Variable Expressivity and Allelic Heterogeneity in Type 2 Familial Partial Lipodystrophy: The p.(Thr528Met) LMNA Variant

Journal of Clinical Medicine Article Variable Expressivity and Allelic Heterogeneity in Type 2 Familial Partial Lipodystrophy: The p.(Thr528Met) LMNA Variant David Araújo-Vilar 1,2,† , Antía Fernández-Pombo 1,2,† , Berta Victoria-Martínez 3, Adrián Mosquera-Orgueira 4, Silvia Cobelo-Gómez 1, Ana Castro-Pais 2,5,Álvaro Hermida-Ameijeiras 1,6 , Lourdes Loidi 7 and Sofía Sánchez-Iglesias 1,*   Citation: Araújo-Vilar, D.; Fernández-Pombo, A.; Victoria-Martínez, B.; Mosquera-Orgueira, A.; Cobelo-Gómez, S.; Castro-Pais, A.; Hermida-Ameijeiras, Á.; Loidi, L.; Sánchez-Iglesias, S. Variable Expressivity and Allelic Heterogeneity in Type 2 Familial Partial Lipodystrophy: The p.(Thr528Met) LMNA Variant. J. Clin. Med. 2021,10, 1497. https://doi.org/ 10.3390/jcm10071497 Academic Editor: Emmanuel Andrès, Katrien Benhalima Received: 30 January 2021 Accepted: 1 April 2021 Published: 3 April 2021 Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). 1UETeM-Molecular Pathology Group, Department of Psychiatry, Radiology, Public Health, Nursing and Medicine, IDIS-CIMUS, University of Santiago de Compostela, 15782 Santiago de Compostela, Spain; [email protected] (D.A.-V.); [email protected] (A.F.-P.); [email protected] (S.C.-G.); [email protected] (Á.H.-A.) 2Division of Endocrinology and Nutrition, University Clinical Hospital of Santiago de Compostela, 15706 Santiago de Compostela, Spain; [email protected] 3Burnett School of Biomedical Sciences, College of Medicine, University of Central Florida, Orlando, FL 32827, USA; [email protected] 4 Department of Hematology, University Clinical Hospital of Santiago de Compostela, Santiago de Compostela, 15706 Santiago de Compostela, Spain; [email protected] 5CIBER Fisiopatología de la Obesidad y la Nutrición (CIBERobn), 28029 Madrid, Spain 6Division of Internal Medicine, University Clinical Hospital of Santiago de Compostela, 15706 Santiago de Compostela, Spain 7Fundación Galega de Medicina Xenómica, 15706 Santiago de Compostela, Spain; [email protected] *Correspondence: [email protected]; Tel.: +34-881-815-446 † These authors contributed equally to this manuscript. Abstract: Type 2 familial partial lipodystrophy, or Dunnigan disease, is a metabolic disorder characterized by abnormal subcutaneous adipose tissue distribution. This rare condition results from variants principally affecting exons 8 and 11 of the LMNA gene. In this study, five FPLD2-diagnosed patients carrying the c.1583C>T, p.(Thr528Met) variant in exon 9 of the LMNA gene and with obvious clinical heterogeneity were evaluated. Specific polymorphisms in LMNA and in PPARG were also detected. Exhaustive clinical course, physical examination, biochemical features and family history were recorded, along with the assessment of anthropometric features and body composition by dual-energy X-ray absorptiometry. Preadipocytes obtained from a T528M patient were treated with the classic adipose differentiation medium with pioglitazone. Various adipogenes were evaluated by real-time PCR, and immunofluorescence was used to study intracellular localization of emerin, lamin A and its precursors. As demonstrated with Oil red O staining, the preadipocytes of the T528M patient failed to differentiate, the expression of various adipogenic genes was reduced in the lipodystrophic patient and immunofluorescence studies showed an accumulation of farnesylated prelamin A in T528M cells. We conclude that the T528M variant in LMNA could lead to FPLD2, as the adipogenic machinery is compromised. Keywords: type 2 familial partial lipodystrophy; FPLD2; LMNA; T528M 1. Introduction Familial partial lipodystrophies are a group of Mendelian diseases characterized by the loss of subcutaneous adipose tissue in the lower limbs and sometimes also in the upper limbs, with abnormal fat accumulation in other regions. Affected subjects have insulin resistance leading to complications such as diabetes, dyslipidemia, liver