPÍTULO 7 ADIPONECTINA Y LEPTINA EN EL TEJIDO ADIPOSO EPICÁRDICO Y PRONÓSTICO CARDIOVASCULAR
CAPÍTULO 7 106 EPICARDIAL ADIPOSE TISSUE ADIPONECTIN LEVELS PREDICT CARDIOVASCULAR EVENTS. A LONG-TERM FOLLOW-UP STUDY. Elvis Teijeira-Fernandez,a Sonia Eiras,b Lilian Grigorian Shamagian,b Antonio Salgado Somoza,b Jose Rubio,c Jose R Gonzalez-Juanatey,a, b aDepartment of Cardiology. Hospital Clínico Universitario. Santiago de Compostela. Spain. bLaboratory 6. Instituto de Investigaciones Sanitarias. Hospital Clínico Universitario. Santiago de Compostela. Spain. cDepartment of Cardiothoracic Surgery. Hospital Clínico Universitario. Santiago de Compostela. Spain. (enviado para publicación)
Adiponectina y leptina en el TAE y pronóstico cardiovascular 107 ABSTRACT Background: Epicardial adipose tissue (EAT) produces a wide range of adipokines and has recently been linked to the physiopathology of cardiovascular (CV) and metabolic diseases. We aimed to study whether EAT and subcutaneous (SAT) adiponectin and leptin expression levels are associated with CV outcomes during long-term follow-up. Methods: We included 137 patients undergoing elective cardiac surgery -mainly for CABG (n=62), valve surgery (n=60) or both (n=13)- between 2004 and 2007. Samples of EAT and SAT were obtained during surgery. RNA was purified and adiponectin and leptin expression levels analyzed by real time RT-PCR. Plasma adiponectin levels were determined in a subsample of subjects (n=43). Patients were followed up to assess CV events, defined as stroke, coronary acute syndrome, admission for heart failure, need for revascularization or CV death. Results: Mean age was 69.9 (s.d.8.2) years and there were 31% women. In all, 34 patients developed CV events during 41.4 (s.d. 23.3) months of mean follow-up. Patients with CV events had lower EAT and SAT adiponectin levels at baseline (12.4 (3.0) vs. 15.7 (3.8) a.u., P=0.001; and 13.7 (2.6) vs. 15.7 (4.4)a.u., P=0.048, respectively). However, baseline EAT and SAT leptin levels and plasma adiponectin levels were not significantly different between patients with and without cardiovascular events during follow-up. Cox proportional hazards models adjusting for covariates in stages revealed that only EAT adiponectin levels and heart failure could predict CV events. Conclusions: Baseline EAT adiponectin levels are strong predictors of CV outcomes in patients with CV diseases. EAT might play a major role in the development of CV complications through local effects. Keywords: adiponectin, cardiovascular, epicardial adipose tissue, prognosis.
CAPÍTULO 7 108 INTRODUCTION In recent years, adipose tissue has been recognized as a complex endocrine organ which expresses and secretes bioactive molecules generally known as adipokines.2 Adipokines can exert local as well as systemic effects, through autocrine, paracrine and endocrine mechanisms, and play a relevant role in the development of cardiovascular (CV) and metabolic diseases. Adiponectin is an insulin-sensitizer32 anti-inflammatory287 anti-atherogenic33 adipokine which is mainly secreted by adipocytes and represents their most abundant circulating product.23 Lower plasma adiponectin levels are related to obesity,23 metabolic syndrome,68 hypertension (HT),79 diabetes,67 coronary artery disease (CAD)70 and heart failure (HF).84 Adiponectin concentrations can predict the risk of development of metabolic syndrome and diabetes.294 Despite the known beneficial effects of adiponectin, several studies showed that higher plasma levels are associated with worse prognosis in patients with CAD,297 although others found the opposite.74 However, in these patients hyperadiponectinemia could be due to feedback stimulation, and the beneficial effects of the hormone would be unable to reverse such an advanced inflammatory atherogenic process.291 Hyperadiponectinemia is also associated with worse prognosis in patients with chronic HF, possibly either owing to deleterious energy expenditure or because it is a marker of weight loss.298 Besides, higher adiponectin plasma levels have also curiously been found to predict worse CV outcomes in the elderly.299 Leptin, a hormone mainly produced by adipocytes,119 is positively correlated to total body fat and exerts pro-atherosclerotic effects.269 Leptinemia and inflammatory markers are also related.272 However, even though some studies showed an association between high leptin levels and CAD,112 others failed to link leptin levels and CV outcome115 or simply found that they do not provide more information on prognosis than BMI alone.300 Epicardial adipose tissue (EAT) is a particularly interesting fat pad due to its anatomical location close to the myocardium and the major coronary arteries. The absence of a fibrous layer and the fact that they share the same microvasculature led to hypothesize that the wide range of adipokines produced by EAT8 could directly affect the structure and function of the heart. EAT adiponectin expression is lower in patients with HT214 and EAT adiponectin and interleukin-6 levels are also related to the extension of CAD.213 Nevertheless, curiously no
Adiponectina y leptina en el TAE y pronóstico cardiovascular 109 association was found between EAT and SAT adiponectin and leptin levels and the presence of diabetes.295 EAT could be the link between metabolic and CV conditions and influence CV prognosis. We sought to explore whether EAT and SAT adiponectin and leptin expression levels could predict CV events during long-term follow-up. SUBJECTS AND METHODS Subjects. We included 137 patients who underwent elective cardiac surgery between 2004 and 2007 at our hospital, mostly for coronary artery bypass grafting (n=62), valve surgery (n=60) or both (n=13). Exclusion criteria were previous cardiothoracic surgery, active infective diseases and diabetes mellitus type 1. The study was approved by the local Ethics Committee and conducted according to the principles of the Declaration of Helsinki. Written informed consent was obtained from every patient before participation in the study. Baseline data and follow-up. Both baseline clinical data and follow-up data were obtained by checking medical records. Outcomes were assessed as of May 6th 2010 in 100% of patients. CV events were defined as stroke, coronary acute syndrome, heart failure, need for revascularization or CV death during follow-up. Blood samples were collected after overnight fasting up to one week prior to surgery -except for cholesterol levels, determined within 6 months before surgeryand analyzed at the hospital laboratory using standard methods. Significant coronary artery disease was diagnosed by coronary angiogram prior to surgery. Coronary artery stenoses in excess of 50% of lumen diameter were considered angiographycally significant. Collection of adipose tissue samples. SAT and EAT samples were obtained before starting extracorporeal circulation and processed as described previously.295 EAT biopsies were collected from the area near the proximal tract of the right coronary artery. SAT samples were harvested from the thorax. Tissue samples were immediately frozen and stored at -80 °C until laboratory processing.
