BioMed Cen al
Page 1 o 6
(page numbe no o ci a ion pu poses)
BMC Mic obiology
Open Access
Resea ch a icle
Fi s isola ion and u he cha ac e iza ion o en e opa hogenic
Esche ichia coli (EPEC) O157:H45 s ains om ca le
Roge S ephan*1, Nicole Bo el2, Claudio Zwei el1, Miguel Blanco3 and
Jesús E Blanco3
Add ess: 1Ins i u e o Food Sa e y and Hygiene, Ve suisse Facul y, Uni e si y o Zu ich, 8057 Zu ich, Swi ze land, 2Ins i u e o Ve e ina y
Pa hology, Ve suisse Facul y, Uni e si y o Zu ich, 8057 Zu ich, Swi ze land and 3Depa amen o de Mic obioloxía e Pa asi oloxía, Labo a o io de
Re e encia de E. coli (LREC), Facul ade de Ve e ina ia, Uni e sidade de San iago de Compos ela (USC), 27002 Lugo, Spain
Email: Roge S ephan* - s ephan @ sa e y.unizh.ch; Nicole Bo el - n.bo
[email protected]; Claudio Zwei el - [email p o ec ed]zh.ch;
Miguel Blanco -
[email protected]; Jesús E Blanco -
[email protected]
* Co esponding au ho
Abs ac
Backg ound: En e opa hogenic Esche ichia coli (EPEC), mainly causing in an ile dia hoea,
ep esen s one o a leas six di e en ca ego ies o dia heagenic E. coli wi h co esponding dis inc
pa hogenic schemes. The mechanism o EPEC pa hogenesis is based on he abili y o in oduce he
a aching-and-e acing (A/E) lesions and in ima e adhe ence o bac e ia o he in es inal epi helium.
The ole and he epidemiology o non- adi ional en e opa hogenic E. coli se og oup s ains a e no
well es ablished. E. coli O157:H45 EPEC s ains, howe e , a e desc ibed in associa ion wi h
en e ocoli is and spo adic dia hea in human. Mo eo e , a la ge ou b eak associa ed wi h E. coli
O157:H45 EPEC was epo ed in Japan in 1998. Du ing a p e ious s udy on he p e alence o E.
coli O157 in heal hy ca le in Swi ze land, E. coli O157:H45 s ains o igina ing om 6 a ening ca le
and 5 cows we e isola ed. In his s udy, pheno ypic and geno ypic cha ac e is ics o hese s ains
a e desc ibed. Va ious i ulence ac o s (s x, eae, ehxA, as A, EAF plasmid, b p) o di e en
ca ego ies o pa hogenic E. coli we e sc eened by di e en PCR sys ems. Mo eo e , he capabili y
o he s ains o adhe e o cells was es ed on issue cul u e cells.
Resul s: All 11 so bi ol-posi i e E. coli O157:H45 s ains es ed nega i e o he Shiga oxin genes
(s x), bu we e posi i e o eae and we e he e o e conside ed as EPEC. All s ains ha bo ed eae
sub ype α1. The gene encoding he hea -s able en e o oxin 1 (EAST1) was ound in 10 o he 11
s ains. None o he s ains, howe e , ca ied ehx A genes. The capabili y o he s ains o adhe e
o cells was shown by 10 s ains ha bou ing b p gene by localized adhe ence pa e n on HEp-2 and
Caco-2 cells.
Conclusion: This s udy epo s he i s isola ion o ypical O157:H45 EPEC s ains om ca le.
Fu he mo e, ou indings emphasize he ac ha E. coli wi h he O157 an igen a e no always STEC
bu may belong o o he pa ho ypes. Ca le seem also o be a ese oi o O157:H45 EPEC s ains,
which a e desc ibed in associa ion wi h human diseases. The e o e, hese s ains appea o play a
ole as ood bo ne pa hogens and ha e o be conside ed and e alua ed in iew o ood sa e y
aspec s.
