First isolation and further characterization of enteropathogenic Escherichia coli (EPEC) O157:H45 strains from cattle

BioMed Cen al Page 1 o 6 (page numbe no o ci a ion pu poses) BMC Mic obiology Open Access Resea ch a icle Fi s isola ion and u he cha ac e iza ion o en e opa hogenic Esche ichia coli (EPEC) O157:H45 s ains om ca le Roge S ephan*1, Nicole Bo el2, Claudio Zwei el1, Miguel Blanco3 and Jesús E Blanco3 Add ess: 1Ins i u e o Food Sa e y and Hygiene, Ve suisse Facul y, Uni e si y o Zu ich, 8057 Zu ich, Swi ze land, 2Ins i u e o Ve e ina y Pa hology, Ve suisse Facul y, Uni e si y o Zu ich, 8057 Zu ich, Swi ze land and 3Depa amen o de Mic obioloxía e Pa asi oloxía, Labo a o io de Re e encia de E. coli (LREC), Facul ade de Ve e ina ia, Uni e sidade de San iago de Compos ela (USC), 27002 Lugo, Spain Email: Roge S ephan* - s ephan @ sa e y.unizh.ch; Nicole Bo el - n.bo [email protected]; Claudio Zwei el - [email p o ec ed]zh.ch; Miguel Blanco - [email protected]; Jesús E Blanco - [email protected] * Co esponding au ho Abs ac Backg ound: En e opa hogenic Esche ichia coli (EPEC), mainly causing in an ile dia hoea, ep esen s one o a leas six di e en ca ego ies o dia heagenic E. coli wi h co esponding dis inc pa hogenic schemes. The mechanism o EPEC pa hogenesis is based on he abili y o in oduce he a aching-and-e acing (A/E) lesions and in ima e adhe ence o bac e ia o he in es inal epi helium. The ole and he epidemiology o non- adi ional en e opa hogenic E. coli se og oup s ains a e no well es ablished. E. coli O157:H45 EPEC s ains, howe e , a e desc ibed in associa ion wi h en e ocoli is and spo adic dia hea in human. Mo eo e , a la ge ou b eak associa ed wi h E. coli O157:H45 EPEC was epo ed in Japan in 1998. Du ing a p e ious s udy on he p e alence o E. coli O157 in heal hy ca le in Swi ze land, E. coli O157:H45 s ains o igina ing om 6 a ening ca le and 5 cows we e isola ed. In his s udy, pheno ypic and geno ypic cha ac e is ics o hese s ains a e desc ibed. Va ious i ulence ac o s (s x, eae, ehxA, as A, EAF plasmid, b p) o di e en ca ego ies o pa hogenic E. coli we e sc eened by di e en PCR sys ems. Mo eo e , he capabili y o he s ains o adhe e o cells was es ed on issue cul u e cells. Resul s: All 11 so bi ol-posi i e E. coli O157:H45 s ains es ed nega i e o he Shiga oxin genes (s x), bu we e posi i e o eae and we e he e o e conside ed as EPEC. All s ains ha bo ed eae sub ype α1. The gene encoding he hea -s able en e o oxin 1 (EAST1) was ound in 10 o he 11 s ains. None o he s ains, howe e , ca ied ehx A genes. The capabili y o he s ains o adhe e o cells was shown by 10 s ains ha bou ing b p gene by localized adhe ence pa e n on HEp-2 and Caco-2 cells. Conclusion: This s udy epo s he i s isola ion o ypical O157:H45 EPEC s ains om ca le. Fu he mo e, ou indings emphasize he ac ha E. coli wi h he O157 an igen a e no always STEC bu may belong o o he pa ho ypes. Ca le seem also o be a ese oi o O157:H45 EPEC s ains, which a e desc ibed in associa ion wi h human diseases. The e o e, hese s ains appea o play a ole as ood bo ne pa hogens and ha e o be conside ed and e alua ed in iew o ood sa e y aspec s. Published: 17 Ma ch 2004 BMC Mic obiology 2004, 4:10 Recei ed: 16 Janua y 2004 Accep ed: 17 Ma ch 2004 This a icle is a ailable om: