Exploring the molecular mechanisms of the human VGF-derived antidepressant neuropeptide TLQp-62 on neurogenesis

TESE DE DOUTORAMENTO DOCTORAL THESIS ON MOLECULAR MEDICINE EXPLORING THE MOLECULAR MECHANISMS OF THE HUMAN VGF-DERIVED ANTIDEPRESSANT NEUROPEPTIDE TLQP-62 ON NEURODIFFERENTIATION DANIELA MESQUITA MOUTINHO ESCOLA DE DOUTORAMENTO INTERNACIONAL PROGRAMA DE DOUTORAMENTO EN MEDICINA MOLECULAR SANTIAGO DE COMPOSTELA, SPAIN 2018 DECLARACIÓN DA AUTORA DA TESE EXPLORING THE MOLECULAR MECHANISMS OF THE HUMAN VGF-DERIVED ANTIDEPRESSANT NEUROPEPTIDE TLQP-62 ON NEURODIFFERENTIATION Dna. Daniela Mesquita Moutinho, mestre en Xenética Molecular e Biomedicina pola Facultade de Ciencias e Tecnoloxía da Universidade Nova de Lisboa, Portugal, presento a miña tese, seguindo o prodecimento axeitado ao regulamento, e declaro que: 1) A tese abarca os resultados da elaboración do meu traballo. 2) De selo caso, na tese faise referencia ás colaboracións que tivo este traballo. 3) A tese é a versión definitiva presentada para a súa defensa e coincide coa versión enviada en formato electrónico. 4) Confirmo que a tese non incorre en ningún tipo de plaxio doutros autores nin de traballos presentados por min para a obtención doutros títulos. En Santiago de Compostela, 11 de Outubro de 2018 Asdo . AUTORIZACIÓN DO DIRECTOR DA TESE EXPLORING THE MOLECULAR MECHANISMS OF THE HUMAN VGF-DERIVED ANTIDEPRESSANT NEUROPEPTIDE TLQP-62 ON NEURODIFFERENTIATION D. Jesús Rodriguez Requena, Doutor en Ciencias Químicas, Profesor Contratado Doutor do Departamento de Medicina da Universidade de Santiago de Compostela, INFORMA que: a presente tese, correspóndese co traballo realizado por Dna. Daniela Mesquita Moutinho, baixo a miña dirección, e a utorizo a súa presentación, considerando que reúne os r equisitos esixidos no R egulamento de Estudos de Doutoramento da USC, e que como director desta non incorre nas causas de abstención establecidas na Lei 40/2015. En Santiago de Compostela, 11 de Outubro de 2018 Asdo. DECLARACIÓN DE CONFLICTOS DE INTERESES EXPLORING THE MOLECULAR MECHANISMS OF THE HUMAN VGF-DERIVED ANTIDEPRESSANT NEUROPEPTIDE TLQP-62 ON NEURODIFFERENTIATION Dna. Daniela Mesquita Moutinho, mestre en Xenética Molecular e Biomedicina pola Facultade de Ciencias e Tecnoloxía da Universidade Nova de Lisboa, Portugal, declaro que: non hai conflictos de intereses no presente traballo. “Cada pessoa deve trabalhar para o seu aperfeiçoamento e, ao mesmo tempo, participar na responsabilidade colectiva por toda a humanidade” “Every person must work for his own improvement, and at the same time he must share a general responsibility for all humanity.” Marie Skłodowska Curie This work was supported by EC under Mare Curie Initial Training Network FP7PEOPLE-2013-ITN (607616) and as a part of the In-Sens: Deciphering interand intracellular signalling in schizophrenia program. 5 RESUMO As enfermidades neuropsiquiátricas afectan un 10% da población mundial. Porén, do ponto de vista biolóxico e molecular non hai ainda moita información que permita un tratamento e diagnóstico efectivos. Un dos procesos que está afectado nestas enfermidades é a neuroxenese. Varios xenes e as correspondentes proteínas ten sido implicados en enfermidades mentais e neurolóxicas, e na neuroxénese adulta, como é o caso de DISC1 (do ingles, Disrupted in Schizophrenia 1) e VGF (sen acronimo) que estan implicados na via de sinalización BDNF/TrkB/ /CREB da neuroxénese hipocampal. DISC1 regula VGF via PI3K/AKT /CREB na liña celular humana SHSY5Y. VGF é inducida por NGF e BDNF, e é o precusor de vários outros pequenos neuropéptidos, como TLQP-62. Este péptido ten un efeito antidepresivo promovendo a neuroxénese hipocampal aumentando a actividade sináptica e dendritoxénese, sendo un alvo de investigación interesante na busca de tratamento para estas enfermidades. No presente estudo, dividido en tres capítulos, se evaluaron os efeitos de TLQP-62 humano na diferenciación da liña celular SHSY5Y, se intentou a encontrar un receptor para TLQP-62 e aínda se determinou a estrutura tridimensional deste péptido. TLQP-62 ten a capaciade para inducir a diferenciación das células promovendo o aumento das neuritas. No estudo proteómico, TLQP-62 induce a expresión de varias proteinas relacionadas con procesos de neurodesenvolvimento e plasticidade sináptica, como crecimento e comunicación celular, metabolismo e biosíntese, función mitocondrial e resposta imunolóxica. Estes procesos son fundamentais para a neuroxéneses e estan desregulados en varias enfermidades mentais e neurolóxicas. DANIELA MESQUITA MOUTINHO 6 Para mellor entender os mecanismos moleculares de TLQP-62 na neuroxénese e neurodiferenciación é necesario determinar o receptor de TLQP-62. Utilizouse cromatografia de afinidade pola avidina para isolar o receptor do lisado de celulas SH-SY5Y con biotina-TLQP-62, identificándose o receptor acoplado á proteina G OR5P3. Comprobouse a capacidade de TLQP-62 para aumentar os niveis de cAMP num modelo celular que sobreexpresa OR5P3. A chaperona HSPA8 foi tambén identificada e a sua capacidade para interaccionar con TLQP-62 foi evaluada por análise de redistribuición dinámica de masa. A estrutura de TLQP-62 foi avaliada e determinouse ser maioritariamente desorganizada en transición con unha alfa-helice, que probabelmente será estabilizada en complexo con HSPA8 ou OR5P3. Futuros estudos estruturais e moleculares son necesarios para mellor comprender os mecanismos de acción de TLQP-62 e de que forma é que un potencial agonista pode ser producido e usado como tratamento para algumas enfermidades neuropsiquiátricas e neurolóxicas. 7 SUMMARY Neuropsychiatric disorders, as major depression, schizophrenia or bipolar disorder, affect about 10% of world population, having a huge impact on society and a bigger stigma. Knowledge from a molecular and biological view is still poor, and diagnostic and treatment are lacking effectiveness, leading to a high suicide index. These disorders have a genetic and environmental component, and some genes have been pointed out as possible risk factors. Although diagnose is performed through self-reporting of patient in a clinical interview and behaviour observation, there are evidence from patients suffering from these disorders of hippocampal abnormality with reduced volume and decreased cell proliferation, which affect cognitive functions and memory. Changes can be reversed by treatment with antidepressants, antipsychotics or physical exercise, by having an impact on neurogenesis. Neurogenesis is the generation of new neurons from neural stem cells, occurring mainly during the embryonic brain development, but it continues during life in some areas of the brain, mainly being in the subgranular zone of dentate granule cells in the dentate gyrus of the hippocampus and subventricular zone of interneurons in the olfactory bulb. This process generates new cells that suffer migration, differentiation with axon and dendrite outgrowth, and synapse formation to integrate the pre-existing neuronal circuit, confering plasticity to those regions. Understanding the molecular mechanisms underlying adult neurogenesis may give critical insight for successful treatment for these disorders. The BDNF/TrkB/CREB signalling pathway has been shown to be implicated in hippocampal neurogenesis, together with some other proteins, as DISC1 and VGF. DANIELA MESQUITA MOUTINHO 8 DISC1 was found mutated, leading to its dysregulation, in individuals with schizophrenia, schizoaffective disorder, bipolar disorder or major depression. This protein is linked to neurogenesis and it functions as a scaffold protein, interacting with several other proteins important for neurodevelopment and synaptic function. It has been previously reported that DISC1 knockdown produces a significant downregulation of VGF, a nerve growth factor responsive gene, in SH-SY5Y cells. DISC1 apparently does not interact directly with VGF but seems to regulate this gene expression through the PI3K/AKT/CREB pathway. VGF is a peptide precursor for TLQP-62, an antidepressant neuropeptide that promotes hippocampal neurogenesis, with an effect on memory and learning, through a BDNF-dependent mechanism, increasing synaptic activity and dendritic branching. Thus, this neuropeptide is a very attractive target for further search and investigation of its role and molecular mechanisms in neurogenesis and neurodifferentiation. Also, the identification of TLQP-62 receptor(s) and mediated signalling pathways are crucial for a better understanding of these neuropeptide molecular mechanisms, as well as the three-dimensional structures, for further investigation for agonists to be used as a treatment for chronic mental disorders. The human derived cell line SH-SY5Y reproduces biochemical and morphological properties of neurons, being often used as a human in vitro model. Those cells can be induced to differentiate into a more neuron-like phenotype, through retinoic acid induction, and express high levels of VGF. Thus, those cells can be used as a model for neurogenesis concerning the neurodifferentiation step. In the present study the effect of TLQP-62 on SH-S5Y5 was evaluated, concerning its ability to induce proliferation and/or neurodifferentiation with neuritogenesis and dendritogenesis. Morphological and proteomic evaluation were performed. TLQP-62 is capable alone of induce neurodifferentiation on SH-SY5Y cells, rather than proliferation, promoting more and longer dendrites with occasional connection between cells. Moreover, in a proteomic analysis, several proteins involved in neurodevelopment and synaptic 9 plasticity processes – as cell growth and communication, biosynthesis and metabolism, fatty acid and glucose metabolism, and immune an inflammatory response – are increased by TLQP-62. These processes are known to be implicated in neurogenesis and in neurological disorders. To better understand the molecular mechanisms of TLQP-62 in neurogenesis and neurodifferentiation processes, as dendritogenesis, it is crucial to know the TLQP-62 receptor(s), and for that an avidin affinity chromatography assay was performed to membrane fraction of SH-SY5Y cells incubated with biotin-TLQP-62 crosslinked with sulfo-EMCS. Olfactory receptor 5P3 was isolated, a GPCR, apparently classified as an olfactory receptor based on homology. TLQP-62 is capable of increase cAMP levels in a cell model overexpressing OR5P3, proving it is an active ligand for this receptor and may act through a Gs protein signalling pathway. HSPA8 and HSPD1 were also isolated. HSPA8 have been previously described as a TLQP-21 binding protein, and in the present study was proved to interact with TLQP-62 by label-free dynamic mass redistribution analysis. The structure of TLQP-62 was also explored in order to further understand its interaction with OR5P3 and HSPA8. In solution TLQP62 acts as a random coil transitory with an α-helix, which might be stabilized upon binding to HSPA8 or to its receptor OR5P3. Moreover, HSPA8-OR5P3-TLQP-62 might form a complex to activate a signal transduction pathway. Further structural insights into this putative complex can help developing a pharmacological drug agonist for this receptor to enhance neurogenesis and to be used as a treatment of some neuropsychiatric and other neurological disorders. All data taken together contribute to better understand TLQP-62 mechanism of action in neurogenesis and neurodifferentiation, and also in mental and neurological disorders. 11 TABLE OF CONTENTS Page Resumo/Summary ………………………………………….……...……. 3 Table of Contents ……………………………………..………….…..... 11 List of Abbreviations ………………………………………………....... 17 GENERAL INTRODUCTION ..……………………………………………….. 21 1 NEUROPSYCHIATRIC DISORDERS ………..………………………….…. 23 1.1 Major Depression ……………………….…………………...…. 25 1.2 Bipolar Affective Disorder ……………….…………………...... 27 1.3 Schizophrenia ………………………………………….…….… 28 2 ADULT NEUROGENESIS AND NEUROPSYCHIATRIC DISORDERS ……….. 31 3 DISC1 ………………………………………………………..……….… 33 3.1 Gene and Protein ………………………..………………………. 34 3.2 Interactions and Subcellular Localization ………......………..… 35 3.3 Functions …………………………………………………...…... 36 3.4 DISC1 and VGF …………………………………………...……. 36 4 NEUROPEPTIDE VGF ……………………………………………….…. 37 4.1 Gene, Protein and T issue Distribution ……………………..…... 37 4.2 Derived peptides and Functions ……………………………..….. 38 4.2.1 Role in Energy and Water Balance ….………………….... 40 4.2.2 Role in Gastrointestinal Function ……………………...… 41 4.2.3 Role in Reproduction ………………………………...…. 41 4.2.4 Role in Pain Modulation …….………………….……….. 42 4.2.5 Role in Memory and Learning ..………………….………. 43 4.3 Role in Neuropsychiatric Disorders ………..………..……….… 43 12 5 ANTIDEPRESSANT TLQP-62 NEUROPEPTIDE ………………………….. 45 5.1 Functions ……………………………………….……...………. 45 5.2 Signaling Pathways …………………………….……………… 46 OBJECTIVES ..……………………………………………...…………..….. 49 CHAPTER I | Effect of TLQP-62 on SHSY-5Y differentiation ..….…… 53 1 INTRODUCTION …………………………………………………….…... 55 2 OBJECTIVE …..……………………………………………………....…. 58 3 METHODS ……….……………………………….………………...….. 59 3.1 Human TLQP-62 peptide …………….…………………...…..... 59 3.2 SH-SY5Y cell culture ……………………..…………………...... 59 3.2.1 SH-SY5Y preparation for morphol ogy studies ……….…. 60 3.2.2 SH-SY5Y culture for proteomic studies ……………….… 60 3.3 Immunocyt ochemistry ………………………………………....... 60 3.4 Protein extraction and Quantification …..………………………. 61 3.5 Monodimensional (1D) SDS-PAGE ……………………………. 62 3.6 Imunoblotting .….……………………….………………………. 62 3.7 Bidimensional Fluorescence Differential Gel Electrophoresis …. 63 3.7.1 Fluorescent labelling and Rehydration …….…………….. 63 3.7.2 First dimension: IEF and Equilibration …..…………........ 64 3.7.3 Second dimension: SDS-PAGE ………………………….. 65 3.8 SYPRO Ruby protein gel staining ……………………………… 66 3.9 Mass Spectrometry ………………………………………….….. 66 4 RESULTS …..……………………...………………………………….. 67 4.1 Confirmation of VGF expression on SH-SY5Y cells ………....... 67 4.2 TLQP-62 promotes differentiation and neuritogenesis on SH-SY5Y ……...………………………………………………… 68 4.3 TLQP-21 moderately inhibits proliferation on SH-SY5Y ……… 70 4.4 VGF silencing affects SH-SY5Y cell viability …..………....…… 72 4.5 TLQP-62 supports SH-SY5Y RA-induced differentiation …..…. 72 4.6 SH-SY5Y morphological effects of TLQP-62 and DISC1 …….... 75 13 4.7 Proteomic study of RA-differentiated SH-SY5Y cell response to TLQP-62 by 2D-DIGE: Upregulation of proteins involved in neurodevelopmental and synaptic processes, energy metabolism, oxidative stress and immune response ………...….……………. 77 5 DISCUSSION …………………….……….......…………………………. 85 5.1 VGF is required for normal cell survival and proliferation, and TLQP-62 promotes and supports SH-SY5Y on neurodifferentiation and neuritogenesis ………..……………....... 86 5.2 TLQP-62 and DISC1 regulates neuronal differentiation .…..…… 89 5.3 TLQP-62 supports neuritogenesis by inducing and supporting the expression of several proteins involved in neurodevelopmental and synaptic processes …………………………….……...…….. 90 CHAPTER II | Olfactory receptor 5P3: a human TLQP-62 receptor ….. 99 1 INTRODUCTION …………………………………....…..………….…… 101 2 OBJECTIVE …….…………………………….…………………….…. 102 3 METHODS ……………..………………….....……...……………..….. 103 3.1 Human hippocampus homogenate preparation ………....……… 103 3.2 SH-SY5Y cell culture & protein fraction preparation ...………. 103 3.3 Protein preparation and quantification …...……….…....…..….. 104 3.4 Biotinylated TLQP-62 peptide and crosslinker conjugation ...… 104 3.5 Monomeric avidin agarose affinity chromatography ………….. 10 5 3.5.1 Purification of biotin-TLQP-62 crosslinked with SH-SY5Y membrane proteins …………………………. 105 3.5.3 Purification of biotin-TLQp-62 crosslinked with hippocampus homogenate proteins ……….......…….…. 105 3.6 Monodimensional (1D) SDS-PAGE ……………..…….………. 106 3.7 Immunobloting …………………………..…………...………… 106 3.8 Mass spectrometry ………………………..…………...………. 106 3.9 Immunocytochemistry ………………………………...………. 106 3.10 Analysis of HSPA8-TLQP-62 interaction by label-free dynamic mass redistribution analysis ………………..…..……. 107 DANIELA MESQUITA MOUTINHO 20 RXR Retinoid X receptor S6K1 Ribosomal protein S6 kinase 1 SCZD Schizophrenia SDS Sodium dodecyl sulfate shRNA Short hairpin ribonucleic acid sulfo-EMCS Sulfo-N-[ɛ-maleimidocaproyloxy]succinimide ester TBS Tris buffered saline TCA Trichloroacetic acid TCEP Tris(2-carboxyethyl)phosphine TPH Tryptophan hydroxylase Trk Tyrosine kinase TUBB Tubulin beta chain VEGF Vascular endothelial growth factor GENERAL INTRODUCTION 23 GENERAL INTRODUCTION 1 NEUROPSYCHIATRIC DISORDERS Neuropsychiatric disorders, such as schizophrenia, major depression, bipolar disorder, and other affective disorders, are characterized as the impairment of intellectual functions and memory with deterioration of personality with the course of being progressive, stationary or reversible. In another words, neuropsychiatric illness causes brain dysfunction affecting perception, thinking, language, mood and behavior. Data obtained from US National Institute for Mental Health (NIMH) indicated that in 2012, 1.1% of adult US population was affected with schizophrenia, 2.6% by bipolar disorder and 6.9% by major depression (www.nimh.nih.gov). In European Union, the statistics indicate that 27% of adult population had experienced at least one episode of mental disorder, being major depression the leading cause of chronic disorders in Europe (www.euro.who.int). Mental disorders have a huge impact on society at a medical and financial level, being the third most costly medical condition around the world. Also, the lack of information and effective treatment makes these disorders a target of stigma on society. These progressive diseases are poorly understood from a molecular and biological point of view and are diagnosed as mere clinical phenotypes by self-reporting of patients in a clinical interview according to internationally defined criteria (American Psychiatric Association APA. Diagnostic and Statistical Manual IV (DSM IV), Washington DC 1994). Neuropsychiatric disorders are the most prevalent neurological disorders affecting about 10% of world population. DANIELA MESQUITA MOUTINHO 24 Effective treatment includes a combination of several factors as medication, healthy life style, education, job, peer support and psychotherapy. Although there are several antipsychotics, antidepressants and mood stabilizing drugs, ~30% of patients do not respond to these drugs, have undesired secondary symptoms, or a poor efficacy, ameliorating some of the symptoms, but not the core pathology, like in the case of classical antipsychotic for schizophrenia, that prevent positive symptoms, but have limited efficacy for negative and cognitive symptoms (Figure GI.1). This can lead to a higher suicide index and thus better treatment is needed. Anxiety Sleep problems Heart palpitations Chest pain FIGURE GI.1 | SCHEMATIC REPRESENTATION OF 5 MAJOR MENTAL DISORDERS MAIN SYMPTOMS: schizophrenia, bipolar disorder, major depression, autism spectrum disorder and attention deficit hyperactivity disorder. Major Depression “Anergy” Difficulty making decisions Sad, anxious or empty mood Reduced or increased appetite Insomnia or hypersomnia Feeling worthless Bipolar Disorder Grandiose delusions Increased physical / mental activity Racing speech and thoughts Irritability and aggressive behavior Exaggerated optimism Impulsiveness 6& ADHD Inattention Hyperactivity Impulsivity Schizophrenia Positive: delusions, hallucinations, unstable emotions and behavior, disordered thinking Negative: anhedonia, apathy, catatonia Cognitive: poor memory and concentration Affective: depression Autism Social communication and interaction problems Suicidal thoughts GENERAL INTRODUCTION 1 Neuropsychiatric Disorders 25 These disorders tend to run in families as they share certain genetic roots and symptoms, suggesting similarities at a biological level. The international research Psychiatric Genomics consortium conducted an analysis that incorporated data from the genome-wide associated studies (GWAS) of the 5 major mental disorders. The analysis revealed two L-type voltage-gated calcium channel subunits CACNA1C and CACNB2 genes to be linked to the 5 disorders1. Another GWAS revealed that schizophrenia, depression and bipolar disorder are not only linked through shared genes, but the genetic mutations associated with them also work together to rule immunity, neuronal signaling and genome function later in life, which could mean that only one drug could be required to treat all these disorders2. 