CAPÍTULO 7 110 Trizol method was used for RNA purification. The concentration and purity of the samples were estimated by the ratio between absorbances at 260 and 280 nm. Genomic DNA contamination was avoided by treating samples with DNase I. Each 5 ug of RNA was treated with 10 U of DNase I and 20 U of RNase inhibitor (both manufactured by Invitrogen Ltd, Paisley, UK) for 2 h at 37 °C. Phenol, chloroform and isoamylalcohol were used to remove proteins and DNA from the samples. The RNA was precipitated with 96% ethanol and sodium acetate 0.3 M. Freezing-thawing cycles were avoided whenever possible in order to maximize the quality of the determinations. Reverse transcription and real time polymerase chain reaction (real time RTPCR). Real time RT-PCR was performed using 1.2 µg samples of purified mRNA and 200 U reverse transcriptase (MMLV) (Invitrogen Ltd) in 30 µl of a pH 8.4 solution containing 20 mM TrisHCl, 50 mM KCl, 2.5 mM MgCl2, nucleotides (1mM each), 20 U of RNase inhibitor and random primers under the following conditions: 50 min at 37 °C, 10 min 42 °C and 5 minutes at 95 °C. The comparative analysis of adiponectin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression in EAT was performed with real time RT-PCR using SybrGreen (Roche Diagnostics Corp, In, USA) as fluorochrome and the primers previously described.230 Adiponectin mRNA amplification was performed as follows: 5 minutes at 95 °C, then 40 cycles of 30 seconds at 95 °C, 45 seconds at 60 °C, and 60 seconds at 72 °C.228 Genomic contamination was ruled out by using negative controls without MMLV under retrotranscription conditions. Fluorescence curves were analyzed with Chromo 4 software (MJ Research, Inc., Reno, NV, USA). Gene expression levels were obtained by calculating the antilogarithm of inverse adiponectin/GAPDH ratio and presented in arbitrary units (a.u.). All laboratory measurements were made blind to participants’ disease status, with samples randomly distributed for analysis. Plasma adiponectin determinations. Plasma adiponectin levels were analyzed in duplicate in a random subsample of 43 patients by using a commercially available human high sensitivity enzyme-linked immunosorbent assay
Adiponectina y leptina en el TAE y pronóstico cardiovascular 111 (ELISA) kit (SPI-bio, Montigny le Bretonneux, France). The lowest limit of sensitivity was 0.5 ng/ml and intraand inter-assay variance coefficients was below 10%. Statistical analysis. Categorical variables are expressed as percentages and compared using χ2-test or Fisher’s exact test when applicable. Kolmogorov-Smirnov test was used to check normality assumptions of continuous variables. Non-skewed variables are summarized as mean (standard deviation) and those with skewed distribution as median (interquartile range). Differences between continuous variables were tested for statistical significance by means of t test. Mann-Whitney test was performed whenever non-parametrical testing was required. We used Kaplan-Meier test to compare cumulative survival rates free from CV events in different groups of patients according to baseline parameters. Cox proportional regression multivariable stepwise models were computed to examine associations between adipose tissue adiponectin and leptin levels and CV outcomes. We included covariates most likely to predict CV events (age, gender, BMI, HT, CABG surgery, creatinine levels) at the first step. Spearman test was used to study possible correlations between plasma adiponectin concentrations and EAT and SAT adiponectin expression levels. When missing data, we checked that there was no unequal distribution between groups. Statistical significance was defined as p<0.05. All analyses were computed using SPSS 17.0 software for Windows (SPSS, Inc., Chicago, IL, USA). RESULTS Patients’ characteristics. In all, 137 patients (31% women) with a mean age of 69.9 years (s.d. 8.2) were included in the study. The main sample characteristics are shown on Table 7-1. Of note, there was a very high prevalence of obesity, with overall ratios of overweight and obesity of 54% and 30%, respectively. Besides, the prevalence of HT, CAD and HF was also quite high in our sample. During a mean follow-up of 41.4 (s.d. 23.3) months, 34 patients suffered from CV events, defined as heart failure (n=17), coronary acute syndrome (n=7), CV mortality (n=7), need for revascularization (n=2) and stroke (n=1). Patients with CV events during follow-up were
CAPÍTULO 7 118 could explain the previous conflicting evidence showing that higher plasma adiponectin levels in patients with CV disease did not affect CV prognosis or could even worsen it.297 If plasma levels do not reflect local adiponectin concentrations, these results would no longer be contradictory. The lack of an independent association between SAT adiponectin levels and CV outcomes is also interesting. We hypothesize that SAT adiponectin levels might play a role in CV prognosis to some extent, but they would be more influenced by systemic factors than EAT adiponectin levels. EAT is a visceral fat pad with a particular location and could act as an endocrine organ directly affecting the underlying coronary arteries and the myocardium and being mostly influenced by them. EAT levels are lower in patients with CAD,181 especially in those with more severe CAD.213 Remarkably, those levels were elevated in EAT but not in SAT, which suggested a major implication of EAT in CV physiopathology. We could not find an association between adiponectin levels and CV mortality or all-cause mortality. Obviously, the relatively small number of events may account for these results. In what concerns leptin, no association was found between its EAT or SAT levels and CV outcomes. These results are hardly surprising, considering that leptin has many different biological effects and has failed to show a clear net effect on CV diseases in some previous studies.115, 300 The role of adipokines in the physiopathology of CV diseases remains still to be fully elucidated. The initial vision of adiponectin as a beneficial hormone has recently been questioned. Although plasma adiponectin could be a marker of worse CV prognosis in some circumstances that need to be cleared, our results support the classical evidence that the role of adiponectin is mainly protective. Thus, plasma adiponectin might not accurately reflect local levels within the heart, and these levels rather than systemic ones could truly influence CV prognosis. Study limitations. Owing to ethical concerns, only patients undergoing elective heart surgery were included in the study. We focused on EAT and SAT mRNA expression levels rather than on protein tissue levels as the latter could have a different origin and not reflect adipose tissue adiponectin and leptin
Adiponectina y leptina en el TAE y pronóstico cardiovascular 119 production properly. Plasma adiponectin levels were analyzed only in a small subsample of patients and plasma leptin was not analyzed at all in this study. Treatment changes during follow-up were not considered and therefore their influence could not be tested. Conclusions. EAT adiponectin levels are strong predictors of CV outcomes in patients with CV diseases. EAT might play a major role in the development of CV complications. ACKNOWLEDGEMENTS The study was supported by Hospital Clínico Universitario de Santiago de Compostela (Santiago de Compostela, Spain) and a grant from Xunta de Galicia (PGIDIT07PXIB918092PR). Dr. S. Eiras is a researcher within Isidro Parga Pondal Program (Xunta de Galicia, Santiago de Compostela, Spain). CONFLICTS OF INTEREST/DISCLOSURES STATEMENT None.
