Osmotic stress responses of individual white oak (Quercus section, Quercus subgenus) genotypes cultured in vitro

Ou e e ence: JPLPH 51807 P-au ho que y- 9 AUTHOR QUERY FORM Jou nal: JPLPH Please e-mail o ax you esponses and any co ec ions o: E-mail: co ec ions.esch@else ie . homsondigi al.com A icle Numbe : 51807 Fax: +353 6170 9272 Dea Au ho , Please check you p oo ca e ully and ma k all co ec ions a he app op ia e place in he p oo (e.g., by using on-sc een anno a ion in he PDF ile) o compile hem in a sepa a e lis . No e: i you op o anno a e he ile wi h so wa e o he han Adobe Reade hen please also highligh he app op ia e place in he PDF ile. To ensu e as publica ion o you pape please e u n you co ec ions wi hin 48 hou s. Fo co ec ion o e ision o any a wo k, please consul h p://www.else ie .com/a wo kins uc ions. Any que ies o ema ks ha ha e a isen du ing he p ocessing o you manusc ip a e lis ed below and highligh ed by lags in he p oo . Click on he ‘Q’ link o go o he loca ion in he p oo . Loca ion in Que y / Rema k: click on he Q link o go a icle Please inse you eply o co ec ion a he co esponding line in he p oo The e e ence gi en he e is ci ed in he ex bu is missing om he e e ence lis – please make he lis comple e o emo e he e e ence om he ex : ‘Johnson e al. (2002)’. Q1 Please con i m ha gi en names and su names ha e been iden i ied co ec ly. Q2 Re e ence‘Johnsone al.(2002)’isci edin he ex bu no p o ided in he e e ence lis . Please p o ide i in he e e ence lis o dele e he ci a ion om he ex . Please check his box o indica e you app o al i you ha e no co ec ions o make o he PDF ile Thank you o you assis ance. Please ci e his a icle in p ess as: Deme e Z, e al. Osmo ic s ess esponses o indi idual whi e oak (Que cus sec ion, Que cus subgenus) geno ypes cul u ed in i o. J Plan Physiol (2013), h p://dx.doi.o g/10.1016/j.jplph.2013.09.013 ARTICLE IN PRESS G Model JPLPH 51807 1–9 Jou nal o Plan Physiology xxx (2013) xxx– xxx Con en s lis s a ailable a ScienceDi ec Jou nal o Plan Physiology j o u nal homepage: www.else ie .com/loca e/jplph Physiology1 Osmo ic s ess esponses o indi idual whi e oak (Que cus sec ion, Que cus subgenus) geno ypes cul u ed in i o 2 3 Zi a Deme e a, Pé e Kanalasa, Csaba Má héa,∗, Klá a Csekeb, E zsébe Sz˝ oll˝ osia, Q1 Má a M-Ham asa, Ka alin Jámb ika, Zol án Kissa, Ilona Mészá osa,∗ 4 5 aUni e si y o Deb ecen, Facul y o Science and Technology, Depa men o Bo any, PO Box 14, H-4010 Deb ecen, Hunga y6 bHunga ian Fo es Resea ch Ins i u e, PO Box 30/A, H-9600 Sá á , Hunga y7 8 a i c l e i n o 9 10 A icle his o y:11 Recei ed 25 June 201312 Recei ed in e ised o m 11 Sep embe 2013 13 14 Accep ed 22 Sep embe 201315 A ailable online xxx 16 Keywo ds:17 Que cus issue cul u e18 Osmo ic s ess19 Reco e y20 Guaiacol pe oxidase 21 Single-s and p e e ing nuclease22 a b s a c Whi e oaks (Que cus sec ion, Que cus subgenus) a e widely dis ibu ed in Eu ope. Que cus pe aea (ses- sile oak), an economically impo an species is p edic ed o be a ec ed by clima e change. Q. pubescens (pubescen oak) and Q. i giliana (I alian pubescen oak) a e economically less impo an , d ough ol- e an