1.1 MAJOR DEPRESSION According to NIMH and WHO, major depressive disorder (MDD; OMIM#608516) is the leading cause of disability worldwide and it can cause the affected person to suffer severely, compromising its normal social functions and activities, and leading, at its worse, to suicide. This common illness can be defined as the presence of a depressed mood or loss of interest or pleasure, and at least four other symptoms reflecting change in functioning, such as problems with sleep, eating, energy, concentration, and having feelings of guilt or low self-worth, for two weeks or longer. Many people that suffer from depression also suffer from anxiety symptoms. Antidepressant drug treatments for both depressive and anxiety disorders target monoaminergic neurotransmission, based on serotonin and catecholamine hypotheses3–5. These hypotheses consist in the notion that diminished activity of serotonin and monoamines plays a causal role in the pathophysiology of depression that can be reversed by antidepressants, restoring normal functioning6. Selective serotonin reuptake inhibitors are used to treat depression and anxiety, by increasing hippocampal cell proliferation (neurogenesis) and enhanced expression of neuroplasticity related proteins, such as brain derived neurotrophic factor (BDNF). However not all patients benefit from it The 5 major neuropsychiatric disorders are schizophrenia, bipolar disorder, major depression, autism spectrum disorder and attention deficit hyperactivity disorder (ADHD). DANIELA MESQUITA MOUTINHO 26 and several drug devoid of major effects on serotonergic neurotransmission are effective to improve mood7,8. Thus, there is a growing consensus that altered monoaminergic transmission is insufficient to explain the etiology of depressive disorders and that currently used antidepressants instead are modulating other neurochemical systems that have a more fundamental role in MDD9. Another hypothesis is explained by Hypothalamic-Pituitary-Adrenal (HPA) axis hyperactivity, that leads to stress and has been associated with neuropsychiatric disorders as it causes hippocampal volume reduction with dendritic process atrophy, decreased neurogenesis and neuroplasticity and neuronal losses10,11. MDD can be also explained converging genetic, epigenetic and stressinduced deficits in GABAergic transmission, as the therapeutic effects of currently used monoaminergic antidepressants involve downstream alterations in GABAergic transmission. Reduced brain concentration of γ-aminobutyric acid (GABA) and alterations in GABA receptors mediating GABAergic inhibition are observed in MDD patients. GABA plays a prominent role in the brain control of stress, the most important vulnerability factor in mood disorders, controlling hippocampal neurogenesis and neural maturation12. It is known that no single gene is necessary and sufficient for MDD, that each susceptibility gene contributes a small fraction of the total genetic risk and that there is a complex genetic heterogeneity that can predispose individuals to similar syndromes that are clinically indistinguishable. Several genetic biomarker candidates have been proposed for better understanding and treatment of depression, although these are dependent of environmental factors13. Some of those genes that have been pointed out as risk factors for MDD are CACNA1C1, Serotonin Transporter (5HTT)14,15, Serotonin Receptors (5HTR)16–21, Catechol-O-methyltransferase (COMT)22,23, Dopamine Transporter (DAT1)24,25, Dopamine Receptors (DRD)26–30, Tryptophan Hydroxylase (TPH)31, Methylene Tetrahydrofolate Reductase (MTHFR)13,32,33, Apolipoprotein E (APOE) 34,35, Guanine nucleotide binding protein (GNB3)36,37, Cyclic adenosine monophosphateresponsive element-binding protein 1 (CREB1)38–41, BDNF42,43. MDD is one of the most common mental disorders affecting people from all ages. GENERAL INTRODUCTION 1 Neuropsychiatric Disorders 27 1.2 BIPOLAR AFFECTIVE DISORDER Bipolar affective disorder (BPD; OMIM 125480), also known as major affective or manic-depressive disorder, is characterized by the shifting from a depression mood of feeling down, empty or hopeless, with lack of energy, to manic episodes, involving feeling “up”, with a lot of energy and irritable mood, over activity, inflated self-esteem and a decreased need for sleep. Sometimes patients can suffer psychotic symptoms, as hallucinations or delusions, anxiety and ADHD44. Symptoms of ADHD include poor concentration, distractibility, impulsivity, restlessness, and agitation that are also features of a manic episode. Anxiety worsen the course and prognosis of BPD. Mood stabilizers, antidepressants and atypical antipsychotics help to treat bipolar disorder45. There is not a single hypothesis regarding genetic, biochemical, pharmacological or anatomical cause46. Biochemical investigations focus on neurotransmitters (serotonin, catecholamines, GABA, glutamate and others), hormones (brainderived neurotrophic factor, thyroid and others), and steroids. The catecholamine hypothesis explains mania as an excess, and depression due to a depletion of catecholamines. Norepinephrine has been implicated because of abnormalities linked with depression including its modulation by tricyclic antidepressants. Dopamine has been implicated because the dopamine precursor L-dopa, amphetamines, and tricyclic antidepressants often produce hypomania in bipolar patients. Antipsychotic medications that selectively block dopamine receptors are effective against severe mania. The “permissive serotonin hypothesis” says that low serotonergic function accounts for both manic and depressive states through defective dampening of other neurotransmitters (mainly norepinephrine and dopamine). Some use this as an explanation as to why some bipolar patients do better on such antidepressants, including rare cases of mania that dissipate. Neuroanatomical and neuroimaging studies show that lesions in the frontal and temporal lobes are most frequently associated with bipolar disorder. Left-sided lesions tend to be associated with depression and right-sided lesions with mania. The circadian rhythm desynchronization has also been implicated in bipolar disorder. Some of the risk factor genes are common to BPD, SCZD and MDD. DANIELA MESQUITA MOUTINHO 28 There is evidence of heritability and specific genes have been linked to the predisposition to bipolar disorder26,47–49. Some of those are CACNA1C1,50–52, Ankyrin-G (ANK3)50,53–55, Neurocan (NCAN)56– 58, Monoamine oxidase A (MAOA)48,59,60, COMT61,62, Dysbindin63, MTHFR33,64,65, 5HTT26,66, 5HTR1A17, D-amino acid oxidase activator (DAOA)59,67,68, BDNF69–72, Nesprin73, Disrupted in Schizophrenia 1 (DISC1)74, G-protein receptor kinase 3 (GRK3)75–77. Some of these genes were also found to be linked to schizophrenia49,61 and to MDD73 (Table I.1). Although bipolar disorder and schizophrenia are classified and treated as separate diseases with separate etiologies, there are similar features and genetic observations that bring these two disorders closer, and some individuals show mood and psychotic features classified as schizoaffective disorder. These three disorders tend to occur in members of a same family78. 1.3 SCHIZOPHRENIA Schizophrenia (SCZD; OMIM#181500) is a chronic severe mental illness affecting thought, feeling and behaviour. It is not as common as depression, but the symptoms are very disabling. Children can have schizophrenia, but usually the first episode happens in the adolescence up to the age of thirty. Symptoms of schizophrenia can be positive, negative, cognitive and affective (Figure GI.1). Schizophrenia is a heterogeneous syndrome considered a disorder with a neuro-developmental component with a genetic inherited origin having a highly heritability. Many different genes may increase its risk in some cases (Table I.1) but not all, as environment can also have a strong influence on the onset of this disorder. So far, causes of the disease remain incompletely understood, but some risk factors have been identified49. Several candidate genes have been pointed out as having a role on schizophrenia aetiology: as DISC174,79–81, NCAN56,58, DRDs82–84, COMT85,86, MTHFR33,64, 5-HTR2A87, BDNF88, Neuroregulin 1 (NRG1)89–94, Dysbindin95–97, D-amino acid oxidase (DAO) and DAOA98–101, Regulator of G-protein signalling 4 (RGS4)102–104, Proline dehydrogenase (PRODH)105–107, Metabotropic glutamate receptor 3 (mGluR3)108,109. Some of these genes have also been associated with bipolar disorder and depression (Table GI.1)110– 112. GENERAL INTRODUCTION 1 Neuropsychiatric Disorders 29 TABLE GI.1 | CANDIDATE GENES WITH THE STRONGEST EVIDENCE FOR A ROLE IN THE GENESIS OF SCHIZOPHRENIA, BIPOLAR DISORDER AND DEPRESSION (adapted from 49,113) Gene Hypothesized Role SCZ evidence BP evidence MDD evidence Disrupted in schizophrenia 1 (DISC1) Poorly understood: possible roles suggested in synaptogenesis and neurodevelopment +++ ++ + Neuroregulin 1 (NRG1) Effects on synaptic plasticity, neuro-development and transmitter activity ++ + Dysbindin (DTNBP1) Via synaptic glutamate release ++ + Regulator of G-protein signaling 4 (RGS4) Modulates activity serotonergic and metabotropic glutamatergic receptors; modulated by dopaminergic transmission + Dopamine receptors (DRD2/DRD3/DRD4) Receptors for dopamine, associated with cognitive, emotional, and endocrine functions + ++ Serotonin 1A/2A receptor (5-HTR1A/2A) Receptor for serotonin, a neurotransmitter with many roles + ++ Metabotropic glutamate receptor 3 (mGluR3) NMDA receptor effects via affecting presynaptic glutamate release + Proline dehydrogenase (PRODH) Possibly affects ratio of Lto Dserine, that may have a role in regulation of NMDA receptor + Catechol-O-methyl transferase (COMT) Metabolizes cerebral monoamines including dopamine + + + D-amino acid oxidase activator (DAOA) Modulation of synaptic transmission ++ + + Methylene tetrahydrofolate reductase (MTHFR) Catalyzes the conversion of 5,10methylenetetrahydrofolate to 5methyltetrahydrofolate + + + Brain-derived neurotrophic factor (BDNF) Promotes survival and differentiation of selected neuronal populations of the peripheral and central nervous systems + ++ +++ DANIELA MESQUITA MOUTINHO 36 FIGURE GI.4 | PROPOSED DISC1 REGULATION OF VGF. Trk receptors are activated and recruit Grb2 and Gab2 leading to the activation of PI3K, that activates CREB which in turn promotes VGF expression. DISC1 directly interacts with Grb2 and it is necessary to its proper localization. Lower levels of DISC1 fail to localize Grb2, disrupting this pathway, leading to lower VGF levels. [Constructed from data of Rodríguez-Seoane et al. 2015] 3.3 FUNCTIONS DISC1 presumed functions are based on its interacting partners, suggesting that if it acts as a scaffold protein it affects the function of different proteins at different locations. DISC1-related psychiatric disorders are likely to arise through the dysregulation of not just one, but several protein interactions at once, affecting neurodevelopmental and signalling pathways. Therefore, DISC1 plays a role on cAMP signaling pathway, dopamine and glutamate signaling, synaptic activity, myelination, neuronal migration, interacting with several proteins related with the cytoskeleton; neuronal proliferation, by interacting with GSK3β, and differentiation, neurite outgrowth, and adult neurogenesis174,184. High levels of DISC1 are found in cells in dentate gyrus in hippocampus and interneurons on olfactory bulb, where it participates in different steps of adult neurogenesis151. Patients suffering from mental illness show reduced olfactory bulb and hippocampal volume, and olfactory and memory dysfunction115,185,186. 3.4 DISC1 AND VGF Our group reported that DISC1 knockdown SH-SY5Y cells produce a significant downregulation of VGF, a nerve growth factor responsive gene187. DISC1 apparently does not interact directly with VGF, but instead seems to regulate VGF expression through the phosphoinositide 3-kinase (PI3K) /protein kinase B (AKT) /CREB pathway (Figure GI.4)148. VGF is a peptide precursor with potent antidepressant effects promoting adult neurogenesis on hippocampus associated with BDNF signalling150,188–190. VGF lower-than-normal levels have been associated with schizophrenia, depression, bipolar disorder and other neurological disorders191–194. GENERAL INTRODUCTION 37 4 NEUROPROTEIN VGF VGF gene was identified after its strong induction by exposure to nerve growth factor (NGF) in PC12 cells195. PC12 is a cell line derived from a pheochromocytoma of the rat adrenal medulla with an embryonic origin from the neural crest that has a mixture of neuroblastic cells and eosinophilic cells, and have been widely used as a model for neural differentiation196. VGF was named from the selection of this clone from plate V of Nerve Growth Factor induced PC12 cell cDNA library. VGF expression is induced by neurotrophins, as such neurotrophin-3 (NT3) or BDNF through CREB, and by 5-HT and drugs that increase this neurotransmitter levels189,197,198. The resulting secreting neuroprotein is widely expressed in neurons in brain, spinal cord and neuroendocrine organs, but regulated in response to different stimuli that originate different smaller peptides, involved in regulation of energy homeostasis, metabolism and synaptic plasticity, and stored in secretory vesicles199. 4.1 GENE, PROTEIN AND TISSUE DISTRIBUTION Human VGF gene (Ensembl ID: ENSG00000128564) is located at chromosome 7 in the q22 region, and contains 3 exons and several consensus motifs for transcriptional regulators within its promoter. Some of these consensus sequences are a TATA box along with a CCAAT box, for the RNA transcription factor binding, various SP-1 (specificity protein 1) and AP-2 binding sites, an enhancer box, for gene expression regulation through transcription factors, a cAMP response element (CRE) and a CREB binding sites200–202. VGF expression is induced by activity, such as physical and mental exercise: running, learning, memory, synaptogenesis or long-term potentiation; resulting in an antidepressant-like effect188,190,203–206. VGF mRNA is present in neurons of hypothalamus, hippocampus, olfactory system, including olfactory bulb, cerebral cortex, amygdala, brain stem, cerebellum and spinal cord, in motor and sensory neurons and neuroendocrine organs, as pituitary, adrenal gland, and DANIELA MESQUITA MOUTINHO 38 gastrointestinal tract207. VGF mRNA in hypothalamus alters in response to feeding or fasting, salt loading or seasonal rhythms, and in pituitary varies during estrous cycle208–212. Full proVGF human protein sequence is encoded only for the 2.3 kb of the third exon originating a 615 residues (617 in mouse/rat) proneuroprotein with predicted 68 kDa (Figure GI.5), but detected as a 80-90 kDa doublet. This acidic protein is proline and glycine rich, and belongs to the family of granins, a family of proteins responsible for controlling the endocrine, neuroendocrine and neuronal cells supply of neurotransmitters, hormones, growth factors and peptides213,214. ProVGF is a precursor that is processed into more than 15 different neuropeptides (Figure GI.5) by prohormones convertases PC1/3 and PC2 at its C-terminal, but the known N-terminal peptides are not compatible with the known motifs required for PC enzymes, meaning that some VGF-derived peptides are generated by other endoproteases yet not identified199,215–219. After proteolytic process in a postendoplasmic reticulum compartment the derived peptides are kept and enriched in vesicles, and released in response to membrane depolarizing stimuli, playing several roles in neuronal communication 199,220. 4.2 VGF-DERIVED PEPTIDES AND THEIR FUNCTIONS Studies in mouse, rat, bovine and human revealed several VGFderived peptides. VGF gene and protein are very highly conserved in these species and one can expect to find the same derived peptides in all those species. Several N-terminal VGF derived peptides were identified in mouse or rat and its correspondents in human: APPG-37, APPG-40, GRPE-37, neuroendocrine regulatory peptides (NERP) 1, 2 and 3, and big NERP-2194,221. VGF C-terminal derived peptides were also identified in mouse, rat, bovine and human. Peptide ELQE-20 found in mouse222 and peptides HFHH-10, HFHH-51 and HHPD-41 were found in rat, the last exhibits bioactivity, but until date no human analogous have been reported223 . Peptide GGGE was found in rat and its analogous in human GGEE have been described. Peptides TPGH, NERP-3, NERP-4, NAPP-129, TLQP-62, TLQP-21, TLQP-24 (antimicrobial peptide), AQEE-30 (peptide V), AQEE-11, LQEQ-19, were found in mouse, rat and human, and shown to be bioactive. GENERAL INTRODUCTION 4 Neuroprotein VGF 39 FIGURE GI.5 | SCHEMATIC REPRESENTATION OF HUMAN VGF GENE AND ITS DERIVED PEPTIDES. VGF gene encodes a 615 amino acid precursor that is processed in several peptides. In dark blue are the peptides that have been described as showing some biological activity or function. The VGF C-terminal neuropeptide TLQP-62 is further processed in several smaller peptides with known biological activities. DANIELA MESQUITA MOUTINHO 40 VGF-derived peptides are (most of them, but not all) named after its first 4 amino acids and its residue length. TLQP-62 and AQEE-30 have been reported to increase activity of hippocampal neurons, regulate synaptic function, induce neurogenesis and have antidepressive like properties188,191. HHPD-41, AQEE-30, AQEE-11 and LQEQ-19 stimulate sympathetic outflow facilitating penile erection in rats224,225. NERP-1, -2 and -3 regulate water homeostasis and suppress vasopressin release226,227. NERP-2 regulates food intake, gastric acid secretion, body temperature and oxygen consumption, while TLQP-21 increases energy expenditure, prevents diet induced obesity, stimulates catabolic pathways, regulates contractile response in the gastrointestinal tract, has analgesic properties modulating pain, decrease blood pressure and reduces neuronal apoptosis in vitro75,228–234. Thus, VGF-derived peptides have roles in energy and water balance, gastrointestinal motor function, reproduction, pain, and memory, learning and depression. 