CAPÍTULO 8 120
Discusión general 121 CAPÍTULO 8 DISCUSIÓN GENERAL os trabajos que componen la presente memoria aportan información sobre la expresión diferencial de varias adipoquinas en el TAE y en el TAS, y su asociación con la hipertrofia adipocitaria, con la patología cardiovascular y metabólica, y con el pronóstico cardiovascular. El estudio de la grasa corporal ha demostrado que este tejido presenta una intensa actividad metabólica y que actúa como un auténtico órgano endocrino.1 Clásicamente, se ha observado que el tejido adiposo visceral posee propiedades diferentes respecto al tejido adiposo subcutáneo, y que participa en la patogenia del llamado síndrome metabólico y de las enfermedades cardiovasculares asociadas al mismo. El TAE es también un compartimento adiposo visceral, pero su peculiar situación anatómica, desfavorable para la mecánica cardiaca, ha despertado un interés especial en los últimos años. Se ha demostrado que este tejido produce una gran variedad de moléculas bioactivas,8 y mediante técnicas de imagen se ha encontrado también una fuerte asociación entre la cantidad de TAE y la enfermedad cardiovascular.193-195 IMPLICACIONES DEL TAE A NIVEL LOCAL Aunque el TAE representa tan sólo una mínima proporción de la grasa corporal total, dada la estrecha relación anatómica con el miocardio y las arterias coronarias, se postuló que las adipoquinas producidas por el mismo podrían ejercer efectos paracrinos y vasocrinos relevantes. En este sentido, resulta muy interesante la ausencia de una fascia que separe el TAE del miocardio y de las arterias coronarias epicárdicas, así como el hecho de que compartan la misma microvasculatura,9 lo que sugiere que estas estructuras podrían estar interrelacionadas funcionalmente. L
CAPÍTULO 8 122 Relación entre el estado hipertrófico adipocitario y la expresión de adipoquinas: comparación entre el TAE y el TAS. La obesidad es un proceso inflamatorio13 que se asocia a la hipertrofia adipocitaria205 y que incrementa el riesgo de eventos cardiovasculares.204 El tejido adiposo consta de células del estroma vascular y de adipocitos, y la ratio entre ellos puede asociarse a la modulación de diversas vías de señalización.206 Asimismo, se ha observado que el patrón de secreción de los adipocitos depende en gran parte del tamaño de los mismos.207 Por otra parte, MCP-1 actúa como un potente factor de la quimiotaxis de macrófagos en el tejido adiposo y contribuye a la resistencia a la insulina, a la esteatosis hepática en la obesidad131 y a la aterogénesis.125 IL-10 y TNF-α son otras citoquinas secretadas por el tejido adiposo cuya producción se incrementa en los sujetos obesos.119 No obstante, hasta el momento no disponíamos de información sobre la relación entre el tamaño de los adipocitos en el TAE y su patrón de expresión de adipoquinas. Por este motivo, decidimos estudiar la posible relación de la hipertrofia adipocitaria en el TAE y en el TAS con el índice de masa corporal, así como con los niveles de expresión de citoquinas proinflamatorias, concretamente de TNF-α y de MCP-1, y de una citoquina con efectos antiinflamatorios, IL-10 (capítulo 2). En línea con estudios previos, que asocian la obesidad a un incremento de la masa adiposa debida fundamentalmente a la hipertrofia adipocitaria,215 observamos que el tamaño medio de los adipocitos en el TAS se correlaciona directamente con el IMC. Sin embargo, no ocurre lo mismo en el TAE, donde el tamaño medio de los adipocitos es menor que en el TAS, lo cual concuerda también con observaciones anteriores,183 y no se asocia al IMC. Estos resultados apoyan la hipótesis de que las propiedades de ambos tejidos son muy diferentes. Los mecanismos de la hipertrofia adipocitaria parecen ser distintos en el TAE y en el TAS, como se desprende también de los estudios que muestran que el volumen de TAE se correlaciona mejor con la masa ventricular que con la cantidad total de grasa corporal.171, 172 Por otra parte, mientras que el tamaño de los adipocitos en el TAS se asocia directamente a su expresión de MCP-1, curiosamente en el TAE la correlación entre el tamaño de los adipocitos y la expresión de MCP-1 es inversa. Esta tendencia persiste tras estratificar por la presencia de enfermedad arterial coronaria, pero sólo con diferencias significativas en el grupo más
Discusión general 123 numeroso, el de pacientes varones con enfermedad arterial coronaria, posiblemente por falta de potencia en el resto de grupos debido a un tamaño muestral pequeño. Estudios previos realizados con adipocitos procedentes del TAS demostraron que la expresión y liberación de citoquinas inflamatorias depende del volumen celular,184 y también se observó que la expresión de MCP-1 se incrementa en animales obesos.219 Nuestros resultados confirman la correlación positiva entre los niveles de MCP-1 y el tamaño de los adipocitos en el TAS, pero no en el TAE, lo cual sugiere de nuevo que el comportamiento de ambos tejidos es diferente, por lo menos en los pacientes cardiópatas, que constituyen nuestra población de estudio, en los que la inflamación local podría regular la expresión de MCP-1 por el TAE. La correlación inversa descrita entre el tamaño de los adipocitos y la expresión de MCP-1 resulta a priori sorprendente, pero concuerda en cierto modo con observaciones previas que señalaban que los adipocitos perivasculares son de menor tamaño y producen mayores niveles de MCP-1 que los del TAS.220 Por tanto, la regulación de la expresión de MCP-1 –y probablemente de otras adipoquinas– debe de ser distinta en el TAE y en el TAS, lo cual implica la existencia de diferencias en el metabolismo de ambos tejidos o bien en la regulación a nivel local. Mediante inmunohistoquímica, comprobamos que, en ambos tipos de tejido, los adipocitos, los macrófagos y los mastocitos expresan MCP-1, si bien en el TAE también se observa MCP1 en los fibroblastos y en los linfocitos. Es posible que exista una compleja interacción entre las distintas células de este tejido, que podría tener implicaciones en la fisiopatología cardiovascular en determinadas circunstancias. A pesar de que los pacientes con exceso de peso presentan niveles circulantes elevados de marcadores inflamatorios como la PCR y de citoquinas proinflamatorias como IL-6 y TNF-α, no encontramos ninguna asociación entre los niveles de expresión de IL-10 o TNF-α y el tamaño de los adipocitos. IL-10 es una citoquina antiinflamatoria que contrarresta los efectos de TNF-α aunque, por el contrario, otros estudios sugieren que los niveles de IL-10 podrían reflejar un estado proinflamatorio.216, 217 Por otra parte, observamos que los pacientes con enfermedad arterial coronaria presentan niveles de ARNm de IL-10 más elevados, si bien este no era el objetivo primario de nuestro estudio, por lo que el resultado debe considerarse con cautela. Sin embargo, mientras que otros autores describen concentraciones superiores de TNF-α en el TAE de los pacientes con