steatosis and increased cardiovascular risk. FPLD2 patients exhibit lipoatrophy in the upper and lower J. Clin. Med. 2021,10, 1497. https://doi.org/10.3390/jcm10071497 https://www.mdpi.com/journal/jcm J. Clin. Med. 2021,10, 1497 2 of 15 limbs and buttocks from puberty, particularly in women, and accumulation of fat in the neck, face and visceral depots, following an autosomal dominant pattern of inheritance. FPLD2 results from variants in the LMNA gene (1q21–q23), which codes for type-A lamins by alternative splicing: lamin A, lamin C, lamin C2 and lamin A ∆ 10. These are intermediate filament proteins, forming polymers at the nuclear lamina, a meshwork underlying the inner nuclear membrane. They exert recognized functions in a range of transcendental biological processes: mechanical function in nuclear shape maintenance, conservation of nuclear and chromatin architecture, DNA replication and transcription, cell cycle and cellular senescence/apoptosis, cell proliferation, tumor progression and interactions with other nuclear and cytoplasmatic proteins (thus regulating the communication between these two compartments). Type-A lamins have a characteristic structure: a small N-terminal head domain, a coiled-coil rod domain divided into four α -helix segments, and a globular C-terminal IgG-like end or tail domain. The rod domain allows coiled-coil dimerization, while the head and the tail are involved in the end-to-end assembly of the polymer, and greater associations. The main isoforms of type-A lamins are lamins A and C, both identical to codon 566, from which lamin C lacks part of the C-terminal region, including some amino acids of exon 10, exon 11 and exon 12. It is important to note that FPLD is generally caused by heterozygous amino acid changes in the C-terminal domain of lamin A/C, usually between exons 8 and 11 (>90% of variants affect codon 482 of the gene, a mutational hot spot). These regions codify for the protein elements involved in prelamin A processing to generate mature lamin A. Previous studies have suggested that variant c.1583C>T, p.(Thr528Met) only produces pathological manifestations when it appears in compound heterozygosity [ 1 , 2 ]. We report here the cases of five patients from four pedigrees with clinical diagnosis of FPLD2, carrying the p.(Thr528Met) missense variant in exon 9 of the LMNA gene. Various genes related to other forms of familial partial lipodystrophies were also analyzed by NGS (next-generation sequencing). The primary objective of this study was to clearly establish that this LMNA variant is the primary cause of the lipodystrophy observed in our patients by evaluating whether it alters adipogenesis in human preadipocytes. No less important was the aim to examine the complex genotype-phenotype associations in more depth along with the wide clinical heterogeneity observed. 2. Experimental Section This study was approved by the Ethics Review Panel of Xunta de Galicia, and carried out according to the ethical guidelines of the Helsinki Declaration. Patients gave informed consent for participation in the study and the publication of clinical, biochemical, and genetic information. 2.1. Subjects, Analysis and Interpretation of Variants All patients studied are heterozygous for the variant c.1583C>T, p.(Thr528Met) in the LMNA gene. The search for variants in genes AGPAT2,AKT2,BANF1,BLM,BSCL2, CAV1,CIDED,ERCC6,ERCC8,FBN1,KCNJ6,LIPE,PCYT1A,PIK3R1,PLIN1,POLD1, PPARG,PSMB8,PTRF,SPRTN,WRN and ZMPSTE24 was made by NGS (Ion torrent System, Thermo Fisher Scientific, Waltham, MA, USA) sequencing of the entire coding region of the genes and the flanking intronic regions. The capture of the regions of interest was performed using SureSelectXT Custom (Agilent, St Clara, CA, USA) and data analysis was performed using computer tools: TMAP 5.4.11, TVC 5.4–11, GATK v3.8–0, Picard 2.10.2-SNAPSHOT, BEDtools v2.26.0, SAMtools 1.5 and ExomeDepth 1.1.10. Interpretation of classification of variants was done by following the guidelines of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG, Bethesda, MD, USA) [ 3 ]. The classification of the variants identified reflects the current state of scientific knowledge and they might change as new scientific information becomes available. Different resources and databases were used for the variant classification as J. Clin. Med. 2021,10, 1497 3 of 15 Varsome [ 4 ], gnomAD [ 5 ] (https://gnomad.broadinstitute.org, accessed 2 April 2021), ClinVar [6] and dbSNP [7]. 