species. F equen hyb idiza ion o whi e oaks was obse ed and cu en ly he in og ession o Q. pubescens and Q. i giliana in non-medi e anean egions o Eu ope has been epo ed. Ou goal was o use issue cul u es es ablished om indi idual ees o he abo e axa and hei pu a i e hyb ids, all p esen in he o es s and o Sík ˝ okú LTER Resea ch A ea (NE Hunga y) as simple expe imen al model sys ems o s udying d ough /osmo ic s ess ole ance. Tissue cul u es a e mo e sui able models o such s udies, han seedlings, because hey a e gene ically iden ical o he pa en plan s. Polye hylene glycol (PEG6000) ea men s we e used o his pu pose. The iden ifica ion o axa was based on lea mo phological ai s and mic osa elli e analysis and showed ha Q. pe aea is gene ically dis inc o all o he axa examined. We es ablished six callus lines o Que cus. As expec ed, in Q. pe aea cul u es PEG6000 induced se e e loss o esh weigh and he abili y o eco e a e emo al o he osmo icum, which was no cha ac e is ic o Q. pubescens and Q. i giliana. Pu a i e hyb ids exhibi ed an in e media e esponse o osmo ic s ess. Ac i i y gels showed he inc ease o single-s and p e e ing (SSP) nuclease and no significan change o guaiacol-pe oxidase ac i i ies in d ough -sensi i e geno ypes/cul u es and no significan inc ease o SSP nuclease ac i i ies accompanied wi h inc eases o guaiacol-pe oxidase ac i i ies in d ough - ole an ones. This indica es ha d ough /osmo ic s ess ole ance is associa ed o inc eased capaci y o sca eng- ing eac i e oxygen species and hence less suscep ibili y o DNA damage. Ou esul s confi m ha issue cul u es o oak a e sui able model sys ems o s udying d ough /osmo ic s ess esponses. © 2013 Published by Else ie GmbH. In oduc ion 23 Oaks (Que cus spp.) a e widesp ead in Eu ope and play an24 impo an ecological and sil icul u al ole. High gene ic and mo -25 phological a iabili y has been epo ed o he Que cus sec ion 26 (=Lepidobalanus; o whi e oaks sensu Nixon, 1993) o he Que -27 cus subgenus (He zog, 1996; Gailing e al., 2007). The h ee main28 whi e oak species a e Que cus obu L., Q. pe aea (Ma .) Liebl and29 Q. pubescens Willd. Se e al o he oak axa ha e also been dis- 30 inguished om he Eu opean b oadlea ed o es s, o which Q.31 dalechampii Ten., Que cus polyca pa Schu , and Q. i giliana Ten.32 a e impo an . The wo o me ones esemble o Q. pe aea sensu33 s ic o and a e usually included in he agg ega e o Q. pe aea sensu34 ∗Co esponding au ho . Tel.: +36 52512900; ax: +36 52512943. E-mail add esses: [email p o ec ed] (C. Má hé), [email p o ec ed] (I. Mészá os). la o, while Q. i giliana belongs o he agg ega e o Q. pubescens 35 sensu la o (Schwa z, 1936a,b; Bo dács e al., 2002). In e specific 36 hyb idiza ion is e y common be ween whi e oak species (Cu u 37 e al., 2007; Lepais e al., 2009; Sal ini e al., 2009; Lepais and 38 Ge be , 2011) which inc eases he gene ic di e si y in na u al pop- 39 ula ions (Bo o ics e al., 1998; Gömö y and Schmid o á, 2007; 40 Kanalas e al., 2008). 