scieee AI-readable full text Open interactive document viewer

Serotypes, virulence genes and intimin types of Shiga toxin (verocytotoxin)-producing Escherichia coli isolates from minced beef in Lugo (Spain) from 1995 through 2003

Mora Gutiérrez, Azucena; Blanco Álvarez, Miguel; Blanco Álvarez, Jesús Eulogio; Dahbi, Ghizlane; López Capón, Cecilia; Justel, Paula; Alonso, María Pilar; Echeita, Aurora; Bernárdez Hermida, Isabel; González García, Enrique Antonio; Blanco Álvarez, Jorge

Abstract

Background Shiga toxin-producing Escherichia coli (STEC) have emerged as pathogens that can cause food-borne infections and severe and potentially fatal illnesses in humans, such as haemorrhagic colitis (HC) and haemolytic uraemic syndrome (HUS). In Spain, like in many other countries, STEC strains have been frequently isolated from ruminants, and represent a significant cause of sporadic cases of human infection. In view of the lack of data on STEC isolated from food in Spain, the objectives of this study were to determine the level of microbiological contamination and the prevalence of STEC O157:H7 and non-O157 in a large sampling of minced beef collected from 30 local stores in Lugo city between 1995 and 2003. Also to establish if those STEC isolated from food possessed the same virulence profiles as STEC strains causing human infections. Results STEC were detected in 95 (12%) of the 785 minced beef samples tested. STEC O157:H7 was isolated from eight (1.0%) samples and non-O157 STEC from 90 (11%) samples. Ninety-six STEC isolates were further characterized by PCR and serotyping. PCR showed that 28 (29%) isolates carried stx1 genes, 49 (51%) possessed stx2 genes, and 19 (20%) both stx1 and stx2. Enterohemolysin (ehxA) and intimin (eae) virulence genes were detected in 43 (45%) and in 25 (26%) of the isolates, respectively. Typing of the eae variants detected four types: γ1 (nine isolates), β1 (eight isolates), ε1 (three isolates), and θ (two isolates). The majority (68%) of STEC isolates belonged to serotypes previously detected in human STEC and 38% to serotypes associated with STEC isolated from patients with HUS. Ten new serotypes not previously described in raw beef products were also detected. The highly virulent seropathotypes O26:H11 stx1 eae-β1, O157:H7 stx1stx2 eae-γ1 and O157:H7 stx2eae-γ1, which are the most frequently observed among STEC causing human infections in Spain, were detected in 10 of the 96 STEC isolates. Furthermore, phage typing of STEC O157:H7 isolates showed that the majority (seven of eight isolates) belonged to the main phage types previously detected in STEC O157:H7 strains associated with severe human illnesses. Conclusion The results of this study do not differ greatly from those reported in other countries with regard to prevalence of O157 and non-O157 STEC in minced beef. As we suspected, serotypes different from O157:H7 also play an important role in food contamination in Spain, including the highly virulent seropathotype O26:H11 stx1 eae-β1. Thus, our data confirm minced beef in the city of Lugo as vehicles of highly pathogenic STEC. This requires that control measures to be introduced and implemented to increase the safety of minced beef.

Full text

BioMed Central Page 1 of 9 (page number not for citation purposes) BMC Microbiology Open Access Research article Serotypes, virulence genes and intimin types of Shiga toxin (verocytotoxin)-producing Escherichia coli isolates from minced beef in Lugo (Spain) from 1995 through 2003 Azucena Mora1, Miguel Blanco1, Jesús E Blanco1, Ghizlane Dahbi1, Cecilia López1, Paula Justel1, María Pilar Alonso1,2, Aurora Echeita3, María Isabel Bernárdez1, Enrique A González1,4 and Jorge Blanco*1 Address: 1Laboratorio de Referencia de E. coli (LREC), Departamento de Microbioloxía e Parasitoloxía, Universidade de Santiago de Compostela (USC), 27002 Lugo, Spain, 2Unidade de Microbioloxía Clínica, Complexo Hospitalario Xeral-Calde, 27004 Lugo, Spain, 3Laboratorio de Bacteriología, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Madrid, Spain and 4Deceased Email: Azucena Mora - [email protected]s; Miguel Blanco - [email protected]; Jesús E Blanco - [email protected]; Ghizlane Dahbi - gdah[email protected].es; Cecilia López - clopezc[email protected].es; Paula Justel - pjus[email protected].es; María Pilar Alonso - [email protected]; Aurora Echeita - [email protected]; María Isabel Bernárdez - [email protected]; Enrique A González - [email protected]; Jorge Blanco* - j[email protected]s * Corresponding author Abstract Background: Shiga toxin-producing Escherichia coli (STEC) have emerged as pathogens that can cause food-borne infections and severe and potentially fatal illnesses in humans, such as haemorrhagic colitis (HC) and haemolytic uraemic syndrome (HUS). In Spain, like in many other countries, STEC strains have been frequently isolated from ruminants, and represent a significant cause of sporadic cases of human infection. In view of the lack of data on STEC isolated from food in Spain, the objectives of this study were to determine the level of microbiological contamination and the prevalence of STEC O157:H7 and non-O157 in a large sampling of minced beef collected from 30 local stores in Lugo city between 1995 and 2003. Also to establish if those STEC isolated from food possessed the same virulence profiles as STEC strains causing human infections. Results: STEC were detected in 95 (12%) of the 785 minced beef samples tested. STEC O157:H7 was isolated from eight (1.0%) samples and non-O157 STEC from 90 (11%) samples. Ninety-six STEC isolates were further characterized by PCR and