2.2. Body Composition Studies Height and body weight were measured by standard procedures. Skinfold thicknesses were measured with Lange Skinfold calipers (Cambridge Scientific Industries, Watertown, MA, USA) at two truncal (subscapular and suprailiac) and four peripheral sites (biceps, triceps, thigh and calf) on the right side of the body. The distribution of body fat was assessed via whole-body dual-energy X-ray absorptiometry (DXA), using a Lunar model DPX apparatus (GE Healthcare Lunar, Madison, WI, USA) [8]. 2.3. Biochemical Analyses Fasting serum samples were analyzed for glucose, total cholesterol, HDL-cholesterol, LDL-cholesterol, triglycerides, thyroid stimulating hormone (TSH), creatinine, and creatine kinase (CK) as described previously [ 9 ]. Glycated hemoglobin (HbA1c) was measured using ion-exchange high-performance liquid chromatography (Bio-Rad Laboratories Inc., Hercules, CA, USA). Aspartate aminotransferase (AST), alanine aminotransferase (ALT) and gamma-glutamyl transpeptidase (GGT) were determined with enzymatic methods on an ADVIA analyzer (Siemens, Bayer Diagnostics, Tarrytown, NY, USA). Plasma insulin concentrations were determined in duplicate by chemiluminescence, using a commercial kit (Nichols Institute, San Juan Capistrano, CA, USA). Plasma leptin levels and C-peptide were determined by ELISA assay (DRG International, Inc., Springfield, NJ, USA). 2.4. Adipose Tissue Biopsies and Cell Culture A small sample of subcutaneous adipose tissue was obtained from the lower back area of Case #1 at 42 years of age. A control of normal adipose tissue sample was obtained from the back of a 32-year-old woman who underwent programmed surgery for lipoma extraction, in accordance with current Spanish legislation. Small pieces of adipose tissue were placed on a 60 mm dish (BD FalconTM; Mississauga, ON, Canada) containing Dulbecco’s modified Eagle’s medium (DMEM) plus 30% fetal bovine serum (FBS) and gentamicin 50 µ g/mL, and incubated at 37 ◦ C with 5% CO 2 in a Water-Jacket CO 2 incubator (NuAire; Plymouth, MN, USA). Preadipocytes were recognized by the presence of small lipid droplets in the fibroblast-like cells using a phase microscope. Subsequently, these preadipocytes were trypsinized (TrypLE ™ Express Stable Trypsin-like Enzyme with Phenol Red; Gibco Life Technologies; Carlsbad, CA, USA) and cultured on 100 mm dishes in DMEM containing 10% FBS and penicillin-streptomycin 1%. 2.5. Adipocyte Differentiation Procedure After confluence, preadipocytes were cultured on 35 mm multi-well dishes (6-well plates) in a differentiation cocktail containing Dulbecco’s modified Eagle’s medium plus 10% fetal bovine serum, insulin (1 µ g/mL), dexamethasone (0.25 µ M) and 3-isobutyl-1methylxanthine (0.1 mM in DMSO) [ 10 ] for 3 days, with a PPARG agonist, pioglitazone (10 µ M in DMSO; Alexis Biochemicals, Lausanne, Switzerland), after which this medium was changed for a growth medium containing 1 µ g/mL insulin with pioglitazone (10 µ M) for two more days. The cells were then left to differentiate for another 5 days with growth medium containing pioglitazone (10 µ M) changed every other day. Non-differentiated preadipocytes were supplemented with equivalent concentrations of DMSO and used as controls. 2.6. Phase Contrast Microscopy Cells were fixed in 10% formalin for 60 min at room temperature, washed three times with distilled water and then stained with 0.5% (w/v) Oil red O solution in 60% isopropanol for 60 min, at 22 ◦ C. Cells were washed again three times with distilled water, and lipid accumulation was finally estimated by phase contrast microscopy. J. Clin. Med. 2021,10, 1497 4 of 15 2.7. RNA Extraction and Retrotranscription Total RNA was extracted from preadipocytes, using TRIzol (Invitrogen, Madrid, Spain) as per the manufacturer’s instructions. RNA was reverse-transcribed by using M-MLV reverse transcriptase (Invitrogen) as previously described [11]. 