h p://www.biomedcen al.com/1471-2180/4/10 © 2004 S ephan e al; licensee BioMed Cen al L d. This is an Open Access a icle: e ba im copying and edis ibu ion o his a icle a e pe mi ed in all media o any pu pose, p o ided his no ice is p ese ed along wi h he a icle's o iginal URL. BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10 Page 2 o 6 (page numbe no o ci a ion pu poses) Backg ound En e opa hogenic Esche ichia coli (EPEC), mainly causing in an ile dia hoea, ep esen s one o he a leas six di e - en ca ego ies o dia heagenic E. coli wi h co esponding dis inc pa hogenic schemes [1]. Mos o he EPEC s ains belong o a se ies o O an igenic g oups known as EPEC O se og oups: O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142 and O158. The main mechanism o EPEC pa hogenesis is he abili y o in oduce a aching-and-e acing (A/E) lesions on in es inal cells cha ac e ized by mic o illus des uc ion, in ima e adhe ence o s ains o he in es inal epi helium, pedes al o ma ion and agg ega ion o pola ized ac in a si es o bac e ial a achmen [2]. The gene ic de e minan s o he p oduc ion o A/E lesions a e loca ed on he locus o en e ocy e e acemen (LEE), a pa hogenici y island ha con ains he genes encoding in imin (eae), a ype III sec e ion sys em, a numbe o sec e ed p o eins (ESP) and he ansloca ed in imin ecep o (Ti ) [2]. Cha ac e iza ion o eae genes e ealed he exis ence o di e en eae a ian s. A p esen , 15 (α1, α2, β1, β2, γ1, γ2/θ, δ/κ, ε, ζ, η, ι, λ, µ, ν, ξ) gene ic a ian s o he eae gene ha e been iden i ied [3-7]. I is dis- cussed ha di e en in imins may be esponsible o di - e en hos - and issue cell opism [8,9]. In epi helial cul u e cells EPEC s ains p oduce cha ac e is ic adhe - ence pa e ns: (i) localized adhe ence (LA), whe e mic o- colonies a ach a e 3 hou s incuba ion o one o wo small a eas on he cells [10,11]; (ii) di use adhe ence (DA), whe e bac e ia co e he cells uni o mly [10]; (iii) en e oadhe en -agg ega i e adhe ence (AA), whe e he bac e ia ha e a cha ac e is ic s acked-b ick-like a ange- men [12] and (iiii) localized adhe ence-like adhe ence (LAL), cha ac e ized by o ma ion o less-compac mic o- colonies o clus e s o bac e ia han hose by LA [13]. Localized adhe ence is associa ed wi h he p esence o he la ge EPEC adhe ence ac o (EAF) plasmid, on which also he clus e o genes encoding bundle- o ming pili (BFP) is p esen [1]. EPEC a e classi ied as ypical, when possessing he EAF plasmid; whe eas a ypical EPEC s ains do no possess he EAF plasmid [14,15]. Typical and a ypical EPEC s ains usually belong o ce ain se o ype clus e s, di e in hei adhe ence pa e ns on cul- u ed epi helial cells ( ypical: LA; a ypical: DA; AA; LAL), a e ypically ound in di e en hos s ( ypical EPEC s ains ha e only been eco e ed om humans), and display di - e ence in hei in imin ypes [15]. The ole and he epidemiology o non- adi ional en e - opa hogenic E. coli se og oup s ains in human dia hea a e no well es ablished. E. coli O157:H8 and E. coli O157:H45 EPEC s ains ha e been desc ibed o be associ- a ed wi h dia hea in human [4,16]. Makino e al. [17] epo ed he i s la ge ou b eak wi h E. coli O157:H45 EPEC in Japan in 1998. Ne e heless, hese O157 EPEC s ains a e no well cha ac e ized. This s udy epo s he i s isola ion o O157:H45 EPEC s ains om ca le