CAPÍTULO 8 124 enfermedad coronaria,218 no encontramos diferencias en cuanto a la expresión génica de TNFα en el TAE de pacientes con o sin enfermedad coronaria. Al analizar los niveles plasmáticos de MCP-1, hallamos una tendencia a la asociación con el tamaño de los adipocitos en el TAE, pero no con los del TAS, lo cual sugiere que los efectos locales en el TAE podrían ser un factor determinante de las diferencias de expresión del MCP1 en este tejido. En conclusión, en los pacientes cardiópatas, el tamaño medio de los adipocitos del TAS se relaciona directamente con el IMC y con los niveles de expresión de MCP-1, en línea con lo descrito en otras poblaciones.184 Sin embargo, el tamaño medio de los adipocitos en el TAE no se asocia con el IMC, y se correlaciona de manera inversa con los niveles de MCP-1. El TAE y TAS presentan diferentes componentes celulares que participan en la expresión de la proteína quimiotáctica MCP-1, responsable de la infiltración de células inflamatorias. Estos datos sugieren que el comportamiento de ambos tejidos es diferente, y que probablemente también poseen implicaciones distintas en la fisiopatología cardiovascular y metabólica. Enfermedad arterial coronaria Por su relación anatómica con las arterias coronarias epicárdicas, parte de la investigación sobre el TAE se ha centrado en estudiar su implicación en la fisiopatología de la enfermedad coronaria. En los últimos años, múltiples estudios de imagen han demostrado la relación entre la cantidad de TAE y la aterosclerosis coronaria.193-195 No obstante, debido a la dificultad de obtener biopsias de este tejido, existen muchos menos datos sobre el patrón de producción de adipoquinas por el mismo y la enfermedad coronaria. Un estudio pionero mostró que el TAE de los pacientes sometidos a cirugía de revascularización presenta un perfil patogénico de expresión de adipoquinas similar al tejido graso visceral, y mayor infiltración macrofágica;201 pero no se comparó con el TAE de controles sin cardiopatía isquémica. Iacobellis y colaboradores181 publicaron un estudio con un número pequeño de pacientes sometidos a cirugía cardiaca, en el que observaron niveles de expresión de adiponectina en TAE más bajos en los sujetos con enfermedad coronaria, respecto a los que no la presentaban. Es probable que los individuos con mayor cantidad de TAE presenten menores niveles plasmáticos de adiponectina, tal como se ha observado que ocurre con los niveles plasmáticos de la hormona en relación con la grasa abdominal.249 De este modo, los pacientes con mayor cantidad de
Discusión general 125 TAE, asociado directamente a la cantidad de grasa visceral, expresarían menores niveles locales de adiponectina, y por lo tanto tendrían una mayor susceptibilidad a la aterosclerosis coronaria. Partiendo de estos trabajos previos, decidimos estudiar los niveles de expresión de adiponectina y de IL-6 en el TAE de pacientes con enfermedad coronaria en una muestra mayor que la publicada previamente,181 e investigar también si dichos niveles se correlacionan con la extensión de la enfermedad coronaria, medida según el número de arterias coronarias epicárdicas afectas (capítulo 3). Como grupo control, seleccionamos pacientes sin enfermedad arterial coronaria sometidos a cirugía cardiaca por otros motivos. Comprobamos así que los pacientes con enfermedad arterial coronaria sometidos a cirugía cardiaca presentan niveles de expresión de adiponectina en el TAE menores que los sujetos control. Además, los pacientes con mayor número de arterias coronarias afectas presentan en el TAE niveles significativamente menores de expresión de adiponectina y niveles superiores de IL-6. El hecho de que IL-6 atenúe la asociación entre los niveles de adiponectina en el TAE y la extensión de la enfermedad coronaria quizá pueda explicarse por la interrelación que existe entre las distintas adipoquinas. Es decir, si bien los niveles de expresión de adiponectina en el TAE se asocian a la extensión de la enfermedad coronaria, esta relación podría verse también influida por el efecto de otras adipoquinas. No obstante, en una muestra menor de pacientes, no encontramos asociación entre los niveles de expresión de TNF-α y la presencia de enfermedad arterial coronaria, tal como se describe en el capítulo 2, lo cual se opone a los hallazgos de Cheng y colaboradores.218 Por tanto, a la luz de estos resultados, la implicación de TNF-α en la fisiopatología de la enfermedad arterial coronaria parece ser menor que la de adiponectina, o bien más compleja. Observamos también que los niveles de IL-10 son mayores en pacientes con cardiopatía isquémica. Aunque IL-10 es un inhibidor de TNF-α y sus efectos conocidos son predominantemente antiinflamatorios,216 en esta situación podría reflejar un estado inflamatorio, lo cual explicaría estos hallazgos. No obstante, teniendo en cuenta que el número de pacientes es pequeño y que el estudio no fue diseñado con ese propósito, este hallazgo ha de considerarse con cautela y precisa confirmación mediante estudios específicos, como se ha señalado previamente.
CAPÍTULO 8 126 En cuanto a los niveles de adiponectina en el TAS, también se asocian a la extensión de la enfermedad coronaria, aunque en menor medida que los niveles en el TAE. Obviamente, la expresión de adiponectina en el TAS contribuye de forma importante a los niveles plasmáticos de la hormona, pero el interés de los niveles de expresión de adiponectina en el TAE radica sobre todo en los efectos antiinflamatorios y antiaterogénicos locales que esta adipoquina puede ejercer directamente sobre las arterias coronarias. De este modo, se postula que pueden ser las acciones vasocrinas y paracrinas de la adiponectina sobre las arterias coronarias y el miocardio las que tengan mayor relevancia en la patogenia y fisiopatología de la enfermedad arterial coronaria. Por otra parte, cabe destacar de nuevo la relación que existe entre el volumen de TAE, los factores de riesgo cardiovascular y la propia aterosclerosis coronaria.193, 194, 211 El TAE no se asocia a la cantidad total de grasa corporal, sino que representa un marcador bastante preciso de la grasa visceral total, asociada en mayor medida al síndrome metabólico y a sus complicaciones cardiovasculares, entre ellas la enfermedad arterial coronaria. Así, el TAE podría ser una pieza clave en la relación existente entre los componentes del síndrome metabólico y la enfermedad arterial coronaria. Estudios recientes han mostrado que, en los pacientes con cardiopatía isquémica, los niveles plasmáticos de adiponectina elevados se asocian a un peor pronóstico cardiovascular,297 y que lo mismo ocurre en pacientes con arteriopatía periférica.92 Dado que la adiponectina ejerce efectos beneficiosos desde el punto de vista metabólico, es muy probable que esta asociación se deba a que, en estadios avanzados de la enfermedad, los niveles plasmáticos de adiponectina aumenten por un mecanismo de contrarregulación. En esta situación, las propiedades antiinflamatorias y antiaterogénicas de la hormona ya no serían suficientes para revertir la situación. Es posible que los niveles de expresión de adiponectina en el TAE tengan más importancia que las concentraciones plasmáticas como predictores del pronóstico cardiovascular, ya que podrían reflejar de forma más precisa los niveles locales de la adipoquina.
