scieee AI-readable full text Open interactive document viewer

Ecdysone-related biomarkers of toxicity in the model organism Chironomus riparius: stage and sex-dependent variations in gene expression profiles

Planelló, Rosario; Herrero, Óscar; Gómez Sande, Pablo; Ozáez, Irene; Cobo Gradín, Fernando; Servia, María J.

Abstract

Despite being considered a model organism in toxicity studies, particularly in assessing the environmental impact of endocrine disrupting compounds (EDCs) and other chemicals, the molecular basis of development is largely unknown in Chironomus riparius. We have characterized the expression patterns of important genes involved in the ecdysone pathway from embryos to pupa, but specially during the different phases of C. riparius fourth larval instar, according to the development of genital and thoracic imaginal discs. Real-Time PCR was used to analyze: EcR and usp, two genes encoding the two dimerizing partners of the functional ecdysone receptor; E74, an early response gene induced by ecdysteroids; vg (vitellogenin), an effector gene; hsp70 and hsc70, two heat-shock genes involved in the correct folding of the ecdysone receptor; and rpL13, as a part of the ribosomal machinery. Our results show for the first time stage and sex-dependent variations in ecdysone-responsive genes, specially during the late larval stage of C. riparius. The induction in the expression of EcR and usp during the VII-VIII phase of the fourth instar is concomitant with a coordinated response in the activity of the other genes analyzed, suggesting the moment where larvae prepare for pupation. This work is particularly relevant given that most of the analyzed genes have been proposed previously in this species as sensitive biomarkers for the toxicological evaluation of aquatic ecosystems. Identifying the natural regulation of these molecular endpoints throughout the Chironomus development will contribute to a more in-depth and accurate evaluation of the disrupting effects of EDCs in ecotoxicological studies.

Full text

RESEARCH ARTICLE Ecdysone-Related Biomarkers of Toxicity in the Model Organism Chironomus riparius: Stage and Sex-Dependent Variations in Gene Expression Profiles Rosario Planelló 1☯ *, Óscar Herrero 1☯ , Pablo Gómez-Sande 2,3 , Irene Ozáez 1 , Fernando Cobo 2,3 , María J. Servia 4 1Grupo de Biología y Toxicología Ambiental, Facultad de Ciencias, Universidad Nacional de Educación a Distancia, UNED, Paseo de la Senda del Rey 9, 28040 Madrid, Spain, 2Departamento de Zoología y Antropología Física, Universidad de Santiago de Compostela, USC, Campus Sur s/n, 15782 Santiago de Compostela, Spain, 3Estación de Hidrobioloxía “Encoro do Con”, EHEC, Universidad de Santiago de Compostela, USC, Castroagudín s/n, 36617 Vilagarcía de Arousa, Pontevedra, Spain, 4Departamento de Biología Animal, Biología Vegetal y Ecología, Facultad de Ciencias, Universidade da Coruña, UDC, Campus da Zapateira s/n, 15008 A Coruña, Spain ☯These authors contributed equally to this work. *[email protected] Abstract Despite being considered a model organism in toxicity studies, particularly in assessing the environmental impact of endocrine disrupting compounds (EDCs) and other chemicals, the molecular basis of development is largely unknown in Chironomus riparius. We have characterized the expression patterns of important genes involved in the ecdysone pathway from embryos to pupa, but specially during the different phases of C.riparius fourth larval instar, according to the development of genital and thoracic imaginal discs. Real-Time PCR was used to analyze: EcR and usp, two genes encoding the two dimerizing partners of the functional ecdysone receptor; E74, an early response gene induced by ecdysteroids; vg (vitellogenin), an effector gene; hsp70 and hsc70, two heat-shock genes involved in the correct folding of the ecdysone receptor; and rpL13, as a part of the ribosomal machinery. Our results show for the first time stage and sex-dependent variations in ecdysone-responsive genes, specially during the late larval stage of C.riparius. The induction in the expression of EcR and usp during the VII-VIII phase of the fourth instar is concomitant with a coordinated response in the activity of the other genes analyzed, suggesting the moment where larvae prepare for pupation. This work is particularly relevant given that most of the analyzed genes have been proposed previously in this species as sensitive biomarkers for the toxicological evaluation of aquatic ecosystems. Identifying the natural regulation of these molecular endpoints throughout the Chironomus development will contribute to a more in-depth and accurate evaluation of the disrupting effects of EDCs in ecotoxicological studies. PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 1/20 OPEN ACCESS Citation: Planelló R, Herrero Ó, Gómez-Sande P, Ozáez I, Cobo F, Servia MJ (2015) EcdysoneRelated Biomarkers of Toxicity in the Model Organism Chironomus riparius: Stage and SexDependent Variations in Gene Expression Profiles. PLoS ONE 10(10): e0140239. doi:10.1371/journal. pone.0140239 Editor: Hector Escriva, Laboratoire Arago, FRANCE Received: February 4, 2015 Accepted: September 23, 2015 Published: October 8, 2015 Copyright: © 2015 Planelló et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper. Funding: IO's research was funded by an FPI grant from Ministerio de Ciencia e Innovación (http://www. idi.mineco.gob.es; CTM2009-07189). Research funding was provided by Ministerio de Economía y Competitividad (grant number CTM-2012-37547) and Ministerio de Ciencia e Innovación (grant number CGL2009-10868), Spain. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Introduction Metamorphosis, the transition from the larval stage to the adult, involves important molecular and cellular alterations and results in dramatic morphological and physiological changes in holometabolous insects. These variations demand the loss of embryo tissues and the differentiation or the novo formation of other ones. The harmonized action of two hormones, 20-hydroxyecdysone (20E) and juvenile hormone (JH), is responsible for coordinating insect growth and development, and the balance between them defines the outcome of each developmental transition. In a larva-to-larva molt a JH titer is needed, while metamorphosis takes place when the JH level drops and a 20E titer occurs during the final larval instar [1]. The wide variety of insect groups within Holometabola limits the ability to generalize about development control. The effects of hormones on a group may not be the same in others because of different growth patterns and cell specificities. These differences in responses to hormones add complexity to the interpretation of many findings, and generalizing about common mechanisms in evolutionarily distant and well-described groups should be done cautiously. The steroid signaling mechanisms have been extensively studied in Drosophila melanogaster and Manduca sexta, model insects in developmental studies and neurobiology, and more recently in Tribolium castaneum and Aedes aegypti, an important pest and vector for several diseases, respectively [2]. In contrast, there is little information on the stage-specific expression of hormonal-related genes during the developmental process in the midge Chironomus riparius, which is considered by US EPA and OECD a model organism for ecotoxicity testing and has several internationally validated guidelines [3–5] used for regulatory purposes in environmental toxicology. This species has also been selected as a reference organism in the study of the potential adverse effects of endocrine disrupting chemicals [6] and as a model to evaluate endocrine disrupting effects in aquatic invertebrates for the European IDEA project [7]. Although some changes could somehow be explained in Chironomus from known patterns of closely related species, such as Drosophila or Aedes, physiological differences regarding their life cycle or feeding behavior make interesting a more in-depth study of Chironomus development. Transcriptional response to ecdysteroids in insects requires the action of two nuclear receptor superfamily members, the ecdysone receptor (EcR) and the ultraspiracle (USP) [8]. The activation of the EcR/USP heterodimer initiates the cascade expression of ecdysone-responsive genes that leads to drastic changes in cell proliferation, apoptosis and the disappearance of larval organs, as well as the differentiation of adult tissues. The expression of EcR and usp has been well described during D.melanogaster development, from embryos to adults [9,10]. Different isoforms of these genes have been also characterized in many insects other than Drosophila and dissimilar time-space expression profiles have been reported ([11] and references therein). For example, multiple forms of EcR and usp and their complex regulation have been observed in M.sexta [12], and cDNAs from different isoforms of both genes have been characterized in Chironomus tentans [13,14]. Moreover, the ecdysone receptor gene has been described recently in C.riparius [15], although little is known about the developmental expression profile of EcR and usp in this species, specially during the fourth larval instar, which is the most critical stage for individuals undergoing metamorphosis. Deep into the ecdysone-responsive genes cascade, E74 is one of the early genes induced by ecdysteroids. It has been described as a transcription factor that plays a critical role at the time of metamorphosis in D.melanogaster [16,17] and M.sexta [18], where expression patterns of this gene correlate with pupal commitments. As a part of their development, insects supply their eggs with protein, lipids, carbohydrates and other resources for feeding the growing embryos. Several types of YPP (Yolk Protein Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 2/20 Competing Interests: The authors have declared that no competing interests exist. Precursor) are accumulated by insect oocytes in response to endogenous estrogens, but vitellogenin (Vg) is the most abundant. Multiple vg genes/cDNAs have been sequenced in many insects [19]. The synthesis of Vg is regulated at transcriptional level and vg gene is normally silenced in males and immature females probably due to low levels of estrogens in plasma, although may be activated by (xeno-)estrogens. Therefore, Vg has been proposed as a useful biomarker in the evaluation of the estrogenic effects of pollutants in vertebrates and invertebrates, including C.riparius [20,21]. Nevertheless, there is a lack of information about expression patterns throughout the development of this midge. It is worth highlighting the importance of heat-shock proteins (HSPs) in the folding and maturation of steroid hormone receptors. Among all HSPs, the HSP70 family represents one of the most highly conserved proteins identified to date in all organisms in which they have been described. The family includes constitutive members such as cognate proteins (HSC70), highly abundant in normal cellular conditions, and inducible proteins (HSP70) under a broad spectrum of physical and chemical stress conditions [22]. A functional relationship between steroid hormones and HSPs has been reported and it is known that HSP70, HSC70 and HP90 play an important role in the folding and maturation of steroid hormone receptors and different transcription factors [23]. There have been recent advances in the molecular description of hsp70 genes in a variety of insects, including C.riparius, as well as in their evaluation in response to different environmental stressful conditions [24–27]. It also has been suggested that hsc70/ hsp70 ratio may be a potential indicator of polluted environments [28]. On the contrary, the information about the response of these genes across developmental stages in C.riparius in relation to their chaperone activity and their role in the folding of the ecdysone receptor is still scarce. Finally, ribosomal protein genes are essential for cellular growth and development, since they code for the necessary machinery for protein synthesis, together with the four rRNAs (28S, 18S, 5.8S, 5S). They are considered housekeeping genes and they are constitutively expressed. Furthermore, additional ribosomal functions have