and pheno ypic and geno ypic cha ac- e is ics o he isola ed s ains a e desc ibed. Resul s and discussion All 11 so bi ol-posi i e E. coli O157:H45 s ains, six s ains isola ed om a ening ca le and i e s ains iso- la ed om cows es ed nega i e o Shiga oxin genes (s x). The eae gene, which is s ongly co ela ed o he a aching- and-e acing lesions, was p esen in all s ains. The e o e, hese s ains a e conside ed o be EPEC. Ou indings emphasize he ac ha E. coli wi h he O157 O an igen a e no always STEC bu may belong o o he pa ho ypes. Fu - he esul s o s ain cha ac e iza ion a e shown in Tab. 2. In all es ed s ains, LEE was inse ed in selC and hus hese s ains could be e olu iona ily mo e akin o he EPEC 1 and EHEC 1 clones han o o he clones [18]. Fu he cha ac e iza ion o he eae a ian s showed in all s ains eae sub ype α1. Oswald e al. [4] es ing in hei s udy he dis ibu ion o in imin ypes among di e en EPEC s ains, ound he same eae sub ype in O157:H45 s ains isola ed om human wi h dia hea. The gene encoding he hea -s able en e o oxin (EAST1), ep esen ing an addi ional de e minan in he pa hogene- sis o E. coli dia hea, was ound in en o he 11 s ains. None o he s ains, howe e , ca ied ehxA genes. Nine s ains we e posi i e o he EAF plasmid and 10 s ains ha bo ed he b pA gene encoding bundlin, he s uc u al subuni o he bundle- o ming pilus exp essed by ypical EPEC s ains. The EAF plasmid nega i e bu b pA posi i e s ain may ha e a de ec in he EAF egion ha does no in e e e wi h he plasmid's unc ion. All b pA gene posi i e s ains showed a localized adhe ence (LA) pa e n, he peno pyical cha ac e is ic associa ed wi h he exp ession o bundle- o ming pili and he e o e seem o be a ypical EPEC. Fo HEp-2 and Caco-2 cells simila esul s we e ob ained (Figu e 1, 2). Caco-2 cells ins ead o Hela cells we e used o adhesion assay and FAS es , because hey ep esen a sys em close o he human in es inal cells. Fu he mo e, Viei a e al. [19] ha e shown ha esul s ob ained by Caco-2 cells a e compa able o Hela cells. 10 o he 11 s ains showed an A/E p ope y wi h he lu- o escen ac in s aining (FAS) es (Figu e 3). BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10 Page 3 o 6 (page numbe no o ci a ion pu poses) Acco ding o Kape [14] mos o ou O157:H45 s ains ha e o be classi ied as ypical EPEC s ains, because hey a e possessing he EAF plasmid and a e showing he local- ized adhe ence (LA) pa e n. Howe e , hey a e ha bo ing as A genes, which is mo e common o a ypical EPEC s ains [15]. Fu he s udies a e needed o e alua e he ole o such EPEC s ains isola ed om asymp oma ic animals. Conclusions Ca le ha e no only o be conside ed as impo an asymp oma ic ca ie s o O157 STEC bu can also be a es- e oi o O157 EPEC s ains, which a e desc ibed in asso- cia ion wi h human diseases. These s ains appea o play a ole as ood bo ne pa hogens and ha e o be conside ed in iew o ood sa e y aspec s. Table 1: Sequences and p edic ed leng hs o PCR ampli ica ion p oduc s o oligonucleo ide p ime s used Ta ge P ime Oligonucleo ide sequence (5'-3')Sequence P oduc size Re e ence s x VT1 ATTGAGCAAAATAATTTATAT GTG 523 bp 21 VT2 TGATGATGGCAATTCAGTAT 520 bp eae SK1 CCCGAATTCCGCACAAGCATAAGC 863 bp 22 SK2 CCCGGATCCGTCTCGCCAGTATTCG eae-α1 EAE-FB AAAACCGCGGAGATGACTTC 820 bp 7 EAE-A CACTCTTCGCATCTTGAGCT eae-α2 