Published: 17 Ma ch 2004
BMC Mic obiology 2004, 4:10
Recei ed: 16 Janua y 2004
Accep ed: 17 Ma ch 2004
This a icle is a ailable om: h p://www.biomedcen al.com/1471-2180/4/10
© 2004 S ephan e al; licensee BioMed Cen al L d. This is an Open Access a icle: e ba im copying and edis ibu ion o his a icle a e pe mi ed in all
media o any pu pose, p o ided his no ice is p ese ed along wi h he a icle's o iginal URL.
BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10
Page 2 o 6
(page numbe no o ci a ion pu poses)
Backg ound
En e opa hogenic Esche ichia coli (EPEC), mainly causing
in an ile dia hoea, ep esen s one o he a leas six di e -
en ca ego ies o dia heagenic E. coli wi h co esponding
dis inc pa hogenic schemes [1]. Mos o he EPEC s ains
belong o a se ies o O an igenic g oups known as EPEC O
se og oups: O26, O55, O86, O111, O114, O119, O125,
O126, O127, O128, O142 and O158.
The main mechanism o EPEC pa hogenesis is he abili y
o in oduce a aching-and-e acing (A/E) lesions on
in es inal cells cha ac e ized by mic o illus des uc ion,
in ima e adhe ence o s ains o he in es inal epi helium,
pedes al o ma ion and agg ega ion o pola ized ac in a
si es o bac e ial a achmen [2].
The gene ic de e minan s o he p oduc ion o A/E
lesions a e loca ed on he locus o en e ocy e e acemen
(LEE), a pa hogenici y island ha con ains he genes
encoding in imin (eae), a ype III sec e ion sys em, a
numbe o sec e ed p o eins (ESP) and he ansloca ed
in imin ecep o (Ti ) [2]. Cha ac e iza ion o eae genes
e ealed he exis ence o di e en eae a ian s. A p esen ,
15 (α1, α2, β1, β2, γ1, γ2/θ, δ/κ, ε, ζ, η, ι, λ, µ, ν, ξ) gene ic
a ian s o he eae gene ha e been iden i ied [3-7]. I is dis-
cussed ha di e en in imins may be esponsible o di -
e en hos - and issue cell opism [8,9]. In epi helial
cul u e cells EPEC s ains p oduce cha ac e is ic adhe -
ence pa e ns: (i) localized adhe ence (LA), whe e mic o-
colonies a ach a e 3 hou s incuba ion o one o wo
small a eas on he cells [10,11]; (ii) di use adhe ence
(DA), whe e bac e ia co e he cells uni o mly [10]; (iii)
en e oadhe en -agg ega i e adhe ence (AA), whe e he
bac e ia ha e a cha ac e is ic s acked-b ick-like a ange-
men [12] and (iiii) localized adhe ence-like adhe ence
(LAL), cha ac e ized by o ma ion o less-compac mic o-
colonies o clus e s o bac e ia han hose by LA [13].
Localized adhe ence is associa ed wi h he p esence o he
la ge EPEC adhe ence ac o (EAF) plasmid, on which also
he clus e o genes encoding bundle- o ming pili (BFP) is
p esen [1]. EPEC a e classi ied as ypical, when possessing
he EAF plasmid; whe eas a ypical EPEC s ains do no
possess he EAF plasmid [14,15].
Typical and a ypical EPEC s ains usually belong o ce ain
se o ype clus e s, di e in hei adhe ence pa e ns on cul-
u ed epi helial cells ( ypical: LA; a ypical: DA; AA; LAL),
a e ypically ound in di e en hos s ( ypical EPEC s ains
ha e only been eco e ed om humans), and display di -
e ence in hei in imin ypes [15].
The ole and he epidemiology o non- adi ional en e -
opa hogenic E. coli se og oup s ains in human dia hea
a e no well es ablished. E. coli O157:H8 and E. coli
O157:H45 EPEC s ains ha e been desc ibed o be associ-
a ed wi h dia hea in human [4,16]. Makino e al. [17]
epo ed he i s la ge ou b eak wi h E. coli O157:H45
EPEC in Japan in 1998. Ne e heless, hese O157 EPEC
s ains a e no well cha ac e ized.