41 Eu opean whi e oaks di e in he p e e ence o ecological con- 42 di ions and g ow in a ious habi a s. The dis ibu ion o oaks is 43 mos ly dependen on hei capaci y o esis d ough o excess o 44 wa e in he soil o e en he wo phenomena successi ely (Jones, 45 1959; Johnson e al., 2002). Among he h ee main whi e oak species Q246 Q. pubescens is he mos d ough ole an one and occupies wa m 47 and xe ic si es in Eu ope (Bo o ics e al., 1998; Yu uko and Zhele , 48 2001; Thomas e al., 2002; Gallé e al., 2007; Siam e al., 2009). Q. 49 pe aea g ows p edominan ly on mesic o ela i ely d y si es on 50 lowe al i ude slopes and idges, whe eas Q. obu can popula e 51 lowland si es wi h we and empo a ily wa e logged soils (Jones, 52 0176-1617/$ – see on ma e © 2013 Published by Else ie GmbH. h p://dx.doi.o g/10.1016/j.jplph.2013.09.013 Please ci e his a icle in p ess as: Deme e Z, e al. Osmo ic s ess esponses o indi idual whi e oak (Que cus sec ion, Que cus subgenus) geno ypes cul u ed in i o. J Plan Physiol (2013), h p://dx.doi.o g/10.1016/j.jplph.2013.09.013 ARTICLE IN PRESS G Model JPLPH 51807 1–9 2Z. Deme e e al. / Jou nal o Plan Physiology xxx (2013) xxx– xxx Table 1 Iden i y o Que cus axa used in his s udy, based on 16 lea quan i a i e ai s measu ed acco ding o Bo o ics (2000) and Kanalas e al. (2008, 2009). Explan code numbe Iden i y A149 Q. pe aea D137 Q. pe aea × Q. dalechampii D89 Q. pe aea × Q. pubescens A211 Q. i giliana × Q. polyca pa B50 Q. i giliana A75 Q. pubescens 1959; Aas, 1998). Q. dalechampii Ten. (Theodo opoulos e al., 1995)53 and Que cus polyca pa Schu (Ma ula, 2009) a e dis inc om Q.54 pe aea sensu s ic o in ecological equi emen s. Bo h a e mo e55 d ough ole an and g ow in wa me si es. Q. dalechampii Ten.56 and Q. i giliana ha e been desc ibed om a id si es o sou he n57 Eu ope (Ofle ea e al., 2011). Those oak species o hei hyb ids58 ha a e mo e capable o s and d y and ho summe pe iods could59 be impo an ools o he u u e o es y as global wa ming and60 equen d ough e en s a e p edic ed o inc ease he p essu es o61 Eu opean oak o es s (IPCC, 2007). 62 In Hunga y mixed o es s o sessile oak and Tu key oak (Que ce-63 um pe aeae-ce is) co e he la ges pa o o es ed a ea. The64 Sík ˝ okú Long- e m Ecological Resea ch Si e (LTER) (Bükk Moun-65 ains, no h-eas e n Hunga y) ep esen s his o es ype (Jakucs,66 1985) and has in e na ional epu a ion as a o me IBP and MAB67 a ea and cu en LTER Eu ope ne wo k membe . The a ea is si ua ed68 in he ansi ion be ween o es and o es -s eppe zone (47◦55N,69 20◦26E, 320–340 m a.s.l.) and is ulne able o he clima e change70 (Mészá os e al., 2007). In ense o es moni o ing esea ch has been71 unning o 40 yea s in he si e. The o es s and is cu en ly cha ac- 72 e ized by he dominance o axa om Que cus sec ion and Q. ce is73 (Mészá os e al., 2007; Kanalas e al., 2008, 2009). Based on lea 74 mo phological ai s he assignmen o ees o whi e oak species75 showed ha his o es s and is mos ly composed o Q. pe aea76 senso s ic o (70.2%). 1% o sampled ees was assigned o Q. poly-77 ca pa, 2.5% was assigned o Q. i giliana and 4% was assigned o78 Q. pubescens. 