2.8. Real-Time PCR Specific primers and probes designed by Universal Probe Library (Roche Diagnostics, Sant Cugat del Valles, Spain; Table 1) were used to determine the specific expression of CEBPA,CEBPB,FABP4,GLUT4,LPL, and PPARG and PREF-1 genes in a Light Cycler 2.0 (Roche Diagnostics). Real-time PCR conditions are available upon request. Results were normalized for the internal control RNA polymerase II gene, using the 2- ∆∆ CT method [12]. Table 1. Primer sequences and probes. Genes Forward Primer (50–30) Reverse Primer (50–30)Probe Probe Sequences Amplicon Length (nt) CEBPA GCAAATCGTGCCTTGTCAT CTCATGGGGGTCTGCTGTAG 12 CTCCTTCC 72 CEBPB CGCTTACCTCGGCTACCA ACGAGGAGGACGTGGAGAG 74 CTGCTGCC 65 FABP4 CCTTTAAAAATACTGAGATTTCCTTCA GGACACCCCCATCTAAGGTT 72 TTCCTGGC 105 GLUT4 CTGTGCCATCCTGATGACTG CGTAGCTCATGGCTGGAACT 67 TGCTGGAG 62 LPL ATGTGGCCCGGTTTATCA CTGTATCCCAAGAGATGGACATT 25 CTCCTCCA 76 PPARG GACCTGAAACTTCAAGAGTACCAAA TGAGGCTTATTGTAGAGCTGAGTC 39 CTCCACCT 95 PREF-1 GACGGGGAGCTCTGTGATAG CATAGAGGCCATCGTCCAG 68 AGGAGCAG 94 RNA polymerase II GCATCATGAACAGCGATGAG TCATCCATCTTGTCCACCAC 69 GGAGGAAG 64 2.9. Immunofluorescence Cells grown on glass coverslips were fixed with 4% paraformaldehyde, at 4 ◦ C, for 1 h , and permeabilized in 0.1% Triton X-100, at room temperature for, 10 min. After blocking for non-specific binding (4% BSA, 1 h, at room temperature), the coverslips were incubated in an appropriate primary antibody, at 4 ◦ C, overnight (1:150 anti-prelamin A (ANT0045, Diatheva, Fano, Italy), 1:120 anti-farnesylated prelamin A (ANT0046, Diatheva, Fano, Italy), 1:50 anti-emerin (Novocastra Leica, Barcelona, Spain) and 1:100 anti-lamin A/C (N-18) (Santa Cruz Biotechnology, Heidelberg, Germany)). The ANT0045 does not bind carboxymethylated-farnesylated prelamin A, while no cross-reaction is observed between ANT0046 and full-length prelamin A [ 13 ]. The following day, after three washes, the coverslips were incubated for 1 h, at room temperature, in darkness, with 1:600 Cy2-AffiniPure F(ab’)2 Fragment and 1:600 Cy3-AffiniPure F(ab’)2 Fragment (Jackson Immunoresearch, West Grove, PA, USA) and counterstained with 1:1000 DAPI (Life Technologies, Madrid, Spain). Coverslips were mounted in Fluoromount medium (Sigma, Barcelona, Spain). Immunofluorescence staining was analyzed using an Olympus IX51 microscope (Olympus Corporation) equipped with an Olympus DP72 digital camera. 2.10. Statistical Analysis Real-time PCR analyses were performed by triplicates. Statistical significance was determined by using a non-parametric Kruskal-Wallis test, followed by a Mann-Whitney U post hoc Bonferroni’s correction. Data are presented as mean ± standard deviation (SD), with statistical significance set at p< 0.05, and were evaluated by using SPSS for PC (release 22; SPSS, Chicago, IL, USA). 3. Results Photographs of the studied subjects, pedigrees and color map of DXA scans are depicted in Figures 1–3, respectively. Demographic, anthropometric, biochemical and clinical features are summarized in Table 2. J. Clin. Med. 2021,10, 1497 5 of 15 J. Clin. Med. 2021, 10, x FOR PEER REVIEW 6 of 17 Figure 1. Photographs of the five cases with FPLD2 bearing the p.(Thr528Met) variant in the LMNA gene. The photographs show body morphology caused by the p.(Thr528Met) variant. (A) Case #1 is a 53-year-old female. Fat loss higher than in Figure 1. Photographs of the five cases with FPLD2 bearing the p.(Thr528Met) variant in the LMNA gene. The photographs show body morphology caused by the p.