serotyping. PCR showed that 28 (29%) isolates carried stx1 genes, 49 (51%) possessed stx2 genes, and 19 (20%) both stx1 and stx2. Enterohemolysin (ehxA) and intimin (eae) virulence genes were detected in 43 (45%) and in 25 (26%) of the isolates, respectively. Typing of the eae variants detected four types: γ1 (nine isolates), β1 (eight isolates), ε1 (three isolates), and θ (two isolates). The majority (68%) of STEC isolates belonged to serotypes previously detected in human STEC and 38% to serotypes associated with STEC isolated from patients with HUS. Ten new serotypes not previously described in raw beef products were also detected. The highly virulent seropathotypes O26:H11 stx1 eae-β1, O157:H7 stx1stx2 eae-γ1 and O157:H7 stx2eae-γ1, which are the most frequently observed among STEC causing human infections in Spain, were detected in 10 of the 96 STEC isolates. Furthermore, phage typing of STEC O157:H7 isolates showed that the majority (seven of eight isolates) belonged to the Published: 1 March 2007 BMC Microbiology 2007, 7:13 doi:10.1186/1471-2180-7-13 Received: 3 October 2006 Accepted: 1 March 2007 This article is available from: http://www.biomedcentral.com/1471-2180/7/13 © 2007 Mora et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. BMC Microbiology 2007, 7:13 http://www.biomedcentral.com/1471-2180/7/13 Page 2 of 9 (page number not for citation purposes) main phage types previously detected in STEC O157:H7 strains associated with severe human illnesses. Conclusion: The results of this study do not differ greatly from those reported in other countries with regard to prevalence of O157 and non-O157 STEC in minced beef. As we suspected, serotypes different from O157:H7 also play an important role in food contamination in Spain, including the highly virulent seropathotype O26:H11 stx1 eae-β1. Thus, our data confirm minced beef in the city of Lugo as vehicles of highly pathogenic STEC. This requires that control measures to be introduced and implemented to increase the safety of minced beef. Background Shiga toxin-producing Escherichia coli (STEC), also called verocytotoxin-producing E. coli (VTEC), have emerged as pathogens that can cause food-borne infections and severe and potentially fatal illnesses in humans, such as haemorrhagic colitis (HC) and haemolytic uraemic syndrome (HUS). STEC strains that cause human infections belong to a large number of O:H serotypes. Certain STEC strains belonging to serotypes O26:H11, O103:H2, O111:H8, O145:H28, and O157:H7 have been more frequently isolated from humans with severe illnesses. Furthermore, most outbreaks of HC and HUS have been attributed to strains of the enterohemorrhagic serotype O157:H7. However, as non-O157 STEC are more prevalent in animals and are food contaminants, humans are probably more exposed to these strains [1-3]. In Spain, STEC represent a significant cause of sporadic cases of human infection [3]. STEC isolates have caused eight outbreaks in Spain: six produced by the serotype O157:H7 (mainly of PT2), one by the serotype O26:H11, and one by the serotype O111:H-[3]. Pathogenicity of STEC is associated with various virulence factors. The main factor is the capacity to form two potent phage-encoded cytotoxins called Shiga-toxins (Stx1 and Stx2) or verocytotoxins (VT1 and VT2) [1]. In addition to toxin production, another virulence-associated factor expressed by STEC is a protein called intimin encoded by the eae gene and responsible for intimate attachment of STEC to the intestinal epithelial cells, and which causes attaching and effacing (A/E) lesions in the intestinal mucosa [4,5]. The association between infections with intimin-positive STEC and severe illnesses in humans was demonstrated previously, but it was also shown that intimin is not essential for the virulence of certain STEC strains. At present, 21 (α1, α2, β1, ξR/β2B, δ/β2O, κ, γ1, γ2, θ, ε1, νR/ε2, ζ, η1, η2, ι1, µR/ι2, λ, µB, νB, ξB and ο) types and subtypes of intimins encoding in the eae gene have been identified [5-8]. It is discussed that different intimins may be responsible for different hostand tissue cell tropism [9]. A factor that may also affect virulence of STEC is the enterohemolysin (Ehly), also called enterohemorrhagic E. coli haemolysin (EHEC-HlyA), encoded by the ehxA gene [10]. Ruminants, and especially cattle, represent one of the largest reservoirs of STEC, undercooked minced beef and raw milk being the major vehicles of STEC outbreaks [6,1115]. The results of our previous studies indicated that STEC colonization is widespread among cattle in Spain. Between 1993 and 1995, 1,069 healthy cattle were examined for STEC colonization. STEC-positive animals were found in 95% of the farms examined and the estimated proportion of positive cattle in each farm ranged from 0 to 100%. The overall prevalence rates of non-O157 STEC colonization were estimated to be 37% in calves and 27% in cows. In a survey between 1998 and 1999, STEC O157:H7 was isolated from 55 (12%) of 471 feedlot calves (four to eight months of age). Although only a mean of three animals per herd were sampled, STEC O157:H7 isolates were detected in 32 (22%) of the 145 feedlots examined [11,13]. Our current investigation is the first large study in Spain on prevalence of STEC O157 and non-O157 in raw beef products. In view of the increasing importance of STEC as emerging food-borne pathogens, the high STEC prevalence in cattle and the lack of data from STEC isolated from food in Spain, the objective of this study were to determine the prevalence of STEC O157:H7 and nonO157 in a large sampling of minced beef collected from 30 local