been described for some ribosomal proteins, included L13, such as the control of transcriptional regulation, specially in the development and metamorphosis of insects. To date, more than 80 different types of ribosomal proteins have been identified in eukaryotes, but only the genes encoding for six ribosomal proteins have been characterized in C.riparius. Despite their constitutive expression, alterations in the levels of some ribosomal proteins under exposures to different xenobiotics have been reported in this species [29–32]. Due to the recent description of ribosomal genes as potential biomarkers of toxicity and given the lack of information on their potential role during development, evaluating possible ontogenetic-dependent changes is of particular interest. In the present work we characterize the expression patterns of important genes in the ecdysone pathway in C.riparius:EcR,usp,E74,vg,hsp70,hsc70 as well as the housekeeping gene L13. They have been analyzed from embryo to pupa, but specially throughout the fourth larval instar, which is usually the selected stage for ecotoxicity testing. We report for the first time in this organism a developmental stage and sex-dependent expression of all the analyzed genes and describe the coordinated response that triggers the mechanisms to start the metamorphosis. Material and Methods Ethics statement Sampling and protocols used in this study conform to the administrative and ethical laws of the regional government (Xunta de Galicia) and did not involve endangered or protected species. Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 3/20 Test animals and culture conditions The experimental animals were the aquatic embryos, larvae and pupae of the midge Chironomus riparius. They were reared in the laboratory in strict accordance with the recommendations given in standardized international guidelines [3–5]. They were grown from egg masses in aqueous culture medium (0.5 mM CaCl 2 , 1 mM NaCl, 1 mM MgSO 4 , 0.1 mM NaHCO 3 , 0.025 mM KH 2 PO 4 , 0.01 mM FeCl 3 ) supplemented with nettle leaves, commercial fish food, and cellulose tissue in polyethylene tanks (500 ml). Cultures were maintained under constant aeration at 20°C and standard light-dark periods 16:8. Additionally, a brief approach was conducted using larvae from natural populations of the midge collected in the Sar river (Galicia, NW Spain). Embryos were selected 48 h after ovoposition. First to fourth instar larvae were identified by measuring head capsule width, while the phases within the fourth instar were established from the development of genital and thoracic imaginal discs according to [33], where the 4 th instar was divided into nine phases (phase I to phase IX). For the sake of promptness, and in order to reduce stressful conditions to larvae, fourth instar individuals were grouped into five broader categories that could be easily established under the microscope: 1) I-II phase; 2) III-IV phase; 3) V-VI phase; 4) VII-VIII phase; and 5) IX phase. Additionally, the sex of the larvae was established where possible. Larval individuals were sexed and aged under a binocular microscope (x40 magnification) (Fig 1), and four different samples of each category were prepared for analysis of expression profile during embryo stage, larval development and pupation. RNA extraction RNA was extracted from a total of 4 egg masses and 20 frozen individuals (larvae or pupa, depending on the developmental stage or phase), divided into groups of five, using a guanidine isothiocyanate based method, performed with a commercial kit (TRIzol, Invitrogen). To isolate embryo RNA, a prior treatment was performed to remove the gelatinous cover of the egg mass. The egg mass was treated with 1xPBS (137 mM ClNa, 2.7 mM KCl, 8.1 mM Na 2 HPO 4 , 1.5 mM KH 2 PO 4 ) and 0.2% sodium hypochlorite until the gelatinous cover disappeared. Subsequently, the eggs were washed several times with 1xPBS until the sodium hypochlorite was completely eliminated. Briefly, eggs or frozen material were homogenated in one volume of TRIzol and left for 5 min at room temperature. Then, 0.2 volumes of chloroform were added to each sample, mixed and left for 5 min at room temperature. Subsequently, the samples were centrifuged for 15 min at 4°C and 15000 g. Following transfer of the aqueous phase, the RNA was finally recovered by isopropyl alcohol precipitation (0.5 v/v), washed with 70% ethanol, and resuspended in DEPC water. The RNA was then treated with RNase-free DNase (Roche) followed by phenolization. The quality and quantity of total RNA were determined by agarose electrophoresis and absorbance spectrophotometry (Nanodrop1000, Thermo), and the purified RNA was finally stored at -80°C. RNA samples were sent to the Biology and Environmental Toxicology Group (UNED), where expression assays were carried out. Reverse transcription and Real-Time PCR. After checking RNA integrity in 1.5% agarose gels, reverse transcription was performed with 0.5 μg of the isolated RNA, and 0.5 μg oligo dT 20 primer (Sigma) was used with M-MLV enzyme (Invitrogen). The cDNA obtained was used as template for the Polymerase Chain Reaction (PCR). Quantitative Real-Time PCR (qRT-PCR) was used to evaluate the mRNA expression profile of EcR,usp,E74,vg,hsp70,hsc70 and L13 genes during different developmental stages (embryo, 1 st ,2 nd ,3 rd and 4 th instar larvae, and pupa). The q-PCR was performed using CFX96 thermocycler (BioRad) and SsoFast EvaGreen Supermix (BioRad), with 25 ng of cDNA and 300nM of forward and reverse primers per reaction. Ribosomal gene 26S,actin and GAPDH were Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 4/20 employed as endogenous reference genes [34,35]. EcR,usp,E74,hsc70 and hsp70 primers are described in [36,37]. The vg primers were designed from C.riparius sequences present in the database: # HQ260608 [38]. The L13 primers are described in [39]. To accurately determine the efficiencies of the PCR reactions, reaction mixtures with template dilutions 1:2 in five steps were also run in the same PCR conditions, and the slopes of the regression curves were calculated (R 2 >0.98). The Real-Time