Novel human polyomaviruses in pregnancy: higher prevalence of BKPyV, but no WUPyV, KIPyV and HPyV9

1 No el human polyoma i uses in p egnancy: highe p e alence o BKPyV, bu no WUPyV, 1 KIPyV and HPyV9 2 3 Esz e Csoma a, *, Tamás Sápyb, Beá a Mészá osa, Lajos Ge gely a 4 5 a Depa men o Medical Mic obiology, Medical and Heal h Science Cen e, Uni e si y o 6 Deb ecen, Nagye dei k . 98., H-4032 Deb ecen, Hunga y 7 b Depa men o Obs e ics and Gynecology, Medical and Heal h Science Cen e, Uni e si y 8 o Deb ecen, Nagye dei k . 98., H-4032 Deb ecen, Hunga y 9 10 * Co esponding au ho . Tel.: +36 52 255 425; ax: +36 52 255 424. Email add ess: 11 csomae@ eemail.hu. 12 13 Abb e ia ions: 14 WU polyoma i us (WUPyV), KI polyoma i us (KIPyV), human polyoma i us 9 (HPyV9), 15 BK polyoma i us (BKPyV), genome equi alen (GEq), polyme ase chain eac ion (PCR) 16 17 18 19 20 21 Numbe o wo ds in he Abs ac : 248 22 Numbe o wo ds in he ex : 1879 23 24 25 2 Abs ac 26 Backg ound: Immunosupp ession due o p egnancy may lead o highe suscep ibili y o 27 in ec ions and eac i a ion o la en in ec ions, such as BK polyoma i us (BKPyV). The e is 28 lack o in o ma ion abou he p e alence o no el human polyoma i us 9 (HPyV9), WU 29 (WUPyV) and KI (KIPyV) du ing p egnancy. 30 Objec i es: To s udy whe he p egnancy esul s in highe p e alence o HPyV9, WUPyV, 31 KIPyV and hei co ela ion wi h BKPyV. 32 S udy design: Plasma, u ine and h oa swab samples om 100 p egnan and 100 non 33 p egnan women we e sc eened o he p esence o WUPyV, KIPyV, HPyV9 and BKPyV by 34 PCR. 35 Resul s: No WUPyV DNA was de ec ed in plasma, u ine and espi a o y samples om 36 p egnan and non p egnan women. KIPyV DNA was ound in wo plasma samples om non 37 p egnan women (2 %) and no de ec ed in o he samples om nei he p egnan no non 38 p egnan women. HPyV9 DNA was de e mined in all sample ypes o p egnan and non 39 p egnan women, espec i ely. The e we e no signi ican di e ences be ween p egnan and 40 non p egnan women in HPyV9 DNA equencies o plasma (2 % s. 6 %), u ine (3 % s. 2 41 %) and espi a o y samples (2 % s. 2 %). P e alence o BKPyV in u ine samples was 42 signi ican ly highe (p=0.039) in p egnan women (13 %) hen in non p egnan women (4 %); 43 co n ec ion wi h KIPyV and/o HPyV9 was no de ec ed. 44 Conclusions: In con as wi h BKPyV, in ec ion wi h WUPyV, KIPyV and HPyV9 was no 45 de ec ed mo e equen ly du ing p egnancy. To ou knowledge HPyV9 was de ec ed i s in 46 espi a o y samples in ou s udy. 47 48 Key wo ds: human polyoma i uses, p egnancy 49 50 3 1. Backg ound 51 Human polyoma i us BK (BKPyV) se op e alence inc eases wi h age eaching high, 52 80-90 % in adul popula ion.1 Simila ly high, 55-90 % adul se oposi i i ies we e obse ed o 53 ecen ly disco e ed KI2 and WU3 polyoma i uses (KIPyV, WUPyV).4-6 In es iga ion o 54 se oposi i i y agains he newly disco e ed human polyoma i us 9 (HPyV9)7 e ealed 47 % 55 posi i i y o heal hy adul s.8 I is well known ha a e he childhood p ima y in ec ion wi h 56 BKPyV, li elong pe sis en in ec ion is es ablished mainly in enal and u ina y ac cells.1 57 T ansien immunosupp ession due o p egnancy may lead o eac i a ion o BKPyV esul ing 58 in gene ally asymp oma ic i u ia wi h equency o 3 o 54 %.1, 9-11 Beside i u ia, BKPyV 59 i aemia was also de ec ed in p egnan women. 