4.2.1. Role in Energy and Water Balance Fasting has been shown to increase VGF mRNA expression and the administration of leptin prevents this increasing235. A VGF-/- mouse model shows no difference at birth from their wildtype or heterozygous counterparts: no defects in development of the central or peripheral nervous systems. However in the following weeks the VGF-/- mice were smaller with less abdominal fat, leaner, more hyperactive and more hypermetabolic than the wildtype mice208. Consumed twice as oxygen, and leptin, glucose, insulin and glycogen levels were reduced236. Furthermore, VGF deletion blocked obesity in mice in a high-fat diet235. VGF seemed to promote an anabolic drive, but further studies showed that intra-cerebroventricular (ICV) infusion of TLQP-21 in mice resulted in a decrease in food intake and a small increase in energy expenditure228. Also, mice fed high-fat diet and treated with TLQP21 showed decreased body weight and white adipose tissue, and attenuated rises in leptin, indicating that this peptides blocks the effect of this diet and activates adrenal medulla and adipose tissue. Although VGF seems to have an anabolic role, TLQP-21 shows catabolic activity, which might indicate that different VGF-derived peptides have opposite regulated functions. In fact, further studies showed that administration of TLQP-62, HHPD-41 or GENERAL INTRODUCTION 4 Neuroprotein VGF 41 NERP-2 increased food intake, body temperature, oxygen consumption or locomotor activity209,237,238. NERP-1 and NERP-2 are expressed in human pancreas islets and inhibit glucose-stimulated insulin secretion levels, by diminishing the number of insulin granules released. Also, insulin granule-related proteins and mRNA are downregulated by NERP-2, and NERP-2 levels are much increased in diabetic pancreas, indicating that NERP peptides might be suppressors of glucose-dependent insulin secretion239. TLQP-62 was found to modulate insulin secretion, by increasing basal insulin secretion and glucose-stimulated insulin secretion via increased intracellular calcium mobilization and fast expression of insulin 1 gene. Also, peripheral injection of this peptide improved glucose tolerance in mice, suggesting TLQP-62 is an isulinotropic peptide240. Water deprivation and salt loading in rat increases the levels of VGF and vasopressin mRNA and NERP peptides were found to colocalize with vasopressin in storage granules210,241. NERP-1, NERP2 and NERP-3 suppresses the increase in vasopressin induced by hypertonic saline inoculation or water deprivation in rats227,241. Thus, NERP peptides may have a role in the control of body fluid balance. 4.2.2. Role in Gastrointestinal Function ICV injection of TLQP-21 inhibits gastric secretion and emptying by stimulating the release of somatostatin and prostaglandins242,243. TLQP-21 induces a gastric contractile motor effect mediated by central nervous system. As stomach plays a primary role in feeding, this inhibition of gastric emptying by TLQP-21 probably represents a signal of satiety and together with this peptide induced increase of energy expenditure228,229 could be a further mechanism to prevent weight gain and obesity. On the other hand, NERP-2 colocalizes with orexin-A in the lateral hypothalamus and increases orexin-A-induced feeding and energy expenditure. Orexin-A modulates gastric function and ICV administration of NERP-2 increased gastric secretion and emptying through orexin pathway234. 4.2.3. Roles in Reproduction VGF gene deletion causes infertility in both male and female mice, with delayed on the onset of puberty and sexual maturation in males and no mature follicles or corpus lutea, and reduced ovaries and DANIELA MESQUITA MOUTINHO 42 uteri in females208. Reproductive deficits of VGF-/- seem to arise from deficits in the hypothalamic-pituitary-gonadal axis. As alterations in energy metabolism can affect reproductive function and VFG-/- mice have reduced leptin, it could be suggested that the deficit may be due to gonadotropin releasing hormone (GnRH) synthesis or secretion. However, GnRH levels are not affected but LH and FSH mRNA levels are reduced in VGF-/- mice208. Administration of TLQP-21 in female rats during pubertal transition increased the number with signs of ovulation, which might happen through stimulation of GnRH release, as TLQP-21 induces LH secretion244,245. Repeated administration of TLQP-21 on adolescent males with chronic food deprivation the gonadotrophin response of hypothalamic-pituitarygonadal axis was reduced244. Other VGF-derived peptides have a role in reproduction. AQEE-11, LQEQ-19, AQEE-30 and HHPD-41 have been shown to induce penile erection in rats in a dose dependent manner and NERP-1 has a pro-erectile effect by acting in the arcuate nucleus, possibly via nitric oxide activation of oxytocinergic pathways224,246. 4.2.4. Role in Pain Modulation VGF gene is commonly upregulated in sensory neurons in models of neuropathic and inflammatory pain, and peripheral nerve trauma, colocalizing with substance P, calcitonin gene related peptide and TrkA230,232,247. VGF-derived peptides have been associated with pain modulation. Intrathecal infusion of TLQP-62 leads to cold behavioral hypersensitivity in rats, and injection of TLQP-21 in mice hind paw results in hypersensitivity in a formalin model of inflammatory pain230,248. TLQP-21 induces thermal hyperalgesia in the warm-water immersion tail-withdrawal test249. These analgesic effects and inflammatory modulation depend on the route of administration, being pro-nociceptive at a periphery level and anti-nociceptive at a central level. Hyperalgesia and hypersensitivity induced by TLQP-21 seem to be mediated through activation of macrophages232. AQEE-30 and LQEQ-19 have been shown to cause hyperalgesia by inducing mitogen activated protein kinase phosphorylation247. Thus, VGFderived C-terminal peptides seem to play a role in chronic pain in diverse models. GENERAL INTRODUCTION 4 Neuroprotein VGF 43 4.2.5. Role in Memory and Learning VGF mRNA expression has been detected in the hippocampus and to be induced by BDNF exposure, in hippocampal slices, and activities such exercise, memory and learning188,204. TLQP-62 has been shown to induce potentiation in hippocampal slices, enhance synaptic activity, increase neurogenesis in adult hippocampus, enhancing dendritic branching and outgrowth, and have an effect in memory150,190. Proteomic studies showed a reduction in VGF-derived peptides in cerebrospinal fluids and in parietal cortex of patients affected by Alzheimer’s or Parkinson’s disease194. Moreover, VGF levels have been found to be decreased in depressed patients, but to be restored to normal levels by antidepressant drugs and exercise192,205. Microinjection of TLQP-62 into hippocampal CA1 regions showed antidepressant-like behavioral effects in mice via a BDNF-dependent mechanism250,251. TLQP-21 exhibits a neuroprotection effect by preventing apoptosis of cerebellar granule cell cultures induced by serum deprivation, and AQEE-30 induces the expression of genes mediating neuronal protection205,252. 4.3 ROLE IN NEUROGENESIS AND NEUROPSYCHIATRIC DISORDERS VGF has been widely explored for its role in emotional behavior and neuropsychiatric illness213, since its expression pattern is altered in several of those disorders and has even been proposed as a candidate biomarker for frontotemporal dementia253, amyotrophic lateral sclerosis254, Parkinson’s and Alzheimer’s diseases194, or acute encephalopathy255. As described before, VGF has also been found to be involved in depression, bipolar disorder and schizophrenia, being reduced in leukocytes of depressed patients as in the brain of animal models of depression192, in human bipolar postmortem brain193, and in hypothalamus and cerebrospinal fluid of schizophrenic patients256,257. On the other hand, VGF levels were found to be increased in the hippocampus by antidepressant treatment or voluntary exercise189,205. Abnormal activity in the hippocampus has been proposed to play an important role in the origin of depression as evidences suggest that Physical exercise increases VGF expression in mice hippocampus and upregulates a neurotrophic signaling cascade thought to underlie the action of antidepressants. DANIELA MESQUITA MOUTINHO 44 neurotransmission is disrupted in major depression patients due to changes in synaptic activity258. Administration to hippocampal cells of TLQP-62 and AQEE-30 produced an increase in synaptic charge what could explain this peptides antidepressants effects188. Chronic TLQP62 administration induces the BDNF/TrkB/CREB signaling pathway and increases the proliferation of neuronal progenitor cells in the hippocampus in mice, suggesting that this route mediates the antidepressant effects of this peptide150,251. VGF-induced neurogenesis is apparently mediated through NMDA receptor and mGluR5150. Activation of mGluR5 induced the phosphorylation of protein kinase D (PKD) in hippocampal neurons and in neural progenitor cells259. PKD modulates DNA synthesis and cell proliferation through ERK signal pathway and has anti-apoptosis properties in tumor cells260. NMDAR induces the phosphorylation of CaMKII, which regulates synaptic maturation261,262. As described, VGF was found to be markedly decreased as a result of DISC-1 silencing in SH-SY5Y neuroblastoma cells, and another study found Neuronal PAS domain protein 3 (NPAS3), a transcription factor associated with risk factor for mental illness, to markedly upregulate and activate VGF through nuclear factor kB (NfkB) signaling pathway263,264. NPAS3 enhances proliferation of neural cells through VGF, requiring synaptic activity, and PKD and CaMKII molecules through glutamate receptors. Three independent proteins with strong association with neuropsychiatric disorders, DISC1, BDNF and NPAS3, seem to have VGF as a downstream effector, making this neuroprotein, its derived peptides and specially the receptors of the VGF-derived peptides, a very attractive pharmaceutical target to develop new drugs more effective in the treatment of these illnesses. The C-terminal VGF-derived peptides seem to be the ones responsible for this neuroprotective and antidepressant effects, especially TLQP-62 and AQEE-30. Also, given TLQP-21 role in energy homeostasis, it is worth to mention that abnormalities in glucose regulation with increased risk for diabetes mellitus have also been reported in mental disorders, although it is not clear yet if this is related with the antipsychotic drug treatment265–268. GENERAL INTRODUCTION 45 5 TLQP-62 ANTIDEPRESSANT PEPTIDE TLQP-62 was first described in 1995 and named after its first four N-terminal amino acids and its peptide length, as happens with several (but not all) other VGF-derived peptides216. TLQP-62 is derived from VGF precursor protein via proteolytic cleavage by prohormone convertases PC1/3 at the RPR555 site, and several other VGF-derived peptides are part of this C-terminal neuropeptide, as such TLQP-21, TLQP-24, AQEE-30, AQEE-11, LQEQ-19 (Figure GI.5 and GI.6)223. TLQPPSALRRRHYHHALPPSRHYPGREAQARR 32 AQEEAEAEERRLQEQEELENYIEHVLLRRP 62 5.1 FUNCTIONS Among other bioactive VGF derived peptides, TLQP-62 is a very interesting and attractive target for its various behavioural and physiological roles and functions. As described above, TLQP-62, as a bioactive VGF derived peptide plays a role in: Pain modulation: inducing hypersensitivity to mechanical and cold stimuli, and an increase of VGF mRNA and protein was observed in injured dorsal root ganglion neurons, central terminals and their target dorsal horn neurons248; Insulin secretion and glucose homeostasis modulation: TLQP-62 improves glucose tolerance in vivo, modulating insulin secretion, by increasing basal insulin secretion and glucose-stimulated insulin secretion via increased intracellular calcium mobilization and fast expression of insulin 1 gene in cultured insulinoma cells. Peripheral injection of this peptide improved glucose tolerance in mice240. FIGURE GI.6 | VGF-DERIVED TLQP-62 PEPTIDE PRIMARY SEQUENCE. TLQP-62 is formed by the last 62 C-terminal amino acids of proVGF and also integrates peptides TLQP-21 (light blue), AQEEA-30 (underlined), AQEE-11 (dark pink) and LQEQ-19 (purple). CHAPTER I Effect of human TLQP-62 on SH-SY5Y differentiation 55 CHAPTER I Effect of human TLQP-62 on SH-SY5Y differentiation 1 INTRODUCTION The VGF-derived TLQP-62 neuropeptide is known for having antidepressant effects and increase memory on the mouse hippocampus by promoting neurogenesis and synaptic plasticity. As this peptide might be implicated in the regulation of neurological functions, it might be crucial to better understand its effects and molecular mechanisms at a neuronal level. VGF is expressed in neuroendocrine systems and its derived peptide TLQP-62 has been detected at its highest levels in the hippocampus. Several studies have been performed in mice and mouse cultured primary hippocampal neurons showing that BDNF induces VGF expression and in turn VGF increases BDNF expression, enhancing the synaptic activity of those cells, as well as cell proliferation, by increasing the number of type 2a neural progenitor cells by increasing Cyclin D mRNA expression, and dendritic growth and maturation149,150,188,269. The activation of BDNF and its receptor TrkB is important for the development of short term memory and neurons growth, and, thus, for neurogenesis. VGF is induced by several factors, including BDNF, NGF and NPAS3, and in turn VGF is known to induce BDNF expression through BDNF/TrkB/CREB signalling pathway. BDNF is thought to modulate synaptic transmission through mitogen-activated protein kinase kinase (MEK)/ERK and PI3K pathways. NMDA glutamatergic receptor is suspected of being involved in learning and memory by being modulated by BDNF. By inducing BDNF, VGF and its derived peptides TLQP-62 and AQEE-30 are a mechanism to sustain the DANIELA MESQUITA MOUTINHO 56 functions described above and might act through different routes to exert its effects. However it is not clear how VGF and BDNF promote the expression of each other and which are the specific mechanisms of action and the signaling pathways involved. As schematized in figure I.1, BDNF binds to its receptor, TrkB, which in turn can activate three different pathways: PLCy pathway, implicated in cell adhesion, migration and synaptic plasticity; PI3K pathway, whose phosphorylation leads to the activation of AKT, by PDK, mediating cell survival, growth, proliferation, or differentiation, by phosphorylating several proteins; and ERK pathway, through phosphorylation of Ras, that activates Raf, which in turn activates MEK, which activates ERK, which activates ribosomal protein S6 kinase a1 (S6K1) leading to phosphorylation of transcription factors involved in the activation of genes related too differentiation, maturation and neurite growth270. TLQP-62 might participate directly in the binding BDNF/TrkB, as no receptor for this peptide could be identified so far, but could also have not one but several receptors, depending on the tissue and function, which can result in the activation of different signaling pathways. As previously described, DISC1 is a genetic risk factor implicated in major mental disorders and has a role in neural development and in adult neurogenesis in the dentate gyrus of the hippocampus146,147,271. Being a scaffold protein, DISC1 interacts with many other proteins involved in different signalling pathways: GSK3β enhan ces neural proliferation, through PI3K/AKT/mammalian target of rapamycin (mTOR) pathway, and NDEL1/LIS1 regulates neuronal migration146,271. DISC1 mutations affect not only early neural development but continue to disrupt neuronal development in the hippocampus into adulthood. DISC1 knockdown leads to loss of dendritic branching and neuronal maturity in adult hippocampus causing deficit in short-term plasticity144,272–274. Regulation of dendritic development of newborn neurons by DISC1 during adult hippocampal neurogenesis requires neurotransmitter GABA through a convergence onto the AKT-mTOR pathway143. Moreover, DISC1 seems to indirectly regulate VGF expression through the PI3K/AKT/CREB pathway148. CHAPTER I | Effect of TLQP-62 on SH-SY5Y 1 Introduction 57 Thus, investigating and understanding more about the roles played by DISC1 and VGF/TLQP-62 on neurogenesis and dendritogenesis could provide new tools and targets to treat neuropsychiatric illnesses. Culture of primary cells from mouse and rat have been proven useful to study many aspects of neuron physiology and several disease animal models, but human derived cell are necessary to validate the molecular mechanisms of human diseases, which cannot be completely reproduced in animals, and are more adequate for drug testing and screening. The human derived cell line SH-SY5Y reproduces biochemical and morphological properties of neurons, being often used as in vitro model for human neurons275. This line is a successive sub-clone of the SK-N-SH lineobtained from bone marrow biopsy of a patient with neuroblastoma276. SH-SY5Y cells can be induced to differentiate into cells with neuron-like phenotype and expresses high levels of VGF192,277,278. VGF is also decreased in SHSY5Y cells silenced for DISC1, indicating its indirect regulation187. FIGURE I.1 | BDNF/TRKB SIGNALLING PATHWAYS. [Constructed from data of Castrén et Kojima, 2017] DANIELA MESQUITA MOUTINHO 58 The SK-N-SH parental line comprises two morphologically and biochemically distinct phenotypes: neuroblastic (N-type) and substrate adherent (S-type)277. The SH-SY5Y line retains a low proportion of Stype cells, but a considerable proportion of N-type cells undergo differentiation into a more neuronal phenotype, with loss of the round morphology and exhibiting neurite extensions, in the presence of alltrans-retinoic acid (RA) for 5 days in complete medium (DMEM plus 15% fetal calf serum) and then in the presence of BDNF or NGF279,280. Apparently, S-type cells do not exhibit morphological changes and keep proliferating after 10 days of RA-treatment281. This effect is caused by the RA-treatment which induces expression of functional TrkB-receptors, which expression is lacking on neuroblastoma cells, making cells responsive to BDNF282. BDNF, in turn, activates PI3K, AKT and ERK pathways that mediate survival and neuritogenesis, and so adding BDNF to the RA differentiated culture promotes longer neurites and cells to connect283–286. As VGF and TLQP-62 induce BDNF, it would be of interest to evaluate the effect of TLQP-62 on proliferation and differentiation of this cell line, as also investigate the underlying molecular pathways by characterizing the proteomic changes of SH-SY5Y cells after RA/TLQP-62 induced differentiation. 