This s udy epo s he i s isola ion o O157:H45 EPEC
s ains om ca le and pheno ypic and geno ypic cha ac-
e is ics o he isola ed s ains a e desc ibed.
Resul s and discussion
All 11 so bi ol-posi i e E. coli O157:H45 s ains, six
s ains isola ed om a ening ca le and i e s ains iso-
la ed om cows es ed nega i e o Shiga oxin genes (s x).
The eae gene, which is s ongly co ela ed o he a aching-
and-e acing lesions, was p esen in all s ains. The e o e,
hese s ains a e conside ed o be EPEC. Ou indings
emphasize he ac ha E. coli wi h he O157 O an igen a e
no always STEC bu may belong o o he pa ho ypes. Fu -
he esul s o s ain cha ac e iza ion a e shown in Tab. 2.
In all es ed s ains, LEE was inse ed in selC and hus hese
s ains could be e olu iona ily mo e akin o he EPEC 1
and EHEC 1 clones han o o he clones [18]. Fu he
cha ac e iza ion o he eae a ian s showed in all s ains
eae sub ype α1. Oswald e al. [4] es ing in hei s udy he
dis ibu ion o in imin ypes among di e en EPEC
s ains, ound he same eae sub ype in O157:H45 s ains
isola ed om human wi h dia hea.
The gene encoding he hea -s able en e o oxin (EAST1),
ep esen ing an addi ional de e minan in he pa hogene-
sis o E. coli dia hea, was ound in en o he 11 s ains.
None o he s ains, howe e , ca ied ehxA genes.
Nine s ains we e posi i e o he EAF plasmid and 10
s ains ha bo ed he b pA gene encoding bundlin, he
s uc u al subuni o he bundle- o ming pilus exp essed
by ypical EPEC s ains. The EAF plasmid nega i e bu
b pA posi i e s ain may ha e a de ec in he EAF egion
ha does no in e e e wi h he plasmid's unc ion. All
b pA gene posi i e s ains showed a localized adhe ence
(LA) pa e n, he peno pyical cha ac e is ic associa ed
wi h he exp ession o bundle- o ming pili and he e o e
seem o be a ypical EPEC. Fo HEp-2 and Caco-2 cells
simila esul s we e ob ained (Figu e 1, 2). Caco-2 cells
ins ead o Hela cells we e used o adhesion assay and FAS
es , because hey ep esen a sys em close o he human
in es inal cells. Fu he mo e, Viei a e al. [19] ha e shown
ha esul s ob ained by Caco-2 cells a e compa able o
Hela cells.
10 o he 11 s ains showed an A/E p ope y wi h he lu-
o escen ac in s aining (FAS) es (Figu e 3).
BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10
Page 3 o 6
(page numbe no o ci a ion pu poses)
Acco ding o Kape [14] mos o ou O157:H45 s ains
ha e o be classi ied as ypical EPEC s ains, because hey
a e possessing he EAF plasmid and a e showing he local-
ized adhe ence (LA) pa e n. Howe e , hey a e ha bo ing
as A genes, which is mo e common o a ypical EPEC
s ains [15].
Fu he s udies a e needed o e alua e he ole o such
EPEC s ains isola ed om asymp oma ic animals.
Conclusions
Ca le ha e no only o be conside ed as impo an
asymp oma ic ca ie s o O157 STEC bu can also be a es-
e oi o O157 EPEC s ains, which a e desc ibed in asso-
cia ion wi h human diseases. These s ains appea o play
a ole as ood bo ne pa hogens and ha e o be conside ed
in iew o ood sa e y aspec s.