(Thr528Met) variant. ( A ) Case #1 is a 53-year-old female. Fat loss higher than in the other patients. Lack of subcutaneous adipose tissue in limbs, abdomen and buttocks. Rounded face, double chin, hypermuscular appearance with calf hypertrophy, hepatomegaly, phlebomegaly and small breasts. ( B ) Case #2 is a 58-year-old female. Fat loss in upper limbs, hips, thighs and calves. Fat accumulation in face with double chin, in upper back and intra-abdominal region. Scarce abdominal subcutaneous adipose panicle. Phlebomegaly. Calf J. Clin. Med. 2021,10, 1497 6 of 15 hypertrophy. Acanthosis nigricans on the nape and axillae. Hepatomegaly, splenomegaly. ( C ) Case #3 is a 34-year-old female. No obvious fat loss. Low fat in arms, buttocks, hips and lower extremities. Fat accumulation in face, double chin, trunk, abdomen and axillae. Minimal acanthosis nigricans. ( D ) Case #4 is a 20-year-old female. Fat accumulation in face, double chin, dorsal region, axillae, neck, arms and scapular region. Scarce fat in hips, buttocks, thighs and calves. Phlebomegaly and marked musculature in lower limbs. Normal amount of fat in abdomen and upper limbs. Hirsutism. Acanthosis nigricans in axillae, nape and groin areas. ( E ) Case #5 is a 62-year-old female. Fat loss in upper limbs, lower limbs, buttocks and hips. Accumulation of fat in face, abdomen, chin, back and axillae. Well-defined muscles in arms, legs and buttocks. Minimal phlebomegaly in arms. J. Clin. Med. 2021, 10, x FOR PEER REVIEW 7 of 17 the other patients. Lack of subcutaneous adipose tissue in limbs, abdomen and buttocks. Rounded face, double chin, hypermuscular appearance with calf hypertrophy, hepatomegaly, phlebomegaly and small breasts. (B) Case #2 is a 58-yearold female. Fat loss in upper limbs, hips, thighs and calves. Fat accumulation in face with double chin, in upper back and intra-abdominal region. Scarce abdominal subcutaneous adipose panicle. Phlebomegaly. Calf hypertrophy. Acanthosis nigricans on the nape and axillae. Hepatomegaly, splenomegaly. (C) Case #3 is a 34-year-old female. No obvious fat loss. Low fat in arms, buttocks, hips and lower extremities. Fat accumulation in face, double chin, trunk, abdomen and axillae. Minimal acanthosis nigricans. (D) Case #4 is a 20-year-old female. Fat accumulation in face, double chin, dorsal region, axillae, neck, arms and scapular region. Scarce fat in hips, buttocks, thighs and calves. Phlebomegaly and marked musculature in lower limbs. Normal amount of fat in abdomen and upper limbs. Hirsutism. Acanthosis nigricans in axillae, nape and groin areas. (E) Case #5 is a 62-year-old female. Fat loss in upper limbs, lower limbs, buttocks and hips. Accumulation of fat in face, abdomen, chin, back and axillae. Well-defined muscles in arms, legs and buttocks. Minimal phlebomegaly in arms. Figure 2. Pedigrees of the four families with FPLD2 due to the p.(Thr528Met) variant. Genograms. Affected individuals with the LMNA p.(Thr528Met) variant and the LMNA p.(Ser573Leu) variant are shown as half-filled red and blue symbols, respectively, unaffected subjects as unfilled symbols, individuals for whom the phenotype is suspected are shown as halffilled orange symbols. Squares denote males, and circles denote females. Circles and squares with a diagonal slash denote deceased subjects. The inheritance pattern was autosomal dominant in a vertical way. Figure 2. Pedigrees of the four families with FPLD2 due to the p.(Thr528Met) variant. Genograms. Affected individuals with the LMNA p.(Thr528Met) variant and the LMNA p.(Ser573Leu) variant are shown as half-filled red and blue symbols, respectively, unaffected subjects as unfilled symbols, individuals for whom the phenotype is suspected are shown as half-filled orange symbols. Squares denote males, and circles denote females. Circles and squares with a diagonal slash denote deceased subjects. The inheritance pattern was autosomal dominant in a vertical way. J. Clin. Med. 2021, 10, x FOR PEER REVIEW 7 of 17 the other patients. Lack of subcutaneous adipose tissue in limbs, abdomen and buttocks. Rounded face, double chin, hypermuscular appearance with calf hypertrophy, hepatomegaly, phlebomegaly and small breasts. (B) Case #2 is a 58-yearold female. Fat loss in upper limbs, hips, thighs and