2 OBJECTIVE The objective of this chapter is to determine the biological effect of TLQP-62 on the human neuroblastoma-derived cell line SH-SY5Y by: i) evaluating cell morphology, proliferation and differentiation, ii) comparing those effects with retinoic acid-induced effects, iii) investigating those effects on VGF and DISC1 silenced cells, iv) performing a 2D-DIGE proteomic comparative study. CHAPTER I | Effect of TLQP-62 on SH-SY5Y 59 3 METHODS 3.1 HUMAN TLQP-62 PEPTIDE TLQP-62 (human, molecular weight 7503 Da) and TLQP-21 (human, molecular weight 2491) were purchased from ChinaPeptides Co. LTd., Shangai, with a purity >95%, confirmed by HPLC and MS analysis, as a lyophilized powder. A 1 mg/mL stock solution of each peptide was performed in filtered PBS with 10% acetonitrile and stored at -80ºC. TLQP-21 and TLQP-62 peptide sequences are: TLQPPSALRRRHYHHALPPSR 21 TLQP-21 TLQP-62 HYPGREAQARRAQEEAEAEER 42 RLQEQEELENYIEHVLLRRP 62 3.2 SH-SY5Y CELL CULTURE SH-SY5Y cell line (European Collection of Cell Cultures, 90430304) is a cloned subline of the neuroblastoma cell line SK-N-SH established in 1970 from a metastatic bone tumor of a four years old female276,287. Cells were maintained in a 1:1 proportion Earle’s Balanced Salt Solution (EBSS; Sigma-Aldrich) and F12HAM (SigmaAldrich) medium, supplemented with 15% Fetal Bovine Serum (FBS; Gibco, Life Technologies), 1% L-glutamine 200 mM (Gibco, Life Technologies), 1% MEM-Non Essential Amino Acids (NEAA; Gibco, Life Technologies) and 1% penicillin-streptomycin (P/S; Gibco, Life Technologies). Cells were seeded at a density of 104 cells/cm2 in 100x20mm culture dishes (Falcon, Life Sciences), previously coated with 0.1 mg/mL collagen (Sigma) and grown at 37ºC in a 5% CO2 humidified incubator. Media was changed each two days and cells grown until confluence. SH-SY5Y cells silenced for VGF by introduction of shRNA, were previously available in our lab and were used as a negative control and treated the same way as SH-SY5Y cells. DANIELA MESQUITA MOUTINHO 60 3.2.1. SH-SY5Y preparation for morphology studies For cellular effect studies of all-trans-retinoic acid (RA; Sigma), 10 μM RA, and 1 μM TLQP-62 or 1 μM TLQP-21 were added to the cells the day after seeding in cell medium with 15% FBS. Cells were kept in the presence of RA/TLQP-62/TLQP-21 for 9 days, but switched to 10% FBS medium at day 3 and to 5% FBS medium at day 6. As control SH-SY5Y cells were maintained in 15% FBS cell media for the same period of time. RA was prepared as 1 mg/mL stock solution in 90% ethanol and 10% DMSO. Cells were observed with an Olympus inverted microscope IX51 and the microscope imaging software Olympus CellSens standard. Cells were counted and neurite length determined using ImajeJ software. 3.2.2. SH-SY5Y culture for proteomic studies For proteomic studies to investigate the effect of TLQP-62 on RA-differentiated SH-SH5Y cells, cells were plated and grown as described before. The day after seeding, 10 μM RA was added to cells in cell medium with 15% FBS. After 3 days, cells were kept in presence of RA but switched to 10% FBS medium and after 3 more days switched to 5% FBS medium and let to differentiate for more 3 days. At day 10 TLQP-62 (1 μ M in PBS with 10% acetonitrile) was added to cells for 24 hours for further analysis. As control vehicle solution of PBS with 10% acetonitrile was added to the 9 days RAdifferentiated SH-SY5Y cells for 24 h. 3.3 IMMUNOCYTOCHEMISTRY To confirm the expression and subcellular localization of VGF in SH-SY5Y cells and the knockdown/silencing of VGF on VGFshRNA SH-SY5Y cells, cells were plated and grown as described before in a 4-well Milicell EZ slide (Millipore). At the next day cells were washed twice with PBS and fixed with 10% formalin. For blocking, cells were washed with PBS for 5 min and incubated with 2% BSA in PBS for 30 min. Primary antibodies rabbit anti-human VGF(C-term) was diluted in PBS according to manufacturer instructions and added to the cells for 1 hour at room temperature. Cells were washed 3 times for 5 min with PBS before incubated with the secondary antibody CHAPTER I | Effect of TLQP-62 on SH-SY5Y 3 Methods 61 donkey anti-rabbit IgG-FITC (Santa Cruz Biotechnology) in PBS for 30 min and rinsed with PBS 3 times for 5 min. DAPI was added to the cells (1:1000 in PBS) for 5 min and rinsed with PBS for 5 min, twice. Cells were observed using an Olympus inverted microscope IX51 with an Olympus U-RFL-T reflected fluorescence system and the microscope imaging software Olympus CellSens standard. 3.4 PROTEIN EXTRACTION & QUANTIFICATION RA-differentiated SH-SY5Y cells incubated for 24 h with TLQP62 or vehicle solution (control) were washed twice with cold PBS and solubilized in lysis buffer (20 mM HEPES pH 7.4, 2 mM EGTA, 1 mM DTT, 1 mM sodium orthovanadate, 1% Triton X-100, 10% glycerol, 2 µM leupeptin, 400 µM PMSF, 50 µM β-glycerophosphate and 100 µg/ml aprotinin). The cells were scrapped on ice for ten minutes and incubated on ice for 30 min with periodic vortexing at each 10 minutes. Sonication on ice was performed for 3 periods of 15 seconds with 10 seconds interval on ice in between each pulse, with a 10% amplitude. Centrifugation at 4ºC, 14000xg, for 30 min was performed. Pellet was discarded and supernatant recovered for further precipitation with 60% trichloroacetic acid (TCA) in acetone. Frozen samples were mixed with half of their volume with 60% TCA/acetone and incubated on ice for 45 min. Samples were centrifuged for 2 min at 10000xg, 4ºC, and supernatant was discarded. Pellet was resuspended in 500 μl of cold acetone and sonicated 3-4 pulses in the ultrasonic cell disruptor Sonifier 150 (Branson). Samples were kept on ice and further centrifuged at 10000xg for 1 min at 4ºC. Supernatant was discarded and pellet was washed twice with 500 μl of cold acetone. At last wash supernatant was discarded and pellet was left to air dry. Dry pellet was ressuspended in a minimum volume of 2DDIGE sample buffer (5 M urea, 2 M thiourea, 2 mM tributylphosphine, 65 mM DTT, 65 mM CHAPS, 150 mM non-detergent sulfobetaine (NDSB-256), 1 mM sodium vanadate, 0.1 mM sodium fluoride and 1 mM bensamidine), vigorously vortexed for better solubilization and centrifuged for 2 min at 10000xg. Supernatant was recovered and quantified. DANIELA MESQUITA MOUTINHO 68 4.2 TLQP-62 PROMOTES DIFFERENTIATION AND NEURITOGENESIS ON SH-SY5Y CELLS RATHER THAN PROLIFERATION SH-SY5Y cells were plat e grown for 2 days before 1 μM TLQP-62 was added to the cells in order to evaluate its effects on the cell morphology. As previously described, the SH-SY5Y cell line has two morphologically and biochemically distinct phenotypes, N-type and lower proportion of S-type277. When cultures are treated with 10 μM RA for 5 days in complete medium (DMEM plus 15% fetal calf serum), a considerable proportion of N-type cells differentiated to a more neuronal phenotype with loss of the round morphology and exhibiting neurite extension279. This neuritogenesis enhancement occurs through induction of TrkB receptors and BDNF by RA and PI3K/AKT and ERK/MAPK pathways. As described before, TLQP62 promotes the expression of BDNF leading to cell proliferation rather than differentiation150. Here, an evaluation of the effect of TLQP-62 on SH-SY5Y and RA differentiated-SH-SY5Y cells was performed. FIGURE I.3 | SUBCELLULAR LOCALIZATION OF VGF (C-TERM) ON SH-SY5Y AND VGF-SILENCED SH-SY5Y CELLS BY IMMUNOCYTOCHEMISTRY. 20X DAPI Anti-VGF (C-term) shRNA VGF SH-SY5Y SH-SY5Y CHAPTER I | Effect of TLQP-62 on SH-SY5Y 4 Results 69 SH-SY5Y cells were plated (3x106 cells) and after 2 days growth was added to the cultured cells i) vehicle control (10% acetonitrile in PBS), ii) RA (10 μM), iii) TLQP-62 (1 μM) or iv) TLQP-21 (1 μM). Cells were let to grow for 3 days and observed for proliferation and differentiation evaluation (Figure I.4). TLQP-62 alone has the capacity of induce proliferation and differentiation. TLQP-21, another VGF-derived neuropeptide implicated on pain and glucose homeostasis, was also investigated for its capacity to promote these effects, or if those are specific of TLQP-62 neuropeptide. VGFsilenced SH-SY5Y cells (VGFshRNA SH-SY5Y) were also used (Figure I.4). SH-SY5Y SH-SY5Y+RA SH-SY5Y+TLQP-62 SH-SY5Y+TLQP-21 FIGURE I.4 | EFFECT OF RETINOIC ACID, TLQP-62 AND TLQP-21 ON SH-SY5Y AND VGFSILENCED SH-SY5Y CELL PROLIFERATION, DIFFERENTIATION AND MORPHOLOGY. SH-SY5Y and VGF silenced SH-SY5Y cells were plated and grown for 3 days and compared to the ones grown for the same time in the presence of 10 μM RA, 1 µM TLQP-62 or 1 μM TLQP21 in order to evaluate its effects on the cell morphology, differentiation and proliferation. Cells were observed with an Olympus inverted microscope IX51 and the microscope imaging software Olympus CellSens standard. Blue arrows indicate neurite outgrow. SH-SY5YVGFshRNA SH-SY5YVGFshRNA+RA SH-SY5YVGFshRNA+TLQP-62 SH-SY5YVGFshRNA+TLQP-21 (3 days) DANIELA MESQUITA MOUTINHO 70 SH-SY5Y cultures treated with 10 μM RA show a considerable proportion of cells differentiated into a more neuronal phenotype with loss of the neuroblastic round morphology and exhibiting neurite extensions that occasionally connect the cells. TLQP-62 apparently has the same effect as RA, inducing some signs of neurite outgrowth level. Besides, after 3 days in the absence of RA or TLQP-62 no changes indicating cell differentiation could be observed, indicating that TLQP-62 might be involved in the RA differentiation pathway and its expression crucial for neuritogenesis. To investigate the prolonged effects of TLQP-62, the peptide was added to the cultured SH-SY5Y for up to 9 days to evaluate the morphological changes (Figure I.5). TLQP-62 apparently inhibits cell proliferation but induces and sustains a considerable proportion of neuroblastic cells to differentiate into a more neuronal phenotype, with loss of the round morphology and exhibiting neurite extensions that occasionally connect the cells, when compared to the cells not treated for the same period, as also observed in figure I.5. 4.3 TLQP-21 MODERATELY INHIBITS PROLIFERATION OF SH-SY5Y CELLS BUT HAS NO EFFECT ON DIFFERENTIATION As stated before, TLQP-21, a VGF-derived neuropeptide implicated on pain and glucose homeostasis, and described as preventing cell death, was investigated for its capacity to promote cellular proliferation and/or differentiation on SH-SY5Y cells. Cells were treated for three days with 1 μM TLQP-21 and then evaluated for morphological changes. The cells in presence of TLQP-21 showed less morphological changes when compared to the ones treated with TLQP-62 or RA (Figure I.4). VGF-silenced SH-SY5Y cells show a rounder morphology with shorter neurites when compared with SHSY5Y cells. Prolonged treatment of SH-SY5Y cells with TLQP-21 for 9 days, showed a moderate inhibitory effect of TLQP-21 on cell proliferation and no effect on cell differentiation, when compared to TLQP-62 effect on the same cells (Figure I.5). TLQP-21 effect was also investigated and same experiment was performed on VGFsilenced SH-SY5Y cells (Figures I.6). No effect was observed on those cells. CHAPTER I | Effect of TLQP-62 on SH-SY5Y 4 Results 71 SH-SY5Y + TLQP-21 SH-SY5Y + TLQP-62 SH-SY5Y 3rd day with peptide 6th day with peptide 9th day with peptide FIGURE I.5 | EFFECT OF TLQP-62 AND TLQP-21 ON SH-SY5Y CELL GROWTH AND MORPHOLOGY. SH-SY5Y cells were plated and grown for up to 9 days and compared to the ones grown for the same time in the presence of 1 μM TLQP-62 or 1 μM TLQP-21. A) Cells were observed with an Olympus inverted microscope IX51 and the microscope imaging software Olympus CellSens standard at 3rd, 6th and 9th days. Cells were evaluated for B) average cell growth +/-SD; *p<0.01 and **p<0.005 SH-SY5Y vs treated (Mann-Whitney U test); and C) average of neurite length +/-SD; ****p<0.0001, n>100, SH-SY5Y vs treated. Blue arrows indicate neurite outgrowth. A C B DANIELA MESQUITA MOUTINHO 72 4.4 VGF SILENCING AFFECTS SH-SY5Y CELL VIABILITY VGF silenced SH-SY5Y cells seem to have a shorter life time when compared to the wildtype ones and to have a lower proliferative rate. After six days on culture, with changing media each 2 days, cells grew at a lower rate when compared to wildtype cells. After nine days in culture some of the surviving cells are smaller and thinner, which gives the idea of some neurite growth (Figure I.6). Apparently, neither TLQP-62 nor TLQP-21 affect positively SH-SY5Y cell differentiation or proliferation, or protect SH-SY5Y from cell death. This might indicate that a higher concentration of TLQP-62 is needed to support TLQP-62 effects on those silenced cells or that VGF and other VGFderived peptides are required for normal cell survival and proliferation. 4.5 TLQP-62 SUPPORTS SH-SY5Y RA-INDUCED DIFFERENTIATION To investigate the effects of TLQP-62 in sustaining RAdifferentiation, the SH-SY5Y cells were treated for 9 days with RA and then TLQP-62 was added for more 3 days in reduced FBS containing medium (from 15% to 1% FBS), for morphological evaluation (Figure I.7). As control, RA-differentiated SH-SY5Y cells were treated with vehicle control instead of TLQP-62; and the TLQP21 effect was also investigated. After RA-induced neurodifferentiation in low FBS medium, if RA is taken from the media cells start dying and detach from plate (data not shown). TLQP-62 not only induces differentiation (although at a slower rate when compared to RA) but it also successfully supports SH-SY5Y RA-induced differentiation and survival in low FBS containing medium. Cells not only survive as they keep growing neurites, showing bigger length, and occasionally interacting with each other. Surprisingly, although TLQP-21 alone is apparently not capable of induce SH-SY5Y differentiation, it seemed to be capable to support RA-differentiated cells survival in low FBS, after the absence of RA. Same experiment was also performed on VGF-silenced SH-SY5Y cells as control (data no shown) and the ability to support RA differentiation by TLQP-62 and TLQP-21 was also observed, although there are less differentiated cells, indicating that VGF is crucial for this process. CHAPTER I | Effect of TLQP-62 on SH-SY5Y 4 Results 73 SH5YshVGF + TLQP-21 SH5YshVGF + TLQP-62 SH-SY5Y shRNA VGF 3 days 6 days 9 days FIGURE I.6 | EFFECT OF TLQP-62 AND TLQP-21 ON VGF SILENCED SH-SY5Y CELL GROWTH AND MORPHOLOGY. SH-SY5Y cells knockdown for VGF were plated and grown for up to 9 days and compared to the ones grown for the same time in the presence of 1 μM TLQP-62 or 1 μM TLQP-21. A) Cells were observed with an Olympus inverted microscope IX51 and the microscope imaging software Olympus CellSens standard at 3rd, 6th and 9th day, and evaluated for B) average of cell growth +/-SD; ****p< 0.0001 (Mann-Whitney U test); and C) average of neurite length +/-SD. B A C DANIELA MESQUITA MOUTINHO 74 10% FBS medium 5% FBS medium 1% FBS medium 10 μM RA 10 μM RA 10 μM RA 1 μM TLQP-62 FIGURE I.7 | EFFECT OF TLQP-62 AND TLQP-21 ON RETINOIC ACID-DIFFERENTIATED SH-SY5Y CELL MORPHOLOGY. SH-SY5Y cells were plated and grown for up to 9 days on the presence of 10 μM all-trans RA and compared to the ones grown for 6 days in the presence of 10 μM RA and three more days with 1 μM TLQP-62 or 1 μM TLQP-21, in order to evaluate its effects on the cell morphology, differentiation and proliferation. Cells were observed with an Olympus inverted microscope IX51 and the microscope imaging software Olympus CellSens standard. 