Discusión general 127 IMPLICACIONES DEL TAE A NIVEL SISTÉMICO Posiblemente, además de efectos locales, las adipoquinas secretadas por el TAE ejercen efectos sistémicos de gran relevancia. El TAE podría así encontrarse en el centro de una encrucijada que relaciona la obesidad –especialmente el patrón de obesidad central– y la patología que se asocia a ella, ya sea de índole marcadamente sistémica, como el síndrome metabólico, o principalmente local, como la enfermedad arterial coronaria. Por tanto, más allá de la asociación entre los niveles de adiponectina y de citoquinas proinflamatorias en el TAE y la enfermedad arterial coronaria, decidimos investigar la relación entre la expresión de adipoquinas en este tejido y otras enfermedades en las que su papel resultaba a priori menos aparente. Hipertensión arterial. El TAE se asocia a la cantidad total de masa miocitaria, y observaciones recientes mostraron también que los pacientes hipertensos presentan mayor cantidad de TAE medida por resonancia magnética.190, 302 Por otra parte, algunos estudios revelaron que los pacientes con hipertensión arterial presentan niveles plasmáticos de adiponectina menores que los no hipertensos.79 Los niveles plasmáticos bajos de adiponectina se asocian también a la hipertrofia ventricular izquierda, aunque es probable que la propia hipertensión arterial desempeñe un papel importante en esta asociación.82 Partiendo de estos estudios previos, decidimos estudiar si los pacientes con hipertensión arterial presentan niveles de adiponectina en el TAE distintos respecto a los pacientes no hipertensos (capítulo 4). Así, observamos que los pacientes con hipertensión arterial expresan menos adiponectina en el TAE que los no hipertensos, independientemente de otros factores que podrían influir en los niveles de expresión de la hormona. Por otro lado, comprobamos también que la expresión de adiponectina en TAS no se asocia a la hipertensión arterial. Esto concuerda con estudios previos que no hallaron diferencias en la expresión de adiponectina en el TAS en pacientes con o sin enfermedad cardiovascular, o incluso tras intervenciones terapéuticas para incrementar los niveles de adiponectina plasmática.248 No obstante, puesto que determinamos los niveles de expresión genética de adiponectina y no los niveles de proteína, pueden existir cambios postranscripcionales que regulen los niveles de adiponectina y que la implicación del TAS en la fisiopatología de la
CAPÍTULO 8 134 Aunque hay que tener en cuenta la heterogenicidad de la muestra incluida en nuestro estudio, los resultados se mantenían tras ajustar por la presencia de cardiopatía isquémica y por otras variables que podrían influir en la asociación de adiponectina con el pronóstico cardiovascular. Por otro lado, también es preciso reiterar que analizamos los niveles de expresión génica de adiponectina, y no los niveles de proteína. Si bien estos últimos podrían diferir respecto a los niveles de ARNm, todavía no existen estudios a este respecto y, a la luz de los conocimientos actuales, la hipótesis que describimos resulta más plausible. En cuanto a la leptina, no encontramos ninguna asociación entre sus niveles en el TAE o en el TAS y el pronóstico cardiovascular, en línea con observaciones previas que tampoco mostraron relación entre los niveles plasmáticos de la hormona y el pronóstico cardiovascular.115, 300 Realmente, los estudios diseñados para estudiar la asociación entre los niveles plasmáticos de leptina y la enfermedad cardiovascular han aportado resultados contradictorios, lo cual sugiere que la regulación de la leptina es muy compleja y concuerda con la gran diversidad de efectos biológicos que ejerce esta hormona.107 IMPLICACIONES CLÍNICAS El creciente interés por el estudio del tejido adiposo en los últimos años, tras el descubrimiento de sus propiedades secretoras, ha llevado a importantes avances en este campo. Los estudios sobre la expresión de adipoquinas en el TAE y su relación con diversas enfermedades, así como la investigación con técnicas de imagen cardiaca, nos están ayudando a comprender el papel crucial que el TAE puede desempeñar en la fisiopatología cardiovascular. En su conjunto, los resultados que presentamos sugieren que la función del TAE no se limita a servir como un simple depósito energético y como un sistema regulador de ácidos grasos libres para el metabolismo miocárdico, sino también como un auténtico órgano productor de citoquinas inflamatorias y de adipoquinas con efectos paracrinos, vasocrinos e incluso sistémicos. Estos hallazgos apoyan la hipótesis de que el TAE tiene mayor relevancia que el TAS en la fisiopatología cardiovascular y metabólica. Es probable que las diferencias entre el TAS y el tejido adiposo visceral conformen el sustrato fisiopatológico que explica la clásica asociación entre la obesidad central, el síndrome metabólico y el desarrollo de eventos cardiovasculares.
Discusión general 135 Así, por su proximidad a las arterias coronarias y al miocardio, el TAE podría ejercer efectos de extraordinaria importancia en el desarrollo de la aterosclerosis coronaria, pero también ser el nexo de unión entre los factores de riesgo cardiovascular y las enfermedades asociadas, e influir en el pronóstico cardiovascular. De esta forma, en el estudio del TAE podría encontrarse la clave de la clásica asociación entre la obesidad central, el síndrome metabólico y las enfermedades cardiovasculares. Por otra parte, nuestros resultados sugieren también que la adiponectina es una adipoquina con una gran influencia en la enfermedad cardiovascular y que sus efectos son generalmente beneficiosos. Observamos que los pacientes con mayor expresión de adiponectina en el TAE presentan mayor prevalencia de hipertensión arterial y de síndrome metabólico, y mayor prevalencia y severidad de enfermedad arterial coronaria. Aunque, por tratarse de estudios transversales, no era posible establecer una relación temporal entre los niveles de adiponectina y el desarrollo de la patología descrita, también llevamos a cabo un estudio prospectivo que mostró que los pacientes con menores niveles basales de expresión de adiponectina en el TAE presentan una mayor tasa de complicaciones cardiovasculares durante el seguimiento a largo plazo. Si bien estudios previos otorgaban un papel primordial a las citoquinas proinflamatorias, como TNF-α, en la fisiopatología cardiovascular, es posible que la adiponectina preceda al estado proinflamatorio. De esta forma, los individuos con obesidad central y mayor cantidad de tejido adiposo visceral presentarían menores niveles de adiponectina, lo cual conllevaría la sobreexpresión de otras citoquinas29 y el desarrollo de un estado proinflamatorio característico del síndrome metabólico. A nivel local, el déficit de adiponectina propiciaría la ateromatosis coronaria y explicaría la asociación entre el síndrome metabólico y la cardiopatía isquémica. El propio estado inflamatorio podría inducir la expresión de adiponectina en determinadas circunstancias, pero en estadios avanzados sus efectos antiinflamatorios y antiaterogénicos serían insuficientes para revertir la situación. Es probable que este fenómeno explique los similares niveles de expresión de adiponectina en el TAE de los sujetos diabéticos y no diabéticos, así como el peor pronóstico de los pacientes con cardiopatía isquémica e hiperadiponectinemia que reportan otros autores.297 El conocimiento de la fisiopatología del TAE nos permite especular acerca del beneficio de posibles estrategias terapéuticas encaminadas fundamentalmente a estimular la síntesis de
CAPÍTULO 8 136 adiponectina en determinados pacientes con elevado riesgo metabólico y cardiovascular. El ejercicio físico y la pérdida de peso han demostrado disminuir la cantidad de TAE, pero hoy día todavía no disponemos de un tratamiento farmacológico eficaz. Los agonistas PPAR-γ, como las tiazolidinedionas, y algunos betabloqueantes y bloqueantes de los receptores de angiotensina pueden ser útiles para incrementar la adiponectinemia,96, 97, 101, 106 pero o bien sus efectos adversos superan el beneficio que pueden aportar, o sus beneficios en este contexto clínico todavía se desconocen. PERSPECTIVAS FUTURAS El interés que ha despertado el estudio del TAE, junto con los alentadores resultados de los trabajos más recientes y su potencial como diana terapéutica del síndrome metabólico y de las enfermedades cardiovasculares, continuarán motivando el estudio intensivo de este tejido en los próximos años. Entre los campos que merecerán mayor atención se encuentran los siguientes: -Particularidades del TAE en comparación con otros compartimentos de tejido adiposo visceral, y del propio TAE en distintas localizaciones. -Metabolismo de la adiponectina e implicación fisiopatológica de las distintas formas de la hormona (monómeros, trímeros, etc.). Estudio de posibles cambios postranscripcionales y su trascendencia. -Efectos biológicos de las distintas adipoquinas y citoquinas, e interrelación entre ellas. -Estrategias terapéuticas dirigidas a mejorar el perfil metabólico y a prevenir los eventos cardiovasculares, mediante intervención directa sobre el TAE. No cabe duda de que todavía quedan muchos aspectos por esclarecer hasta llegar a comprender por completo la compleja interrelación entre las adipoquinas expresadas en el TAE y su implicación exacta en el desarrollo de las enfermedades cardiovasculares. No obstante, el estudio de este tejido arrojará probablemente mucha luz al conocimiento fisiopatológico, y abrirá nuevas alternativas de prevención integral de los factores de riesgo cardiovascular y de tratamiento de la patología cardiovascular y metabólica.