calves. Fat accumulation in face with double chin, in upper back and intra-abdominal region. Scarce abdominal subcutaneous adipose panicle. Phlebomegaly. Calf hypertrophy. Acanthosis nigricans on the nape and axillae. Hepatomegaly, splenomegaly. (C) Case #3 is a 34-year-old female. No obvious fat loss. Low fat in arms, buttocks, hips and lower extremities. Fat accumulation in face, double chin, trunk, abdomen and axillae. Minimal acanthosis nigricans. (D) Case #4 is a 20-year-old female. Fat accumulation in face, double chin, dorsal region, axillae, neck, arms and scapular region. Scarce fat in hips, buttocks, thighs and calves. Phlebomegaly and marked musculature in lower limbs. Normal amount of fat in abdomen and upper limbs. Hirsutism. Acanthosis nigricans in axillae, nape and groin areas. (E) Case #5 is a 62-year-old female. Fat loss in upper limbs, lower limbs, buttocks and hips. Accumulation of fat in face, abdomen, chin, back and axillae. Well-defined muscles in arms, legs and buttocks. Minimal phlebomegaly in arms. Figure 2. Pedigrees of the four families with FPLD2 due to the p.(Thr528Met) variant. Genograms. Affected individuals with the LMNA p.(Thr528Met) variant and the LMNA p.(Ser573Leu) variant are shown as half-filled red and blue symbols, respectively, unaffected subjects as unfilled symbols, individuals for whom the phenotype is suspected are shown as halffilled orange symbols. Squares denote males, and circles denote females. Circles and squares with a diagonal slash denote deceased subjects. The inheritance pattern was autosomal dominant in a vertical way. Figure 3. DXA scans of patients with the p.(Thr528Met) and p.(Arg482Trp) variants in the LMNA gene and control subjects. The total body scans were color-mapped, with green representing an area of low level % fat (0–25%), yellow an area of medium level % fat (25–60%) and red an area of high level % fat (60–100%). J. Clin. Med. 2021,10, 1497 7 of 15 Table 2. Demographic, anthropometric, biochemical and clinical features of the studied subjects. Demographic Features Case #1 Case #2 Case #3 Case #4 Case #5 Age 42.8 53.8 34.7 18.1 62.1 Sex F F F F F Variants LMNA c.1583C>T p.(Thr528Met) c.1583C>T p.(Thr528Met) c.1583C>T p.(Thr528Met) c.1583C>T p.(Thr528Met)/c.1718C>T p.(Ser573Leu) c.1583C>T p.(Thr528Met) Other genes - WRN c.1495A>G p.(Arg499Gly); BLM c.813G>C p.(Lys271Asn) WRN c.1495A>G p.(Arg499Gly); BLM c.813G>C p.(Lys271Asn) - - Autosomal dominant inheritance yes yes yes yes yes SNP PPARGp.Pro12Ala yes no no no no Clinical features Acanthosis no yes yes yes no Phlebomegaly no yes no yes yes Hypermuscularity yes yes no no yes Lipomas no no yes no no Goiter no no no no yes Diabetes mellitus (DM) yes yes no no (IFG) no (IFG) Dyslipidemia IV IIb IV IV IIb Steatosis no yes no no no Arterial hypertension (AHT) yes yes no no yes Cardiovascular diseases (CVDs) no no no no yes Polycystic ovary syndrome (PCOS) and obstetric complications no no no yes no Pancreatitis no no no no no Lipodystrophy onset Childhood Childhood 31 years of age Adolescence Adolescence Family background Mother and sister: FPLD Daughter: FPLD; Mother: DM Mother: FPLD Father: hypertriglyceridemia Mother: DM Anthropometric data Weight (kg) 58.5 73.5 58.2 61.5 60.8 Height (cm) 157 159 161 165 160 BMI (kg/m2)23.7 29.1 22.5 22.6 23.8 Waist (cm) 76 101 84 84 90 Hip (cm) 87 100 87 94 89 Waist-to-height ratio 0.9 1 1 0.9 1 Waist-to-hip ratio 0.48 0.64 0.52 0.51 0.56 Skinfold thickness (mm) Triceps 5.5 5 16 20 6 Biceps 4 7 8 11 5 Suprailiac 9 18 23 24 11 Subscapular 17.5 34 28 52 28 Thigh 3.9 6 15 12 4 Calf 3.7 3 15 15 2 DXA scan, fat mass (g) Fat % 21.3 31 38.6 38.9 28.9 Total fat 12,442 22,800 21,680 15,720 17,569 Upper-limb fat 993 2677 2757 2968 1991 Lower-limb fat 2454 4735 5383 6325 3151 Trunk fat 8040 14,446 12,734 15,452 11,601 Visceral fat 872 2070 871 1023 1247 Biochemical features Basal glucose (mg/dL) 103 218 67 94 96 Hemoglobin A1c (%) 6.2 7.2 5.3 5,.2 5.7 Plasma insulin (mIU/l) 5.9 ND 20 57.8 13 Peptide C (ng/mL) ND 2.1 ND 3,4 2,2 Plasma leptin (ng/mL) 2.4 