3 days RA 9 days RA + 3 days peptide SH5Y + RA + TLQP-21 SH5Y + RA + TLQP-62 SH-SY5Y + RA CHAPTER I | Effect of TLQP-62 on SH-SY5Y 4 Results 75 4.6 SH-SY5Y MORPHOLOGICAL EFFECTS OF TLQP-62 AND DISC1 As described, DISC1 plays an important role in regulating neurodevelopment, being associated with chronic mental disorders. Moreover, it is known to be involved in neurogenesis and to upregulate VGF expression, apparently through PKA/AKT/CREB pathway. DISC1 effect on TLQP-62 treated SH-SY5Y cells was investigated. For that purpose, SH-SY5Y cells shRNA-silenced and overexpressing DISC1, under Tet-inducible system control, were used. As positive and negative control, SH-SY5Y cells and shRNAVGF silenced SH-SY5Y cells, respectively, were used. Those cells were previously available in our laboratory from previous studies. SH-SY5Y cells were treated with RA for 9 days for morphological evaluation, followed by TLQP-62 treatment for more 3 days. As observed in figure I.12, and previously described in this chapter, TLQP-62 supports RA-SH-SY5Y neurodifferentiation effects, with neuroblastoma cells presenting a more neuron-like phenotype, with more and longer dendrites. As negative control, shVGF-SH-SY5Y cells were used, and, as described, those cells are rounder, with a lower growth rate, and, although RA is capable of induce these cells differentiation, dendrites are fewer and shorter, comparing to the wildtype cells with same treatment. Thus, as already stated, indicates VGF is important for proper cell morphology and differentiation and that TLQP-62 has a role on neurogenesis or dendritogenesis. In an attempt to understand DISC1 and TLQP-62 connection regarding SH-SY5Y neurodifferentiation, cells silenced for DISC1 were evaluated for their capacity to support RA-induced differentiation. Apparently those cells are morphologically normal, but in the presence of RA, comparing to the wildtype, cells have fewer and shorter dendrites (Figure I.8). After 3 days with TLQP-62 treatment, cells keep exhibiting differentiation with neurite outgrowth. DISC1 overexpression enhances SH-SY5Y neurodifferentiation in the presence of RA, and cells presented longer dendrites when compared to the wildtype ones. Plus, TLQP-62 is, as expected, capable of supporting this induced differentiation. DANIELA MESQUITA MOUTINHO 76 A Figure I.8 | EFFECT OF TLQP-62 ON RETINOIC ACID DIFFERENTIATED SH-SY5Y, VGF SILENCED SH-SY5Y, DISC1 SILENCED SH-SY5Y AND DISC1 OVEREXPRESSING SH-SY5Y CELL MORPHOLOGY. Cells were plated and grown for 2 days and then 9 days on the presence of 10 μM alltrans RA and more 3 days with1μM TLQP-62 in low FBS media in order to evaluate the capability of the peptide to support cell growth and survival, and its effects on the cell morphology, differentiation and proliferation. A) Cells were observed with an Olympus inverted microscope IX51 and the microscope imaging software Olympus CellSens standard, and evaluated for B) average of cell growth +/-SD and C) average of neurite length +/-SD. SH-SY5Y shRNA VGF SH-SY5Y tet-on DISC1 SH-SY5Y shRNA DISC1 SH-SY5Y WT 2 days no RA + 9 days with RA + 3 days with TLQP-62 CHAPTER I | Effect of TLQP-62 on SH-SY5Y 4 Results 77 4.7 PROTEOMIC STUDY OF RA-DIFFFERENTIATED SH-SY5Y CELL RESPONSE TO TLQP-62 BY 2D-DIGE: UPREGULATION OF PROTEINS INVOLVED IN NEURODEVELOPMENTAL AND SYNAPTIC PROCESSES, ENERGY METABOLISM, OXIDATIVE STRESS AND IMMUNE RESPONSE As TLQP-62 seems to support SH-SY5Y RA-differentiation, those SY5Y cells were used to evaluate TLQP-62 proteomic response, once this model better reproduces morphological and biochemical properties of neurons, as cells exhibit a more neuron-like phenotype. RA-differentiated SH-SY5Y cells have been reported as undergoing apoptosis after 24 h in RA and serum-free medium281. Thus, a 2D fluorescence differential gel electrophoresis was performed as a comparative analysis to evaluate in detail the response on the proteasome of RA-differentiated SH-SY5Y cell cultures exposed to TLQP-62 for 24h. Figure I.8| EFFECT OF TLQP-62 ON RETINOIC ACID DIFFERENTIATED SH-SY5Y, VGF SILENCED SH-SY5Y, DISC1 SILENCED SH-SY5Y AND DISC1 OVEREXPRESSING SHSY5Y CELL MORPHOLOGY (CONTINUED). Cells were plated and grown for 3 days and then 6 days on the presence of 10 μM all-trans RA and more 3 days with1μM TLQP-62 in low FBS media in order to evaluate the capability of the peptide to support cell growth and survival, and its effects on the cell morphology, differentiation and proliferation. A) Cells were observed at 12th day with an Olympus inverted microscope IX51 and the microscope imaging software Olympus CellSens standard, and evaluated for B) average of cell growth +/-SD; and C) average of neurite length +/-SD; *p<0.05 and **p<0.01, n>100 (Mann-Whitney U test). B C DANIELA MESQUITA MOUTINHO 84 A study concerning samples from major depressive subjects analysed the differences in phosphorylated proteins compared to normal subjects. The differentially phosphorylated proteins were involved in transport, energy and protein metabolism, cell growth and signalling, and neurogenesis and immunity306. GSTP1 plays an important role in detoxification and xenobiotic metabolism, but also in steroid biosynthesis, and is implicated in schizophrenia307. PAFAH1B3 is important for brain development in neuronal differentiation308. In the present study, GSTP1, SOD1 and PARK7, apparently play a role in neurodifferentiation by regulating oxidative stress. Several proteins involved in energy and glucose metabolism were also identified to be increased in the TLQP-62 treated cells: IDH3A, MRPS22, NAA20, PARK7, PGAM2, PSMB2, PSMB3, SOD1 and TPI1. Some of these proteins also have a role in immune response, cell growth and oxidative stress. Moreover, DPYSL3, CDH5, DST, PARK7, SOD1, GSTP1, RAN and UCHL1 are directly involved in nervous system development process and DPYSL2, DPYSL3, SOD1 and UCHL1 in axogenesis and neurodifferentiation. CHAPTER I | TLQP-62 effect on SH-SY5Y 85 5 DISCUSSION From a clinical point of view adult neurogenesis is highly relevant as its dysregulation can evolve as a significant contributor to neuropsychiatric and neurodegenerative diseases. During neurogenesis new cells suffer migration, axon and dendrite outgrowth and synapse formation to integrate the pre-existing neuronal circuits. Thus, neural progenitor cells proliferation and differentiation, with axogenesis, dendritogenesis and synaptogenesis, are essential processes of neural development, during not only embryogenesis, but through adulthood in the hippocampus. Understanding the effect and role of TLQP-62 on neuronal cells might help to better understand its role on neurogenesis, proliferation, neurodifferentiation and dendritogenesis, which can also bring some knowledge into chronic mental disorders. TLQP-62 has been described as having an effect on hippocampal cells neurogenesis and memory, but until very recently, no information about the cell morphological effects of this peptide was available150,190. TLQP-62 induces neurogenesis in neural progenitor cells (NPCs) in the adult hippocampus by increasing the number of type2a, rather than the number of more differentiated type3 cells150. That study shows TLQP-62 enhances cell proliferation by activating BDNF, phosphorylating TrkB and requiring CaMK, PKD and metabotropic glutamate receptor mGluR5150. However, in a recent study TLQP-62 has been shown to be implicated in maturation of hippocampal dendrites, enhancing dendritic branching and outgrowth, and synaptic proteins 149. TLQP-62 can be further processed into TLQP-21 and AQEE-30, which can potentially have an effect on neurogenesis. AQEE-30 is known to have antidepressant-like effects and TLQP-21 was described as not being required for memory formation but rather to impair fear memory190. TLQP-21 has also been reported to have a neuroprotective effect by preventing cell death252. DANIELA MESQUITA MOUTINHO 86 In the present study, the effect of TLQP-62 and TLQP-21 on SHSY5Y neuroblastoma cells morphology was investigated. This cell line is known to express high levels of VGF, which is kept in vesicles in the dendrites. The SH-SY5Y human neuroblastoma cell line was used as it is known to undergo differentiation into a neuron-like cell type in the presence of retinoic acid, with dendrite outgrowth an occasionally connecting with each other. Proteomic analysis was also performed to investigate the effect of TLQP-62 on neuronal cells and the possible signaling pathway in which VGF and TLQP-62 could be implicated, leading to neurogenesis or neurodifferentiation, and more specifically, to neuritogenesis. 5.1 VGF IS REQUIRED FOR NORMAL CELL SURVIVAL AND PROLIFERATION, AND TLQP-62 PROMOTES AND SUPPORTS SH-SY5Y NEURODIFFERENTIATION AND NEURITOGENESIS TLQP-62 was observed to promote SH-SY5Y neuroblastoma cell differentiation into a more neuron-like morphology type enhancing neuritogenesis, promoting neurite branching and outgrowth. On the other hand, TLQP-21 seems to have no effect on differentiation and moderately decreases proliferation, indicating that the effects seen on neuritogenesis are specific of TLQP-62. However, VGF-silenced SH-SY5Y have slower proliferative and survival rate, compared to wildtype cells. That could not be rescued by TLQP-62, nor could this peptide induce differentiation of these cells, in the present study. This might indicate that VGF is crucial for normal cell proliferation and survival, but not probably through TLQP-62 or TLQP-21 action. Moreover, these cells fail to respond to TLQP-62, but can undergo differentiation in response to RA, meaning that a higher concentration of TLQP-62 is probably needed for these cells to differentiate or that TLQP-62 uses a different pathway from RA to induce differentiation. Although TLQP-62 seems to have an effect on SH-SY5Y differentiation, to better illustrate the effect of this neuropeptide would be preferable to use a more neuronal model. Thus, SH-SY5Y cells were first differentiated for 9 days in the presence of RA and treated CHAPTER I | Effect of TLQP-62 on SH-SY5Y 5 Discussion 87 with TLQP-62 for 24 h in order to evaluate possible proteomic changes, compared with the RA-differentiated cells. RA deficiency and abnormal TrkB signaling are involved in the pathophysiology of affective and mood disorders, schizophrenia or Alzheimer’s disease, and has been shown to have an effect on adult hippocampal neurogenesis and memory, together with neurotrophins 282,309–312. RA enters the cell and bind to a retinoic acid receptor (RAR) and retinoid X receptor (RXR) dimer in the nucleus, inducing the expression of several transcription factors. The Trk family plays a crucial role in neuronal survival, differentiation, function, and target organ innervation during development313. Neurotrophins and BDNF regulate the expression of their specific Trk receptors. RA, estrogen, interferon γ, cholesterol are capable of inducing Trk expression314. This variety of compounds capable of altering Trk expression indicates that diverse signal transduction pathways regulate Trk gene expression. In neurons TrkB is known to be regulated by the cAMP/CREB pathway315. SH-SY5Y RA-treatment induces expression of functional TrkA and TrkB-receptors, which expression is lacking on neuroblastoma cells, making cells responsive to BDNF, NGF, NT-3 and NT-4/5282. NGF through TrkA, BDNF and NT4 through TrkB, NT3 through TrkC, TrkA or TrkB, can activate 3 difference pathways: PLCy pathway (cell adhesion, migration and synaptic plasticity), PI3K pathway (PI3K phosphorylation leads to the activation of AKT, by PDK, mediating cell survival, growth and proliferation), or MAPK/ERK pathway (Ras phosphorylation activates Raf/MEK/ERK/ S6K1 pathway leading to phosphorylation of transcription factors implicated in the activation of genes involved in differentiation, maturation and neurite growth)270. Pro-neurotrophins bind to p75NTR activating JunK1 pathway and p53 pathway leading to cell death, or promote cell survival, neurite outgrowth and cell migration, through NF-κB316. Neurotrophins regulate cell fate decisions, axon growth, dendrite growth and the expression of proteins, such as ion channels, transmitter biosynthetic enzymes and neuropeptide transmitters that are essential for normal neuronal function, like VGF. Continued presence of the neurotrophins is required in the adult nervous system, DANIELA MESQUITA MOUTINHO 88 where they control synaptic function and plasticity, and neuronal survival, morphology and differentiation. It has been described that adding BDNF to RA-induced SH-SY5Y cells supports and promotes neuritogenesis and synaptogenesis283–286. On the other hand, in the present study TLQP-62 shows to induce neuritogenesis in SH-SY5Y cells and to support RA-induced differentiation, as cells survive and continue to differentiate in the presence of TLQP-62 and absence of RA. This suggests that TLQP-62 might not only lead to the expression of BDNF, but also of TrkB receptors, considering that in this cell line the TrkB expression is downregulated. VGF has been demonstrated to be regulated by antidepressants in hippocampus, and the BDNF/TrkB/CREB and monoamide transmitter pathways mediate antidepressant effects. BDNF/TrkB signalling has also been related to obesity and nociception, learning and memory, and hippocampal function136,317– 319. TLQP-62 has been showed to increase BDNF expression and TrkB/CREB phosphorylation independently of serotonin or dopamine but requiring glutamate150,190,251. Moreover, TrkB blocking almost completely abolished TLQP62-induced antidepressant effects, BDNF upregulation, and CREB/TrkB phosphorylation251. Moreover, Cyclindependent kinase 5 (CDK5) is involved in BDNF/TrkB-stimulated dendritic growth in hippocampal neurons through Rho GTPase Cdc42 activation, which can lead to PI3K/AKT activation which inhibits GSK3β284,320. Cdc42 regulates signalling pathways that control cell morphology, cell migration, endocytosis and cell cycle progression. Rho GTPases are central to dynamic actin cytoskeletal assembly and rearrangement that are the basis of cell-cell adhesion and migration. Activated Cdc42 activates by conformational changes p21-activated kinases PAK1 and PAK2, which in turn initiate actin reorganization and regulate cell adhesion, migration, and invasion321. TLQP-62 induces and is induced by BDNF, indicating a regulation loop. TLQP-62 might, moreover, participate directly in the binding BDNF/TrkB, as no receptor for this peptide could be identified so far. However, TLQP-62 might have other receptor(s), depending on the tissue and function, which can result in the CHAPTER I | Effect of TLQP-62 on SH-SY5Y 5 Discussion 89 activation of different signaling pathways, leading to the expression of BDNF and TrkB. 5.2 TLQP-62 AND DISC1 REGULATES NEURONAL DIFFERENTIATION VGF-silenced and DISC1-silenced SH-SY5Y neuroblastoma cells were used as a model to evaluate its effects on RA-induced neurodifferentiation of those cells, in an attempt to determine which converging signaling pathways connecting DISC1 and VGF/TLQP-62 could be implicated in neurodifferentiation and possible in chronic mental disorders. Lack of VGF originates rounder cells, with a shorter life-time and with a slower response to RA-differentiation. Also, DISC1 silencing causes a deficit in neurite outgrowth with a reduction in number and size of neurites. Thus, indicating there is a connection between DISC and VGF, and not only DISC1 but also VGF and TLQP-62 have an important and fundamental role in neurodifferentiation and neuritogenesis, being capable of support the effects caused by DISC1 silencing or DISC1 overexpression. RA is known to induce TrkB receptor making SH-SY5Y responsive to BDNF282, and from the present study, also to TLQP-62. BDNF activates the PI3K/AKT pathway and induces VGF, and its inhibition causes neurite outgrow to fail in the presence of RA. If TLQP-62 is capable of induce differentiation, it is possible that it induces TrkB, somehow. If both DISC1 and VGF silencing causes abnormal neurite outgrowth means that both proteins are needed to mediate this process. DISC1 interacts with many other proteins involved in different signalling pathways: GSK3β enhances neural proliferation, through PI3K/AKT/mTOR pathway, and NDEL1/LIS1 regulates neuronal migration146,271. DISC1 seems to indirectly regulate VGF expression through the PI3K/AKT/CREB pathway148. That same pathway is induced by BDNF and upregulates VGF. DISC1 might be important for proper regulation of VGF levels and to maintain a regulatory loop between VGF and BDNF during differentiation. DANIELA MESQUITA MOUTINHO 90 5.3 TLQP-62 SUPPORTS NEURITOGENESIS BY INDUCING AND SUPPORTING THE EXPRESSION OF SEVERAL PROTEINS INVOLVED IN NEURODEVELOPMENTAL AND SYNAPTIC PROCESSES To unveil the molecular effects of RA and TLQP-62 on these cells, and investigate which signaling pathways could increase the expression of BDNF and TrkB, a proteomic study was performed. Several proteins involved in fundamental cellular processes are increased in response to TLQP-62 in RA-differentiated SH-SY5Y cells. Neurogenesis is a neurodevelopment stage involving NPCs proliferation, migration and neuron differentiation with integration in the pre-existing neuronal circuits. Dendritogenesis, with spine morphogenesis and dendritic arborisation, is a crucial process for the establishment of synaptic plasticity, allowing neurons communication. During neurodevelopmental events several proteins related to cell cycle regulation, cytoskeleton organization and axon growth are overexpressed to prepare and support neurons for those processes. Differences regarding metabolic requirements between proliferative and differentiated cells have been reported322,323. Neurons have high energetic requirements due to the repeated generation of postsynaptic and action potentials, and neurotransmitters cycle324,325. Thus, neurons have a high activity of glucose and lipid metabolism and oxidative stress. Also, the biosynthetic pathways are essential during neuron proliferation and differentiation. The mitochondrion plays a fundamental role in neurogenesis, in neuroplasticity and neurodifferentiation, in axon and dendritic growth and synapse formation with neurotransmitters release. CREB and BDNF are involved in synaptic plasticity and enhance mitochondrial energy production. Also, mTOR has been linked to the regulation of metabolic pathways in neuron maturation. Among the identified proteins several are somehow involved in neurodevelopment or synaptic function, with neurogenesis, cell differentiation, cytoskeleton formation, axon growth and guidance, and in cell cycle and growth and communication (Figure I.10), but also in energy and glucose metabolism and metabolites biosynthesis, and oxidative stress and immune response (Figure I.11). CHAPTER I | Effect of TLQP-62 on SH-SY5Y 5 Discussion 91 Analysing the set of identified proteins, using the Cytoscape and String tools, several other proteins appear related to them. Among them are GSK3β, CDK1 and p53, involved in DNA repair and cell cycle regulation during development. GSK3β is a kinase, which increased expression is associated with bipolar disorder, and is inhibited by ERK1/2. This protein is involved in energy metabolism and neurodevelopment. CDK1, is a kinase that phosphorylates several substrates involved in cell cycle progression. Tumor protein p53 is a tumor suppressor playing a role in apoptosis and genomic stability, activating the expression of several genes implicated in cell cycle. RA promotes neurogenesis and neurodifferentiation by being involved in the switch between proliferation and differentiation. This effect is thought to occur via retinoic acid receptors and Wnt signalling pathway. RA induces several changes in the cell and promotes the expression of several genes involved in energy metabolism preparing the cell for changes in energy requirements and cellular morphology associated with neurogenesis by adjusting lipid content326,327. RA induces CDK1 that interacts with the retinoid acid receptor γ (RARγ) modulating the levels of AKT and P27 kip phosphorylation influencing cell cycle progression and differentiation328. Neurodevelopment Synaptic Plasticity MRPS22 NIT2 PCBP1 TPI1 ALB ADD1 PDIA1 DPYSL2 ZNF638 PARK7 SOD1 DST CNN3 CHD5 DPYSL3 EIF4H IDHA3 SOD1 AIF1 CALD1 CEP135 COPB2 ERP29 GSTP1 HNRNPD NAA20 PAFAH1B3 PNPO PSMB2 PSMB3 RAN SUSD1 TUBB UCHL1 FIGURE I.10 | PROTEINS INVOLVED IN NEURODEVELOPMENT OR SYNAPTIC PLASTICITY. DANIELA MESQUITA MOUTINHO 92 SH-SY5Y cells were induced by RA and differentiated into a more neuron-like phenotype. TLQP-62 showed to be able to support and maintain those cells differentiation, promoting neuritogenesis, through regulating the expression of several proteins involved in cytoskeleton organization and cell cycle regulation. The majority f the identified proteins play a role in cell cycle regulation and several are responsible