PCR primers sequences used in this study, efficiencies and fragment size of each gene-specific pair of primers are listed in Table 1. The acceptable range for PCR efficiencies calculated using standard curve serial dilution experiments is 90–110% [40]. Real-Time PCR was run in the following cycling conditions: initial denaturation at 95°C for 3 min, 35 cycles of 95°C denaturation for 5 s, 58°C annealing for 15 s and 65°C elongation for 10 s. To verify the accuracy of each amplicon, a melting curve analysis was carried out after amplification BioRad CFX Manager 2.1 software was used to calculate the mRNA levels by the normalized gene expression (2 -ΔΔCT ) against three endogenous reference genes (26S, actin and GAPDH). Additionally, several statistical analyses were carried out to deeply interpret the Fig 1. Representative images of the separation of larvae carried out in this work. Fourth instar larva were aged and sexed based on the development of genital and thoracic imaginal discs, according to [33], who divided the fourth instar into nine phases (phase I to phase IX). In order to reduce stressful conditions to larvae, phases were grouped into five broader categories (I-II; III-IV; V-VI; VII-VIII and IX, respectively). A. (I-II); B. (III-male); C. (IV-female); D. (V-male); E. (VI-female); F. (VII-male); G. (VIII-female); H. (IX-male) and I. (IX-female). doi:10.1371/journal.pone.0140239.g001 Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 5/20 results. A total of four egg masses and 20 individuals of each developmental category (1 st ,2 nd and 3 rd instar larvae, five phases of the 4 th instar, and pupa, respectively) were used in this study. For each category, samples were divided into four groups containing one egg mass, five larvae or five pupae, as appropriate. To avoid variations caused by experimental procedures each group was analyzed three times (three PCR amplification replicates) and each q-PCR replicate was run in duplicate wells. Determination of ecdysteroids levels during development Ecdysteroids levels were measured via competitive Enzyme Immunoassay (EIA) 20-Hydroxyecdysone EIA kit (A05120) SPI-Bio kit (Bertin Pharma), using 20E and 20E acetylcholinesterase as the standard and enzymatic tracer, respectively. For sample preparation, individual larvae were weighed and homogenized in 250 μl of iced-cold 75% aqueous methanol and centrifuged at 13000 g at 4°C for 15 min. Precipitates were resuspended in an additional 100 μlof aqueous methanol and kept on ice for 30 min. After a new centrifugation as above, the supernatant was combined with the previous one. Samples were vacuum dried and resuspended in 100ul of enzyme immunoassay (EIA) buffer. Ellmann reagent was used for the chromogenic reaction and absorbance was read at 415 nm. All assays were performed in triplicate. Statistical analysis Normality and homoscedasticity of data were tested using the Shapiro-Wilk and Levene tests respectively. Datasets were, if necessary, normalized using natural log (ln) or square root transformations. The levels of the specific gene transcripts were analyzed with ANOVA, followed by Games Howell’s or Tukey’s post Hoc tests when appropriate. If transformed data were not homogeneous or normally distributed the Kruskal-Wallis test was used, and the differences Table 1. Primers used for Real-Time PCR amplification of the genes studied in C.riparius. Gene Name DNA sequence (50-30) Fragment size (bp) Efficiency (%) actin Forward GATGAAGATCCTCACCGAACG 201 104 Reverse CGGAAACGTTCATTACCG GAPDH Forward GGTATTTCATTGAATGATCACTTTG 110 96.6 Reverse TAATCCTTGGATTGCATGTACTTG 26S Forward TTCGCGACCTCAACTCATGT 220 90.4 Reverse CCGCATTCAAGCTGGACTTA EcR Forward CCATCGTCATCTTCTCAG 180 106.6 Reverse TGCCCATTGTTCGTAG usp Forward GCCCAATCATCCGTTAAGTGG 114 108.1 Reverse CGTTTGAAGAATCCTTTACATCC E74 Forward TCTTACTGAAACTTCTTCAAGATCG 111 103.2 Reverse GCTTTGAGACAGCTTTGGAATCG vg Forward GATTGTTCCATGTGCAG 215 112.3 Reverse TTTGAGTATGGTGGAGAATC hsp70 Forward ACTTGAACCAGTTGAGCGT 132 103.8 Reverse TTGCCACAGAAGAAATCTTG hsc70 Forward CGTGCTATGACTAAGGACAA 239 99.3 Reverse GCTTCATTGACCATACGTTC rpL13 Forward AAGCTGCTTTCCCAAGAC 351 109.3 Reverse TTGGCATAATTGGTCCAG doi:10.1371/journal.pone.0140239.t001 Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 6/20 between pairs were analyzed using the multiple comparisons of mean ranks for all groups test of [41]. Differences were considered significant at p<0.05. A cluster analysis method for grouping the different developmental stages was applied using the mean expression values of each gene. All the analyses were performed using SPSS 21 (IBM). Results Expression patterns of hormonal receptors and ecdysone-inducible genes At the molecular level, the first step in the action of 20E consists in its binding to a complex of two nuclear receptors: the ecdysone receptor (EcR) and its heterodimerization partner ultraspiracle (USP). The induction of EcR by the 20E controls the transcription of a set of early response genes, as E74 among others. Our results show a coordinated expression pattern with a stage dependent variation of all these genes, especially when comparing early larval stages with late larval stages or even pupae. We found similar responses for EcR,usp and E74 genes, which consisted of a high transcriptional activity in the embryo stage that dropped drastically at the 1 st larval instar. However, it is noteworthy that although transcript levels remained low throughout early phases of the 4 th instar, a strong induction was clearly measured for late phases and pupa stages. As shown in Figs 2A and 3A,EcR was strongly and significantly induced at VII-VIII phase and reached maximum levels in the IX phase (prepupa) (respectively, 60-fold and up to 260-fold when compared to the lowest level measured in this study). Interestingly, usp showed a similar trend but with lower transcriptional rates than those of EcR, with maximal inductions of 30-fold and 130-fold respectively in VII-VIII and IX phases (Figs 2B and 3B). Apart from these developmental changes, the expression pattern of both EcR and usp showed a sex-dependent response during the 4 th