Conclusiones 137 CAPÍTULO 9 CONCLUSIONES Conclusión 1: Al contrario de lo que ocurre en el TAS, el tamaño de los adipocitos en el TAE no se asocia al IMC y se correlaciona inversamente con los niveles de expresión de MCP-1. No se ha observado asociación entre los niveles de expresión de TNF-α y de IL-10 y el tamaño de los adipocitos en el TAE ni en el TAS. Es probable que los mecanismos de hipertrofia adipocitaria y la regulación de MCP-1 sean distintos en el TAE y en el TAS. Conclusión 2: Los pacientes con mayor extensión de la enfermedad arterial coronaria expresan niveles bajos de mRNA de adiponectina y niveles elevados de mRNA de IL-6 en el TAE. Sin embargo, no existen diferencias significativas en cuanto a los niveles de expresión de adiponectina ni de IL-6 en el TAS. El TAE podría tener una implicación directa en la fisiopatología de la enfermedad arterial coronaria. Conclusión 3: Los pacientes con hipertensión arterial presentan niveles bajos de expresión de adiponectina en el TAE y similares niveles de expresión de adiponectina en el TAS respecto a los no hipertensos, independientemente de otros factores. Este hallazgo podría explicar en parte la relación entre la hipertensión arterial y la obesidad central. Conclusión 4: Los niveles de expresión de adiponectina y leptina en el TAE y el TAS son similares en los pacientes con diabetes mellitus tipo 2 respecto a los no diabéticos. Este hallazgo podría deberse a un fenómeno de contrarregulación, o bien a otros mecanismos todavía no dilucidados. Conclusión 5: Los pacientes con síndrome metabólico presentan menores niveles de mRNA en el TAE que los sujetos sin síndrome metabólico, mientras que los niveles
CAPÍTULO 9 138 en el TAS no difieren entre ambos grupos. Los pacientes con niveles bajos de expresión de adiponectina en el TAE presentan un mayor número de los componentes que definen el síndrome metabólico. El TAE puede ser uno de los nexos entre el síndrome metabólico y sus complicaciones cardiovasculares. Conclusión 6: Los pacientes con menores niveles de expresión de adiponectina en el TAE y en el TAS presentan más eventos cardiovasculares durante el seguimiento a largo plazo. Los niveles de adiponectina en el TAE y la insuficiencia cardiaca son predictores independientes del pronóstico cardiovascular tras la cirugía cardiaca. Sin embargo, no se ha encontrado asociación entre la expresión de leptina en el tejido adiposo y el pronóstico cardiovascular, ni entre la expresión de adiponectina y leptina y la mortalidad por cualquier causa durante el seguimiento.
Bibliografía 139 BIBLIOGRAFÍA 1. Ahima RS, Flier JS. Adipose tissue as an endocrine organ. Trends Endocrinol Metab. 2000;11:327-332 2. Kershaw EE, Flier JS. Adipose tissue as an endocrine organ. J Clin Endocrinol Metab. 2004;89:2548-2556 3. Frayn KN, Karpe F, Fielding BA, Macdonald IA, Coppack SW. Integrative physiology of human adipose tissue. Int J Obes Relat Metab Disord. 2003;27:875-888 4. Leow MK, Addy CL, Mantzoros CS. Clinical review 159: Human immunodeficiency virus/highly active antiretroviral therapy-associated metabolic syndrome: Clinical presentation, pathophysiology, and therapeutic strategies. J Clin Endocrinol Metab. 2003;88:1961-1976 5. Cornier MA, Dabelea D, Hernandez TL, Lindstrom RC, Steig AJ, Stob NR, Van Pelt RE, Wang H, Eckel RH. The metabolic syndrome. Endocr Rev. 2008;29:777-822 6. Dusserre E, Moulin P, Vidal H. Differences in mrna expression of the proteins secreted by the adipocytes in human subcutaneous and visceral adipose tissues. Biochim Biophys Acta. 2000;1500:88-96 7. Third report of the national cholesterol education program (ncep) expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (adult treatment panel iii) final report. Circulation. 2002;106:3143-3421 8. Mazurek T, Zhang L, Zalewski A, Mannion JD, Diehl JT, Arafat H, Sarov-Blat L, O'Brien S, Keiper EA, Johnson AG, Martin J, Goldstein BJ, Shi Y. Human epicardial adipose tissue is a source of inflammatory mediators. Circulation. 2003;108:24602466 9. Iacobellis G, Corradi D, Sharma AM. Epicardial adipose tissue: Anatomic, biomolecular and clinical relationships with the heart. Nat Clin Pract Cardiovasc Med. 2005;2:536-543 10. Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expression of tumor necrosis factor-alpha: Direct role in obesity-linked insulin resistance. Science. 1993;259:87-91 11. Kern PA, Saghizadeh M, Ong JM, Bosch RJ, Deem R, Simsolo RB. The expression of tumor necrosis factor in human adipose tissue. Regulation by obesity, weight loss, and relationship to lipoprotein lipase. J Clin Invest. 1995;95:2111-2119 12. Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante AW, Jr. Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest. 2003;112:1796-1808 13. Wellen KE, Hotamisligil GS. Obesity-induced inflammatory changes in adipose tissue. J Clin Invest. 2003;112:1785-1788 14. Lumeng CN, Bodzin JL, Saltiel AR. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J Clin Invest. 2007;117:175-184 15. Di Gregorio GB, Yao-Borengasser A, Rasouli N, Varma V, Lu T, Miles LM, Ranganathan G, Peterson CA, McGehee RE, Kern PA. Expression of cd68 and