22, 3% o ees we e conside ed as pu a i e hyb ids:79 Q. pe aea × Q. dalechampii (5.1%), Q. pe aea × polyca pa (2.5%), Q.80 pe aea × Q. pubescens (5.6%), Q. pe aea × Q. i giliana (7.1%) and81 Q. i giliana × Q. pubescens (2%) (Kanalas e al., 2008, 2009). The82 pe cen age o hyb ids is ela i ely high as compa ed o oak commu-83 ni ies om o he Eu opean egions (see Cu u e al., 2007; Guge li84 e al., 2007 o examples). The oak decline obse ed in he 1980s85 in Eu ope app oached his si e oo, he die-back o ees occu ed86 p ima ily in popula ion o Que cus pe aea sensu la o. 87 Plan issue cul u e echniques including callus and cell sus-88 pension cul u es o e many ad an ages – e.g. hey p o ide ully89 con ollable sys ems – o physiological/biochemical s udies. Con-90 sequen ly hey we e applied o oak species as well, e.g. o s udying91 he ole o ABA in he ma u a ion o Q. ilex emb yos (Mau i and92 Manzane a, 2004) o o dehyd in p o eins in Q. obu soma ic93 emb yos (ˇ Sunde líko á e al., 2009). E en hough in i o cul u es94 ep esen di e en de elopmen al s ages and gene exp ession pa -95 e ns han ma u e plan s, cell and callus cul u es o sessile oak and96 peduncula e oak p o ed o be excellen models and a e cu en ly97 used o he s udy o osmo ic s ess- ela ed ansc ip ional changes 98 and o he physiological esponses. They a e hough o be sui able99 o physiological s udies a issue, cell and molecula le el (Gleeson100 e al., 2004; Po h e al., 2005; ˇ Sunde líko á e al., 2009).101 In ou s udy we ha e selec ed ees o se e al pu a i e 102 d ough -sensi i e and - ole an axa belonging o Que cus sec ion103 co-occu ing in he o es s and o Sík ˝ okú P ojec LTER si e (Jakucs,104 1985) o es ablishing in i o cul u es (Table 1). Wha could be he105 impo ance o issue cul u es in his espec ? Ins ead o s udying 106 he e ec o en i onmen al s ess in ma u e ees we can examine107 physiological esponses in in i o cul u es unde con olled condi- 108 ions. In i o cul u es es ablished om ege a i e issues a e mo e 109 likely o eflec he gene ic backg ound o o iginal plan s/explan s, 110 han e.g. seedlings wi h unce ain gene ic o igin. Ou p incipal aim 111 was o s udy d ough /osmo ic s ess ole ance o di e en oak 112 geno ypes in a model – in i o cul u e sys em. Fo his pu pose, 113 we needed o es ablish a p ocedu e o c ea ing s able issue cul- 114 u es since he e we e no li e a u e da a o cul u e eady- o-use 115 o hose oak geno ypes. The use o axenic cul u es allowed us o 116 a oid po en ial supe imposing e ec s o mul iple en i onmen al 117 condi ions. 118 Pe oxidases (E.C. 1.11.1.7) play a ole in he sca enging o eac- 119 i e oxygen species (ROS) known o ele a ed le els du ing d ough . 120 The p esence o sca enging sys ems is a good indica o o d ough 121 ole ance (Reddy e al., 2004). In he absence o p o ec ion agains 122 oxida i e s ess, DNA and RNA damage occu s. This may be accom- 123 panied by inc eases in he ac i i y o nucleases, among hem, single 124 s and p e e ing (SSP) nucleases (EC 3.1.30.1) (Reddy e al., 2004; 125 Roldán-A jona and A iza, 2009). The e o e, we s udied PEG6000 126 induced changes in s ess enzyme – pe oxidase, nuclease – ac i - 127 i ies ha accompanied al e a ions o esh weigh and eco e y o 128 oak issue cul u es. PEG6000 is widely used o modeling osmo ic 129 s ess in highe plan s, due o minimal side-e ec s