for arresting cell cycle, inhibiting cell proliferation. The generation, migration, and differentiation of neurons require the functional integrity of the microtubule cytoskeleton. ADD1 is induced by RA and phosphorylated by CDK1 contributing for cytoskeleton and cell–cell adhesion and to maintain axon diameter301. It mediates signal transduction in cellular processes via PKC, PKA and CaMKII, and regulates actin dynamics301. α-adducin is present at the synapse, presynaptically and postsynaptically302,303. Moreover, it has been implicated in the regulation of adipogenesis and with neurodegenerative disorders304. ADD1 is inhibited by GSK3β, and so an increase in ADD1 might indicate that GSK3β is inhibited in the presence of TLQP-62. Moreover, GSK3β inhibition enhances RARγ activity an cell differentiation329,330. CALD1 is regulated by CDK1 and CaMKII binding and phosphorylation, modulating cell shape, cytokinesis, cell adhesion, having an important role in regulating cell morphology and motility. CALD1 regulates microfilament organization and interacts with actin and CNN3. CNN3 is found expressed in the brain and may regulate actin cytoskeleton formation with a role on neural plasticity. CNN3 is also found in dendritic spines of adult hippocampal neurons being crucial for central nervous system development331. The overexpression of this protein induces neural differentiation by regulating ionotropic glutamate receptors, GluR1 and NR1332. CNN3 has been suggested as an adaptor protein in PKC and ERK signalling. CEP135 is a centrosomal protein and a microtubule-associated protein (MAP) involved in microtubule organization, important for cell cycle regulation333. Its downregulation causes microcephaly and disturbed centrosomal function334,335. It binds to tubulin to stabilize and destabilize microtubules, guides it towards specific cellular locations, crosslink microtubules and mediates interactions of microtubules with other proteins in the cell. CHAPTER I | Effect of TLQP-62 on SH-SY5Y 5 Discussion 93 Surprisingly, TUBB was found downregulated in this study. TUBB is an important protein for normal brain structure, being highly expressed in the developing cortex336. Perturbation of TUBB can alter the mitotic index of progenitor cells and their subsequent migration. Depletion of TUBB causes alterations in cell morphology, dendritic spine density, neuronal complexity and axon outgrowth in the mouse cerebral cortex, by altering the dynamic properties of the microtubule cytoskeleton during neurodifferentiation337. NAA20 is the catalytic subunit of the NatB complex which acetylates specific proteins and is required for maintaining the structure and function of actomyosin fibers, which are implicated in cell signaling pathways, including Hippo, Ras-MAPK, PI3K and NFkB, that are critical in the control of cell cycle progression (disruption of actin filaments causes G1 arrest and impaired cytokinesis), cell growth, cell size and cell motility338,339. HNRNPD (or AUF1) is a nucleic acid binding protein that regulates mRNA stability and interacts with other proteins in developing cortical neurons. It is specifically expressed in subsets of proliferating neural precursors and differentiating postmitotic neurons of the developing cerebral cortex340,341. AIF1 UCHL1 ALB ADD1 NIT2 IDH3A PNPO SOD1 Oxidative Stress & Immune Response TPI1 ZNF638 Biosynthesis & Metabolism EIF4H MRPS22 NAA20 GSTP1 PARK7 PDIA1 PGAM2 PSMB2 PSMB3 ERP29 Cell Cycle/Growth & Communication CEP135 CHD5 CNN3 COPB2 DPYSL2 DPYSL3 DST CALD1 TUBB HNRNPD PAFAH1B3 RAN FIGURE I.11 | CLASSIFICATION OF THE IDENTIFIED PROTEINS ACCORDING TO THEIR CELLULAR AND MOLECULAR FUNCTIONS. 101 CHAPTER II Olfactory Receptor 5P3: a human TLQP-62 receptor 1 INTRODUCTION Of all the VGF derived peptides, TLQP-21 has been the only one to have possible cell surface receptors identified. Chen et al. identified gC1qR, showing that TLQP-21 activated rat macrophages through gC1qR, causing mechanical hypersensitivity in rats232. gC1qR protein was originally described as the receptor to the globular domains of the first complement component C1q and is expressed by both brain and spinal cord derived microglia being indispensable for adipogenesis and insulin signaling296. Hannedouche et al. identified the complement receptor C3A receptor-1 (C3AR1) as a receptor for TLQP-21379. C3AR1 is a G-protein coupled receptor originally thought to be restricted to the innate immune response. More recently, in our group Akhter et al. described heat shock protein HSPA8 as a binding partner and potential receptor for TLQP-21380. The discovery of these receptors will help identify the mechanisms by which TLQP-21 and possible other derived peptide may modulate its actions. The most accepted hypothesis is that there are different receptors for the different VG-derived peptides. To date, no TLQP-62 receptors have been described. Since this peptide has an important role in neuronal processes, the identification of its receptor(s) could help better understand the downstream mechanisms and signaling pathways involved in TLQP-62 effects. VGF mRNA is widely expressed in neurons throughout the brain in central system and in peripheral endocrine and neuroendocrine tissues. In the adult brain VGF mRNA has the highest expression in the hypothalamus and the cerebellum, but it is also expressed in cortex, hippocampus, basal ganglia, thalamus, amygdala, midbrain, the main and accessory olfactory bulbs, and the brainstem. VGF and its derived peptides are DANIELA MESQUITA MOUTINHO 102 found in dense core vesicles and are released in response to depolarizing signals from neuronal and neuroendocrine cells through the regulated secretory pathway. VGF-derived peptides are prominent in the adult spinal cord, in motor neurons of the ventral horn and in the dorsal horn neurons. TLQP peptides are expressed at higher levels in ventral hippocampus and plasma, when compared to other VGFderived peptides221. A receptor is a protein on a given cell that after binding a ligand promotes a biological response and signal transduction. Receptors can be localized on cell surface membrane or intracellularly in the cytosol or nucleus. To isolate and identify a given receptor is necessary to know if the ligand in study is biological active and has a cellular function. Then, the tissue or cell line used in the experiment should express high levels of the ligand, since his might indicate also high expression levels of the receptor, increasing the chances of getting ligand-receptor complex. The next step is isolate cell membrane fraction and cytosolic fraction. Membrane fraction should be solubilized in order to facilitate ligand-receptor interaction and further purify this complex. The known ligand can be chemically, biologically or radiologically labelled. Fluorescently labelled ligands are widely used has it allows fluorescent confocal microscopy. Biotinylated peptides are also commonly used in peptide-receptor interaction, as it allows peptide-receptor complex isolation in an avidin column by affinity chromatography. To increase peptidereceptor binding, a chemical covalent crosslinker can be used in order to facilitate the complex purification and further identification by mass spectrometry. 2 OBJECTIVE The main objective of this chapter and study is to identify a potential human receptor for the human VGF-derived peptide TLQP62, using SH-SY5Y cell line and human hippocampus, by covalent crosslinking of the biotinylated peptide with the potential receptor and affinity chromatography followed by mass spectrometry analysis of the isolated complex. CHAPTER II | OR5P3 is a human TLQP-62 receptor 103 3 METHODS 3.1 HUMAN HIPPOCAMPUS HOMOGENATE PREPARATION Human hippocampus was obtained from an archive collection approved by the Ethics Review panel of Xunta de Galicia (Spain) and performed in accordance with the ethical guidelines of the Helsinki Declaration. Homogenate from 1 g hippocampus was prepared adding 10 mL PBS with 20% glycerol, 0.1% Triton X-100, 100 µM PMSF, 1 mM EDTA and 1 mM DTT. The homogenate was centrifuged for 10 minutes at 4ºC, 1000xg, pellet was kept frozen and supernatant was collected for further centrifugation for 30 minutes at 100 000xg. Supernatant was discarded and pellet was resuspended in PBS with 20% glycerol and 4% n-octyl-β-D-glucopyranoside and further centrifuged for 30 minutes at 100 000xg. Supernatant (S), containing the cytosolic fraction, and pellet (P), containing the membrane fraction, were collected for protein precipitation and quantification. 3.2 SH-SY5Y CELL CULTURE & PROTEIN FRACTION PREPARATION SH-SY5Y cells were maintained in a 1:1 proportion EBSS and F12HAM medium, supplemented with 15% FBS, 1% L-glutamine 200 mM, 1% MEM-NEAA and 1% Penicillin/Streptomycin. Cells were seeded at a density of 104 cells/ cm2 in 100x20 mm culture dishes (Falcon, Life Sciences) and grown at 37ºC in a 5% CO2 humidified incubator. Confluent SH-SY5Y cell plates were washed twice with cold PBS and solubilized in lysis buffer (20 mM HEPES pH 7.4, 2 mM EGTA, 1 mM DTT, 1 mM sodium orthovanadate, 1% Triton X-100, 10% glycerol, 2 µM leupeptin, 400 µM PMSF, 50 µM β-glycerophosphate and 100 µg/ml aprotinin). The cells were scrapped on ice for 10 min and incubated on ice for 30 min with periodic vortexing at each 10 min. Sonication on ice was performed for 3 periods of 15 seconds with 10 seconds interval on ice in between each pulse, with a 10% amplitude. Centrifugation at 4ºC, 14000xg, for 30 min was performed. Pellet was discard and supernatant was recovered DANIELA MESQUITA MOUTINHO 104 and 1 mM DTT and 2% n-octyl-β-D-glucopyranoside was added for membrane protein solubilization, and briefly sonicated for protein precipitation and quantification (see below), and kept frozen at -80ºC. 3.3 PROTEIN PREPARATION & QUANTIFICATION Protein fractions were precipitated in 6 volumes of cold methanol 100% for 45 min at -20ºC, followed by centrifugation at 4ºC, 14000xg for 20 min. Supernatant was discarded and pellet was let to air-dry and resuspended in 50 µL sample buffer (PBS with 1% n-octyl-β-Dglucopyranoside, 10 mM DTT, 1 mM EDTA, 100 µM PMSF) and sonicated for 5 min in a ultrasonic cell disruptor Sonifier 150 (Branson) for solubilization. Protein quantification was performed with Protein Reagent (Bio-rad) as described in chapter I.3.4. 3.4 BIOTINYLATED TLQP-62 PEPTIDE & CROSSLINKER CONJUGATION Human biotinylated TLQP-62 with an extra cysteine residue with total molecular weight 7833 Da was purchased from ChinaPeptides Co. Ltd, Sanghai, at >95% purity, confirmed by HPLC and MS analysis, as a lyophilized power and stored at -80ºC. Biotin-TLQP62 was prepared at 1 mg/mL (128 µM) in 20% acetonitrile in filtered PBS with 50 µM TCEP and used or kept at - 80ºC. The peptide sequence is biotin-CTLQPPSALRRRHYHHALPPSRHYPGREAQARR AQEEAEAEERRLQEQEELENYIEHVLLRRP. Sulfo-EMCS (sulfo-N-[ɛ-maleimidocaproyloxy]succinimide ester) was used as a cross-linker to bind TLQP-62 to its putative receptor. 1 mM Sulfo-EMCS (Thermo Scientific) was dissolved in conjugation buffer (0.1 M sodium phosphate, 0.15 M NaCl, pH 7.2 [PBS]) and mixed with 50 µM biotin-TLQP-62 and incubated on ice for 2 hours for peptide conjugation. For the crosslinking reaction the conjugated peptide (1 mL at 50 µM) was mixed with SH-SY5Y cell homogenate fraction (1 mL at 2 mg/ml) or human hippocampus homogenate fraction (1 mL at 2 mg/mL) and incubated on ice for 2 hours. The reaction was terminated by adding 50 mM Tris-HCl, pH 8.0. As control, cell homogenate, unconjugated sulfo-EMCS and conjugation buffer, without conjugated peptide were incubated. Samples were then submitted to an avidin agarose column for further protein purification and identification as a putative receptor of TLQP-62. CHAPTER II | OR5P3 is a human TLQP-62 receptor 3 Methods 105 3.5 MONOMERIC AVIDIN AGAROSE AFFINITY CHROMATOGRAPHY Pierce Monomeric avidin kit (Thermo Scientific) was used for affinity chromatography using a 2 mL prepacked monomeric 4% beaded avidin column, wash buffer (0.1 M sodium phosphate, 0.15 M NaCl, pH 7.2, with 0.01% sodium azide), biotin blocking/elution buffer (PBS with 2 mM D-biotin) and regeneration buffer (0.1 M glycine, pH 2.8). All components were stored at 4ºC and equilibrated to room temperature before use. Columns were washed with 8 mL wash buffer followed by 6 mL biotin blocking/elution buffer to block non-reversible biotin binding sites. Regeneration buffer was added to remove biotin from reversible binding sites followed by 8 mL wash buffer. Biotinylated proteins should be added to the column and incubated, then washed, eluted and finally regenerated by washing with 4 mL regeneration buffer to strip off residual bound biotin and then washed with 5 mL PBS with 0.01% sodium azide and stored at 4ºC. All fractions were precipitated and pellet was resuspended in 1x Laemmeli buffer for SDS-PAGE and western blot analysis. 3.5.1. Purification of biotin-TLQP-62 crosslinked with SHSY5Y membrane fraction SH-SY5Y cells were grown as described before until confluence. Culture medium was removed; cells were washed 3 times with cold PBS and incubated with 2 mL PBS containing 1 mM sulfo-EMCS with 50 µM biotin-TLQP-62 for 2 h at room temperature. Cells were lysed and membrane fraction (P) was recovered as described before. 2 mL of solubilized biotinylated SH-SY5Y membrane proteins were applied to the avidin column and incubated 1 hour at room temperature. Column was washed with 12 mL wash buffer and eluted with 10 mL biotin blocking/elution buffer, collecting fractions for further precipitation and analysis by SDS-PAGE and SYPRO® Ruby staining and Western blot. As control, cell homogenate with1 mM sulfo-EMCS but without biotin-TLQP-62, was added to a column under the same conditions and analyzed. 3.5.2. Purification of biotin-TLQP-62 crosslinked with hippocampus homogenate proteins Hippocampus homogenate was prepared as described before for cytosolic (S) and membrane (P) fractions. To 1 mM sulfo-EMCS was DANIELA MESQUITA MOUTINHO 106 added 50 µM biotin-TLQP-62 and let for 2 h at room temperature, before adding P or S hippocampus fraction for 2 more hours. Resulting sulfo-EMCS-biotin-TLQP-62 was applied to the avidin column and incubated 1 hour at room temperature. Column was washed with 12 mL wash buffer and eluted with 10 mL biotin blocking/elution buffer, collecting fractions for further precipitation and analysis by SDS-PAGE and SYPRO® ruby staining and Western blot. As control, hippocampus fraction with1 mM sulfo-EMCS but without biotin-TLQP-62, was added to a column under the same conditions and analyzed. 3.6 MONODIMENSIONAL (1D) SDS-PAGE and SYPRO® RUBY STAIN Protein extracts or eluted fractions were submitted to SDS-PAGE and SYPRO ruby gel stain as described in chapters I.3.5 and I.3.8 3.7 IMMUNOBLOTTING Immunobloting was performed as described in chapter I.3.6. Primary and secondary antibodies were diluted in 1% BSA in TBS-T. Goat anti-human HSPA8 (Invitrogen; 1:1000 dilution) and antiOR5P3 (Invitrogen; 1:1000 dilution) were used as primary antibodies. Secondary antibody anti-goat IgG-HRP (Santa Cruz; 1:2000 dilution). 3.8 MASS SPECTROMETRY Bands chosen for analysis, after SYPRO Ruby gel staining and visualization, were excised from the gel using a Blue Box (Invitrogen) to aid visualization and sent for protein identification by nLC-ESItrampa with tryptic digestion and Mascot analysis at Mass Spectrometry Unit at CACTUS, University of Santiago de Compostela, as descried before in chapter I.3.9. 3.9 IMMUNOCYTOCHEMISTRY SH-SY5Y cells were plated and grown, as described before, in a 4-well Milicell EZ slide (Millipore). At the next day cells were washed twice with PBS and fixed with 10% formalin. For blocking, cells were washed with PBS for 5 min and incubated with 2% BSA in PBS for 30 min. Primary antibodies against the human proteins (rabbit anti-VGF(C-term), anti-HSPA8 and anti-OR5P3) were diluted in PBS CHAPTER II | OR5P3 is a human TLQP-62 receptor 3 Methods 107 according to manufacturer instructions and added to the cells for 1 hour at room temperature. Cells were washed 3 times for 5 min with PBS before incubated with the secondary antibody donkey anti-rabbit IgG-FITC (Santa Cruz Biotechnology) in PBS for 30 min and rinsed with PBS 3 times for 5 min. DAPI was added to the cells (1:1000 in PBS) for 5 min and rinsed with PBS for 5 min, twice. Cells were observed using an Olympus inverted microscope IX51 with an Olympus U-RFL-T reflected fluorescence system and the microscope imaging software Olympus CellSens standard. 3.10 ANALYSIS OF HSPA8-TLQP-62 INTERACTION BY DYNAMIC MASS REDISTRIBUTION ANALYSIS Label-free high sensitivity plates (PerkinElmer 6057460) were activated with 15 μl of 400 mM N-(3-dimethylaminopropyl)-N’- ethylcarbodiimide hydrochloride (EDC) (Sigma-Aldrich) and 100 mM Sulfo-N-hydroxysulfosuccidime (sulfo-NHS) (Ther moFisher) diluted in ultrapure water 30 min at room temperature. Microplates were subsequently washed four times with ultrapure water. HSPA8 immobilization was performed by adding 15 μl of 25 μg/ml of protein in 20 mM sodium acetate buffer at pH = 5. After overnight incubation at 4°C, microplates were washed four times with PBS containing 0,005% Tween-20 buffer, pH = 7.4. Baseline was read after the microplate was equilibrated inside the EnSpire® Multimode Plate Reader (Perkin Elmer) for 3 hours. TLQP-62 peptide dilutions were prepared in PBS containing 0,005% Tween-20 buffer, pH = 7.4. To this, 15 μl of peptide solution were added to the plate and mixed. Final reading was performed every two minutes over a period of 1 hour. 3.11 ANALYSIS OF OR5P3-TLQP-62 INTERACTION BY CAMP MEASUREMENT In order to evaluate the effect of TLQP-62 on the activation of OR5P3 it was necessary to generate a cell model overexpressing this olfactory receptor to them measure cAMP levels. This experiment was performed in collaboration with BioFarma Group and Dr. Eduardo Dominguez at Universidad de Santiago de Compostela, Spain. DANIELA MESQUITA MOUTINHO 108 3.11.1. Hana3A cells and culture media Hana3A cells derived from HEK293T have the specific characteristic of expressing genes important for the expression and functionality of olfactory receptors (i.e. RTP1, RTP2, REEP1 and Golf). Cells were grown in DMEM (Gibco) with 10% FBS (Sigma Aldrich), 1% P/S (Sigma Aldrich), 2.5% puromycin (Sigma Aldrich) at 37ºC with 5% CO2. 