Table 1: Sequences and p edic ed leng hs o PCR ampli ica ion p oduc s o oligonucleo ide p ime s used
Ta ge P ime Oligonucleo ide sequence (5'-3')Sequence P oduc size Re e ence
s x VT1 ATTGAGCAAAATAATTTATAT GTG 523 bp 21
VT2 TGATGATGGCAATTCAGTAT 520 bp
eae SK1 CCCGAATTCCGCACAAGCATAAGC 863 bp 22
SK2 CCCGGATCCGTCTCGCCAGTATTCG
eae-α1 EAE-FB AAAACCGCGGAGATGACTTC 820 bp 7
EAE-A CACTCTTCGCATCTTGAGCT
eae-α2 IH2498aF AGACCTTAGGTACATTAAGTAAGC 517 bp 7
IH2498aR TCCTGAGAAGAGGGTAATC
eae-β1 EA-B1-F CGCCACTTAATGCCAGCG 811 bp 7
EAE-B CTTGATACACCTGATGACTGT
eae-β2 EA-B2-F CCCGCCACTTAATCGCACGT 807 bp 7
EAE-B CTTGATACACCTGATGACTGT
eae-γ1 EAE-FB AAAACCGCGGAGATGACTTC 804 bp 7
EAE-C1 AGAACGCTGCTCACTAGATGTC
eae-γ2/θEAE-FB AAAACCGCGGAGATGACTTC 808 bp 7
EAE-C2 CTGATATTTTATCAGCTTCA
eae-δ/κEAE-FB AAAACCGCGGAGATGACTTC 833 bp 7
EAE-D CTTGATACACCCGATGGTAAC
eae-εEAE-FB AAAACCGCGGAGATGACTTC 722 bp 7
LP5 AGCTCACTCGTAGATGACGGCAAGCG
eae-ζZ1 GGTAAGCCGTTATCTGCC 206 bp 7
Z2 ATAGCAAGTGGGGTGAAG
eae-ηEAE-FB AAAACCGCGGAGATGACTTC 712 bp 7
LP8 TAGATGACGGTAAGCGAC
eae-ιEAE-FB AAAACCGCGGAGATGACTTC 807 bp 7
LP7 TTTATCCTGCTCCGTTTGCT
eae-λ68.4F CGGTCAGCCTGTGAAGGGC 466 bp 7
68.4R ATAGATGCCTCTTCCGGTATT
eae-µFV373F CAACGGTAAGTCTCAGACAC 443 bp 7
FV373R CATAATAAGCTTTTTGGCCTACC
eae-νIH1229aF CACAGCTTACAATTGATAACA 311 bp 7
IH1229aR CTCACTATAAGTCATACGACT
eae-ξEAE-FB AAAACCGCGGAGATGACTTC 468 bp 7
B49R ACCACCTTTAGCAGTCAATTTG
ehxA HlyA1 GGTGCAGCAGAAAAAGTTGTAG 1551 bp 23
HlyA2 TCTCGCCTGATAGTGTTTGGTA
as A EAST1 CCA TCA ACA CAG TAT ATC CGA 111 bp 24
EAST2 GGT CGC GAG TGA CGG CTT TGT
EAF EAF1 CAG GGT AAA AGA AAG ATG ATA A 397 bp 25
EAF25 TAT GGG GAC CAT GTA TTA TCA
b pA EP1 AAT GGT GCT TGC GCT TGC TGC 326 bp 26
EP2 GCC GCT TTA TCC AAC CTG GTA
BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10
Page 4 o 6
(page numbe no o ci a ion pu poses)
Me hods
O igin o he E. coli s ains
The s ains cha ac e ized in his wo k we e isola ed du ing
a ecen s udy on p e alence o E. coli O157 in heal hy ca -
le in Swi ze land [20]. The s udy was based on in es iga-
ions ha we e ca ied ou wi hin he las one and a hal
yea s (Janua y 2002 – June 2003) in wo EU-app o ed
slaugh e houses. F om 2,930 bo ine ecal samples (1,183
Localized adhe ence (LA) pa e n o he E. coli O157:H45 s ain 1070/03 on HEp-2 cellsFigu e 1
Localized adhe ence (LA) pa e n o he E. coli O157:H45 s ain 1070/03 on HEp-2 cells. (a) 3 h assay, (b) 6 h assay
Localized adhe ence (LA) pa e n o he E. coli O157:H45 s ain 1070/03 on Caco-2 cellsFigu e 2
Localized adhe ence (LA) pa e n o he E. coli O157:H45 s ain 1070/03 on Caco-2 cells. (a) 3 h assay, (b) 6 h assay
a b
a b
BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10
Page 5 o 6
(page numbe no o ci a ion pu poses)
cal es, 1,201 a ening ca le and 546 cows), 11 so bi ol-
e men ing E. coli O157:H45 s ains ( om 6 a ening ca -
le and 5 cows) we e isola ed. The de e mina ion o he O
and H an igens was pe o med as p e iously desc ibed
using all a ailable O (O1 o O181) and H (H1 o H56)
an ise a [6].