stores in Lugo city between 1995 and 2003. Another objective was to establish the serotypes, virulence genes and intimin types of those STEC isolated from minced beef to determine their potential pathogenicity to humans. Results and discussion In the present study STEC were detected in 95 (12%) of the 785 minced beef samples collected. STEC O157:H7 was isolated from eight (1.0%) samples and non-O157 STEC were isolated from 90 (11%) (Table 1). In three samples, both STEC O157:H7 and non-O157 (O8:H21, O22:H8, O110:H-) were isolated. The best results for detection and isolation of STEC were obtained when the cells were plated onto cefixime tellurite sorbitol MacConkey (CTSMAC) agar (18 h at 44°C) and MacConkey (MAC) agar (18 h at 44°C). The highest prevalence of STEC was detected in the samples with higher level of BMC Microbiology 2007, 7:13 http://www.biomedcentral.com/1471-2180/7/13 Page 3 of 9 (page number not for citation purposes) fecal contamination. Thus, STEC were detected in 33% of minced beef samples with more than 999 E. coli per gramme (Table 2). The comparison of data on STEC prevalence in food is subject to certain limitations. First, the use of different sampling methods on different types of products. Second, protocols for isolation and detection of these pathogens vary and are not uniform among and within laboratories. Third, most studies are focused on O157:H7, and thus underestimate STEC prevalence by ignoring the presence of non-O157 STEC. In any case, figures found in our laboratory do not differ greatly from those reported abroad (12% in New Zealand, 11% in Canada, 11% in the United Kingdom, 9% in Thailand) with studies carried out on the prevalence of both O157 and non-O157 STEC in minced beef [16-19]. Higher prevalences were reported in other countries (i.e. USA, Argentina, India). Thus, three main studies were carried out in Washington state with prevalences of 23% [20], 17% [21], and a quite different 1% [22]. In Argentina, Parma et al. [23] detected a prevalence of 30% in 50 minced beef samples. In India, Khan et al. [24] found 50% of 111 minced beef samples positive for stx by PCR. In our study STEC O157:H7 was isolated from eight (1.0%) samples. A similar prevalence was detected in different countries: 1% and 0.4% in United Kingdom [25,26]; 1% in The Netherlands [27]; 0.4% and 2% in Italy [28,29]; 0.3% in Czeck Republic [30]. In USA, prevalences reported varied from 0% [31], 0.7% [32] and 2.8% [33]. Higher prevalences were detected in Argentina 3.8% [34], China 5% [35], Perú 19% [36], and in Canada, with two studies of 2% and 29% of prevalence, respectively [32,37]. Analyzing Table 1, we can appreciate a longitudinal maintenance of the prevalence of non-O157 STEC in minced beef samples, with a decline prevalence occurred during 2002. However, it should be considered that only 20 samples were analysed during this year. The same happens with STEC O157:H7, whose prevalence fluctuates from 0% to 1.3%, with the exception of 1995, when it increased to 5%. The present study comprises data from 1995 to 2003, and data from this longitudinal period does not reflect any control measures to reduce contamination in raw minced beef sold in different stores from Lugo. STEC strains that cause human infections belong to a large number of O:H serotypes (a total of 472 serotypes are listed in the authors' website [38]. Most outbreaks of HC and HUS have been attributed to strains of the enterohemorrhagic serotype O157:H7 [39]. However, as NonO157 STEC are more prevalent in animals and as contaminant in foods, humans are probably more exposed to these strains. Infections with some non-O157 STEC types, such as O26:H11 or H-(non-motile), O91:H21 or H-, O103:H2, O111:H-, O113:H21, O117:H7, O118:H16, O121:H19, O128:H2 or H-, O145:H28 or Hand O146:H21 are frequently associated with severe illnesses in humans, but the role of other non-O157 STEC types in human illnesses needs further examination [2,3]. In the present study we have characterized 96 STEC isolates (Table 3). These isolates belonged to 42 O serogroups, 61 O:H serotypes (including 10 new serotypes). The majority (68%) of STEC isolates belonged to serotypes previously found in human STEC and 38% to serotypes (O5:H-, O8:H21, O22:H8, O26:H11, O26:H-, O76:H7, O91:H-, O103:H2, O103:H-, O111:H-, O112:H2, O113:H21, O118:H16, O145:H-, O157:H7, O174:H21, O174:H-, ONT:H4 and ONT:H-) (ONT = O not typeable) associated with STEC isolated from patients with HUS. By PCR the 96 STEC isolates showed that 28 (29%) carried stx1 genes, 49 (51%) stx2, and 19 (20%) both stx1 and stx2. Enterohemolysin (ehxA) and intimin (eae) virulence genes were detected in 43 (45%) and 25 (26%) of the isolates, respectively. A total of 71 different seropathotypes (associations between serotypes and virulence genes) were detected, being seropathotype O157:H7 stx1stx2eae-γ1 ehxA the most common (five isolates), followed by O8:H21 stx2 and ONT:H21 stx1 (four isolates, respectively), O26:H11 stx1eae-β1 ehxA, and O64:H5 stx1 (three isolates, respectively). Like other authors [40], we Table 1: Prevalence of STEC in minced beef in Spain, from 1995 through 2003 Year No. of samples analysed STEC O157:H7 Non-O157 STEC Total STEC 1995 58 3 5% 8 14% 10 17% 1996 91 0 0% 8 9% 8 9% 1997 173 1 0.6% 20 12% 21 12% 1998 133 1 0.8% 18 14% 18 14% 2001 80 1 1.3% 6 8% 7 9% 2002 20 0 0% 1 5% 1 5% 2003 230 2 0.9% 29 13% 30 13% Total 785 8 1.0% 90 11% 95 12% BMC Microbiology 2007, 7:13 http://www.biomedcentral.com/1471-2180/7/13 Page 4 of 9 (page number not for citation purposes) have observed that STEC isolated from beef and human STEC of the same