3.11.2. Recombinant expression of OR5P3 For the recombinant expression of OR5P3 the plasmid pCI-OR5P3 was used. For the genetic transfer of the receptor to the HANA3A cells the FuGENE6 protocol (Promega) was used following the fabricant recommendations. A 3:1 ratio of cDNA:FuGENE6 was used to incubate 15000 cells/well in a 96 well plate. The minimum media OptiMEM (Gibco) was used to optimize the complex formation and cells were incubated for 24h. 3.11.3. Immunofluorescent detection of OR5P3 expression Cells were permeabilized with HBSS (Gibco), PBS, 2% PFA, 1% Saponin and 5% BSA for 24h at 4ºC with anti-rhodopsin antibody (Rho4D2). Goat anti-mouse IgG AlexaFluor 488 was used as secondary antibody. The cell nuclei were observed with Hoechst. For images a microscope Operetta (Perkin Elmer) was used. 3.11.4. cAMP determination The commercial assay CisBio BioAssay cAMp-GS Dynamic was used. It was based in specific antibodies marked with criptato (doner) and cAMP copled to d2 (acceptor). It is constitutated by several components: Stimulation Buffer 1 (5x), Lysis & Detection Buffer 2, IBMX, Forskolin, cAMP-d2 and anti-AMPc-cryptate. Foskolin was used as an activator of adenylate cyclase at 25 μmol/mL for 30 min to stimulate the cAMP pathway. The effect of several potential ligands of OR5P3 was evaluated: hexanol, carvone, cumarine and TLQP-62, by adding it to the cultured cells for 24 h. Tecan Infinite M1000 PRO was used to read the homogeneous time resolved fluorescence (HTRF) signal. The resulting data was analysed by GraphPad Prism 6, calculating the ration between the signal at 665 nm and 620 nm for each well. Results are expressed as the percentage of HTRF signal difference from the background measurements (%DF). CHAPTER II | OR5P3 is a human TLQP-62 receptor 109 4 RESULTS Here an effort was made to identify a possible receptor for VGFderived antidepressant peptide TLQP-62. Receptors can be on the cell membrane or intracellularly, membrane bound or cytoplasmic. Although TLQP-62 is a 62 residues peptide and not expected to be able to cross or be transported across the cell membrane, total SHSY5Y cell lysate was used to search for a possible receptor. As it is sill to unveil if TLQP-62 interacts directly with BDNF and is receptor TrkB or acts through other receptor, biotinylated TLQP-62 was crosslinked with SH-SY5Y cultured cells in vivo and its membrane fraction was further isolated and analyzed through affinity chromatography. 4.1 IDENTIFICATION OF HEAT SHOCK PROTEINS HSPA8 AND HSPD1 AND THE G-PROTEIN COUPLED OLFACTORY RECEPTOR OR5P3 AS TLQP-62 BINDING PROTEINS ON SH-SY5Y CELLS For identification of a putative receptor or some binding partner of human TLQP-62 peptide, SH-SY5Y neuroblastoma cell line was used, as it is known to express high levels of VGF precursor. 4.1.1. Affinity purification of crosslinked biotin-TLQP-62 with SH-SY5Y membrane proteins Biotinylated TLQP-62 was crosslinked with sulfo-EMCS and incubated with SH-SY5Y cells on plate for 2 hours at room temperature. After cells recovery, lysis and membrane fraction isolation, membrane lysate was analyzed through an avidin column. As control, no biotin-TLQP-62 was used, and only sulfo-EMCS was conjugated with cells and the resulting membrane lysate was passed through the column. Figure II.1 shows elution fractions, and several protein bands not visible in the control are seen in the reaction fraction (M). Bands (M1-M5) around 70, 60, 50, 45 and 25 kDa were analyzed through LC/MC for protein identification by Mascot (Table II.1). DANIELA MESQUITA MOUTINHO 116 4.3 CHARACTERIZATION OF HSPA8-TLQP-62 INTERACTION To evaluate the interaction between HSPA8 and TLQP-62 a dynamic mass redistribution analysis was performed using a range of different concentrations of peptide: 10, 20, 40, 60, 80 and 100 μM. For higher concentrations than 100 μM the peptide starts to precipitate and it is not possible to read the reflected wavelength shits properly. Response at 1 hour is shown in Figure II.6, indicating a weak interaction between the peptide and the chaperone, represented by a Kd of 155.2 μM. FIGURE II.6 | DYNAMIC MASS REDISTRIBUTION ANALYSIS OF TLQP-62 INTERACTION WITH HSPA8. A range of different concentration of peptide were tested, 10, 20, 40, 60, 80 and 100 μM. Response is shown at 60 min with a Kd of 155.2 uM. Label-free responses are measured as shifts in reflected wavelength and expressed in picometers (pm). Kd = 155.2 μM CHAPTER II | OR5P3 is a human TLQP-62 receptor 4 Results 117 4.4 TLQP-62 IS A LIGAND FOR OR5P3 To prove TLQP-62 is an OR5P3 ligand, a cell model overexpressing this putative olfactory receptor was evaluate for this neuropeptide ability to increase cAMP levels. Hana3A cells were used to express the human OR5P3 by using a specific plasmid. As observed in Figure II.7, OR5P3 was successfully transfected into Hana3A cells and was being expressed on these cells. To determinate cAMP levels, a commercial assay was performed. Cultured cells expressing OR5P3 were treated with several potential OR5P3 ligands – hexanol, coumarin and carvone – and TLQP-62 for 24h and cAMP levels were measured. As observed in figure II.8, an agonist activity was observed for TLQP-62 neuropeptide on the cAMP pathway in OR5P3 expressing cells, with an EC50 of 32.6 nM, and not in the control ones. None of the other odor ligands produces a similar effect, proving that OR5P3 function is most probably not connected to smell or odor. FIGURE II.7 | OLFACTORY RECEPTOR OR5P3 EXPRESSION IN TRANSFECTED HANA3A CELLS. An immunocytochemistry assay was performed to confirm OR5P3 expression. Hana3A control Hana3A pCI-OR5P3 transfected DANIELA MESQUITA MOUTINHO 118 FIGURE II.8 | EVALUATION OF THE EFFECT OF SEVERAL POTENTIAL LIGANDS OF OR5P3 ON ITS COUPLED CAMP PATHWAY. Hexanol, coumarin and carvone were investigated as odorant ligand, to compare with TLQP-62. From all investigated ligands, only TLQP-62 succeeded by promoting a response via cAMP. CHAPTER II | OR5P3 is a human TLQP-62 receptor 119 5 DISCUSSION Considering the important role of human TLQP-62 antidepressant peptide on neuronal processes and neurological disorders, it is crucial the identification of a human receptor, not described to date, to better understand the underlying molecular mechanisms and signaling pathways, to pursue a treatment for several conditions, including depression and other neuropsychiatric disorders. An effort was made to identify a putative human receptor for human TLQP-62, using SH-SY5Y cell line and human hippocampus homogenate as models of study. Membrane fraction of SH-SY5Y and hippocampus homogenate membrane fraction were used to perform a crosslinking experiment with biotin-TLQP-62. TLQP-62 was modified by attachment of a biotin molecule at the N-terminal via amide bound and with an extra cysteine residue to react with a crosslinker to facilitate the search for a receptor, and further purification by avidin affinity chromatography and detection by immunodetection using streptavidin-HRP. Biotin-TLQP-62 was first crosslinked with sulfo-EMCS, a heterobifunctional crosslinker containing a N-hydroxysuccimide ester, that reacts at pH 7-9 with primary amines by nucleophilic attack forming amide bonds, and a maleimide that reacts with sulfhydryl groups in cysteines at pH 6.57.5 forming stable thioester bonds383,384. Crosslinked biotinylated peptide was incubated with SH-SY5Y membrane fraction and purified by affinity chromatography for binding partners and possible receptor’s isolation. 5.1 OR5P3: TLQP-62 BINDING PARTNER AND PUTATIVE RECEPTOR As TLQP-62 has 62 residues and it is not expected to be able to cross or be transported across the cell membrane, there must be a receptor localized in the cell surface to transduce the signal. By crosslinking sulfo-EMSC-biotin-TLQP-62 with the SH-SY5Y membrane fraction and purifing any crosslinked complex using an avidin column, chaperones HSPA8 and HSPD1 were identified as FIGURE IV.3 | KNOWN AND PREDICTED INTERACTIONS BETWEEN THE RESULTING PURIFIED AND IDENTIFIED MEMBRANE PROTEINS FROM CROSSLINKING OF BIOTIN-TLQP62 WITH SH-SY5Y CULTURED CELLS (TABLE IV.3) USING THE STRING tool. FIGURE IV.12 | EVALUATION OF THE EFFECT OF SEVERAL POTENTIAL LIGANDS OF OR5P3 ON ITS COUPLED CAMP PATHWAY. Hexanol, coumarin and carvone were investigated as odorant ligand, to compare with TLQP-62. From all investigated ligands, only TLQP62 succeeded by promoting a response via cAMP. DANIELA MESQUITA MOUTINHO 120 TLQP-62 binding partners, together with the G-protein coupled olfactory receptor 5P3 (OR5P3) (Figure II.1 and Table II.1). Several tubulins and actin were also identified, together with elongation factor 1A1 and peroxiredoxins. All of these proteins can be found in the cytosol, but also in the cell surface. Given the known functions and protein characteristics, heat shock proteins HSPA8 and HSPD1, and G-protein coupled receptor OR5P3 were selected to be further analyzed as putative receptors or binding partners of TLQP-62 with biological significance. Although OR5P3 was identified with a low score (<40), it was considered for further analysis, as the tissue used was only the cell membrane fraction. OR5P3 is a G-protein coupled receptor, classified by homology as an olfactory like-receptor. Olfactory receptors (ORs) were thought to be expressed only in the olfactory neurons present in the olfactory epithelium, and that each olfactory neuron only expressed one type of OR385. However, more recently ORs were found to be expressed in non-chemosensory tissues, including the brain. Moreover, a single neuron outside the olfactory epithelium can express more than one receptor and the mechanism of transcriptional regulation may be different in olfactory epithelia and brain neurons382,386,387. ORs are described as being responsible for the binding of volatile, water soluble or lipid soluble molecules that lead to the initial perception of smell in the brain, and usually are co-expressed in the cells with one type of taste receptors. The signaling from the smell molecules from the olfactory epithelium goes to the olfactory bulb, then to the amygdala and then to the hippocampus, where memories linked to smell are produced by promoting hippocampal neurogenesis. 5.2 CONFIRMATION OF TLQP-62 AND OR5P3 BINDING: To confirm OR5P3 expression on SH-SY5Y cells an immunocytochemistry analysis was performed on cultured cells using antihuman OR5P3 antibody where its presence was observed (Figure II.4). Also, OR5P3 immunodetection was performed in the eluted fraction resulting from the affinity purification of the crosslinked biotin-TLQP-62 with SH-SY5Y membrane fraction, as observed in figure II.3. Moreover, OR5P3 was also immunodetected in membrane fraction of human hippocampus homogenate (Figure II.5). CHAPTER II | OR5P3 is a human TLQP-62 receptor 5 Discussion 121 5.3 CHARACTERIZATION OF OR5P3 AS A TLQP-62 RECEPTOR When a ligand bind to a OR it is activated and associated Golf proteins dissociate into subunits α, β and γ, and induce an increase of intracellular cAMP caused by the membrane form of adenylate cyclase 3 (AC3). To confirm TLQP-62 as a ligand of OR5P3 a cell model overexpressing this receptor was used: TLQP-62 was shown to increase cAMP levels through OR5P3 binding in the Hana3A cell model overexpressing this receptor. Several potential odorant ligands have been suggested to be OR5P3 ligands in the olfactory epithelium: hexane, coumarin and carvone. We evaluate for 24h the ability of these ligands to increase cAMP levels by activating OR5P3, and compared to the results when using TLQP-62 neuropeptide. Surprisingly, in Hana3A cells we could not detected an agonist activity for the 3 odorant ligands. Only for TLQP-62 was observed a cAMP activity indicating this neuropeptide is a ligand for OR5P3, with an EC50 of 32.6 nM. As none of the other odor ligands produces a similar effect, this proves that OR5P3 function is most probably not connected to smell or odor. Therefore, these preliminary results indicate TLQP-62 is a functional ligand of OR5P3 and its signal transduction in neurons is possibly linked to the expression of BDNF induced by TLQP-62, leading to neurogenesis. 5.4 HSPA8 IS A TLQP-62 BINDING PARTNER On the other hand, we also found HSPA8 (HSC70), and probably HSPD1 (HSP60), to bind to TLQP-62. HSPA8 had been previously identified as a binding partner of TLQP-21380. Heat shock proteins are known for their chaperone functions, helping to proper folding proteins during cell stress, but also during normal cell functioning by helping to transport and fold nascent protein to its proper localization. HSPA8 and HSPD1 are constitutively expressed proteins that help in transport and folding of protein, inclusively membrane proteins, and can be found associated in lipid rafts in the plasma membrane helping to maintain its integrity and the structure of the membrane proteins, as receptors, including GPCRs381,388,389. HSPD1 prevents protein aggregation, and HSPA8 stabilizes and folds proteins. HSP60 are large oligomeric ring-shaped proteins known as chaperonins that bind partially folded intermediates, preventing their aggregation, and DANIELA MESQUITA MOUTINHO 122 facilitating their folding and assembly. These chaperones are found in all biological compartments except the ER. In addition to preventing aggregation, it has been suggested that HSP60 may permit misfolded structures to unfold and refold390. HSPA8, besides its chaperone function, is known to also carry out other important biological functions, as regulation of cell division, signaling, and transcriptional and translational control391. 5.5 CHARACTERIZATION OF TLQP-62 AND HSPA8 BINDING: To confirm HSPA8 expression on SH-SY5Y cells an immunocytochemistry analysis was performed on cultured cells using antihuman HSPA8 antibody where its presence can be observed (Figure II.4). Also, HSPA8 immunodetection was performed in the eluted fraction resulting from the affinity purification of the crosslinked biotin-TLQP-62 with SH-SY5Y membrane fraction (Figure II.3a). Dynamic mass redistribution analysis was performed to evaluate the interaction between HSPA8 and TLQP-62, which indicated a weak interaction between the peptide and the chaperone, represented by a Kd of 155.2 μM, as observed in figure II.6. 5.6 OLFACTORY RECEPTORS AND OR5P3 More than 900 ORs genes and pseudogenes were identified from human genome sequences databases by homology392. The classification or nomenclature of OR genes is not fully established and its evolution is poorly understood. As illustrated in figure II.9, odorant signal transduction is initiated when odorants interact with specific ORs. ORs linked to Golf proteins are activated, by dissociating into subunits μ, β and γ, and induce an increase of intracellular cAMP caused by the membrane form of adenylate cyclase 3 (AC3). Increased intracellular cAMP causes an external Ca2+ influx by activating a cation-selective cyclic nucleotide-gated (CNG) channel. Then, rapid plasma membrane depolarization is triggered by the Ca2+-activated Clchannel. The elevated intracellular Ca2+ concentration is reduced by expelling Ca2+ through the plasma membrane by a Na+/Ca2+ exchanger (NCX), a potassium-dependent Na+/Ca2+ exchanger (NCKX4), and plasma membrane Ca2+-ATPase (PMCA). Olfactory marker protein (OMP) facilitates NCX activity and allows rapid Ca2+ CHAPTER II | OR5P3 is a human TLQP-62 receptor 5 Discussion 123 extrusion. The complex Ca2+-calmodulin activates phosphodiesterase (PDE) that hydrolyzes cAMP and produces a negative feedback effect on the CNG channel393–395. Here, a CNGB3 channel was identified as binding to TLQP-62 on human hippocampus homogenate (data not shown). CNG channels are usually linked or very close to ORs in the plasma membrane, and as we also succeed to immunodetect OR5P3 in the human hippocampus homogenate as a potential TLQP-62 receptor, it is normal to also find CNGs associated. 5.6.1. ORs in non-olfactory tissues As mentioned before, some olfactory receptors are expressed not only in olfactory neurons but also in non-chemosensory tissues, where ORs are found to be co-expressed in the same cell type and also coexpressed with other GCPRs and taste receptors. In olfactory neurons, activation of the receptors elicits a receptor current, but activation of ectopically expressed receptors can have diverse effects. ORs are GPCRs, which can couple to different intracellular signaling cascades depending on the activation of different types of heterotrimeric Gproteins396, the interaction with other cellular partners, such as arrestins and scaffolding proteins397,398, heteroor dimerization with other receptors and lipid-protein interactions399,400. Different G-protein subunits alpha (GαS, Gαi/o, Gαq/11 or Gα12/13) can trigger different signaling pathways, as illustrated in figure II.10. GαS is stimulatory for AC3 leading to an increase in CAMP and Gαi/o inhibits AC3. FIGURE II.9 | ODORANT SIGNAL TRANSDUCTION INITIATION. [Constructed from data of Borisy et al. 1992, Pifferi et al. 2006 and Kang and Koo, 2012] DANIELA MESQUITA MOUTINHO 124 ORs are known to interact with a specific type of G-proteins, Golf, similar to GS, but not much is known about signaling pathways mechanisms of ORs in non-olfactory tissues. GPCRs are activated by chemical ligands, as such small amines, peptide hormones, chemokines, lipids, proteins, ions, nucleotides and odorants, and can induce a variety of cellular responses, as cell shape changes and altered adhesion, cell migration, survival or proliferation401,402. ORs located in non-olfactory tissue are chemoreceptors triggering several responses not related to odor but rather to cell-cell communication and recognition, tissue injury, repair and regeneration, chemotaxis, cell division, growth and migration, nutrient sensing and regulation of blood pressure, energy homeostasis and cellular metabolism387. For example, ORs are expressed in pyramidal neurons in the cerebral cortex, suggesting its possible important role either in chemical detection of exogenous or endogenous ligands or in a developmental process, such as axon guidance and target recognition 386. OR51E2 regulates cell proliferation and differentiation in human melanocytes and prostate epithelial cells403,404. Also, OR15 is expressed in pancreatic β-cells and promotes glucose-stimulated insulin secretion apparently not through Golf but inducing PLC/IP3 downstream pathways, maybe suggesting Gαq/11 involvement405. ORs are expressed in several tissues and organs, as the heart, brain, lungs, kidneys, placenta, liver, spleen, prostate, erythrocytes, eye and gut. Several molecules delivered from the blood, cerebrospinal fluid, neighboring local neurons and glial cells, distant cells through the extracellular space, and the cell self-regulating internal homeostasis, can be postulated as possible ligands for ORs. For example, ORs respond to short chain fatty acids produced by gut microbiota by regulating blood pressure406, while activation of ORs by spicy species results in serotonin release407. Olfactory binding proteins (OBP) are small soluble extracellular proteins