larval stage (Fig 2A and 2B), with significant differences between males and females, particularly in the onset of metamorphosis (VII-VIII and IX phases). The expression pattern of E74 (Figs 2C and 3C) showed an induction in late larvae (VII-VIII and IX phases) in unison with maximal values of EcR, and reached its highest values in pupation (50-fold when compared to the lowest level measured in this study) concomitantly with a slight drop in the expression level of the ecdysone receptor gene. This result suggests that this up-regulation might be part of the early gene response to ecdysteroids that occurs specifically at the point of pupa commitment. Furthermore, as an example of effector gene in the ecdysone pathway, we focused on the study of vg, which is considered as a reproductive biomarker. Interestingly, vg gene showed a tendency to increase throughout the fourth stage concomitantly with the induction detected in EcR levels, and followed by a sharp and significant decline in pupal stage (Figs 2D and 3D). Finally, a brief study focused in late development (from third instar larvae to pupa) was carried out using larvae from natural populations of the midge. Similar transcriptional response of these genes was observed when compared to laboratory cultures, with low levels detected in early developmental stages and strong inductions at late larval and pupal stages (S1A–S1D Fig). Changes in the expression of the 70-kDa heat-shock inducible and cognate genes Considering the role of the HSP70 and HSC70 as chaperones involved in EcR folding, the basal expression of hsp70 and hsc70 genes was evaluated throughout the C.riparius development, Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 7/20 Fig 2. Ontogenetic variations in the expression pattern of the genes analyzed. Transcriptional levels of genes from C.riparius involved in the ecdysonerelated pathway (EcR,usp,E74 and vg), the folding and maturation of steroid hormone receptors (hsp70 and hsc70) and the synthesis of the ribosomal protein L13. Gene expression was measured from embryo to pupa stages of development. The mRNA values were calculated relative to actin,GAPDH and 26s as reference genes. Each bar is the mean ±SE obtained from four independent samples, each with three experimental replicates. A total of 4 egg masses and 20 larvae of each stage or phase were used. All the analyzed genes showed significant differences among the different stages (Fig 3). doi:10.1371/journal.pone.0140239.g002 Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 8/20 Fig 3. Significant differences in the expression pattern of the genes analyzed. All the analyzed genes showed significant differences among the different stages according to Kruskal-Wallis Post hoc test. Three p values were tested in all cases.—(no differences), +(p <0.05), ++ (p <0.01), +++ (p <0.001). doi:10.1371/journal.pone.0140239.g003 Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 9/20 Conclusions (and Significance) This is the first study in C.riparius about stage-dependent variations of genes related to ecdysone response from embryo to pupa, specially during the different phases of the fourth instar larval stage. Our analyses reveal the point where EcR and usp are significantly upregulated into the 4 th instar. Furthermore, we have detected a coordinated overexpression of both genes with the remaining analyzed genes, suggesting that this is the moment when larvae undergo metamorphosis. This work also reveals a sex-dependent transcriptional activity of the analyzed genes during late development, some of which are associated with important physiological processes such as vitellogenesis. However, further studies are needed to establish the specific role that each gene plays in the development and metamorphosis of C.riparius males and females. Given that C.riparius is considered a model species in ecotoxicology studies and is widely used to evaluate the impact of contaminants at the molecular level, specially the 4 th larval instar, our results should be taken into account in ecotoxicity testing. Indeed, most of the genes used in this work have been proposed as sensitive biomarkers of environmental stress. Thus, understanding the molecular basis of metamorphosis as well as the stage and sex-specific regulation of these ecdysone-related genes will allow us to construct more accurate models for the prediction of toxic effects, assessing more precisely what effects are due to a toxin and which are conditioned by natural physiological processes and also contributing to a more in-depth evaluation of the disrupting effects of EDCs in this organism. Supporting Information S1 Fig. Ontogenetic and sex-dependent variations in the expression pattern of the genes analyzed in natural population larvae and pupae. Transcriptional levels of genes, from natural population of C.riparius, involved in the ecdysone-related pathway (EcR,usp,E74 and vg), the folding and maturation of steroid hormone receptors (hsp70 and hsc70), and the synthesis of the ribosomal protein L13. Gene expression was measured during 3 rd ,4 th and pupa stages of development. The mRNA values were calculated relative to actin,GAPDH and 26s as reference genes. Each bar is the mean ± SE obtained from four independent samples, each with three experimental replicates (a total of 20 larvae of each stage or phase, and separate sex were used). Significant differences among groups: p0.05; p0.005. Different letters indicate significant differences across groups (p0.05; p0.005). (TIF) S2 Fig. Hierarchical clustering dendrogram of the groups established for the expression analysis in natural population larvae and pupae. Cluster analysis arranges biological samples into groups based on the expression levels. Relationships among samples are represented by a dendrogram whose branch lengths reflect the degree of similarity between them as assessed by a pairwise similarity genes response. Two groups of developmental stages or phases are clearly separated, corresponding to 3 rd and early 4 th instar larva (groups 1–4), and to late 4 th instar larva and pupa, respectively (groups 5–7). The root represents