Geno ypic cha ac e iza ion o he O157:H45 s ains
PCR o he de ec ion o pu a i e i ulence genes we e pe -
o med in a T3 he mocycle (Biome a, Ge many). PCR
eagen s we e pu chased om PROMEGA (Madison,
Wis.) and p ime s we e syn hesized by MICROSYNTH
(Balgach, Swi ze land). The 50-µl PCR mix u es no mally
consis ed o 2 µl o bac e ial suspension in 42 µl o dou-
ble-dis illed wa e , 5 µl o 10- old-concen a ed
polyme ase syn hesis bu e con aining 2.0 mM MgCl2,
200 µM (each) desoxynucleosid iphospha e (dNTP), 30
pmol o each p ime and 2.5 U o Taq DNA polyme ase.
The PCR p ime s, a ge sequences and p oduc sizes a e
lis ed in Table 1. Di e ences in he no mal PCR mix u e
and cycling condi ions o each PCR we e p e iously
desc ibed in he ci ed li e a u e.
To e i y whe he LEE was inse ed downs eam o he
selC locus, PCR eac ions ha ampli y he junc ions o his
locus wi h he E. coli ch omosome we e pe o med
acco ding o Spe andio e al. [27]. P ime s K255 (5'-
GGTTGAGTCGATTGATCTCTGG-3') and K260 (5'-
GAGCGAATATTCCGATATCTGGTT-3') we e used o he
igh junc ion; K296 (5'-CATTCTGAAACAAACTGCTC-3')
and K295 (5'-CGCCGATTTTTCTTAGCCCA-3') o he le
junc ion, and K261 (5'-CCTGCAAATAAACACGGCGCAT-
3') and K260 o he in ac selC gene.
Adhesion assay and FAS es
E. coli colonies we e cha ac e ized by he pa e n o adhe -
ence o HEp-2 and Caco-2 cells as desc ibed by Ka ch e al.