serotype have similar known virulenceassociated properties. At least 90 phage types have been reported for STEC O157:H7 [41] but only seven of these (PT2, PT4, PT8, PT14, PT21/28, PT32 and PT54) accounted for the majority (>75%) of the human strains isolated in Europe and Canada [39]. Phage types PT2 and PT8 were predominant in human STEC O157:H7 strains in Spain as well as in many other European countries, including Belgium, Finland, Germany, Italy, England and Scotland; whereas PT14 was the most frequently isolated in Canada. Six different phage types were detected among the eight O157:H7 strains isolated in this study: PT2 and PT8 (two isolates, respectively); PT21/28, PT32, PT54, PT atypical (one isolate, each). Interestingly, seven of those eight isolates belonged to the most common phage types associated with severe human illnesses in Europe and Canada [39]. The eae gene, which has been shown to be necessary for attaching and effacing activity, encodes a 94to 97-kDa outer membrane protein (OMP) which is termed intimin [4]. Numerous investigators have underlined the strong association between the carriage of eae gene and the capacity of STEC strains to cause severe human illnesses, especially HUS [1-3]. This important virulence gene was detected in 100% of STEC O157:H7 and in 19% of nonO157 isolates from beef in the present study. Nevertheless, production of intimin is not essential for pathogenesis, because a number of sporadic cases of HUS have been caused by eae-negative non-O157 STEC strains. Thus, STEC O104:H21 and O113:H21 strains lacking eae gene were responsible for an outbreak and a cluster of three HUS cases in USA and Australia, respectively [1,42]. Differentiation of intimin alleles represents an important tool for STEC typing in routine diagnostics as well as in pathogenesis, epidemiological, clonal and immunological studies [5,43-48]. The C-terminal end of intimin is responsible for receptor binding, and it has been suggested that different intimins may be responsible for different host tissue cell tropism. The 5'regions of eae genes are conserved, whereas the 3'regions are heterogeneous. This observation led to the construction of universal PCR primers and allele-specific PCR primers, which has made possible to differentiate at present 21 variants of the eae gene encoding 21 different intimin types and subtypes (α1, α2, β1, ξR/β2B, δ/β2O, κ, γ1, γ2, θ, ε1, νR/ε2, ζ, η1, η2, ι1, µR/ι2, λ, µB, νB, ξB and ο) [5,8,48]. In this study, four eae variants were differentiated: γ1 (in nine isolates), β1 (eight isolates), ε1 (three isolates), and θ (two isolates). Conclusion Seropathotypes O26:H11 stx1 eae-β1, O157:H7 stx1 stx2 eae-γ1 and O157:H7 stx2 eae-γ1 are the most frequently observed in STEC that cause human infections in Spain [3]. These highly virulent seropathotypes were detected in 10 of 96 STEC isolates characterized in the present study, confirming minced beef as potential source of STEC isolates pathogenic for humans and reinforces the need of HACCP (Hazard Analysis and Critical Control Point) programs all through food chain, from abattoirs to markets, in order to reduce contamination and consequently, illnesses related to minced beef. In addition, consumers should reduce their risk for STEC foodborne illnesses by following safe food-handling recommendations and by avoiding consumption of raw or undercooked meat products. Methods Sample collection, culture, and STEC screening A total of 785 of samples of minced beef were collected from 30 local stores in Lugo city (Spain) between 1995 and 2003. A maximum of 10 samples for week were obtained at random from 10 markets located in different districts. Some stores from those 30 were sampled along the seven years, while others only during a period of the study. In most cases, stores had different meat suppliers. All minced beef samples were packaged individually in sterile plastic bags, refrigerated for transportation to the laboratory, and processed within 2 h of collection. For isolation of STEC O157:H7 a 25 g portion of each minced beef sample was homogenized in a stomacher with 225 ml of buffered peptone water supplemented with vancoTable 2: Most probable number of E. coli and detection of STEC MPNa of E. coli No. of samples analysed STEC O157:H7 Non-O157 STEC Total STEC <10 488 2 (0.4%) 43 (9%) 43 (9%) 10–99 183 2 (1%) 27 (15%) 29 (16%) 100–999 71 2 (3%) 8 (11%) 9 (13%) >999 43 2 (5%) 12 (28%) 14 (33%) aMost probable number of E. coli per gram of minced beef. BMC Microbiology 2007, 7:13 http://www.biomedcentral.com/1471-2180/7/13 Page 5 of 9 (page number not for citation purposes) Table 3: Seropathotypes (serotypes and virulence genes) of STEC isolates (n = 96). Serotype Total stx1stx2eae ehxA Serotype Total stx1stx2eae ehxA O1:H20a1+-+ (NR) d+ O112:H2b1++ - + O1:H20a1 + - - + O113:H21b1-+ - + O2:H8c1 - + - - O113:H21b1-+ - - O2:H27a1-+ - - O116:H16 c1-+ - - O2:H32 1 - + - - O116:H21a1++ - + O2:H-a1 - + - - O118:H16b1+-+ (β1) + O4:H4 1 - + - - O120:H10c1-+ - - O5:H-b1+++ (β1) + O128:H31a1+- - - O6:H10 1 + - - - O141:H19 1 - + - - O6:H49a1-+ - - O145:Hb1+-+ (γ1) + O8:H21b4-+ - - O146:H21 a1-+ - + O8:H-a2 + + - + O146:H-a1++ - + O15:H16 1 - + + (β1) - O156:H8 1 - + + (NR) - O15:H18c1 - + - - O157:H7b1+-+ (γ1) + O17:H45 1 - + - - O157:H7b2-++ (γ1) + O20:H2c1 + - - - O157:H7b5+++ (γ1) + O21:H21 1 - + - - O162:H10 1 + + - - O22:H8b2-+ - - O166:H28 a1++ - + O22:H8b2 + + - + O167:H2 1 + - - - O26:H11b3+-+ (β1) + O168:H8 1 - + - - O26:H-b1-+ - - O171:H2 a2-+ - - O26:H42 1 + - + (β1) + O174:H10 1 + + + (β1) - O39:H21 1 - + - + O174:H21b1-+ - - O42:H21c1-+ - - O174:Hb2-+ - - O54:H-c1 - + - - OX178:H16c1-+ - - O64:H5c3 + - - - ONT:H4b1-+ - - O75:H8a1 + - - + ONT:H19a1-+ - + O75:H8a1 - + - + ONT:H21a1++ - + O76:H7b1 - + + (NR) + ONT:H21a1++ - - O77:H41a2 - + - + ONT:H21a4+- - - O88:H8 1 - + - - ONT:H21a2-+ - - O91:H-b1 + + - + ONT:H38 1 - + - - O103:H2b2+-+ (ε1) + ONT:H? 1 - + - + O103:H-b1+-+ (ε1) + ONT:H-b1+- - - O110:H-c1 + - - + ONT:H-b1-+ - - O111:H-b2+- + (θ) + ONT:H-b1-+ - - a Serotypes previously found in human STEC. b Serotypes previously associated with human STEC strains that cause hemolytic uremic syndrome (HUS). c New serotypes in STEC not reported in previous studies. dTyping of eae (intimin) genes was carried out years after the isolation of the strains. Some of them had lost the viability, so eae typing could not be carried out (NR). BMC Microbiology 2007, 7:13 http://www.biomedcentral.com/1471-2180/7/13 Page 6 of 9 (page number not for citation purposes) mycin 8 mg liter -1, cefixime 0.05 mg liter -1, and cefsulodin 10 mg liter -1 (BPWvcc) and incubated for 6 h at 37°C. One millilitre of this enriched culture was added to 20 µl of magnetic beads coated with O157-antibodies (Dynabeads anti-E. coli O157, Dynal, Oslo) and the immunomagnetic separation (IMS) was performed according to the manufacturer's instructions. The concentrated target cells were plated onto sorbitol MacConkey (SMAC) agar and on cefixime tellurite sorbitol MacConkey (CTSMAC) agar (18 h at 37°C). For isolation of non-O157 STEC a 25 g portion of each minced beef sample was homogenized in an stomacher with 225 ml of buffered peptone water without antibiotics (BPW) and incubated for 6 h at 37°C. The cells were plated onto CTSMAC and MacConkey (MAC) agar (18 h at 37°C and 44°C). STEC were detected by PCR using specific primers for amplification of stx1, stx2, and eae genes (Table 4). For PCR, a loopful of bacterial growth taken from the first streaking area of the culture plates was suspended in 0.5 ml of sterile distilled water and boiled for 5 min to release the DNA. For each PCR-positive culture, 10 E. coli-like colonies obtained from MAC, SMAC and/or CTSMAC plates were analysed by PCR in order to obtain the STEC isolates for further characterization. If no positive single colony was found among the first 10 colonies, at least 40 more were tested. If still none of the assayed coliform colonies was positive in the PCR reaction, the sample was reported as PCR positive without STEC isolation. Production of Shiga toxins (verocytotoxins) by PCR-positive isolates was confirmed by cytotoxicity tests on Vero and HeLa cells [13]. All STEC isolates were subsequently characterized biochemically with the API 20E system (bioMerieux, France) and serotyped. In samples from which all isolates were identical with respect to the profile of virulence genes and O:H serotypes, only one colony was selected. When one sample yielded colonies with different virulence genes or O:H serotypes, one of each was selected for further characterization. Enumeration of E. coli (MPN) Most probable number (MPN) determination was performed by standard method using Petrifilm™ Select E. coli Count Plates (3M Microbiology Products, USA), according to manufacturer's instructions. Detection of virulence genes and typing of eae (intimin) genes by PCR The methodology used for the detection of virulence genes and typing of intimin genes into eae α1, α2, β1, ξR/ β2B, δ/β2O, κ, γ1, γ2, θ, ε1, νR/ε2, ζ, η1, η2, ι1, µR/ι2, λ, µB, νB, ξB and ο has been described elsewhere [7,8,12,13,48]. Base sequences and predicted sizes of amplified products for the specific oligonucleotide primers used in this study are shown in Table 4. The oligonucleotide primers were designed by us according to the nucleotide sequences of the virulence genes. Isolates positive for eae gene with EAE-1 and EAE-2 primers were further analysed with all different variant primers. Due to the high sequence similarity, specific primers could not be designed for distinguishing between eae-γ2 and eaeθ genes, eaeδ and eaeκ , or eae-η1 and eae-η2. In those cases it was necessary to establish the nucleotide sequence of a fragment from the 3' variable region of the eae gene. The nucleotide sequence of the amplification products purified with a QIAquick DNA purification kit (Qiagen) was determined by the dideoxynucleotide triphosphate chain termination method of Sanger, with the BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI 3100 Genetic Analyzer (Applied Bio-Systems). Serotyping The determination of O and H antigens was carried out by the method described by Guinιe et al. [49] employing all available O (O1-O185) and H (H1-H56) antisera. All antisera were obtained and absorbed with the corresponding cross-reacting antigens to remove the nonspecific agglutinins. The O antisera were produced in the LREC (Lugo, Spain) and the H antisera were obtained from the Statens Serum Institut (Copenhagen, Denmark).E. coli strains representing the new O groups O182 to O185 (unpublished data) were kindly provided by Flemming Scheutz (Statens Serum Institut). Phage typing of STEC O157:H7 Phage typing was performed with the method of Khakria et al. [41] in the Centro Nacional de Microbiología (Madrid) [39,50] using phages provided by The National Laboratory for Enteric Pathogens, Laboratory for Disease Control, Otawa, Ontario (Canada). The sixteen different phages used were capable of identifying 90 phage types. E. coli control strains E. coli strains used as controls were: EPEC-2348 (human, O127:H6, eae-α1), AEEC-IH2498a (human, O125:H6, eae-α2), EPEC-337 (human, O111:H2, eae-β1), EPEC-359 (human, O119:H6, eae-ξR/β2B), EPEC-BL152.1 (human, O86:H34, eae-δ/β2O), AEEC-6044/95 (human, O118:H5, eae-κ), STEC-EDL933 (human, O157:H7, stx1, stx2, eae-γ1), STEC-TW07926 (human, O111:H8, stx1, stx2, eae-θ), STEC-VTB-286 (bovine, O103:H2, stx1, eae-ε1), AEEC-IH3205a (human, O123:H19, eae-νR/ε2), STECVTO-50 (ovine, O156:H-, stx1, eae-ζ), AEEC-CF11201 (human, O125:H-, eae-η1), H03/53199a (human, ONT:H45, eae-η2), AEEC-7476/96 (human, O145:H4, eae-ι1), AEEC-217-2 (human, O101:H-, eae-µR/ι2), AEEC-68-4 (human, O34:H-, eae-λ), EPEC-373 (human, O55:H51, eae-µB), AEEC-IH1229a (human, O10:H-, eae- BMC Microbiology 2007, 7:13 http://www.biomedcentral.com/1471-2180/7/13 Page 7 of 9 (page number not for citation purposes) Table 4: PCR primers and conditions for amplification of STEC virulence genes and eae typing Gene Primer Oligonucleotide sequence (5'-3') Fragment size (bp) Annealing temperature Primer CoordinatesaAccession number stx1 VT1-A CGCTGAATGTCATTCGCTCTGC 302 55°C 113–134 M17358 VT1-B CGTGGTATAGCTACTGTCACC 394–414 stx2 VT2-A CTTCGGTATCCTATTCCCGG 516 55°C 50–69 M59432 VT2-B CTGCTGTGACAGTGACAAAACGC 543–565 ehxA HlyA1 GGTGCAGCAGAAAAAGTTGTAG 1.551 60°C 238–259 X79839 HlyA4 TCTCGCCTGATAGTGTTTGGTA 1767–1788 eaebEAE-1 GGAACGGCAGAGGTTAATCTGCAG 346 55°C 631–654 AF022236 EAE-2 GGCGCTCATCATAGTCTTTC 957–976 eae-α1 EAE-FB AAAACCGCGGAGATGACTTC 820 60°C 1909–1928 AF022236 EAE-A CACTCTTCGCATCTTGAGCT 2709–2728 eae-α2 IH2498aF AGACCTTAGGTACATTAAGTAAGC 517 60°C 2099–2122 AF530555 IH2498aR TCCTGAGAAGAGGGTAATC 2597–2615 eae-β1 B1F CACAATTAATGCACCGGGT 241 55°C 2499–2517 AF453441 B1R GCTTGATACACCTGATGACT 2720–2739 eae-ξR/β2B B2F TGAAGGGGGGAACCCCTGTG 564 62°C 2054–2073 AF530556 B2R TTTCTTTTGACTGTGCTAAAGC 2596–2617 AJ715407 eae-δ/κ/β2O EAE-FB AAAACCGCGGAGATGACTTC 830 60°C 1909–1928 U66102 EAE-D CTTGATACACCCGATGGTAAC 2718–2738 eae-γ1 EAE-FB AAAACCGCGGAGATGACTTC 804 60°C 1909–1928 AF071034 EAE-C1 AGAACGCTGCTCACTAGATGTC 2691–2712 eae-θ/γ2 EAE-C2F AGAACGTTACTGGTGACTTA 414 58°C 2303–2322 AF025311 EAE-C2R CTGATATTTTATCAGCTTCA 2697–2716 eae-ε1 EAE-FB AAAACCGCGGAGATGACTTC 722 66°C 1909–1928 AF116899 LP5 AGCTCACTCGTAGATGACGGCAAGCG 2605–2630 eae-νR/ε2 EAE-E2F AATACAGAAGTTAAGGCAT 378 58°C 2230–2248 AF530554 EAE-E2R ACGACCACTATTCATTTC 2590–2607 eae-ζZ1 GGTAAGCCGTTATCTGCC 206 62°C 2062–2079 AF449417 Z2 ATAGCAAGTGGGGTGAAG 2250–2267 eae-η1/η2 EAE-FB AAAACCGCGGAGATGACTTC 702 60°C 1899–1918 AJ308550 ETA-B TAAGCGACCACTATTCGTG 2582–2600 eae-η1 ETA-FN CGCTTTGTTTAATGCCGATAAA 410 62°C 1074–1095 AJ308550 ETA-RN GACTGCGTAATGCACTG 1467–1483 eae-ι1 EAE-FB AAAACCGCGGAGATGACTTC 651 55°C 1909–1928 AJ308551 IOTA-B GTCATATTTAACTTTTACACTA 2538–2559 eae-µR/ι2, Iota2-F CTGGTAAAGCGATAGTCAAAC 936 58°C 1850–1870 AF530553 Iota2-R GCGTTTTTGAAGAAACATTTTGC 2763–2785 eae-λ68.4F CGGTCAGCCTGTGAAGGGC 370 64°C 2061–2079 AJ715409 68.4R AATACCGGAAGAGGCATCTAT 2410–2430 eae-µB EAE-FB AAAACCGCGGAGATGACTTC 655 60°C 1909–1928 AJ705049 FV373R ACTCATCATAATAAGCTTTTTGG 2541–2563 eae-νB IH1229aF CACAGCTTACAATTGATAACA 311 60°C 2255–2275 AJ705050 IH1229aR CTCACTATAAGTCATACGACT 2545–2565 eae-ξB EAE-FB AAAACCGCGGAGATGACTTC 468 66°C 1909–1928 AJ705051 B49R ACCACCTTTAGCAGTCAATTTG 2355–2376 eae-οH2997fF AGCGTTAGCAATGCCGCAGTTGAT 271 60°C 2203–2226 AJ876647 IH2997fR CAACGGTAATTGTTGTTTCC 2454–2473 AJ876648 a Location within eae gene. The oligonucleotide primers were designed by us according to the nucleotide sequences of the virulence genes. bUniversal oligonucleotide primer pair EAE1 and EAE-2 with homology to the 5'conserved region of eae gene (detects all types of eae variants described at the moment). Isolates positive for eae gene with EAE-1 and EAE-2 primers were further analysed with all different variant primers. BMC Microbiology 2007, 7:13 http://www.biomedcentral.com/1471-2180/7/13 Page 8 of 9 (page number not for citation purposes) νB), STEC-B49 (bovine, O80:H-, stx1,eae-ξB), AEECIH2997f (human, O129:H-, eae-ο) and K12-185 (negative for stx1, stx2, bfpA, and eae genes). Strains were stored at room temperature in nutrient broth with 0.75% of agar. Authors' contributions AM, CL, and PJ carried out the isolation of the E. coli and performed the detection of virulence genes. MB, EAG and GD carried out the typing of the eae gene. JEB, MPA and MIB performed the serotyping. AE carried out the phage typing. JB carried out the design of the study and, together with AM, drafted the manuscript. All authors read and approved the final manuscript. Acknowledgements This paper is dedicated to the memory of Dr. Enrique A. González, an eminent scientist, an excellent Professor of Microbiology and a very good friend. We thank to A. Román and M. Núñez for their collaboration in this study. We thank Monserrat Lamela for skillful technical assistance. This work was supported by grants from the Fondo de Investigación Sanitaria (grants FIS G03-025-COLIRED-O157 and PI052023), from the Xunta de Galicia (grants PGIDIT02BTF26101PR, PGIDIT04RAG261014PR, PGIDIT05BTF26101PR, and PGIDIT065TAL26101PR), from the Comisión Interministerial de Ciencia y Tecnología (grants CICYT-ALI98-0616 and CICYT-FEDER-1FD1997-2181-C02-01), and from European Commission (FAIR programme grants CT98-4093 and CT98-3935). A. Mora, G. Dahbi and C. López acknowledge the Agencia Española de Cooperación Internacional (AECI) and the Xunta de Galicia for research fellowships. References 1. Paton JC, Paton AW: Pathogenesis and diagnosis of shiga toxinproducing Escherichia coli infections. Clin Microbiol Rev 1998, 11:450-479. 2. Beutin L, Krause G, Zimmermann S, Kaulfuss S, Gleier K: Charaterization of Shiga toxin-producing Escherichia coli strains isolated from human patients in Germany over a 3-year period. J Clin Microbiol 2004, 42:1099-1108. 