the whole data set. A leaf represents a single object in the data set. An internal node represents the union of all objects in its sub-tree. The weight of an internal node represents the distance between its two child nodes. (TIF) Acknowledgments Authors would like to thank Enrique Rego for his helpful comments and statistical processing; Dr. P. Fernández and Dr. M.J. Hazen (Universidad Autónoma de Madrid, Spain) for their assistance with spectrophotometry equipment used for immunoassays; and the Faculty of Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 16 / 20 Sciences of the National Distance Education University (UNED). We also thank C. González (Vitro S.A., Spain) and Berthin Pharma (France) for providing the 20E EIA detection kits for their validation in this work. Author Contributions Conceived and designed the experiments: RP OH PGS MJS. Performed the experiments: RP OH PGS IO. Analyzed the data: RP OH MJS. Contributed reagents/materials/analysis tools: FC MJS RP. Wrote the paper: RP OH MJS. References 1. Dubrovsky EB. Hormonal cross talk in insect development. Trends Endocrinol Metab. 2005; 16: 6–11. doi: 10.1016/j.tem.2004.11.003 PMID: 15620543 2. Riddiford LM. How does juvenile hormone control insect metamorphosis and reproduction? Gen Comp Endocrinol. 2012; 179: 477–84. doi: 10.1016/j.ygcen.2012.06.001 PMID: 22728566 3. EPA. Methods for Measuring the Toxicity and Bioaccumulation of Sediment-associated Contaminants with Freshwater Invertebrates. Second Edition. Washington: United States Environmental Protection Agency; 2000. p. 212. 4. OECD. Test No. 218: Sediment-Water Chironomid Toxicity Test Using Spiked Sediment. Paris: Organisation for Economic Co-operation and Development; 2004. p. 21. 5. OECD. Test No. 219: Sediment-Water Chironomid Toxicity Test Using Spiked Water. Paris: Organisation for Economic Co-operation and Development; 2004. p. 21. 6. Chironomids: suitable test organisms for risk assessment investigations on the potential endocrine disrupting properties of pesticides [Internet]. [cited 9 Sep 2014]. Available: http://download.springer.com/ static/pdf/667/art%253A10.1007%252Fs10646-006-0117-x.pdf?auth66=1410428279_ 90c5297641ca55e72f530e84ccb5e8fd&ext = .pdf 7. Segner H, Caroll K, Fenske M, Janssen CR, Maack G, Pascoe D, et al. Identification of endocrine-disrupting effects in aquatic vertebrates and invertebrates: report from the European IDEA project. Ecotoxicol Environ Saf. 2003; 54: 302–14. PMID: 12651186 8. Thomas HE, Stunnenberg HG, Stewart AF. Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature. 1993; 362: 471–5. doi: 10.1038/362471a0 PMID: 8385270 9. Henrich VC, Szekely AA, Kim SJ, Brown NE, Antoniewski C, Hayden MA, et al. Expression and function of the ultraspiracle (usp) gene during development of Drosophila melanogaster. Dev Biol. 1994; 165: 38–52. doi: 10.1006/dbio.1994.1232 PMID: 8088449 10. Schwedes CC, Carney GE. Ecdysone signaling in adult Drosophila melanogaster. J Insect Physiol. Elsevier Ltd; 2012; 58: 293–302. doi: 10.1016/j.jinsphys.2012.01.013 11. Fahrbach SE, Smagghe G, Velarde RA. Insect nuclear receptors. Annu Rev Entomol. Annual Reviews; 2012; 57: 83–106. doi: 10.1146/annurev-ento-120710-100607 12. Hiruma K, Riddiford LM. Developmental expression of mRNAs for epidermal and fat body proteins and hormonally regulated transcription factors in the tobacco hornworm, Manduca sexta. J Insect Physiol. 2010; 56: 1390–5. doi: 10.1016/j.jinsphys.2010.03.029 PMID: 20361974 13. Imhof MO, Rusconi S, Lezzi M. Cloning of a Chironomus tentans cDNA encoding a protein (cEcRH) homologous to the Drosophila melanogaster ecdysteroid receptor (dEcR). Insect Biochem Mol Biol. 1993; 23: 115–124. doi: 10.1016/0965-1748(93)90089-B PMID: 8485513 14. Vögtli M. Functional characterization of two Ultraspiracle forms (CtUSP-1 and CtUSP-2) from Chironomus tentans. Insect Biochem Mol Biol. 1999; 29: 931–942. doi: 10.1016/S0965-1748(99)00068-5 PMID: 10528412 15. Nair PMG, Choi J. Modulation in the mRNA expression of ecdysone receptor gene in aquatic midge, Chironomus riparius upon exposure to nonylphenol and silver nanoparticles. Environ Toxicol Pharmacol. 2012; 33: 98–106. doi: 10.1016/j.etap.2011.09.006 PMID: 22196049 16. Thummel CS, Burtis KC, Hogness DS. Spatial and temporal patterns of E74 transcription during Drosophila development. Cell. 1990; 61: 101–11. Available: http://www.ncbi.nlm.nih.gov/pubmed/1690603 PMID: 1690603 17. Fletcher JC, Burtis KC, Hogness DS, Thummel CS. The Drosophila E74 gene is required for metamorphosis and plays a role in the polytene chromosome puffing response to ecdysone. Development. 1995; 121: 1455–65. Available: http://www.ncbi.nlm.nih.gov/pubmed/7789275 PMID: 7789275 Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 17 / 20 18. Stilwell GE, Nelson CA, Weller J, Cui H, Hiruma K, Truman JW, et al. E74 exhibits stage-specific hormonal regulation in the epidermis of the tobacco hornworm, Manduca sexta. Dev Biol. 2003; 258: 76– 90. doi: 10.1016/S0012-1606(03)00105-2 PMID: 12781684 19. Tufail M, Takeda M. Molecular characteristics of insect vitellogenins. J Insect Physiol. 2008; 54: 1447– 58. doi: 10.1016/j.jinsphys.2008.08.007 PMID: 18789336 20. Hahn T, Schenk K, Schulz R. Environmental chemicals with known endocrine potential affect yolk protein content in the aquatic insect Chironomus riparius. Environ Pollut. 2002; 120: 525–8. Available: http://www.ncbi.nlm.nih.gov/pubmed/12442778 PMID: 12442778 21. Porte C, Janer G, Lorusso LC, Ortiz-Zarragoitia M, Cajaraville MP, Fossi MC, et al. Endocrine disruptors in marine organisms: approaches and perspectives. Comp Biochem Physiol Part C, Toxicol Pharmacol. 2006; 143: 303–15. doi: 10.1016/j.cbpc.2006.03.004 22. Mayer MP, Bukau B. Hsp70 chaperones: cellular functions and molecular mechanism. Cell Mol Life Sci. 2005; 62: 670–84. doi: 10.1007/s00018-004-4464-6 PMID: 15770419 23. Wegele H, Müller L, Buchner J. Hsp70 and Hsp90—a relay team for protein folding. Rev Physiol Biochem Pharmacol. 2004; 151: 1–44. doi: 10.1007/s10254-003-0021-1 PMID: 14740253 24. Karouna-Renier NK, Rao KR. An inducible HSP70 gene from the midge Chironomus dilutus: characterization and transcription profile under environmental stress. Insect Mol Biol. 2009; 18: 87–96. doi: 10. 