and he incapa- 130 bili y o plan cells o me abolize i (see Hohl and Schop e , 1991; 131 Guó h e al., 2010 o examples). Ou basic hypo hesis was ha 132 osmo ic s ess esponses will be di e en o in i o cul u es es ab- 133 lished om explan s de i ed om indi iduals o d ough sensi i e 134 (Q. pe aea sensu s ic o) om hose o d ough ole an species (Q. 135 pubescens, Q. i giliana). Since Q. dalechampii is closely ela ed o Q. 136 pe aea (Bo o ics e al., 1998), hus he sensi i i y o d ough o is- 137 sue cul u es o indi iduals ep esen ing hyb ids be ween hem (Q. 138 pe aea × Q. dalechampii) was expec ed o be close o d ough sen- 139 si i e Q. pe aea. In con as , cul u es o Q. i giliana × Q. polyca pa 140 hyb ids we e expec ed o be mo e ole an o osmo ic s ess han Q. 141 polyca pa, due o he highe d ough ole ance o Q. i giliana pa - 142 en . Cul u es o Q. pe aea × Q. pubescens hyb id we e p esumably 143 in e media y be ween he wo pa en s wi h espec o d ough ol- 144 e ance. I in i o expe imen s confi m he expec ed esponses o 145 indi iduals o non-hyb id axa (i.e. d ough sensi i i y o Q. pe aea 146 and ole ance o Q. pubescens and Q. i giliana), hey can be used o 147 es ing o cul u es de i ed om Que cus geno ypes (e.g. pu a i e 148 hyb ids) wi h unknown d ough sensi i i y. 149 The main goal o his s udy was o o e a model sys em based 150 on in i o cul u es o selec ed indi idual whi e oak ees o he 151 es ima ion o hei geno ype-dependen d ough ole ance. 152 Ma e ials and me hods 153 Plan ma e ial and issue cul u e 154 Plan ma e ial was collec ed in he oak o es o Sík ˝ okú 155 Resea ch A ea, No h-Eas e n Hunga y (47◦55N, 20◦26E, 156 320–340 m a.s.l.) in ea ly sp ing be o e lea flush. Young (2–4 157 yea s old) shoo s we e cu om he lowe canopy o 105–110 158 yea s old ma u e ees o Que cus pe aea (Ma uschka) Lieblein, 159 Q. pubescens Willd., Q. i giliana Ten. and o pu a i e hyb ids 160 and ans e ed o labo a o y. Each explan was collec ed om 161 a selec ed single ee pe geno ype lis ed in Table 1 and used 162 o es ablishmen o issue cul u e and subsequen physiological 163 expe imen s. All explan s o igina ed om he same ecological 164 condi ions. A e collec ion shoo s we e kep unde condi ions 165 o 22 ± 2◦C, 20 ␮mol m−2s−1PFD and 12/12 h pho ope iod un il 166 he de elopmen o young lea es (12 ± 4 mm leng h). These 167 young lea es we e used as explan s o he induc ion o issue 168 cul u es. The induc ion and main enance o callus p oduc ion 169 Please ci e his a icle in p ess as: Deme e Z, e al. Osmo ic s ess esponses o indi idual whi e oak (Que cus sec ion, Que cus subgenus) geno ypes cul u ed in i o. J Plan Physiol (2013), h p://dx.doi.o g/10.1016/j.jplph.2013.09.013 ARTICLE IN PRESS G Model JPLPH 51807 1–9 Z. Deme e e al. / Jou nal o Plan Physiology xxx (2013) xxx– xxx 3 Table 2 Key pa ame e s o he SSR ma ke s used o mic osa elli e analysis o whi e oak ees used in his s udy. SSR p ime pai Repea mo i P ime sequence No. o alleles/ no. o ees Obse ed he e ozygosi y Re e ence o he me hod o mic osa elli e analysis ZAG1/5 F (GT)5(GA)9 GCTTGAGAGTTGAGATTTGT 7/6 0.500 S einkellne e al. (1997) ZAG1/5 R GCAACACCCTTTAACTACCA ZAG 