3. Blanco JE, Blanco M, Alonso MP, Mora A, Dahbi G, Coira MA, Blanco J: Serotypes, virulence genes and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from human patients: prevalence in Lugo, Spain, from 1992 through 1999. J Clin Microbiol 2004, 42:311-319. 4. Kaper JB, Elliott S, Sperandio V, Perna NT, Mayhew GF, Blattner FR: Attaching and effacing intestinal histopathology and the locus of enterocyte effacement. In Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains Edited by: Kaper JB, O'Brien AD. American Society for Microbiology, Washington, DC; 1998:163-182. 5. Garrido P, Blanco M, Moreno-Paz M, Briones C, Dahbi G, Blanco JE, Blanco J, Parro V: STEC-EPEC oligonucleotide microarray: a new tool for typing genetic variants of the LEE pathogenicity island of human and animal Shiga toxin-producing Escherichia coli (STEC) and enteropathogenic E. coli (EPEC) strains. Clin Chem 2006, 52:192-201. 6. Blanco M, Podola NL, Krüger A, Sanz ME, Blanco JE, González EA, Dahbi G, Mora A, Bernárdez MI, Etcheverria AL, Arroyo GH, Lucchesi PMA, Parma AE, Blanco J: Virulence genes and intimin types of Shiga-toxin-producing Escherichia coli isolated from cattle and beef products in Argentina. Int Microbiol 2004, 7:269-276. 7. Blanco M, Schumacher S, Tasara T, Zweifel C, Blanco JE, Dahbi G, Blanco J, Stephan R: Serotypes, intimin variants and other virulence factors of eae positive Escherichia coli strains isolated from healthy cattle in Switzerland. Identification of a new intimin variant gene (eae-η2). BMC Microbiol 2005, 5:23. 8. Blanco M, Blanco JE, Dahbi G, Alonso MP, Mora A, Coira MA, Madrid C, Juárez A, Bernárdez MI, González EA, Blanco J: Identification of two new intimin types in atypical enteropathogenic Escherichia coli. Int Microbiol 2006, 9(2):103-110. 9. Torres AG, Zhou G, Kaper JB: Adherence of diarrheagenic Escherichia coli strains to epithelial cells. Infect Immun 2005, 73:18-29. 10. Schmidt H, Beutin L, Karch H: Molecular analysis of the plasmidencoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect Immun 1995, 66:1055-1061. 11. Blanco J, Blanco M, Blanco JE, Mora A, Alonso MP, González EA, Bernárdez MI: Epidemiology of verocytotoxigenic Escherichia coli (VTEC) in ruminants. In Verocytotoxigenic Escherichia coli Edited by: Duffy G, Garvey P, McDowell D. Food & Nutrition Press Inc, Trumbull, USA; 2001:113-148. 12. Blanco M, Blanco JE, Mora A, Rey J, Alonso JM, Hermoso M, Hermoso J, Alonso MP, Dhabi G, González EA, Bernárdez MI, Blanco J: Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J Clin Microbiol 2003, 41:1351-1365. 13. Blanco M, Blanco JE, Mora A, Dahbi G, Alonso MP, González EA, Bernárdez MI, Blanco J: Serotypes, virulence genes, and intimin types of Shiga toxin (Verotoxin)-producing Escherichia coli isolates from cattle in Spain and identification of a new intimin variant gene (eae-ξ). J Clin Microbiol 2004, 42:645-651. 14. Zweifel C, Blanco JE, Blanco M, Blanco J, Stephan R: Serotypes and virulence genes of ovine non-O157 Shiga toxin-producing Escherichia coli in Switzerland. Int J Food Microbiol 2004, 95:19-27. 15. Zweifel C, Schumacher S, Blanco M, Blanco JE, Tasara T, Blanco J, Stephan R: Phenotypic and genotypic characteristics of nonO157 Shiga toxin-producing Escherichia coli (STEC) from Swiss cattle. Vet Microbiol 2005, 105:37-45. 16. Read SC, Gyles CL, Clarke RC, Lior H, McEwen S: Prevalence of verocytotoxigenic Escherichia coli in ground beef, pork, and chicken in southwestern Ontario. Epidemiol Infect 1990, 105:11-20. 17. Suthienkul O, Brown E, Seriwatana J, Tienthongdee S, Sastravaha S, Echeverria P: Shiga-like-toxin-producing Escherichia coli in retail meats and cattle in Thailand. Appl Environ Microbiol 1990, 56:1135-1139. 18. Willshaw GA, Smith HR, Roberts D, Thirlwell J, Cheasly T, Rowe B: Examination of raw beef products for the presence of vero cytotoxin producing Escherichia coli, particularly those of serogroup O157. J Appl Bacteriol 1993, 75:20-426. 19. Brooks HJL, Mollison BD, Bettelheim KA, Matejka K, Paterson KA, Wark VK: Occurrence and virulence factors of non-O157 Shiga toxin-producing Escherichia coli in retail meat in Dunedin, New Zealand. Lett Appl Microbiol 2001, 32:118-122. 20. Samadpour M, Ongerth JE, Liston J, Tran N, Nguyen D, Whittam TS, Wilson RA, Tarr PI: Occurrence of Shiga-like toxin-producing Escherichia coli in retail fresh seafood, beef, lamb, pork, and poultry from grocery stores in Seattle, Washington. Appl Environ Microbiol 1994, 60:1038-1040. 21. Samadpour M, Kubler M, Buck FC, Depavia GA, Mazengia E, Stewart J, Yang P, Alfi D: Prevalence of Shiga toxin-producing Escherichia coli in ground beef and cattle feces from King County, Washington. J Food Prot 2002, 65:1322-1325. 22. Schroeder CM, White DG, Ge B, Zhang Y, McDermott PF, Ayers S, Zhao S, Meng J: Isolation of antimicrobial-resistant Escherichia coli from retail meats purchased in Greater Washington, DC, USA. Int J Food Microbiol 2003, 85:197-202. 23. Parma AE, Sanz ME, Blanco JE, Blanco J, Viñas MR, Blanco M: Virulence genotypes and serotypes of verotoxigenic Escherichia coli isolated from cattle and foods in Argentina. Eur J Epidemiol 2000, 16:757-762. 24. Khan A, Yamasaki S, Sato T, Ramamurthy T, Pal A, Datta S, Chowdhury NR, Das SC, Sikdar A, Tsukamoto T, Bhattacharya SK, Takeda Y, Nair GG: Prevalence and genetic profiling of virulence determinants of non-O157 Shiga toxin-producing Escherichia coli isolated from cattle, beef, and humans, Calcutta, India. Emerg Infect Dis 2002, 8:54-62. 25. Chapman PA, Siddons CA, Cerdan Malo AT, Harkin MA: A one year study of Escherichia coli O157 in raw beef and lamb products. Epidemiol Infect 2000, 124:207-213. 