[28] wi h mino modi ica ions. B ie ly, HEp-2 and Caco-
2 cells we e g own o 48 h wi h 5% CO2 on s e ilized
co e slips (13 mm diame e ; Bibby S e ilin™ L d., S one,
England) in 24-well la -bo om issue cul u e pla es wi h
low e apo a ion lid (16 mm diame e ; BD Falcon™, Bed-
o d, USA) con aining Minimum essen ial medium (MEM
wi h Ea le's sal s, 25 mM HEPES, wi hou L-
Glu amine;GIBCO™ In i ogen AG, Basel, Swi ze land)
supplemen ed wi h e al cal se um (FCS, 10%, Bio Con-
cep ™, Allschwil, Swi ze land), MEM Non Essen ial
Amino Acids (MEM NEAA (100x) wi hou L-Glu amine,
GIBCO™ In i ogen AG, Basel, Swi ze land) and
Glu aMAX™I Supplemen 200 mM (100x), (GIBCO™ In -
i ogen AG, Basel, Swi ze land). Bac e ia used o he
adhesion assay we e g own o e nigh in LB-b o h Mille
(Bec on Dickinson, Ma yland, USA). P io o incuba ion,
he con luen cells we e washed wo imes wi h Dul-
becco's phospa e bu e ed saline (D-PBS (1x) wi hou Cal-
cium and Magnesium, GIBCO™ In i ogen AG, Basel,
Swi ze land). E. coli dilu ed 1:100 in 1 ml esh media
(MEM wi h supplemen s) was added o he cells and was
incuba ed o 3 h a 37°C and 5% CO2. A e his incuba-
ion pe iod, monolaye s we e washed i e imes wi h D-
PBS (3 h assay) o monolaye s we e washed en imes wi h
D-PBS, esh media (MEM wi h supplemen s) was added
and an addi ional incuba ion pe iod o 3 h p oceeded (6h
assay). Subsequen ly, he monolaye s we e washed i e
imes wi h D-PBS and he cells we e ixed o 10 min wi h
4 Me hanol. A e he s aining wi h May-G ünwald-
Giemsa (Fluka™, Buchs SG, Swi ze land), he co e slips
we e examined by ligh mic oscopy o de e mine he
adhe ence pa e ns o he s ains.
The ollowing luo escen ac in-s aining (FAS) es was
pe o med on Caco-2 cells acco ding o Ka ch e al. [28]
wi h mino modi ica ions. The cells we e ixed wi h 4%
o maldehyde in D-PBS, hen washed h ee imes wi h D-
Ac in luo escence mic og aph showing E. coli O157:H45 s ain 1070/03-in ec ed Caco-2 cellsFigu e 3
Ac in luo escence mic og aph showing E. coli O157:H45
s ain 1070/03-in ec ed Caco-2 cells
Table 2: Cha ac e iza ion esul s o 11 so bi ol- e men ing
O157:H45 EPEC s ains isola ed om ca le in Swi ze land
No. o
s ains
LEE in
selC
In imin
ype
EAF
Plasmid
b p Adhe ence
pa e n
as Aehx
9yesα1+ +LA +-
1yesα1- +LA +-
1yesα1- -NA --
LA: localized adhe ence; NA: no adhe ence
BMC Mic obiology 2004, 4h p://www.biomedcen al.com/1471-2180/4/10
Page 6 o 6
(page numbe no o ci a ion pu poses)
PBS and incuba ed o 5 min wi h 0.1% T i on X-100
(Fluka™, Buchs SG, Swi ze land) in D-PBS. A e ano he
h ee washes wi h D-PBS, he monolaye s we e incuba ed
wi h 5 µg/ml o luo escein iso hiocyana e labelled pha-
loidin (Sigma, S einheim, Ge many) o 30 min. A e
ano he h ee washes wi h D-PBS, he co e slips we e
examined by luo escence mic oscopy (Leica ™).
Au ho s' con ibu ions
RS isola ed he s ains and d a ed he manusc ip , CZ was
esponsible o u he s ain cha ac e iza ion, NB pe -
o med adhesion assays and FAS es s, MB pe o med he
PCR yping o eae genes and JE has done se o yping o he
s ains. All au ho s ead, commen ed on and app o ed o
he inal manusc ip .
Acknowledgemen s
We hank Sand a Schumache and Ca men Kaise o he excellen echni-
cal assis ance. This s udy was pa ly suppo ed by a g an om he Fondo
de In es igación Sani a ia (FIS G03/025-COLIRED-O157).
Re e ences
1. Na a o JP, Kape JB: Dia heagenic Esche ichia coli. Clin Mic obiol
Re 1998, 11:142-201.
2. F anke G, Phillips AD, Rosenshine I, Dougan G, Kape JB, Knu on S:
En e opa hogenic and en e ohaemo hagic Esche ichia coli:
mo e sub e si e elemen s. Mol Mic obiol 1998, 30:911-921.