9.7 ND 13 3,3 Total cholesterol (mg/dL) 146 174 264 220 161 Plasma triglycerides (mg/dL) 372 247 214 338 151 High-density lipoprotein cholesterol (HDLc) (mg/dL) 26 36 53 39 45 J. Clin. Med. 2021,10, 1497 8 of 15 Table 2. Cont. Demographic Features Low-density lipoprotein cholesterol (LDLc) (mg/dL) 39 89 169 113 86 Alanine aminotransferase (ALT) (IU/L) 27 56 13 44 26 Aspartate aminotransferase (AST) (IU/L) 16 65 16 26 20 Gamma-glutamyl transpeptidase (GGT) (UI/L) 9 57 23 23 14 Creatinine (mg/dL) 0.81 0.5 0.5 0.59 0.64 Creatine kinase (CK) ND 103 54 81 110 Thyroid stimulating hormone (TSH) 1.43 2.02 2.78 3.27 3.58 Blood pressure (BP) 136/79 147/80 125/69 135/89 155/87 Echocardiogram (ECHO) -normal -normal mitral regurgitation Medication Sitagliptin, Fenofibrate, Omega-3 fatty acids, Telmisartan Metformin, Insulin, Ramipril, Rosuvastatin, Aspirin, Dapaglifozin -Metformin Lormetazepam, Clopidogrel, Aldactone, Atorvastatin “Obstetric complications” include miscarriages, gestational diabetes and/or macrosomy. IFG, impaired fasting glucose. ND, not determined. SNP, single nucleotide polymorphisms. 3.1. Case Reports Case #1 is a 53-year-old female (Figure 1A). She has suffered from Crohn’s disease since her youth. The patient was diagnosed with FPLD when she was 42 years of age. The lipodystrophic phenotype started during childhood and was characterized by the lack of subcutaneous adipose tissue in limbs, abdomen and buttocks, rounded face, double chin, and a hypermuscular appearance with calf hypertrophy, phlebomegaly and small breasts. She did not have acanthosis nigricans, hirsutism nor cardiac disease (normal Holter and echocardiography). At that age, she had a normal BMI (23.7 kg/m 2 ), and reduced skinfolds in limbs, but in normal range in trunk (Table 2). She had hepatomegaly, albeit with normal glucose metabolism and no insulin resistance. On the other hand, she was taking omega-3 fatty acids for hypertriglyceridemia and her plasma leptin levels were low. At the age of 49, she was diagnosed with breast cancer and high blood pressure. At the age of 52, she was diagnosed with diabetes mellitus, and at present she is on sitagliptin, fenofibrate, n-3 fatty acids and telmisartan. Regarding her relatives, her mother (deceased) and sister had a similar lipodystrophic phenotype. Moreover, her mother had diabetes, hypertriglyceridemia, eruptive xanthomata, ischemic cardiopathy and suffered a stroke. Her 59-year-old sister also had high blood pressure and was diagnosed with diabetes mellitus when she was 52 years old, but she never came to the consultation for a medical evaluation. However, her lipid profile was always normal. Both the proband and her sister carry a heterozygous transition of cytosine to thymine in codon 1583 (exon 9) of the LMNA gene, leading to a substitution of threonine for methionine in the highly conserved protein residue 528. It was not possible to sequence the DNA of the deceased parents. Case #2 is a 58-year-old female diagnosed with diabetes mellitus at the age of 44 ( Figure 1B ). She was referred to the Endocrinology Division due to a lipodystrophic phenotype which began in childhood. She had fat loss in upper limbs, hips, thighs and calves, as well as fat accumulation in the face with double chin, in the upper back and the intra-abdominal region and scarce abdominal subcutaneous adipose panicle. Her upper and lower limbs were muscular with phlebomegaly. Her hands were large with thick fingers, and her calves were hypertrophied. There were no palpable lipomas. She presented acanthosis nigricans on the nape and axillae, and also some acrochordons. She J. Clin. Med. 2021,10, 1497 9 of 15 had high blood pressure, and hypertriglyceridemia. Her menstruation was regular and did not suffer from fertility problems. She had no cardiovascular diseases. Abdominal ultrasonography showed hepatomegaly (10–12 cm) with heterogeneous echostructure and irregular margins, suggestive of non-alcoholic steatohepatitis and splenomegaly of 15 cm. At the age of 54, she was diagnosed with