IH2498aF AGACCTTAGGTACATTAAGTAAGC 517 bp 7 IH2498aR TCCTGAGAAGAGGGTAATC eae-β1 EA-B1-F CGCCACTTAATGCCAGCG 811 bp 7 EAE-B CTTGATACACCTGATGACTGT eae-β2 EA-B2-F CCCGCCACTTAATCGCACGT 807 bp 7 EAE-B CTTGATACACCTGATGACTGT eae-γ1 EAE-FB AAAACCGCGGAGATGACTTC 804 bp 7 EAE-C1 AGAACGCTGCTCACTAGATGTC eae-γ2/θEAE-FB AAAACCGCGGAGATGACTTC 808 bp 7 EAE-C2 CTGATATTTTATCAGCTTCA eae-δ/κEAE-FB AAAACCGCGGAGATGACTTC 833 bp 7 EAE-D CTTGATACACCCGATGGTAAC eae-εEAE-FB AAAACCGCGGAGATGACTTC 722 bp 7 LP5 AGCTCACTCGTAGATGACGGCAAGCG eae-ζZ1 GGTAAGCCGTTATCTGCC 206 bp 7 Z2 ATAGCAAGTGGGGTGAAG eae-ηEAE-FB AAAACCGCGGAGATGACTTC 712 bp 7 LP8 TAGATGACGGTAAGCGAC eae-ιEAE-FB AAAACCGCGGAGATGACTTC 807 bp 7 LP7 TTTATCCTGCTCCGTTTGCT eae-λ68.4F CGGTCAGCCTGTGAAGGGC 466 bp 7 68.4R ATAGATGCCTCTTCCGGTATT eae-µFV373F CAACGGTAAGTCTCAGACAC 443 bp 7 FV373R CATAATAAGCTTTTTGGCCTACC eae-νIH1229aF CACAGCTTACAATTGATAACA 311 bp 7 IH1229aR CTCACTATAAGTCATACGACT eae-ξEAE-FB AAAACCGCGGAGATGACTTC 468 bp 7 B49R ACCACCTTTAGCAGTCAATTTG ehxA HlyA1 GGTGCAGCAGAAAAAGTTGTAG 1551 bp 23 HlyA2 TCTCGCCTGATAGTGTTTGGTA as A EAST1 CCA TCA ACA CAG TAT ATC CGA 111 bp 24 EAST2 GGT CGC GAG TGA CGG CTT TGT EAF EAF1 CAG GGT AAA AGA AAG ATG ATA A 397 bp 25 EAF25 TAT GGG GAC CAT GTA TTA TCA b pA EP1 AAT GGT GCT TGC GCT TGC TGC 326 bp 26 EP2 GCC GCT TTA TCC AAC CTG GTA BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10 Page 4 o 6 (page numbe no o ci a ion pu poses) Me hods O igin o he E. coli s ains The s ains cha ac e ized in his wo k we e isola ed du ing a ecen s udy on p e alence o E. coli O157 in heal hy ca - le in Swi ze land [20]. The s udy was based on in es iga- ions ha we e ca ied ou wi hin he las one and a hal yea s (Janua y 2002 – June 2003) in wo EU-app o ed slaugh e houses. F om 2,930 bo ine ecal samples (1,183 Localized adhe ence (LA) pa e n o he E. coli O157:H45 s ain 1070/03 on HEp-2 cellsFigu e 1 Localized adhe ence (LA) pa e n o he E. coli O157:H45 s ain 1070/03 on HEp-2 cells. (a) 3 h assay, (b) 6 h assay Localized adhe ence (LA) pa e n o he E. coli O157:H45 s ain 1070/03 on Caco-2 cellsFigu e 2 Localized adhe ence (LA) pa e n o he E. coli O157:H45 s ain 1070/03 on Caco-2 cells. (a) 3 h assay, (b) 6 h assay a b a b BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10 Page 5 o 6 (page numbe no o ci a ion pu poses) cal es, 1,201 a ening ca le and 546 cows), 11 so bi ol- e men ing E. coli O157:H45 s ains ( om 6 a ening ca - le and 5 cows) we e isola ed. The de e mina ion o he O and H an igens was pe o med as p e iously desc ibed using all a ailable O (O1 o O181) and H (H1 o H56) an ise a [6]. Geno ypic cha ac e iza ion o he O157:H45 s ains PCR o he de ec ion o pu a i e i ulence genes we e pe - o med in a T3 he mocycle (Biome a, Ge many). PCR eagen s we e pu chased om PROMEGA (Madison, Wis.) and p ime s we e syn hesized by MICROSYNTH (Balgach, Swi ze land). The 50-µl PCR mix u es no mally consis ed o 2 µl o bac e ial suspension in 42 µl o dou- ble-dis illed wa e , 5 µl o 10- old-concen a ed polyme ase syn hesis bu e con aining 2.0 mM MgCl2, 200 µM (each) desoxynucleosid iphospha e (dNTP), 30 pmol o each p ime and 2.5 U o Taq DNA polyme ase. The PCR p ime s, a ge sequences and p oduc sizes a e lis ed in Table 1. Di e ences in he no mal PCR mix u e and cycling condi ions o each PCR we e p e