Bibliografía 140 macrophage chemoattractant protein-1 genes in human adipose and muscle tissues: Association with cytokine expression, insulin resistance, and reduction by pioglitazone. Diabetes. 2005;54:2305-2313 16. Cinti S, Mitchell G, Barbatelli G, Murano I, Ceresi E, Faloia E, Wang S, Fortier M, Greenberg AS, Obin MS. Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans. J Lipid Res. 2005;46:2347-2355 17. Strissel KJ, Stancheva Z, Miyoshi H, Perfield JW, 2nd, DeFuria J, Jick Z, Greenberg AS, Obin MS. Adipocyte death, adipose tissue remodeling, and obesity complications. Diabetes. 2007;56:2910-2918 18. Trayhurn P, Wood IS. Adipokines: Inflammation and the pleiotropic role of white adipose tissue. Br J Nutr. 2004;92:347-355 19. Hosogai N, Fukuhara A, Oshima K, Miyata Y, Tanaka S, Segawa K, Furukawa S, Tochino Y, Komuro R, Matsuda M, Shimomura I. Adipose tissue hypoxia in obesity and its impact on adipocytokine dysregulation. Diabetes. 2007;56:901-911 20. Kim JY, van de Wall E, Laplante M, Azzara A, Trujillo ME, Hofmann SM, Schraw T, Durand JL, Li H, Li G, Jelicks LA, Mehler MF, Hui DY, Deshaies Y, Shulman GI, Schwartz GJ, Scherer PE. Obesity-associated improvements in metabolic profile through expansion of adipose tissue. J Clin Invest. 2007;117:2621-2637 21. Agarwal AK, Garg A. Genetic disorders of adipose tissue development, differentiation, and death. Annu Rev Genomics Hum Genet. 2006;7:175-199 22. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF. A novel serum protein similar to c1q, produced exclusively in adipocytes. J Biol Chem. 1995;270:2674626749 23. Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, Hotta K, Shimomura I, Nakamura T, Miyaoka K, Kuriyama H, Nishida M, Yamashita S, Okubo K, Matsubara K, Muraguchi M, Ohmoto Y, Funahashi T, Matsuzawa Y. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun. 1999;257:79-83 24. Maeda K, Okubo K, Shimomura I, Funahashi T, Matsuzawa Y, Matsubara K. Cdna cloning and expression of a novel adipose specific collagen-like factor, apm1 (adipose most abundant gene transcript 1). Biochem Biophys Res Commun. 1996;221:286-289 25. Kishida K, Nagaretani H, Kondo H, Kobayashi H, Tanaka S, Maeda N, Nagasawa A, Hibuse T, Ohashi K, Kumada M, Nishizawa H, Okamoto Y, Ouchi N, Maeda K, Kihara S, Funahashi T, Matsuzawa Y. Disturbed secretion of mutant adiponectin associated with the metabolic syndrome. Biochem Biophys Res Commun. 2003;306:286292 26. Pajvani UB, Du X, Combs TP, Berg AH, Rajala MW, Schulthess T, Engel J, Brownlee M, Scherer PE. Structure-function studies of the adipocyte-secreted hormone acrp30/adiponectin. Implications fpr metabolic regulation and bioactivity. J Biol Chem. 2003;278:9073-9085 27. Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, Bihain BE, Lodish HF. Proteolytic cleavage product of 30-kda adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci U S A. 2001;98:2005-2010
Bibliografía 141 28. Motoshima H, Wu X, Sinha MK, Hardy VE, Rosato EL, Barbot DJ, Rosato FE, Goldstein BJ. Differential regulation of adiponectin secretion from cultured human omental and subcutaneous adipocytes: Effects of insulin and rosiglitazone. J Clin Endocrinol Metab. 2002;87:5662-5667 29. Maeda N, Takahashi M, Funahashi T, Kihara S, Nishizawa H, Kishida K, Nagaretani H, Matsuda M, Komuro R, Ouchi N, Kuriyama H, Hotta K, Nakamura T, Shimomura I, Matsuzawa Y. Ppargamma ligands increase expression and plasma concentrations of adiponectin, an adipose-derived protein. Diabetes. 2001;50:20942099 30. Han SH, Quon MJ, Kim JA, Koh KK. Adiponectin and cardiovascular disease: Response to therapeutic interventions. J Am Coll Cardiol. 2007;49:531-538 31. Yang WS, Lee WJ, Funahashi T, Tanaka S, Matsuzawa Y, Chao CL, Chen CL, Tai TY, Chuang LM. Weight reduction increases plasma levels of an adipose-derived antiinflammatory protein, adiponectin. J Clin Endocrinol Metab. 2001;86:3815-3819 32. Ouchi N, Kihara S, Arita Y, Nishida M, Matsuyama A, Okamoto Y, Ishigami M, Kuriyama H, Kishida K, Nishizawa H, Hotta K, Muraguchi M, Ohmoto Y, Yamashita S, Funahashi T, Matsuzawa Y. Adipocyte-derived plasma protein, adiponectin, suppresses lipid accumulation and class a scavenger receptor expression in human monocyte-derived macrophages. Circulation. 2001;103:1057-1063 33. Berg AH, Combs TP, Scherer PE. Acrp30/adiponectin: An adipokine regulating glucose and lipid metabolism. Trends Endocrinol Metab. 2002;13:84-89 34. Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, Mori Y, Ide T, Murakami K, Tsuboyama-Kasaoka N, Ezaki O, Akanuma Y, Gavrilova O, Vinson C, Reitman ML, Kagechika H, Shudo K, Yoda M, Nakano Y, Tobe K, Nagai R, Kimura S, Tomita M, Froguel P, Kadowaki T. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med. 2001;7:941946 35. Nakamura Y, Shimada K, Fukuda D, Shimada Y, Ehara S, Hirose M, Kataoka T, Kamimori K, Shimodozono S, Kobayashi Y, Yoshiyama M, Takeuchi K, Yoshikawa J. Implications of plasma concentrations of adiponectin in patients with coronary artery disease. Heart. 2004;90:528-533 36. Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S, Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K, Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature. 2003;423:762-769 37. Kharroubi I, Rasschaert J, Eizirik DL, Cnop M. Expression of adiponectin receptors in pancreatic beta cells. Biochem Biophys Res Commun. 2003;312:1118-1122 38. Chinetti G, Zawadski C, Fruchart JC, Staels B. Expression of adiponectin receptors in human macrophages and regulation by agonists of the nuclear receptors pparalpha, ppargamma, and lxr. Biochem Biophys Res Commun. 2004;314:151-158 39. Berg AH, Combs TP, Du X, Brownlee M, Scherer PE. The adipocyte-secreted protein acrp30 enhances hepatic insulin action. Nat Med. 2001;7:947-953