3. Adu-Bobie J, F ankel G, Bain C, Goncal es AG, T abulsi LR, Douce G,
Knu on S, Dougan G: De ec ion o in imins alpha, be a,
gamma, and del a, ou in imin de i a i es exp essed by
a aching and e acing mic obial pa hogens. J Clin Mic obiol
1998, 36:662-668.
4. Oswald E, Schmid H, Mo abi o S, Ka ch H, Ma ches O, Cap ioli A:
Typing o in imin genes in human and animal en e ohemo -
hagic and en e opa hogenic Esche ichia coli: cha ac e iza-
ion o a new in imin a ian . In ec Immun 2000, 68:64-71.
5. Zhang WL, Kohle B, Oswald E, Beu in L, Ka ch H, Mo abi o S, Cap-
ioli A, Sue baum S, Schmid H: Gene ic di e si y o in imin
genes o a aching and e acing Esche ichia coli s ains. J Clin
Mic obiol 2002, 40:4486-4492.
6. Blanco M, Blanco JE, Mo a A, Rey J, Alonso JM, He moso M, He moso
J, Alonso MP, Dahbi G, González EA, Be ná dez MI, Blanco J: Se o-
ypes, i ulence genes and in imin ypes o Shiga oxin
(Ve o oxin)-p oducing Esche ichia coli isola es om heal hy
sheep in Spain. J Clin Mic obiol 2003, 41:1351-1356.
7. Blanco M, Blanco JE, Mo a A, Dahbi G, Alonso MP, González EA,
Be ná dez MI, Blanco J: Se o ypes, i ulence genes and in imin
ypes o Shiga oxin (Ve o oxin)-p oducing Esche ichia coli
isola es om ca le in Spain: iden i ica ion o a new in imin
a ian gene (eae-xi). J Clin Mic obiol 2004, 42:645-651.
8. Jo es J, Zehmke K, Eichbe g J, Rume L, Wiele LH: Desc ip ion o
a no el in imin a ian ( ype ze a) in he bo ine O84:NM
e o oxin-p oducing Esche ichia coli s ain 537/89 and he
diagnos ic alue o in imin yping. Exp Biol Med (Maywood). 2003,
228:370-376.
9. Pié a d D, Muylde mans G, Mo iau L, S e ens D, Lauwe s S: Iden i-
ica ion o new e ocy o oxin ype 2 a ian B-subuni genes
in human and animal Esche ichia coli isola es. J Clin Mic obiol
1998, 36:3317-3322.
10. Scale sky IC, Sil a ML, T abulsi LR: Dis inc i e pa e ns o adhe -
ence o en e opa hogenic Esche ichia coli o HeLa cells. In ec
Immun 1984, 45:534-536.
11. Knu on S, Shaw RK, Anan ha RP, Donnenbe g MS, Zo gani AA: The
ype IV bundle- o ming pilus o en e opa hogenic Esche ichia
coli unde goes d ama ic al e a ions in s uc u e associa ed
wi h bac e ial adhe ence, agg ega ion and dispe sal. Mol
Mic obiol 1999, 33:499-509.
12. Na a o JP, Kape JB, Robins-B owne R, P ado V, Vial P, Le ine MM:
Pa e ns o adhe ence o dia heagenic Esche ichia coli o
HEp-2 cells. Paedia In ec Dis J 1987, 6:829-831.
13. Scale sky IC, Pelayo JS, Gi aldi R, Rod igues J, Ped oso MZ, T abulsi
LR: EPEC adhe ence o Hep-2 cells. Re Mic obiol 1996, 27:58-62.
14. Kape JB: De ining EPEC. Re Mic obiol 1996, 27:130-133.
15. T abulsi LR, Kelle R, Ta delli Gomes TA: Typical and a ypical
en e opa hogenic Esche ichia coli. Eme g In ec Dis 2002,
8:508-513.
16. Sco land SM, Willshaw GA, Cheas y T, Rowe B: S ains o
Esche ichia coli O157:H8 om human dia hea belong o
a aching and e acing class o E. coli. J Clin Pa hol 1992,
45:1075-1078.