iously desc ibed in he ci ed li e a u e. To e i y whe he LEE was inse ed downs eam o he selC locus, PCR eac ions ha ampli y he junc ions o his locus wi h he E. coli ch omosome we e pe o med acco ding o Spe andio e al. [27]. P ime s K255 (5'- GGTTGAGTCGATTGATCTCTGG-3') and K260 (5'- GAGCGAATATTCCGATATCTGGTT-3') we e used o he igh junc ion; K296 (5'-CATTCTGAAACAAACTGCTC-3') and K295 (5'-CGCCGATTTTTCTTAGCCCA-3') o he le junc ion, and K261 (5'-CCTGCAAATAAACACGGCGCAT- 3') and K260 o he in ac selC gene. Adhesion assay and FAS es E. coli colonies we e cha ac e ized by he pa e n o adhe - ence o HEp-2 and Caco-2 cells as desc ibed by Ka ch e al. [28] wi h mino modi ica ions. B ie ly, HEp-2 and Caco- 2 cells we e g own o 48 h wi h 5% CO2 on s e ilized co e slips (13 mm diame e ; Bibby S e ilin™ L d., S one, England) in 24-well la -bo om issue cul u e pla es wi h low e apo a ion lid (16 mm diame e ; BD Falcon™, Bed- o d, USA) con aining Minimum essen ial medium (MEM wi h Ea le's sal s, 25 mM HEPES, wi hou L- Glu amine;GIBCO™ In i ogen AG, Basel, Swi ze land) supplemen ed wi h e al cal se um (FCS, 10%, Bio Con- cep ™, Allschwil, Swi ze land), MEM Non Essen ial Amino Acids (MEM NEAA (100x) wi hou L-Glu amine, GIBCO™ In i ogen AG, Basel, Swi ze land) and Glu aMAX™I Supplemen 200 mM (100x), (GIBCO™ In - i ogen AG, Basel, Swi ze land). Bac e ia used o he adhesion assay we e g own o e nigh in LB-b o h Mille (Bec on Dickinson, Ma yland, USA). P io o incuba ion, he con luen cells we e washed wo imes wi h Dul- becco's phospa e bu e ed saline (D-PBS (1x) wi hou Cal- cium and Magnesium, GIBCO™ In i ogen AG, Basel, Swi ze land). E. coli dilu ed 1:100 in 1 ml esh media (MEM wi h supplemen s) was added o he cells and was incuba ed o 3 h a 37°C and 5% CO2. A e his incuba- ion pe iod, monolaye s we e washed i e imes wi h D- PBS (3 h assay) o monolaye s we e washed en imes wi h D-PBS, esh media (MEM wi h supplemen s) was added and an addi ional incuba ion pe iod o 3 h p oceeded (6h assay). Subsequen ly, he monolaye s we e washed i e imes wi h D-PBS and he cells we e ixed o 10 min wi h 4 Me hanol. A e he s aining wi h May-G ünwald- Giemsa (Fluka™, Buchs SG, Swi ze land), he co e slips we e examined by ligh mic oscopy o de e mine he adhe ence pa e ns o he s ains. The ollowing luo escen ac in-s aining (FAS) es was pe o med on Caco-2 cells acco ding o Ka ch e al. [28] wi h mino modi ica ions. The cells we e ixed wi h 4% o maldehyde in D-PBS, hen washed h ee imes wi h D- Ac in luo escence mic og aph showing E. coli O157:H45 s ain 1070/03-in ec ed Caco-2 cellsFigu e 3 Ac in luo escence mic og aph showing E. coli O157:H45 s ain 1070/03-in ec ed Caco-2 cells Table 2: Cha ac e iza ion esul s o 11 so bi ol- e men ing O157:H45 EPEC s ains isola ed om ca le in Swi ze land No. o s ains LEE in selC In imin ype EAF Plasmid b p Adhe ence pa e n as Aehx 9yesα1+ +LA +- 1yesα1- +LA +- 1yesα1- -NA -- LA: localized adhe ence; NA: no adhe ence BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10 Page 6 o 6 (page numbe no o ci a ion pu poses) PBS and incuba ed o 5 min wi h 0.1% T i on X-100 (Fluka™, Buchs SG, Swi ze land) in D-PBS. A e ano he h ee washes wi h D-PBS, he monolaye s we e incuba ed wi h 5 µg/ml o luo escein iso hiocyana e labelled pha- loidin (Sigma, S einheim, Ge