26. Chapman PA, Cerdán Malo AT, Ellin M, Ashton R, Harkin MA: Escherichia coli O157 in cattle and sheep at slaughter, on beef Publish with BioMed Central and every scientist can read your work free of charge "BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp BioMedcentral BMC Microbiology 2007, 7:13 http://www.biomedcentral.com/1471-2180/7/13 Page 9 of 9 (page number not for citation purposes) and lamb carcasses and in raw beef and lamb products in South Yorkshire, UK. Int J Food Microbiol 2001, 64:139-150. 27. Heuvelink AE, Zwartkruis-Nahuis JTM, Beumer RR, De Boer E: Occurrence and survival of verocytotoxin-producing Escherichia coli O157 in meats obtained from retail outlets in The Netherlands. J Food Prot 1999, 62:1115-1122. 28. Conedera G, Dalvit P, Martín M, Galiero G, Gramaglia M, Goffredo E, Loffredo G, Morabito S, Ottaviani D, Paterlini F, Pezzotti G, Pisanu M, Semprini P, Caprioli A: Verocytotoxin-producing Escherichia coli O157 in minced beef and dairy products in Italy. Int J Food Microbiol 2004, 96:67-73. 29. Stampi S, Caprioli A, De Luca G, Quaglio P, Sacchetti R, Zanetti F: Detection of Escherichia coli O157 in bovine meat products in northern Italy. Int J Food Microbiol 2004, 90:257-262. 30. Lukásová J, Abraham B, Cupáková S: Occurrence of Escherichia coli O157 in raw material and food in Czech Republic. J Vet Med B 2004, 51:77-81. 31. Tarr PI, Tran TN, Wilson RA: Escherichia coli O157:H7 in retail ground beef in Seattle: results of a one-year prospective study. J Food Prot 1999, 62:133-139. 32. Doyle MP, Schoeni JL: Isolation of Escherichia coli O157:H7 from retail fresh meats and poultry. Appl Environ Microbiol 1987, 53:2394-2396. 33. Padhye NV, Doyle MP: Rapid procedure for detecting Enterohemorrhagic Escherichia coli O157:H7 in food. Appl Environ Microbiol 1991, 57:2693-2698. 34. Chinen I, Tanaro JD, Miliwebsky E, Lound LH, Chillemi G, Ledri S, Baschkier A, Scarpin M, Manfredi E, Rivas M: Isolation and characterization of Escherichia coli O157:H7 from retail meats in Argentina. J Food Prot 2001, 64:1346-1351. 35. Zhou Z, Nishikawa Y, Zhu P, Hong S, Hase A, Cheasty T, Smith HR, Zheng M, Haruki K: Isolation and characterization of Shiga toxin-producing Escherichia coli O157:H7 from beef, pork, and cattle fecal samples in Changchun, China. J Vet Med Sci 2002, 64:1041-1044. 36. Mora A, León SL, Blanco M, Blanco JE, López C, Dahbi G, Echeita A, González EA, Blanco J: Phage types, virulence genes and PFGE profiles of Shiga toxin-producing Escherichia coli O157:H7 isolated from raw beef meat, soft cheese and vegetables in Lima (Peru). Int J Food Microbiol 2007, 114:204-210. 37. Sekla L, Milley D, Stackiw W: Verotoxin-producing Escherichia coli in ground beef in Manitoba. Can Med Assoc J 1990, 143:519-521. 38. [http://www.lugo.usc.es/ecoli/SEROTIPOSHUM.htm]. 39. Mora A, Blanco M, Blanco JE, Alonso MP, Dahbi G, Thompson-Carter F, Usera MA, Bartolomé R, Prats G, Blanco J: Phage Types and Genotypes of Human and Animal Shiga Toxin-Producing Escherichia coli O157:H7 in Spain. Identification of two predominating phage types (PT2 and PT8). J Clin Microbiol 2004, 42:4007-4015. 40. Meng J, Zhao S, Doyle MP: Virulence genes of shiga toxin-producing Escherichia coli isolated from food, animals and humans. Int J Food Microbiol 1998, 45:229-235. 41. Khakria R, Duck D, Lior H: Extended phage-typing scheme for Escherichia coli O157:H7. Epidemiol Infect 1990, 105:511-520. 42. Paton AW, Woodrow MC, Doyle RM, Lanser JA, Paton JC: Molecular characterization of a shiga toxigenic Escherichia coli O113:H21 strain lacking eae responsible for a cluster of cases of hemolytic-uremic syndrome. J Clin Microbiol 1999, 37:3357-3361. 43. Adu-Bobie J, Frankel G, Bain C, Goncalves AG, Trabulsi LR, Douce G, Knutton S, Dougan G: Detection of intimins α, β, γ, and δ, four intimin derivatives expressed by attaching and effacing microbial pathogens. J Clin Microbiol 1998, 36:662-668. 44. Oswald E, Schmidt H, Morabito S, Karch H, Marchès O, Caprioli A: Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect Immun 2000, 68:64-71. 45. Tarr CL, Whittam S: Molecular evolution of the intimin gene in O111 clones of pathogenic Escherichia coli. J Bacteriol 2002, 184:479-487. 46. Zhang WL, Köhler B, Oswald E, Beutin L, Karch H, Morabito S, Caprioli A, Suerbaum S, Schmidt H: Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. J Clin Microbiol 2002, 40:4486-4492. 47. Ramachandran V, Brett K, Hornitzky MA, Dowton M, Bettelheim KA, Walker MJ, Djordjevic SP: Distribution of intimin subtypes among Escherichia coli isolates from ruminant and human sources. J Clin Microbiol 2003, 41:5022-5032. 48. Blanco M, Blanco JE, Dahbi G, Mora A, Alonso MP, Varela G, Gadea MP, Schelotto F, Gonzalez EA, Blanco J: Typing of intimin (eae) genes from enteropathogenic Escherichia coli (EPEC) isolated from children with diarrhoea in Montevideo, Uruguay: identification of two novel intimin variants (µB and ξR/β2B). J Med Microbiol 2006, 55:1165-1174. 49. Guinée PAM, Jansen WH, Wadström T, Sellwood R: Escherichia coli associated with neonatal diarrhoea in piglets and calves. In Laboratory Diagnosis in Neonatal Calf and Pig diarrhoea: Current Topics in Veterinary and Animal Science Edited by: Leeww PW, Guinée PAM. Martinus-Nijhoff, The Hague, Netherlands; 1981:126-162. 50. Mora A, Blanco JE, Blanco M, Alonso MP, Dhabi G, Echeita A, Gonzalez EA, Bernardez MI, Blanco J: Antimicrobial resistance of Shiga toxin (verotoxin)-producing Escherichia coli O157:H7 and non-O157 strains isolated from humans, cattle, sheep and food in Spain. Res Microbiol 2005, 156:793-806.