related to pheromone and odor transduction, mainly but not exclusively found in olfactory organs. OBPs are also present in several fluids, as vaginal discharge, urine, saliva, tears and amniotic fluid. OBPs in brain and other organs do not necessarily participate in olfaction, but rather are used in other metabolic functions which have nothing in common with smell. CHAPTER II | OR5P3 is a human TLQP-62 receptor 5 Discussion 125 5.6.2. ORs in non-olfactory organs of the nervous system GPCRs are known to be essential in the regulation of structural plasticity and cognitive function by altering dendrite morphology and synapse formation through binding of neurotransmitters and neurotrophic factors. An example is brain-specific angiogenesis inhibitor 3 (BAI3), a p53 target gene encoding a adhesion GPCR expressed in central nervous system and crucial for synaptic plasticity in the hippocampus, and found to be altered in schizophrenia and other neuropsychiatric and neurodevelopmental disorders142,408,409. Several ORs have been found in dopaminergic neurons of substantia nigra and neurons of the spinal cord, in the cerebral and cerebellar cortex, hippocampus, dentate gyrus, striatum, thalamus and hypothalamus382. It is possible that neuropeptides can bind ORs in the brain, and other non-chemosensory tissues, to trigger homeostasis signals. Moreover, OR gene expression is known to be altered in several neurodegenerative diseases, including Parkinson’s and Alzheimer’s disease, prion disorders, and in depression and schizophrenia185,186,382. Also, taste receptors (TASRs) were observed in the mammalian brain, whose function is not related to taste410–412. FIGURE II.10 | DIFFERENT SIGNALING PATHWAYS ARE ACTIVATED BY DIFFERENT G PROTEINS. [Constructed from data of Luttrel, 2006] Ligand binding to the receptor 132 133 CHAPTER III Human TLQP-62 Structural Insights 1 INTRODUCTION VGF-derived peptide TLQP-62 is a small protein of 62 amino acids, with an important role in neurological processes. Proteins and peptides are responsible for carrying out fundamental biological molecular functions in the cell. Usually a protein is classified as a peptide when it has less than 50 residues. Because of its small size, peptides tend to be less well defined in structure and form random coils and so be more prone to aggregate, than proteins. However, peptides often have conformational preferences and adapt their native secondary structures, as helices and sheets. Peptides are regulators of the activity of other molecules, including proteins, and the function of a protein or peptide is determined by structure. Thus, knowing the three-dimensional structure of a peptide is of great help to understand how it will interact with other molecules, for example its receptor, and so its function. This facilitates the design of peptides or drugs (agonists/antagonists) with pharmaceutical use. There are several methods to identify protein secondary and tertiary structure, including circular dichroism spectroscopy, X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy or electron microscopy. Also computer simulations, as molecular dynamics, are being used as an alternative tool to predict the structure of some peptides. Circular dichroism is used to unveil the secondary structure of a protein in solution. It is very important that the protein or peptide does not aggregate and conditions for best solubility and stability must be achieved. X-ray crystallography requires the protein to be in a crystal form and for that large amount of extremely pure DANIELA MESQUITA MOUTINHO 134 protein in solution is needed to test many different conditions for nucleation and growth of ordered crystals which will serve as a signal amplifier428. NMR also requires large amounts of isotopically labelled protein in solution but has slight lower resolution when compared to X-ray crystallography. NMR measures the quantum mechanical properties of the nuclei of atoms in proteins, determined by their local molecular environment, proving information on how close atoms are and how they could be linked chemically. These distance information can be used to determine protein tertiary structure429. As described in Chapter I, we investigated the effects of TLQP-62 neuropeptide in SH-SY5Y cells, which promotes its differentiation into a more neuron-like type cell, and its connection with DISC1. In Chapter II we identified OR5P3 as a receptor for this peptide in SHSY5Y cells and human hippocampus homogenate. VGF has been implicated in some psychoand neurological disorders, and described to be indirectly regulated by DISC1148,187,191,193,430. As TLQP-62 is known for having antidepressant properties - by promoting neurogenesis and having a role on memory and learning, through increasing BDNF expression – the identified receptor OR5P3 might be involved in this pathway and be a drug target for treating depression and other neurological disorders 150,190,431. Thus, it is important to know more about the structure of TLQP62 and OR5P3, alone and in complex, for further drug design. 2 OBJECTIVE The aim of this chapter is to produce and purify TLQP-62 to further investigate its structural features by circular dichroism and NMR spectroscopy. CHAPTER III | Human TLQP-62 structural insights 135 3 METHODS 3.1 HUMAN TLQP-62 PEPETIDE SYNTHESIS & PRIMARY SEQUENCE TLQP-62 (human, molecular weight 7503 Da) was purchased from ChinaPeptides Co. LTd., Shangai, >95% pure, confirmed by HPLC and MS analysis, as a lyophilized powder. A stock solution of 1 mg/mL was performed in filtered PBS with 10% acetonitrile and stored at -80ºC. Peptide sequence is: TLQPPSALRRRHYHHALPPS RHYPGREAQARRAQEEAEAEERRLQEQEELENYIEHVLLRR. 3.2 SECONDARY STRUCTURE ESTIMATION The secondary structure was predicted using the TLQP-62 primary sequence and the server Capito: a CD analysis & plotting tool (http://capito.nmr.leibniz-fli.de/) and the Swiss-Model tool from Expasy (http://swissmodel.expasy.org). Circular dichroism spectroscopy experiment was performed in a J1500 circular dichroism spectrophotometer (JASCO) at 25ºC to evaluate TLQP-62 secondary structure. A solution of 0.1 mg/mL TLQP-62 in 50 mM NaH2PO4 pH 6, 7.5 or 9 was analyzed. The resulting data was analyzed also using Capito plotting tool. 3.3 TERTIARY STRUCTURE DETERMINATION: NMR For human TLQP-62 expression the correspondent cDNA was cloned into a suitable vector for further transformation into Escherichia coli for expression. As hTLQP-62 is a peptide of around 8 kDa, is susceptible to digestion by bacterial proteases and for better stabilization, solubility and longer half time life in vivo, a fusion protein was used to aid expression and solubility. The pETiteTM N6His SUMO vector (Figure V.1) allows the expression of the target protein as a fusion with an amino-terminal 6xHis-SUMO tag, which has been shown to increase the yield and enhance the solubility of a variety of proteins. SUMO (Small Ubiquitin-like Modifier) is a small protein (100 amino acids) recognized by the higly-specific SUMO DANIELA MESQUITA MOUTINHO 136 Express Protease, allowing precise removal of the tag to produce the target protein. The 6xHis motif at the amino terminus of the SUMO tag allows purification of the fusion protein by metal affinity chromatography. The vector is ready for co-transformation with the PCR product containing the gene of interest. The desired insert must be amplified with primers including 18 nucleotides of overlap with the ends of the vector. Recombination between the vector and insert occurs within the host strain, fusing the gene of interest to the vector. 3.3.1 Expression of isotopically labelled recombinant TLQP-62 peptide pETiteTM N-6His SUMO vector: To clone human TLQP-62 cDNA into a vector for further expression on E. coli, the Expresso T7 SUMO cloning and Expression System (Lucigen) was used, containing preprocessed pETiteTM N-6His SUMO Kan vector, HI-controlTM 10G Chemically Competent Cells for cloning and HI-controlTM BL21 (DE3) Chemically Competent cells for protein expression and SUMO express protease for posterior SUMO cleavage. Human TLQP-62 cDNA cloning: Human TLQP-62 cDNA was cloned as gene of interest into the pETite-N-6His-SUMO vector resulting in the recombinant vector pETiteN6HSUMO_hTLQP-62 expressing the recombinant protein 6HSUMOhTLQP-62 (Figure III.1). The hTLQP-62 cDNA sequence (Figure III.2) was inserted into pETite vector after amplification. A source of hTLQP-62 was required and for that purpose SH-SY5Y human neuroblastoma cell line was used. M H H H H H H G S L Q D S E V N Q E A K P E V K P E V K P E T H I N L K V S D G S S E I F F K I K K T T P L R R L M E A F A K R Q G K E M D S L T F L Y D G I E I Q A D Q T P E D L D M E D N D I I E A H R E Q I G G T L Q P P S A L R R R H Y H H A L P P S R H Y P G R E A Q A R R A Q E E A E A E E R R L Q E Q E E L E N Y I E H V L L R R P Stop FIGURE III.1 | 5’3’ FRAME OF HTLQP-62 INTO PETITE N-HIS SUMO VECTOR. In light blue, the histidine tag, in black, the sequence for SUMO and in underlined dark blue, the sequence for hTLQP-62. CHAPTER III | Human TLQP-62 structural insights 3 Methods 137 SH-SY5Y cell culture: The SH-SY5Y cell line (European Collection of Cell Cultures, 90430304) is a cloned subline of the neuroblastoma cell line SK-N-SH established in 1970 from a metastatic bone tumor of a four-year-old female (Biedler et al, 1973, 1978). Cells were maintained in a 1:1 proportion Earle’s Balanced Salt Solution (SigmaAldrich) and F12HAM (Sigma-Aldrich) medium, supplemented with 15% Fetal Bovine Serum (Gibco, Life Technologies), 1% L-glutamine 200 mM (Gibco, Life Technologies), 1% MEM-Non Essential Amino Acids (Gibco, Life Technologies) and 1% penicillin-streptomycin (Gibco, Life Technologies) in 100x20 mm Falcon dishes (Life Sciences). Cells were grown at 37ºC in a 5% CO2 humidified incubator. Confluent cell plates were washed twice with cold PBS and scrapped in 2 mL PBS. Cells were transferred to microtubes, centrifuged at 14000xg for 30 sec and supernatant discarded. DNA extraction: genomic DNA extraction was performed using the RealPure Genomic DNA extraction kit (Real Laboratory) following manufacturer instructions. DNA was rehydrated by adding 50 µL of DNA hydration solution and incubating at 65 ºC for 1 hour with R1 primer F1 primer TATACATATGCATCATCACCACCATCACGGGTCCCTGCAGGACTCAGAAGTCAATCAAGAAGCTAA GCCAGAGGTCAAGCCAGAAGTCAAGCCTGAGACTCACATCAATTTAAAGGTGTCCGATGGATCTTCAGA GATCTTCTTCAAGATCAAAAAGACCACTCCTTTAAGAAGGCTGATGGAAGCGTTCGCTAAAAGACAGGG TAAGGAAATGGACTCCTTAACGTTCTTGTACGACGGTATTGAAATTCAAGCTGATCAGACCCCTGAAGA TTTGGACATGGAGGATAACGATATTATTGAGGCTCACCGCGAACAGATTGGAGGTACACTGCAGCCGCC CTCGGCCTTGCGCCGCCGCCACTACCACCACGCCTTGCCGCCTTCGCGCCACTATCCCGGCCGGGAGGC CCAGGCGCGGCGCGCGCAGGAGGAGGCGGAGGCGGAGGAGCGCCGGCTGCAGGAGCAGGAGGAGCTGGA GAATTACATCGAGCACGTGCTGCTCCGGCGCCCGTGATAATAGAGCGGCCGCCACCGCTGAGC 6 x His FIGURE III.2 | INSERTION OF HUMAN TLQP-62 CDNA INTO PETITE™N-HISSUMOKANVECTOR. Vector has 2535 bp and hTLQP62 186 bp. In light blue is the sequence for the histidine tag, followed by SUMO sequence in black. The sequence for hTLQP-62 follows in underlined dark blue. Forward (F1) and reverse (R1) primer sequences used for cDNA amplification are indicated. DANIELA MESQUITA MOUTINHO 138 shaking for DNA dispersion. DNA was quantified in a NanoDrop™ 2000 Spectrophotometer (Thermo Scientific) at 260 nm . Polymerase Chain Reaction (PCR): hTLQP-62 cDNA contains 189 bp and to be inserted into the vector it must be amplified with primers including 18 nucleotides of overlap with the ends of the vector. The primer sequences F1 and R1 (Table III.1) were ordered to SigmaAldrich for further use in a PCR. The lyophilized primers were resuspended in H2OMQ to a concentration of 100 µM and 10 µM and stored at -20 ºC. Different DNA concentrations, temperature and time alignment were tested for PCR. A master mix reaction containing Takara DNA polymerase (Clontech, USA), 5x Takara buffer (Clontech, USA), dNPs (Clontech, USA), F1 and R1 primers (SigmaAldrich) were prepared with 3% DMSO in sterile H2OMQ (Table III.2). Purified genomic DNA (50 ng) was added. Control reactions were performed adding no DNA. PCR program reaction was performed in a thermocicler using a gradient for annealing temperature (Figure III.3). The PCR product (225 bp) was analyzed on a 1% agarose gel with SYBRO® Safe DNA Gel stain (Thermo Scientific), using the 1 kb DNA ladder marker (Genecraft Germany), quantified by absorbance at 260 nm and further cloned into pETite vector. HI-control 10G cells transformation: Unpurified PCR product (50 ng) was mixed with pETiteNHisSUMO vector (25 ng) in a proportion 2:1, and left at room temperature for 5 minutes. For cloning and transformation, manufacturer instructions were followed. After transformation, cells were plated on LB with 30µg/mL kanamycin (LBKan30) and incubated at 37ºC, overnight. Several colonies were picked from the plate and a) used for colony-PCR, using the previously chosen conditions and same primers; and b) grown on LBKan30 at 37 ºC, 225rpm, overnight, for later stock at -80 ºC in 15% glycerol, and for plasmid DNA extraction, using GeneJet Plasmid Miniprep kit (Thermo Scientific) according to manufacturer instructions. All centrifugations were performed at room temperature and 12000 rpm. Purified plasmid DNA was quantified by absorbance at 260 nm and stored at -20 ºC. After PCR, products were analyzed in 1% agarose gel with SYBRO® Safe DNA Gel stain and sent for sequencing. CHAPTER III | Human TLQP-62 structural insights 3 Methods 139 TABLE III.1 | PRIMERS USED FOR PCR. Forward and reverse primers sequences, length and alignment temperature. Primer Sequence 5’ – 3’ Bp Tm Forward (F1) CGC GAA CAG ATT GGA GGT ACA CTG CAG C 28 59 Reverse (R1) GTG GCG GCC GCT CTA TTA TCA CGG G 25 59 TABLE III.2 | PCR MASTER MIX. Volume and concentrations of reagents used. Stock [Final] 5x Takara buffer 1x 2.5 U/µL Takara polymerase 0.25 U 25 mM dNTPs 0.2 mM 10 µM F1 primer 0.2 µM 10 µM R1 primer 0.2 µM DMSO 3% DNA 370 µg/mL 0 / 50 ng Sterile H2OMQ - FIGURE III.3 | PCR PROGRAM. A temperature gradient for annealing was performed. Temperature Time Denaturing 98 ºC 2 min Denaturing 98 ºC 30 sec Annealing 55 - 59 ºC 30 sec Elongation 72 ºC 30 sec x40 cycles Elongation 72 ºC 5 min Rest 4 ºC DANIELA MESQUITA MOUTINHO 140 HI-control BL21(DE3) cells transformation: Manufacturer instructions were followed for HI-control BL21(DE3) cells transformation with resulting pETite6HSUMOhTLQP62 vector. Transformed cells (100 μL) were plated on LBKan30 and incubated overnight at 37 ºC. Colonies were picked and used for colony-PCR, and grown on LB with 30 µg/mL kanamycin for later stock and plasmid DNA extraction, as described before. Isotope 6HSUMOhTLQP-62 expression: According to manufacturer instructions, protein expression was performed in LBKan30 and 0.5% glucose at 37ºC, 225 rpm, overnight. HI-control BL21(DE3): :pETite6HSUMOhTLQP62 culture was inoculated in M9 minimal medium with 30µg/mL kanamycin and D-glucose-[13C6] (Cortecnet) and N15H4Cl (Cortecnet) and kept shaking at 37ºC until optical density at 600 nm was 0.8-1. For induction, IPTG to a final concentration of 1 mM was added to the culture and continued shaking at 30 ºC, 175 rpm. Culture was harvest, centrifuged at 5000 rpm, 20 min 4ºC, resuspended in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, pH 8.0, 1 mg/mL lysozyme, PMSF, DNase, β-mercaptoethanol) and incubated 30 min on ice with shaking. Cells were sonicated for 15 seconds (and 15 seconds interval) on ice, 5 pulses. Lysate was centrifuged at 12000xg for 30 min, and the supernatant containing the soluble protein was saved on ice for SDS-PAGE analysis and further protein purification. Monodimensional (1D) SDS-PAGE: Protein extracts or eluted fractions were mixed with Laemmli sample buffer (Bio-rad) with 5% β-mercaptoethanol and boiled for 5 minutes at 99°C and loaded on 15% SDS-PAGE gels. All Blue Molecular Weight Marker (Bio-rad) and samples were applied on gel and subjected to electrophoresis in XCell Sure Lock system (Invitrogen) with electrophoresis buffer (25 mM Tris, 192 mM glycine, 1% (w/v) SDS, pH 8.3). The electrophoresis was performed for 10 min at 100 V followed by 50 min at 200 V and gel was stained with Coomassie solution for protein visualization and total protein was quantified. Protein Quantification: Protein quantification was performed with Protein Reagent (Bio-rad). The standard calibration curve was prepared in duplicate for seven points of BSA in 20 µL of sample buffer at 1000, 800, 600, 400, 200, 100 and 50 µg/mL) and added to CHAPTER III | Human TLQP-62 structural insights 3 Methods 141 780 µL of reagent. Blank was prepared by mixing 20 µL of sample buffer and 780 µL of reagent and for sample quantification, 2 µL of each sample was added to 800 µL of reagent in duplicate. Reaction was let to occur for 5-10 min and absorbance was measured at 595 nm in a Biomate 3 Spectro-photometer (Thermo Spectromic). Absorbance at 280 nm quantification was performed using a Nanometer 2000 (Thermo Scientific). 3.3.2 Purification of isotopycally labeled 6HSUMOhTLQP-62 recombinant protein The strategy for protein purification is described in figure III.4 Immobilized Metal Affinity Chromatography: a HisTrap 5 mL nickel column (GE Healthcare) was cleaned with filtered and degassed ultrapure H2O and equilibrated with 5 CV (column volume) Buffer A (50 mM NaH2PO4, 300 mM NaCl, 20 mM Imidazole, pH 7.6) before loading the cytosolic fraction (Sample A) at 2 mL/min using a Agilent HPLC system. Flowthrough was collected and column washed with 5 CV Buffer A. A gradient from 0-100% Buffer B (50 mM NaH2PO4, 300 mM NaCl, 750 mM Imidazole, pH 7.6) was applied at 1 mL/min for 40 min and 2 mL fractions were collected for further SDS-PAGE analysis. Selected fractions were pooled together and concentrated using a 15 mL 3 kDa cutoff Amicon (Millipore) concentrator (Sample B) and quantified. Size Exclusion Chromatography: Sample B was dialyzed overnight against S200 Buffer (50 mM Tris-HCl, 100 mM NaCl, 5% glycerol, pH 8.0). A Sephadex 200 column (GE Healthcare) was cleaned with filtered and degased ultrapure H2O, before equilibration with 2 CV S200 Buffer. Sample B was applied to the column at 0.5 mL/min for 1 CV (25 mL = 50 min) and 2 mL fractions were collected for further SDS-PAGE analysis. Fractions were selected, pooled together (Sample C), concentrated and quantified for further cleave of 6HSUMO using SUMO protease at 10 U / 10 mg protein, overnight at 4ºC (Sample D). Sample was analyzed by SDS-PAGE and purified by S100 size exclusion using a as described before for TLQP-62 isolation and recovery. Resulting purified proteins were dialyzed overnight against 0.2 M ammonium acetate to be further lyophilized and kept at -80ºC.