many) o 30 min. A e ano he h ee washes wi h D-PBS, he co e slips we e examined by luo escence mic oscopy (Leica ™). Au ho s' con ibu ions RS isola ed he s ains and d a ed he manusc ip , CZ was esponsible o u he s ain cha ac e iza ion, NB pe - o med adhesion assays and FAS es s, MB pe o med he PCR yping o eae genes and JE has done se o yping o he s ains. All au ho s ead, commen ed on and app o ed o he inal manusc ip . Acknowledgemen s We hank Sand a Schumache and Ca men Kaise o he excellen echni- cal assis ance. This s udy was pa ly suppo ed by a g an om he Fondo de In es igación Sani a ia (FIS G03/025-COLIRED-O157). Re e ences 1. Na a o JP, Kape JB: Dia heagenic Esche ichia coli. Clin Mic obiol Re 1998, 11:142-201. 2. F anke G, Phillips AD, Rosenshine I, Dougan G, Kape JB, Knu on S: En e opa hogenic and en e ohaemo hagic Esche ichia coli: mo e sub e si e elemen s. Mol Mic obiol 1998, 30:911-921. 3. Adu-Bobie J, F ankel G, Bain C, Goncal es AG, T abulsi LR, Douce G, Knu on S, Dougan G: De ec ion o in imins alpha, be a, gamma, and del a, ou in imin de i a i es exp essed by a aching and e acing mic obial pa hogens. J Clin Mic obiol 1998, 36:662-668. 4. Oswald E, Schmid H, Mo abi o S, Ka ch H, Ma ches O, Cap ioli A: Typing o in imin genes in human and animal en e ohemo - hagic and en e opa hogenic Esche ichia coli: cha ac e iza- ion o a new in imin a ian . In ec Immun 2000, 68:64-71. 5. Zhang WL, Kohle B, Oswald E, Beu in L, Ka ch H, Mo abi o S, Cap- ioli A, Sue baum S, Schmid H: Gene ic di e si y o in imin genes o a aching and e acing Esche ichia coli s ains. J Clin Mic obiol 2002, 40:4486-4492. 6. Blanco M, Blanco JE, Mo a A, Rey J, Alonso JM, He moso M, He moso J, Alonso MP, Dahbi G, González EA, Be ná dez MI, Blanco J: Se o- ypes, i ulence genes and in imin ypes o Shiga oxin (Ve o oxin)-p oducing Esche ichia coli isola es om heal hy sheep in Spain. J Clin Mic obiol 2003, 41:1351-1356. 7. Blanco M, Blanco JE, Mo a A, Dahbi G, Alonso MP, González EA, Be ná dez MI, Blanco J: Se o ypes, i ulence genes and in imin ypes o Shiga oxin (Ve o oxin)-p oducing Esche ichia coli isola es om ca le in Spain: iden i ica ion o a new in imin a ian gene (eae-xi). J Clin Mic obiol 2004, 42:645-651. 8. Jo es J, Zehmke K, Eichbe g J, Rume L, Wiele LH: Desc ip ion o a no el in imin a ian ( ype ze a) in he bo ine O84:NM e o oxin-p oducing Esche ichia coli s ain 537/89 and he diagnos ic alue o in imin yping. Exp Biol Med (Maywood). 2003, 228:370-376. 9. Pié a d D, Muylde mans G, Mo iau L, S e ens D, Lauwe s S: Iden i- ica ion o new e ocy o oxin ype 2 a ian B-subuni genes in human and animal Esche ichia coli isola es. J Clin Mic obiol 1998, 36:3317-3322. 10. Scale sky IC, Sil a ML, T abulsi LR: Dis inc i e pa e ns o adhe - ence o en e opa hogenic Esche ichia coli o HeLa cells. In ec Immun 1984, 45:534-536. 11. Knu on S, Shaw RK, Anan ha RP, Donnenbe g MS, Zo gani AA: The ype IV bundle- o ming pilus o en e opa hogenic Esche ichia coli unde goes d ama ic al e a ions in s uc u e associa ed wi h bac e ial adhe ence, agg ega ion and dispe sal. Mol Mic obiol 1999, 33:499-509. 12. Na a o JP, Kape JB, Robins-B owne R, P ado V, Vial P, Le ine MM: Pa e ns o adhe ence o dia heagenic Esche ichia coli o HEp-2 cells. Paedia In ec Dis J 1987, 6:829-831. 