11 The pa hogenic ole o he no el WUPyV, 60 KIPyV and HPyV9 is a om clea , only specula i e. WU and KI i uses we e ound in 61 a ious sample ypes – espi a o y samples, blood, aeces, ce eb ospinal luid, lymphoid 62 issues, u ine – and highe p e alence was obse ed in child en and immunocomp omised 63 pa ien s.12-16 HPyV9 was desc ibed om blood and u ine samples o kidney ansplan 64 pa ien s, hen i was ound in skin samples, bu no in espi a o y and ecal samples.7, 17 The 65 highe equency o hese i uses in immunocomp omised pa ien s sugges s highe 66 suscep ibili y o eac i a ion due o immunosupp ession. Up o now only ou u ine samples 67 om p egnan women we e in es iga ed o he p esence o KIPyV and WUPyV DNA wi h 68 nega i e esul .18 The gene ic and possible ansmission simila i ies o BKPyV, and he highe 69 PCR p e alence da a among immunocop omised pa ien s may sugges ha 70 immunosupp ession, hus p egnancy may lead o highe suscep ibili y o in ec ion wi h 71 WUPyV , KIPyV and HPyV9 o may esul in eac i a ion o possible la en in ec ions. 72 73 2. Objec i e 74 4 The aim o he p esen s udy was o e alua e he p e alence o h ee new human 75 polyoma i uses (WUPyV, KIPyV and HPyV9) du ing p egnancy, o s udy whe he 76 immunosupp ession due o p egnancy may lead o highe p e alence as i was ound in case 77 o BKPyV. The possible co ela ions o hese i uses we e also in es iga ed. 78 79 3. S udy design 80 3.1. Pa ien s and samples 81 U ine, plasma ( om EDTA blood samples) and h oa swab samples we e collec ed on 82 he same day om 100 heal hy p egnan women (age 16.5-41.9 yea s, median 32.1 yea s; 83 p egnancy 5-39 weeks; median 26 weeks) and 100 non p egnan women (age 18-44.3 yea s, 84 median 31.6 yea s) be ween Sep embe 2011 and Decembe 2011. Samples om p egnan 85 women we e collec ed in all h ee imes e s: i s imes e n=28; second imes e n=27; 86 hi d imes e n=45. The con ol samples we e aken om heal hy, non p egnan , e ili y 87 exam isi o women. 88 Immedia ely a e collec ion, nucleic acid was isola ed om samples using High Pu e 89 Vi al Nucleic Acid Ki (Roche, Swi ze land) acco ding o he manu ac u e ’s ins uc ions. 90 B ie ly, nucleic acids om 200 µl plasma, 200 µl u ine specimen and h oa swab sample 91 washed in 200 µl bu e we e elu ed in 50 µl and s o ed a -20 °C un il use. 92 The s udy was app o ed by Regional and Ins i u ional E hics Commi ee o 93 Uni e si y o Deb ecen. All pa ien s we e asked o sign w i en in o med consen . 94 95 3.2. Nes ed and eal- ime PCR o WUPyV, KIPyV, HPyV9 and BKPyV 96 All PCR me hods we e ca ied ou wi h 10 μl nucleic acid in a inal olume o 25 μl. 97 Fo nes ed PCR AmpliTaq Gold 360 Mas e Mix, o WUPyV and KIPyV eal- ime PCR 98 TaqMan Uni e sal PCR Mas e Mix (Applied Biosys ems, USA) we e used. The calib an s 99 5 o quan i a i e PCRs we e se ial dilu ions o KIPyV plasmid (in which he genome o KI 100 polyoma i us isola e S ockholm 60 was inco po a ed) and AP-p003 plasmid (con aining he 101 2228 bp hal genome o WU polyoma i us) kindly p o ided by Tobias Allande and Da id 102 Wang. WUKI nes ed PCR and eal- ime PCR o WU and KI i us we e pe o med as 103 desc ibed p e iously.16 HPyV9 PCR was ca ied ou wi h diagnos ic p ime s and annealing 104 empe a u e published by Scuda e al.7 Fo he i s ound o BKV nes ed PCR, k1 (5’ 105 TGAAGCATATGAAGATGGCC 3’) and k2 (5’ GTTACAGCCTCCCACATC 3’) p ime s 106 we e used wi h 60 ºC annealing empe a u e, while o he second ound b1 (5’ 107 GATGGCCCCAACCAAAAG 3’) and b2 (5’ CTAGAACTTCTACTCCTCC 3’) p ime s and 108 56 ºC annealing empe a u e we e applied. PCR p oduc s we e isualized by elec opho esis 109 in 1.5 % aga ose gel con aining e hidium b omide (0.5 µg/mL). The ampli ied PCR p oduc s 110 om WUKI and HPyV9 nes ed PCR we e cu , pu i ied wi h QIAquick Gel Ex ac ion Ki 111 (Qiagen) acco ding o he ins uc ions and sequenced by using ABI PRISM 3100 Gene ic 112 Analyze (Applied Biosys ems). To de e mine BKPyV i al load BKV i us R-gene 113 quan i ica ion ki was used (A gene, USA) acco ding o he manu ac u e ’s ins uc ions. 114 115 3.3. S a is ical analysis 116 Di e ence in equency o ca ego ical a iables was analysed by Fishe ’s exac es . 117 Fo con inuous a iables Mann-Whi ney U es was applied. Di e ence was conside ed 118 signi ican i p alue was less hen 0.05. 