17. Makino S, Asaku a H, Shi aha a T, Ikeda T, Takeshi K, A ai K,
Nagasawa M, Abe T, Sadamo o T: Molecula epidemiological
s udy o a mass ou b eak caused by en e opa hogenic
Esche ichia coli O157:H45. Mic obiol Immunol 1999, 43:381-384.
18. Wiele LH, McDaniel TK, Whi am TS, Kape JB: Inse ion si e o
he locus o en e ocy e e acemen in en e opa hogenic and
en e ohemo hagic Esche ichia coli di e s in ela ion o he
clonal phylogeny o he s ains. FEMS Mic obiol Le 1997,
156:49-53.
19. Viei a M, And ale J, T abulsi L, Rosa A, Dias A, Ramos S, F ankel G,
Gomes TA: Pheno ypic and geno ypic cha ac e is ics o
Esche ichia coli s ains o non-en e opa hogenic E. coli
(EPEC) se og oups ha ca y eae and lack he EPEC adhe -
ence ac o and Shiga oxin DNA p obe sequences. J In ec Dis
2001, 183:762-772.
20. Al-Saigh H, Zwei el C, Blanco J, Blanco JE, Blanco M, Use a MA,
S ephan R: Fecal shedding o Esche ichia coli O157, Salmonella
spp. and Campylobac e spp. in Swiss ca le a slaugh e . J Food
P o ec in p ess.
21. Bu nens AP, F ey A, Lio H, Nicole J: P e alence and clinical sig-
ni icance o e o-cy o oxin-p oducing Esche ichia coli
(VTEC) isola ed om ca le in he ds wi h and wi hou cal
dia hoea. Zen albl Ve e ina med B 1995, 42:311-318.
22. Schmid H, Plaschke B, F anke S, Rüssmann H, Schwa zkop A, Heese-
mann J, Ka ch H: Di e en ia ion in i ulence pa e ns o
Esche ichia coli possessing eae-genes. Med Mic obiol Immunol
1994, 183:23-31.
23. Schmid H, Beu in L, Ka ch H: Molecula analysis o he plasmid-
encoded hemolysin o Esche ichia coli O157:H7 s ain EDL
933. In ec Immun 1995, 63:1055-1061.
24. Yamamo o T, Nakazawa M: De ec ion and sequences o he
en e oagg ega i e Esche ichia coli hea -s able en e o oxin 1
gene in en e o oxigenic E. coli s ains isola ed om pigle s
and cal es wi h dia hea. J Clin Mic obiol 1997, 35:223-227.
25. F anke J, G anke S, Schmid H, Schwa zkop A, Wiele LH, Balje G,
Beu in L, Ka ch H: Nucled ide sequence analysis o en e opa h-
ogenic Esche ichia coli (EPEC) adhe ence ac o p obe and
de elopmen o PCR o apid de ec ion o EPEC ha bou ing
i ulence plasmids. J Clin Mic obiol 1994, 32:2460-2463.
26. Gunzbu g ST, To niepo h NG, Riley LW: Iden i ica ion o en e -
opa hogenic Esche ichia coli by PCR-based de ec ion o he
bundle- o ming pilus gene. J Clin Mic obiol 1995, 33:1375-1377.
27. Spe andio V, Kape JB, Bo olini MR, Ne ez BC, Kelle R, T abulsi LR:
Cha ac e iza ion o he locus o en e ocy e e acemen
(LEE) in di e en en e opa hogenic Esche ichia coli (EPEC)
and shiga oxin p oducing Esche ichia coli (STEC) se o ypes.
FEMS Mic obiol Le 1998, 164:133-139.
28. Ka ch H, Böhm H, Schmid H, Gunze F, Aleksic S, Heesemann J:
Clonal s uc u e and pa hogenici y o shiga-like oxin-p o-
ducing, so bi ol- e men ing Esche ichia coli O157:H-. J Clin
Mic obiol 1993, 31:1200-1205.