polyclonal hypergammaglobulinemia and mild thrombocytopenia secondary to hepatopathy. A gastroscopy performed at the age of 58 showed incipient esophageal varices. The patient referred that her deceased mother, her daughter and two sisters had a similar phenotype, suggestive of familial partial lipodystrophy. The mother and sisters had been diagnosed with diabetes mellitus. There was no ischemic heart disease in her relatives. Case #3 is the 34-year-old daughter of Case #2. At 31 years of age, she presented an atypical, though not severe, FPLD phenotype with an androgenic distribution of fat but no obvious fat loss (Figure 1C). There was fat accumulation in the face, double chin and trunk (back and abdomen), but not in the hips, arms, buttocks or lower limbs. There was no hypermuscularity or well-defined muscles, except for minimal hypertrophy of the calves. The patient had no phlebomegaly. She claimed to have hyperphagia, and she had no diabetes mellitus, no dyslipidemia, no hepatomegaly and no atherosclerotic cardiovascular disease. At 34 years of age, she presented with hypertriglyceridemia and low fat in the arms, buttocks, hips, and lower limbs, and accumulation of fat in the face, double chin, trunk, abdomen, and axillae. She had a 2 cm lipoma on the right shoulder. She did not manifest hirsutism, and acanthosis was minimal in the axillae. Her palms and soles presented normal fat distribution, as did the rest of the physical examination. Case #4 is a 20-year-old female who has presented an FPLD phenotype since adolescence, with fat accumulation in the face, double chin, dorsal region, axillae, neck, arms and scapular region (Figure 1D). The presence of fat was scarce in the hips, buttocks, thighs, and calves. Fat was preserved in the abdomen. The patient presented phlebomegaly and marked musculature but the hypertrophy of the calves was doubtful. The amount of fat in her upper limbs was normal with no hypermusculation or phlebomegaly. She had acanthosis nigricans in the nape, axillae and groin. No lipomas were present. She had hirsutism, and no alopecia. She had not developed diabetes mellitus or hypertension. Menarche was at age 12, and oligomenorrhea/amenorrhea occurred before starting contraceptive treatment. She suffered a pulmonary thromboembolism at age 19. There were no subjects with diabetes in her family. Her father has hypertriglyceridemia and his lower limbs have normal musculature. Her mother refused to be examined. A paternal aunt and a cousin exhibited a similar phenotype. There was a significant history of cancer in her family: Her paternal grandmother suffered from leukemia, a paternal cousin died at the age of 5 from leukemia, her paternal aunts suffered breast cancer and a paternal uncle died of lung cancer. Case #5 is a 62-year-old female who has presented a classic FPLD phenotype since adolescence, with an absence of adipose tissue in the upper and lower limbs, buttocks and hips, as well as an accumulation of fat on the face, abdomen, chin, back and axillae ( Figure 1E ). Her musculature was well-defined in the arms, lower limbs and buttocks. She had minimal phlebomegaly in her arms, frontotemporal alopecia and hirsutism in her thighs. No lipomas or acanthosis were present. There was no hepatomegaly or splenomegaly. She had a multinodular goiter. The patient did not suffer from diabetes mellitus, but she did have hypertension, hyperlipidemia and muscle aches. At age 53, she underwent a bypass for a revascularized heart disease. She had no fertility problems. She claimed to have hyperphagia. Her father (deceased) exhibited a similar phenotype. He had no diabetes mellitus nor heart disease. Her paternal grandmother also had a similar phenotype. The five cases studied are heterozygous for the variant c.1583C>T, p.(Thr528Met) in the LMNA gene (rs57629361, ENST00000368300.8, NM_170707.2(LMNA):c.1583C>T). This variant is classified as pathogenic according to ACMG guidelines (PM1, PM2, PM5, PP2 y PP3) and its allele frequency in the European Non-Finnish (ENF) population is