1111/j.1365-2583.2008.00853.x PMID: 19196349 25. Zhang Q, Denlinger DL. Molecular characterization of heat shock protein 90, 70 and 70 cognate cDNAs and their expression patterns during thermal stress and pupal diapause in the corn earworm. J Insect Physiol. 2010; 56: 138–50. doi: 10.1016/j.jinsphys.2009.09.013 PMID: 19782689 26. Morales M, Planelló R, Martínez-Paz P, Herrero O, Cortés E, Martínez-Guitarte JL, et al. Characterization of Hsp70 gene in Chironomus riparius: expression in response to endocrine disrupting pollutants as a marker of ecotoxicological stress. Comp Biochem Physiol C Toxicol Pharmacol. Elsevier Inc.; 2011; 153: 150–8. doi: 10.1016/j.cbpc.2010.10.003 27. Herrero O, Planelló R, Morcillo G. The plasticizer benzyl butyl phthalate (BBP) alters the ecdysone hormone pathway, the cellular response to stress, the energy metabolism, and several detoxication mechanisms in Chironomus riparius larvae. Chemosphere. 2015; (In press). 28. Planelló R, Servia MJ, Gómez-Sande P, Herrero O, Cobo F, Morcillo G. Transcriptional responses, metabolic activity and mouthpart deformities in natural populations of Chironomus riparius larvae exposed to environmental pollutants. Environ Toxicol. 2013; doi: 10.1002/tox.21893 29. Govinda S, Kutlow T, Bentivegna CS. Identification of a putative ribosomal protein mRNA in Chironomus riparius and its response to cadmium, heat shock, and actinomycin D. J Biochem Mol Toxicol. 2000; 14: 195–203. Available: http://www.ncbi.nlm.nih.gov/pubmed/10789497 PMID: 10789497 30. Planelló R, Martínez-Guitarte JL, Morcillo G. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae. Sci Total Environ. 2007; 373: 113–21. doi: 10.1016/j.scitotenv. 2006.10.038 PMID: 17169405 31. Nair PMG, Choi J. Characterization of a ribosomal protein L15 cDNA from Chironomus riparius (Diptera; Chironomidae): transcriptional regulation by cadmium and silver nanoparticles. Comp Biochem Physiol B Biochem Mol Biol. 2011; 159: 157–62. doi: 10.1016/j.cbpb.2011.03.006 PMID: 21473924 32. Park K, Kwak IS. Gene expression of ribosomal protein mRNA in Chironomus riparius: effects of endocrine disruptor chemicals and antibiotics. Comp Biochem Physiol Part C, Toxicol Pharmacol. Elsevier Inc.; 2012; 156: 113–20. doi: 10.1016/j.cbpc.2012.05.002 33. Wülker W, Götz P. Die Verwendung der Imaginalscheiben zur Bestimmung des Entwicklungszustandes von Chironomus-larven (Dipt.). Zeitschrift für Morphol der Tiere. 1968; 62: 363–388. doi: 10. 1007/BF00401562 34. Park K, Kwak IS. Alcohol dehydrogenase gene expression in Chironomus riparius exposed to di(2ethylhexyl) phthalate. Comp Biochem Physiol Part C, Toxicol Pharmacol. Elsevier Inc.; 2009; 150: 361–7. doi: 10.1016/j.cbpc.2009.05.015 35. Planelló R, Herrero O, Martínez-Guitarte JL, Morcillo G. Comparative effects of butyl benzyl phthalate (BBP) and di(2-ethylhexyl) phthalate (DEHP) on the aquatic larvae of Chironomus riparius based on gene expression assays related to the endocrine system, the stress response and ribosomes. Aquat Toxicol. 2011; 105: 62–70. doi: 10.1016/j.aquatox.2011.05.011 PMID: 21684242 36. Planelló R, Martínez-Guitarte JL, Morcillo G. Effect of acute exposure to cadmium on the expression of heat-shock and hormone-nuclear receptor genes in the aquatic midge Chironomus riparius. Sci Total Environ. Elsevier B.V.; 2010; 408: 1598–603. doi: 10.1016/j.scitotenv.2010.01.004 37. Morales M, Martínez-Paz P, Ozáez I, Martínez-Guitarte JL, Morcillo G. DNA damage and transcriptional changes induced by tributyltin (TBT) after short in vivo exposures of Chironomus riparius Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 18 / 20 (Diptera) larvae. Comp Biochem Physiol C Toxicol Pharmacol. 2013; 158: 57–63. doi: 10.1016/j.cbpc. 2013.05.005 PMID: 23684738 38. Park K, Park J, Kim J, Kwak IS. Biological and molecular responses of Chironomus riparius (Diptera, Chironomidae) to herbicide 2,4-D (2,4-dichlorophenoxyacetic acid). Comp Biochem Physiol Part C, Toxicol Pharmacol. Elsevier Inc.; 2010; 151: 439–46. doi: 10.1016/j.cbpc.2010.01.009 39. Martínez-Guitarte JL, Planelló R, Morcillo G. Characterization and expression during development and under environmental stress of the genes encoding ribosomal proteins L11 and L13 in Chironomus riparius. Comp Biochem Physiol B Biochem Mol Biol. 2007; 147: 590–6. doi: 10.1016/j.cbpb.2007.03. 015 PMID: 17507274 40. Lüchmann KH, Dafre AL, Trevisan R, Craft JA, Meng X, Mattos JJ, et al. A light in the darkness: new biotransformation genes, antioxidant parameters and tissue-specific responses in oysters exposed to phenanthrene. Aquat Toxicol. 2014; 152: 324–34. doi: 10.1016/j.aquatox.2014.04.021 PMID: 24813265 41. Siegel S, Castellan NJ Jr. Non-parametric statistics for the behavioural sciences. McGraw Hill Int. McGraw-Hill Humanities/Social Sciences/Languages; 1988. pp. 213–214. Available: http://www.ncbi. nlm.nih.gov/nlmcatalog/8810006 42. Richards G. The radioimmunoassay of ecdysteroid titers in Drosophila melanogaster. Mol Cell Endocrinol. 1981; 21:181–197. doi: 10.1016/0303-7207(81)90013-7 PMID: 6783464 43. Riddiford LM. Juvenile hormone: the status of its "status quo" action. Arch Insect Biochem Physiol. 1996; 32(3–4):271–86. doi: 10.1002/(SICI)1520-6327(1996)32:3/4<271::AID-ARCH2>3.0.CO;2-W PMID: 8756300 44. Warren JT, Gilbert LI. Metabolism in vitro of cholesterol and 25-hydroxycholesterol by the larval prothoracic glands of Manduca sexta. Insect Biochem Mol Biol. 1996; 26(8–9):917–29. doi: 10.1016/S09651748(96)00058-6 PMID: 9014337 45. Langelan RE, Fisher JE, Hiruma K, Palli SB, Riddiford LM. Patterns of MHR3 expression in the epidermis during a larval molt of the tobacco hornworm Manduca sexta. Dev Biol. 2000; 227:481–494. doi: 10.1006/dbio.2000.9895 PMID: 11071768 46. Parvy JP, Blais C, Bernard F, Warren JT, Petryk A, Gilbert LI, O'Connor MB, Dauphin-Villemant C. A role for βFTZ-F1 in regulating ecdysteroid titers during postembryonic development in Drosophila melanogaster. Dev Biol. 2005; 282: 84–94. doi: 10.1016/j.ydbio.2005.02.028 PMID: 15936331 47. Riddiford LM, Cherbas P, Truman JW. Ecdysone receptors and their biological actions. Vitam Horm. 2000; 60: 1–73. Available: http://www.ncbi.nlm.nih.gov/pubmed/11037621 PMID: 11037621 48. Planelló R, Martínez-Guitarte JL, Morcillo G. The endocrine disruptor bisphenol A increases the expression of HSP70 and ecdysone receptor genes in the aquatic larvae of Chironomus riparius. Chemosphere. 