Bibliografía 142 40. Fasshauer M, Klein J, Neumann S, Eszlinger M, Paschke R. Hormonal regulation of adiponectin gene expression in 3t3-l1 adipocytes. Biochem Biophys Res Commun. 2002;290:1084-1089 41. Okamoto Y, Arita Y, Nishida M, Muraguchi M, Ouchi N, Takahashi M, Igura T, Inui Y, Kihara S, Nakamura T, Yamashita S, Miyagawa J, Funahashi T, Matsuzawa Y. An adipocyte-derived plasma protein, adiponectin, adheres to injured vascular walls. Horm Metab Res. 2000;32:47-50 42. Shibata R, Ouchi N, Kihara S, Sato K, Funahashi T, Walsh K. Adiponectin stimulates angiogenesis in response to tissue ischemia through stimulation of amp-activated protein kinase signaling. J Biol Chem. 2004;279:28670-28674 43. Ouchi N, Kobayashi H, Kihara S, Kumada M, Sato K, Inoue T, Funahashi T, Walsh K. Adiponectin stimulates angiogenesis by promoting cross-talk between ampactivated protein kinase and akt signaling in endothelial cells. J Biol Chem. 2004;279:1304-1309 44. Kobayashi H, Ouchi N, Kihara S, Walsh K, Kumada M, Abe Y, Funahashi T, Matsuzawa Y. Selective suppression of endothelial cell apoptosis by the high molecular weight form of adiponectin. Circ Res. 2004;94:e27-31 45. Shibata R, Skurk C, Ouchi N, Galasso G, Kondo K, Ohashi T, Shimano M, Kihara S, Murohara T, Walsh K. Adiponectin promotes endothelial progenitor cell number and function. FEBS Lett. 2008;582:1607-1612 46. Ohashi K, Kihara S, Ouchi N, Kumada M, Fujita K, Hiuge A, Hibuse T, Ryo M, Nishizawa H, Maeda N, Maeda K, Shibata R, Walsh K, Funahashi T, Shimomura I. Adiponectin replenishment ameliorates obesity-related hypertension. Hypertension. 2006;47:1108-1116 47. Nishimura M, Izumiya Y, Higuchi A, Shibata R, Qiu J, Kudo C, Shin HK, Moskowitz MA, Ouchi N. Adiponectin prevents cerebral ischemic injury through endothelial nitric oxide synthase dependent mechanisms. Circulation. 2008;117:216-223 48. Okamoto Y, Kihara S, Ouchi N, Nishida M, Arita Y, Kumada M, Ohashi K, Sakai N, Shimomura I, Kobayashi H, Terasaka N, Inaba T, Funahashi T, Matsuzawa Y. Adiponectin reduces atherosclerosis in apolipoprotein e-deficient mice. Circulation. 2002;106:2767-2770 49. Ouchi N, Kihara S, Arita Y, Okamoto Y, Maeda K, Kuriyama H, Hotta K, Nishida M, Takahashi M, Muraguchi M, Ohmoto Y, Nakamura T, Yamashita S, Funahashi T, Matsuzawa Y. Adiponectin, an adipocyte-derived plasma protein, inhibits endothelial nf-kappab signaling through a camp-dependent pathway. Circulation. 2000;102:12961301 50. Kumada M, Kihara S, Ouchi N, Kobayashi H, Okamoto Y, Ohashi K, Maeda K, Nagaretani H, Kishida K, Maeda N, Nagasawa A, Funahashi T, Matsuzawa Y. Adiponectin specifically increased tissue inhibitor of metalloproteinase-1 through interleukin-10 expression in human macrophages. Circulation. 2004;109:2046-2049 51. Takemura Y, Ouchi N, Shibata R, Aprahamian T, Kirber MT, Summer RS, Kihara S, Walsh K. Adiponectin modulates inflammatory reactions via calreticulin receptordependent clearance of early apoptotic bodies. J Clin Invest. 2007;117:375-386
Bibliografía 143 52. Tao L, Gao E, Jiao X, Yuan Y, Li S, Christopher TA, Lopez BL, Koch W, Chan L, Goldstein BJ, Ma XL. Adiponectin cardioprotection after myocardial ischemia/reperfusion involves the reduction of oxidative/nitrative stress. Circulation. 2007;115:1408-1416 53. Shibata R, Sato K, Pimentel DR, Takemura Y, Kihara S, Ohashi K, Funahashi T, Ouchi N, Walsh K. Adiponectin protects against myocardial ischemia-reperfusion injury through ampkand cox-2-dependent mechanisms. Nat Med. 2005;11:10961103 54. Ouedraogo R, Wu X, Xu SQ, Fuchsel L, Motoshima H, Mahadev K, Hough K, Scalia R, Goldstein BJ. Adiponectin suppression of high-glucose-induced reactive oxygen species in vascular endothelial cells: Evidence for involvement of a camp signaling pathway. Diabetes. 2006;55:1840-1846 55. Shinmura K, Tamaki K, Saito K, Nakano Y, Tobe T, Bolli R. Cardioprotective effects of short-term caloric restriction are mediated by adiponectin via activation of ampactivated protein kinase. Circulation. 2007;116:2809-2817 56. Shibata R, Sato K, Kumada M, Izumiya Y, Sonoda M, Kihara S, Ouchi N, Walsh K. Adiponectin accumulates in myocardial tissue that has been damaged by ischemiareperfusion injury via leakage from the vascular compartment. Cardiovasc Res. 2007;74:471-479 57. Pineiro R, Iglesias MJ, Gallego R, Raghay K, Eiras S, Rubio J, Dieguez C, Gualillo O, Gonzalez-Juanatey JR, Lago F. Adiponectin is synthesized and secreted by human and murine cardiomyocytes. FEBS Lett. 2005;579:5163-5169 58. Skurk C, Wittchen F, Suckau L, Witt H, Noutsias M, Fechner H, Schultheiss HP, Poller W. Description of a local cardiac adiponectin system and its deregulation in dilated cardiomyopathy. Eur Heart J. 2008;29:1168-1180 59. Liao Y, Takashima S, Maeda N, Ouchi N, Komamura K, Shimomura I, Hori M, Matsuzawa Y, Funahashi T, Kitakaze M. Exacerbation of heart failure in adiponectindeficient mice due to impaired regulation of ampk and glucose metabolism. Cardiovasc Res. 2005;67:705-713 60. Shibata R, Ouchi N, Ito M, Kihara S, Shiojima I, Pimentel DR, Kumada M, Sato K, Schiekofer S, Ohashi K, Funahashi T, Colucci WS, Walsh K. Adiponectin-mediated modulation of hypertrophic signals in the heart. Nat Med. 2004;10:1384-1389 61. Fujita K, Maeda N, Sonoda M, Ohashi K, Hibuse T, Nishizawa H, Nishida M, Hiuge A, Kurata A, Kihara S, Shimomura I, Funahashi T. Adiponectin protects against angiotensin ii-induced cardiac fibrosis through activation of ppar-alpha. Arterioscler Thromb Vasc Biol. 2008;28:863-870 62. Fujioka D, Kawabata K, Saito Y, Kobayashi T, Nakamura T, Kodama Y, Takano H, Obata JE, Kitta Y, Umetani K, Kugiyama K. Role of adiponectin receptors in endothelin-induced cellular hypertrophy in cultured cardiomyocytes and their expression in infarcted heart. Am J Physiol Heart Circ Physiol. 2006;290:H2409-2416 63. Shibata R, Izumiya Y, Sato K, Papanicolaou K, Kihara S, Colucci WS, Sam F, Ouchi N, Walsh K. Adiponectin protects against the development of systolic dysfunction following myocardial infarction. J Mol Cell Cardiol. 2007;42:1065-1074