13. Scale sky IC, Pelayo JS, Gi aldi R, Rod igues J, Ped oso MZ, T abulsi LR: EPEC adhe ence o Hep-2 cells. Re Mic obiol 1996, 27:58-62. 14. Kape JB: De ining EPEC. Re Mic obiol 1996, 27:130-133. 15. T abulsi LR, Kelle R, Ta delli Gomes TA: Typical and a ypical en e opa hogenic Esche ichia coli. Eme g In ec Dis 2002, 8:508-513. 16. Sco land SM, Willshaw GA, Cheas y T, Rowe B: S ains o Esche ichia coli O157:H8 om human dia hea belong o a aching and e acing class o E. coli. J Clin Pa hol 1992, 45:1075-1078. 17. Makino S, Asaku a H, Shi aha a T, Ikeda T, Takeshi K, A ai K, Nagasawa M, Abe T, Sadamo o T: Molecula epidemiological s udy o a mass ou b eak caused by en e opa hogenic Esche ichia coli O157:H45. Mic obiol Immunol 1999, 43:381-384. 18. Wiele LH, McDaniel TK, Whi am TS, Kape JB: Inse ion si e o he locus o en e ocy e e acemen in en e opa hogenic and en e ohemo hagic Esche ichia coli di e s in ela ion o he clonal phylogeny o he s ains. FEMS Mic obiol Le 1997, 156:49-53. 19. Viei a M, And ale J, T abulsi L, Rosa A, Dias A, Ramos S, F ankel G, Gomes TA: Pheno ypic and geno ypic cha ac e is ics o Esche ichia coli s ains o non-en e opa hogenic E. coli (EPEC) se og oups ha ca y eae and lack he EPEC adhe - ence ac o and Shiga oxin DNA p obe sequences. J In ec Dis 2001, 183:762-772. 20. Al-Saigh H, Zwei el C, Blanco J, Blanco JE, Blanco M, Use a MA, S ephan R: Fecal shedding o Esche ichia coli O157, Salmonella spp. and Campylobac e spp. in Swiss ca le a slaugh e . J Food P o ec in p ess. 21. Bu nens AP, F ey A, Lio H, Nicole J: P e alence and clinical sig- ni icance o e o-cy o oxin-p oducing Esche ichia coli (VTEC) isola ed om ca le in he ds wi h and wi hou cal dia hoea. Zen albl Ve e ina med B 1995, 42:311-318. 22. Schmid H, Plaschke B, F anke S, Rüssmann H, Schwa zkop A, Heese- mann J, Ka ch H: Di e en ia ion in i ulence pa e ns o Esche ichia coli possessing eae-genes. Med Mic obiol Immunol 1994, 183:23-31. 23. Schmid H, Beu in L, Ka ch H: Molecula analysis o he plasmid- encoded hemolysin o Esche ichia coli O157:H7 s ain EDL 933. In ec Immun 1995, 63:1055-1061. 24. Yamamo o T, Nakazawa M: De ec ion and sequences o he en e oagg ega i e Esche ichia coli hea -s able en e o oxin 1 gene in en e o oxigenic E. coli s ains isola ed om pigle s and cal es wi h dia hea. J Clin Mic obiol 1997, 35:223-227. 25. F anke J, G anke S, Schmid H, Schwa zkop A, Wiele LH, Balje G, Beu in L, Ka ch H: Nucled ide sequence analysis o en e opa h- ogenic Esche ichia coli (EPEC) adhe ence ac o p obe and de elopmen o PCR o apid de ec ion o EPEC ha bou ing i ulence plasmids. J Clin Mic obiol 1994, 32:2460-2463. 26. Gunzbu g ST, To niepo h NG, Riley LW: Iden i ica ion o en e - opa hogenic Esche ichia coli by PCR-based de ec ion o he bundle- o ming pilus gene. J Clin Mic obiol 1995, 33:1375-1377. 27. Spe andio V, Kape JB, Bo olini MR, Ne ez BC, Kelle R, T abulsi LR: Cha ac e iza ion o he locus o en e ocy e e acemen (LEE) in di e en en e opa hogenic Esche ichia coli (EPEC) and shiga oxin p oducing Esche ichia coli (STEC) se o ypes. FEMS Mic obiol Le 1998, 164:133-139. 28. Ka ch H, Böhm H, Schmid H, Gunze F, Aleksic S, Heesemann J: Clonal s uc u e and pa hogenici y o shiga-like oxin-p o- ducing, so bi ol- e men ing Esche ichia coli O157:H-. J Clin Mic obiol 1993, 31:1200-1205.