119 120 4. Resul s 121 4.1. De ec ion o WUPyV, KIPyV and HPyV9 DNA in plasma, u ine and espi a o y samples 122 Table 1 shows he esul s o PCR de ec ions o he a ious samples. WUPyV DNA 123 was no de ec ed in plasma, u ine and espi a o y samples nei he om p egnan no om non 124 6 p egnan women. KIPyV was ound in wo plasma samples o non p egnan women, bu was 125 no de e mined in any o he samples. To con i m he posi i e PCR esul s and o de e mine KI 126 o WU i us DNA was de ec ed, PCR p oduc s we e sequenced. The i al loads we e below 127 he limi o de ec ion (< 250 GEq/mL; genome equi alen /mL) by eal- ime PCR. HPyV9 128 DNA was de ec ed in u ine, plasma and espi a o y samples om bo h s udied g oups. To 129 p o e he esul s om PCR, all PCR p oduc s we e sequenced. In de ails, he p e alence o 130 HPyV9 DNA in plasma samples was highe in con ol, non p egnan g oup hen in p egnan 131 women (6/100; 6 % s. 2/100; 2%), bu he di e ence was no s a is ically signi ican . The 132 wo posi i e samples we e aken in he second imes e o p egnancy. Two samples om 133 con ol, non p egnan women wi h HPyV9 i aemia we e also posi i e o KIPyV DNA. In 134 espi a o y samples he equency o HPyV9 DNA was he same in bo h s udied g oups 135 (2/100; 2% and 2/100; 2%). Bo h o he posi i e samples in p egnan women g oup we e 136 collec ed in he i s imes e . Th ee u ine samples om p egnan women we e HPyV9 PCR 137 posi i e (3/100; 3%), while in con ol g oup 2 samples we e posi i e (2/100; 2%) which is no 138 s a is ically signi ican di e ence. 139 4.2. P e alence o BKPyV in u ine and plasma samples 140 BKPyV was no de ec ed in plasma samples. F equency o BKPyV i u ia was 13 % 141 (13/100) in p egnan women and 4 % (4/100) in non p egnan , con ol g oup (Table 1.). The 142 di e ence is s a is ically signi ican (p=0.039). The BKPyV i al load in samples om 143 p egnan women ( ange 50-1.86 x 108; median 11.82 x 103 GEq/mL) did no show s a is ically 144 signi ican di e ence om he i al load in con ol samples ( ange 2.25 x 102-3.58 x 105; 145 median 2.98 x 102). BKPyV p esence in u ine samples was ound in all imes e s. 146 147 5. Discussion 148 7 In ou s udy signi ican ly highe p e alence o BK i u ia was obse ed in p egnan 149 women in con as wi h non p egnan women. Human polyoma i us 9 was ound in plasma, 150 u ine and espi a o y samples om p egnan women bu no mo e equen ly hen in samples 151 om non p egnan women. WU and KI i uses we e no de ec ed in any o he s udied 152 samples om p egnan women. 153 BK polyoma i us is ubiqui ous in he human popula ion, he p ima y in ec ion 154 gene ally occu s du ing childhood wi hou signi ican clinical consequences, espi a o y 155 diseases migh occu . T ansmission o he i uses is no well cla i ied, bu i is sugges ed ha 156 hese i uses a e acqui ed mainly h ough espi a o y, aecal-o al and u ina y ou es, 157 al e na i ely by blood ans usion and o gan ansplan a ion.1 A e he p ima y in ec ion, 158 li elong pe sis ence o he i us is es ablished mainly in kidney and u ina y ac .19, 20 Ly ic 159 in ec ion wi h i u ia occu s in 5-10 % o immunocompe en indi iduals21, bu mo e 160 equen ly in immunocomp omised pa ien s.22 Du ing p egnancy immunologic changes 161 oge he wi h ho monal e ec s may esul in i al in ec ions, eac i a ions. Vi u ia was 162 de ec ed o 3-54 % o p egnan women, while i aemia was ound o be less equen .1, 10, 11, 163 23 In acco dance wi h li e a u e, in his s udy 13 % o p egnan women had ac i e BKPyV 164 eplica ion esul ing in i u ia, bu no i aemia. The possible e ec o BK i us eplica ion 165 du ing p egnancy is no cla i ied. Al hough i al DNA was demons a ed in e al issues 24 he 166 hypo hesis o ansplacen al ansmission was no con i med 10, 11. Recen ly se ological 167 e idence o e ical ansmission o BKPyV was published.9 168 Hi he o, he e a e no p e alence da a abou he no el WU, KI and human 169 polyoma i us 9 du ing p egnancy. Bo ill-Mas e al. in es iga ed 4 u