2008; 71: 1870–6. doi: 10.1016/j.chemosphere.2008.01.033 PMID: 18313723 49. Ozáez I, Martínez-Guitarte JL, Morcillo G. Effects of in vivo exposure to UV filters (4-MBC, OMC, BP-3, 4-HB, OC, OD-PABA) on endocrine signaling genes in the insect Chironomus riparius. Sci Total Environ. 2013; 456–457: 120–6. doi: 10.1016/j.scitotenv.2013.03.081 PMID: 23591065 50. Ozáez I, Martínez-Guitarte JL, Morcillo G. The UV filter benzophenone 3 (BP-3) activates hormonal genes mimicking the action of ecdysone and alters embryo development in the insect Chironomus riparius (Diptera). Environ Pollut. 2014; 192: 19–26. doi: 10.1016/j.envpol.2014.04.038 PMID: 24878782 51. Herrero O, Planelló R, Morcillo G. The plasticizer benzyl butyl phthalate (BBP) alters the ecdysone hormone pathway, the cellular response to stress, the energy metabolism, and several detoxication mechanisms in Chironomus riparius larvae. Chemosphere.2015; 128; 266–77. doi: 10.1016/j.chemosphere. 2015.01.059 PMID: 25725395 52. Berger EM, Dubrovsky EB. Juvenile hormone molecular actions and interactions during development of Drosophila melanogaster. Vitam Horm. 2005; 73: 175–215. doi: 10.1016/S0083-6729(05)73006-5 PMID: 16399411 53. Westerlund S. Measuring juvenile hormone and ecdysteroid titers in insect haemolymph simultaneously by LC-MS: The basis for determining the effectiveness of plant-derived alkaloids as insect growth regulators. PhD. thesis, University of Bayreuth. 2004 54. Henrich VC, Brown NE. Insect nuclear receptors: A developmental and comparative perspective. Insect Biochem Mol Biol. 1995; 25: 881–897. doi: 10.1016/0965-1748(95)00030-Y PMID: 7550245 55. Wang SF, Li C, Zhu J, Miura K, Miksicek RJ, Raikhel AS. Differential expression and regulation by 20hydroxyecdysone of mosquito ultraspiracle isoforms. Dev Biol. 2000; 218: 99–113. doi: 10.1006/dbio. 1999.9575 PMID: 10644414 56. Cho W-L, Kapitskaya MZ, Raikhel AS. Mosquito ecdysteroid receptor: Analysis of the cDNA and expression during vitellogenesis. Insect Biochem Mol Biol. 1995; 25: 19–27. doi: 10.1016/0965-1748 (94)00045-J PMID: 7711747 Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 19 / 20 57. Kapitskaya M, Wang S, Cress DE, Dhadialla TS, Raikhel AS. The mosquito ultraspiracle homologue, a partner of ecdysteroid receptor heterodimer: cloning and characterization of isoforms expressed during vitellogenesis. Mol Cell Endocrinol. 1996; 121: 119–132. doi: 10.1016/0303-7207(96)03847-6 PMID: 8892313 58. Parthasarathy R, Palli SR. Stageand cell-specific expression of ecdysone receptors and ecdysoneinduced transcription factors during midgut remodeling in the yellow fever mosquito, Aedes aegypti.J Insect Physiol. 2007; 53: 216–29. doi: 10.1016/j.jinsphys.2006.09.009 PMID: 17074360 59. Rauch P, Grebe M, Elke C, Spindler K-D, Spindler-Barth M. Ecdysteroid receptor and ultraspiracle from Chironomus tentans (Insecta) are phosphoproteins and are regulated differently by molting hormone. Insect Biochem Mol Biol. 1998; 28: 265–275. doi: 10.1016/S0965-1748(98)00026-5 PMID: 9684334 60. Karim FD, Thummel CS. Ecdysone coordinates the timing and amounts of E74A and E74B transcription in Drosophila. Genes Dev. 1991; 5: 1067–79. Available: http://www.ncbi.nlm.nih.gov/pubmed/ 2044954 PMID: 2044954 61. Blariza MJ, Soria NW, Torres AG, Grosso CG, García BA. cDNA isolation and characterization of two vitellogenin genes in the Chagas’disease vector Triatoma infestans (Hemiptera, Reduviidae). Gene. 2014; 543: 118–24. doi: 10.1016/j.gene.2014.03.054 PMID: 24685521 62. Hansen IA, Attardo GM, Rodriguez SD, Drake LL. Four-way regulation of mosquito yolk protein precursor genes by juvenile hormone-, ecdysone-, nutrient-, and insulin-like peptide signaling pathways. Front Physiol. 2014; 5: 103. doi: 10.3389/fphys.2014.00103 PMID: 24688471 63. Swevers L, Iatrou K. The ecdysone regulatory cascade and ovarian development in lepidopteran insects: insights from the silkmoth paradigm. Insect Biochem Mol Biol. 2003; 33: 1285–1297. doi: 10. 1016/j.ibmb.2003.06.012 PMID: 14599500 64. Comas D, Piulachs MD, Bellés X. Induction of vitellogenin gene transcription in vitro by juvenile hormone in Blattella germanica. Mol Cell Endocrinol. 2001; 183: 93–100. Available: http://www.ncbi.nlm. nih.gov/pubmed/11604229 PMID: 11604229 65. Parthasarathy R, Sun Z, Bai H, Palli SR. Juvenile hormone regulation of vitellogenin synthesis in the red flour beetle, Tribolium castaneum. Insect Biochem Mol Biol. 2010; 40: 405–14. doi: 10.1016/j.ibmb. 2010.03.006 PMID: 20381616 66. Parthasarathy R, Sheng Z, Sun Z, Palli SR. Ecdysteroid regulation of ovarian growth and oocyte maturation in the red flour beetle, Tribolium castaneum. Insect Biochem Mol Biol. 2010; 40: 429–39. doi: 10. 1016/j.ibmb.2010.04.002 PMID: 20385235 67. Servia MJ, Heydorff M, Péry ARR, Garric J, Lagadic L. Sexand Developmental Stage-Related Changes in Energy Reserves in Fourth-instar Larvae of the Midge Chironomus riparius Meigen (Diptera: Chironomidae): Implications for Ecotoxicity Testing. Environ Entomol. Entomological Society of America; 2006; 35: 865–874. doi: 10.1603/0046-225X-35.4.865 68. Fink AL. Chaperone-Mediated Protein Folding. Physiol Rev. 1999; 79: 425–449. Available: http:// physrev.physiology.org/content/79/2/425.full-text.pdf+html PMID: 10221986 69. Bukau B, Weissman J, Horwich A. Molecular chaperones and protein quality control. Cell. 2006; 125: 443–51. doi: 10.1016/j.cell.2006.04.014 PMID: 16678092 70. Helps NR, Adams SM, Brammar WJ, Varley JM. The Drosophila melanogaster homologue of the human BBC1 gene is highly expressed during embryogenesis. Gene. 1995; 162: 245–248. doi: 10. 1016/0378-1119(95)00356-B PMID: 7557437 Natural Variations of Ecdysone-Inducible Genes in Chironomus riparius PLOS ONE | DOI:10.1371/journal.pone.0140239 October 8, 2015 20 / 20