ine samples om 170 p egnan women, bu WU and KI i uses we e no ound. 18 Foe al issues we e also nega i e 171 o WU and KI i uses. 25 In his s udy WU and KI i uses we e no ound in u ine, plasma 172 and espi a o y samples collec ed du ing p egnancy. KIPyV DNA was de ec ed in wo plasma 173 8 samples, bu no in u ine and espi a o y samples om con ol, non p egnan women. The 174 high, 55-90 % se oposi i i y in adul popula ion, and he highe PCR p e alence in samples 175 om child en sugges childhood p ima y KI and WU i us in ec ion. 6, 15 Vi uses we e ound 176 wi h equency 0.4-14 % in a ious samples ypes including espi a o y samples, blood, 177 aeces, ce eb ospinal luid, lymphoid issues and u ine samples, wi h gene ally highe 178 equency in immunocomp omised pa ien s. The possible way o ansmission migh be 179 espi a o y and/o aecal-o al.2, 3, 12-16 The highe PCR p e alence da a o 180 immunocomp omised pa ien s sugges s ha immunosupp ession migh esul in eac i a ion 181 o hese i uses, o migh es ablish highe suscep ibili y o KIPyV and WUPyV in ec ion.1 I 182 was hypo hesized ha simila ly o BKPyV, ansien immunosupp ession due o p egnancy 183 migh esul in highe equency o WU and/o KI i al in ec ions, bu no e idence o i was 184 ound du ing his s udy. Howe e i is impo an o no e, ha i was no a ollow up s udy, 185 samples we e collec ed once andomly du ing p egnancy. 186 Human polyoma i us 9 was desc ibed in 2011.7 Up o now, i al DNA was ound in 187 blood and u ine samples om immunocomp omised pa ien s and skin samples, bu nei he in 188 espi a o y samples om pa ien s wi h espi a o y ailu e no in aeces om child en wi h 189 gas oen e i is.7, 17 Based on hese da a and he ecen ly published 47 % adul hood 190 se oposi i i y 8 , Van Ghelue e al. hypo hesized ha HPyV9 is less equen in he human 191 popula ion6. We ound HPyV9 DNA is all s udied samples om p egnan and non p egnan 192 women wi h equency o 2-6 %. The e was no o no s a is ically signi ican di e ence 193 be ween he PCR p e alence in he espi a o y (2 s. 2 %), u ine (3 s. 2%) and plasma 194 samples (2 s. 6 %) be ween p egnan and non p egnan women. To ou knowledge we 195 published i s HPyV9 p esence in espi a o y samples which may sugges espi a o y 196 ansmission o his i us. In his s udy highe p e alence o HPyV9 was no ound du ing 197 p egnancy, bu he i al loads we e no examined which migh ha e been di e en . Since 198 9 mo he o oe us ansmission o polyoma i uses BK and JC a e sugges ed, his way o 199 ansmission canno excluded in case o he no el WUPyV, KIPyV and HPyV9. E en i his 200 s udy could no suppo e idence o highe suscep ibili y o in ec ion by hese i uses, 201 u he , ollow up s udy o p egnan women du ing he whole pe iod o p egnancy migh 202 answe his ques ion. 203 In conclusion, KI and WU i uses we e no ound in u ine, espi a o y and blood 204 samples om p egnan women, while HPyV9 was de ec ed in all sample ypes bu wi h no 205 signi ican ly highe equency hen i was obse ed o non p egnan women. 206 207 Con lic o in e es 208 The au ho s ha e no con lic o in e es . 209 210 Acknowledgemen s 211 We hank Tobias Allande om Ka olinska Ins i u e (Sweden), Da id Wang om 212 Washing on Uni e si y (USA) and Be nha d Ehle s om Robe Koch-Ins i u (Ge many) o 213 p o iding KIPyV, WUPyV and HPyV9 plasmids, espec i ely. This wo k was suppo ed by 214 g an s om he Hunga ian Scien i ic Resea ch Found (OTKA 73145) and by he TÁMOP-215 4.2.2/B-10/1-2010-0024 p ojec which is co- inanced by he Eu opean Union and he Eu opean 216 Social Fund. 217 218 Re e ences 219 1. Jiang M, Abend JR, Johnson SF,Impe iale MJ. The ole o polyoma i uses in human 220 disease. Vi ology 2009; 384(2):266-73. 221 2. Allande T, And easson K, Gup a S, Bje kne A, Bogdano ic G, Pe sson MA, e al. 222 Iden i ica ion o a hi d human polyoma i us. J Vi ol 2007; 81(8):4130-6. 223