9 F (AG)12 GCAATTACAGGCTAGGCTGG 7/6 0.833 S einkellne e al. (1997) ZAG 9 R GTCTGGACCTAGCCCTCATG ZAG 110 F (AG)15 GGAGGCTTCCTTCAACCTACT 9/6 1.000 S einkellne e al. (1997) ZAG 110 R GATCTCTTGTGTGCTGTATTT ZAG 11 F (TC)22 CCTTGAACTCGAAGGTGTCCTT 4/6 0.833 Kamp e e al. (1998) ZAG 11 R GTAGGTC A AAACCATTGGTTGACT ZAG 96 F (TC)20 CCCAGTCACATCCACTACTGTCC 7/6 1.000 Kamp e e al. (1998) ZAG 96 R GGTTGGGAAAAGGAGATCAGA ZAG 112 F (GA)32 TTCTTGCTTTGGTGCGCG 2/6 0.167 Kamp e e al. (1998) ZAG 112 R GTGGTCAGAG ACTCGGTAAGTATTC was achie ed on WPM medium (Woody Plan Medium, Lloyd 170 and McCown, 1980) solidified wi h 0.8% (w/ ) aga (Di co,171 Law ence, KS, USA). The plan g ow h egula o s (PGRs) used we e 172 0.05–4 mg L−1(0.53–21.5 ␮M) ␣-naph haleneace ic acid (NAA)173 and 0.05–1 mg L−1(0.25–0.5 ␮M) indole-3-bu y ic acid (IBA) as174 auxins and 0.1–4 mg L−1(0.44–17.7 ␮M) N6-benzyladenine (BA) as175 a cy okinin. All PGRs we e om Sigma–Ald ich, Budapes , Hunga y.176 The design o PGR con en o issue cul u e media was based on177 he me hods o Seckinge e al. (1979), Tanaka e al. (1995), Cuenca178 e al. (1999) and To ibio e al. (2004). G ow h condi ions o in i o 179 cul u e we e: 14/10 h pho ope iod wi h a pho on fluence a e180 o 10 ␮mol m−2s−1du ing he ligh pe iod and empe a u es o 181 22 ± 2◦C/18 ± 2◦C.182 De e mina ion o axonomical s a us o whi e oak indi iduals by 183 lea mo phological ai s184 Lea mo phological ai s we e assessed in all ees selec ed o 185 es ablishmen o in i o cul u es in a o me comp ehensi e ax-186 onomic su ey o 198 whi e oak ees in he o es s and (Kanalas187 e al., 2008, 2009). B iefly, in his su ey fi e lea es we e collec ed188 om he lowe canopy o ees. Al oge he means o 16 lea quan- 189 i a i e ai s we e used in nume ic classifica ion analysis wo ked190 ou p e iously o each axon (Bo o ics, 2000; Kanalas e al., 2008,191 2009). This analysis allowed o classi y he indi idual ees as oak 192 species sensu s ic o and hyb ids.193 Mic osa elli e (SSR) analysis 194 Fo DNA ex ac ion win e bud samples o he indi idual ees195 lis ed in Table 1 we e used. A e g inding wi h liquid ni ogen he196 ex ac ion was ca ied ou by he Qiagen Plan Mini Ki (BioMa ke , 197 Gödöll˝ o, Hunga y). DNA concen a ion o ex ac s was checked by198 gel elec opho esis on a 0.5% aga ose (Ro h Ro i®ga ose NEEO, RK199 Tech, Budapes , Hunga y) gel. Polyme ase chain eac ions we e pe -200 o med wi h he ollowing SSR ma ke s (fluo escen dyes a he 201 5-ends a e indica ed in b acke s): ZAG 1/5 (6-FAM), ZAG 9 (6-FAM),202 ZAG 110 (HEX) (S einkellne e al., 1997), ZAG 11 (TET), ZAG 96203 (TET), ZAG 112 (HEX) (Kamp e e al., 1998). Key pa ame e s o 204 SSR ma ke s a e p esen ed in Table 2. PCR mas e mixes and op i- 205 malisa ion p ocedu es we e made up acco ding o S einkellne e al.206 (1997) and Kamp e e al. (1998) and comp ised he ollowing com-207 ponen s o 15 ␮L final eac ion olume: 5× bu e (P omegaGoTaq208 Flexi) 4 ␮L; MgCl21 mM (0.6 ␮L) in case o ma ke s ZAG 1/5 and209 ZAG 9, 2 mM (1.2␮L) in case o he o he ma ke s; P ime F and210 R (Ro h Ro i®ga ose NEEO, RK Tech, Budapes , Hunga y): 0.25 pM211 (0.375 ␮L) each o ZAG 9, 0.75 pM (1.125 ␮L) o ZAG 1/5 and212 0.34pM (0.5 ␮L) o he emaining ma ke s; dNTPmix (P omega213 10 mM) 0.4 ␮L; polyme ase enzyme (P omegaGoTaq Flexi) 0.4 U;214 DNA sample 1 ␮L (app ox. 10 ng/␮L). Fo he PCRs an Eppendo 215 Mas e cycle G adien he mocycle was used wi h he ollowing 216 p og am: in case o ZAG 1/5 and ZAG 9 ini ial dena u a ion 95◦C217 15 min, dena u a ion 95◦C 50 s, p ime annealing 55◦C/ZAG 9 and 218 65◦C/ZAG 1/5 50 s, elonga ion 72◦C 1 min 45 s, epe i ion o las 219 h ee s eps in 35 cycles, final elonga ion 72◦C 10 min. In case o he 220 o he ou ma ke s: ini ial dena u a ion 95◦C 15 min, dena u a ion 221 95◦C 30 s, p ime annealing 50◦C 30 s, elonga ion 65◦C 1 min 30 s, 222 epe i ion o las h ee s eps in 35 cycles, final elonga ion 65◦C223 15 min. F agmen analyses we e ca ied ou by an ABI P ism 310 224 gene ic analyse (Applied Biosys ems Li e Technologies, Budapes , 225 Hunga y) in mul iplexed uns. C ma ix se and TAMRA 500 size 226 s anda d we e applied (Applied Biosys ems Li e Technologies). The 227 e alua ion o agmen sizes was done by he GeneMappe so - 228 wa e. 229 The aw geno ype da a se wi h he SSR agmen leng h sizes 230 was analyzed by he GenAlEx 6.4 (Peakall and Smouse, 2006) pop- 231 ula ion gene ic so wa e. The gene ic dis ances be ween pai s o 232 indi iduals we e calcula ed based on he sha ed alelle equen- 233 cies. The gene ic ela ionship among samples was ep esen ed on a234 dend og am cons uc ed wi h he unweigh ed pai -g oup a e age 235 amalgama ion me hod (UPGMA) (Snea h and Sokal, 1973). Fo his 236 pu pose he Clus e Analyses op ion o S a is ica 6.0 so wa e was 237 used. 238 PEG ea men s and eco e y expe imen s 239 Callus cul u es we e g own on solidified WPM medium (see 240 Resul s sec ion o PGR con en ). They we e ans e ed on liq- 241 uid medium o he same composi ion (2 mL cul u e medium in 242 10 mL s e ile plas ic flasks, Labsys em, Budapes , Hunga y) and 243 ea ed o 24 h wi h 0, 5, 10, 20 and 40% (w/ ) polye hylene gly- 244 col 6000 (PEG6000, VWR, Leu en, Belgium). PEG6000 solu ions 245 co esponded o osmo ic po en ials o −0.05, −0.15, −0.49 and 246 −1.75 MPa. Du ing ea men s wi h he osmo icum, cul u es we e 247 gen ly shaken (100 pm) on a o a o y shake (E. Bühle KS-15, E. 248 Bühle GmbH, Hechingen, Ge many). F esh weigh (FW) o calli 249 was measu ed a he s a and he end o PEG6000 ea men s 250 by means o an analy ical balance (Model AA 200 DS, accu acy 251 ±10 ␮g, Den e Ins umen Co., A ada). FW was in he ange o 252 20–50 mg. Be o e FW measu emen a he s a o expe imen s, 253 excess liquid medium was emo ed by gen le cen i uga ion wi h- 254 ou a ec ing callus g ow h and iabili y (1000 pm, 5 s on a He aeus 255 Bio uge, Kend o Labo a o y P oduc s, Ha au, Ge many). Enzyme 256 ac i i ies (see below) we e measu ed di ec ly a e ea men s 257 wi h he osmo icum. Pe cen age o FW inc ease was calcula ed 258 on he basis o he di e ence be ween FW a he end and a he 259 s a o expe imen s. Reco e y expe imen s we e pe o med as ol- 260 lows: ollowing PEG6000 ea men s, cul u es om PEG con aining 261 Please ci e his a icle in p ess as: Deme e Z, e al. Osmo ic s ess esponses o indi idual whi e oak (Que cus sec ion, Que cus subgenus) geno ypes cul u ed in i o. J Plan Physiol (2013), h p://dx.doi.o g/10.1016/j.jplph.2013.09.013 ARTICLE IN PRESS G Model JPLPH 51807 1–9 4Z. Deme e e al. / Jou nal o Plan Physiology xxx (2013) xxx– xxx medium we e washed ou wo imes by gen le shaking (100 pm)262 in he p esence o liquid cul u e medium lacking he osmo icum263 ollowed by u he cul u e on aga -solidified medium o 30 days.264 F esh weigh o eco e ed calli was also measu ed as desc ibed ea -265 lie . Beside FW measu emen s a he s a and end o cul u e pe iod,266 he p esence o iable, g een callus issue a he end o cul u e was267 moni o ed as well.268 SSP nuclease ac i i y gels269 The ac i i y o SSP nucleases (EC 3.1.30.1) was assayed on270 polyac ylamide gels, basically as desc ibed be o e (Jámb ik e al.,271 2011). In b ie , PEG6000 ea ed calli we e ex ac ed wi h 10 mM272 T is–HCl (Sigma–Ald ich, Budapes , Hunga y), pH 8.0, 150 mM273 NaCl (Reanal, Budapes , Hunga y), 14.6 mM 2-me cap oe hanol274 (Sigma–Ald ich) and 2% (w/ ) poly inyl-py olidone (PVP, Me ck,275 Da ms ad , Ge many). P o ein ex ac s (20 ␮g/well) we e loaded276 on SDS- and single-s anded DNA con aining polyac ylamide gels277 along wi h a molecula weigh ma ke (Sigma–Ald ich). P o ein278 con en o ex ac s was de e mined acco ding o B ad o d (1976). 279 A e ena u a ion o enzymes, gels we e incuba ed in T is–HCl, pH280 6.8 (14 h, 39◦C) o assaying hei ac i i y, s ained wi h 0.5 ␮g mL−1 281 e hidium b omide (Sigma–Ald ich, Budapes , Hunga y) and exam-282 ined wi h an UV ansillumina o . SSP nuclease ac i i ies appea ed283 as clea bands, no s ained wi h e hidium–b omide. To al nuclease284 ac i i ies on gels we e quan ified wi h he aid o CpA las®so wa e285 and exp essed as ela i e band in ensi ies, whe e he alue o con-286 ol ac i i ies was 1. The molecula weigh o ssDNase isoenzymes287 was es ima ed wi h he UVI-TEC®so wa e.288 Pe oxidase ac i i y gels289 PEG6000 ea ed calli we e ex ac ed a 4◦C wi h a bu e 290 con aining 100 mM KH2PO4/K2HPO4(VWR In e na ional L d.,291 Deb ecen, Hunga y), pH 7.2, 8 mM MgCl2(Reanal, Budapes ,292 Hunga y), 4 mM di hio h ei ol (DTT, Sigma–Ald ich), 1% ( / ) T i-293 on X-100 (Reanal), 2% (w/ ) PVP (Me ck). A e cen i uga ion ( wo 294 imes o 30 min) a 15,000 × g wi h a He aeus Bio uge, p o ein295 con en o supe na an s was assayed by he me hod o B ad o d296 (1976). 10 ␮g p o ein was loaded on o each well o na i e 7.5%297 (w/ ) polyac ylamide gels. Elec opho esis was pe o med a 4◦C,298 ollowed by gel s aining o 30–60 min in a bu e con aining299 100 mM sodium ace a e (VWR), 10% ( / ) hyd ogen pe oxide and300 1 mM guaiacol. Pe oxidase (E.C. 1.11.1.7) ac i i y was isible due301 o da k-colo ed e aguaiacol bands (Dixi e al., 2011). Guaiacol-302 pe oxidase ac i i ies we e quan ified wi h he aid o CpA las® 303 so wa e, and exp essed as o SSP nucleases.304 Da a analysis305 All expe imen s we e pe o med a leas ou imes wi h six306 pa allel callus samples pe expe imen o each geno ype and ep-307 esen a i e da a a e p esen ed in he Resul s sec ion. The mean ± SE308 o quan i a i e da a was calcula ed and plo ed wi h he aid o 309 Sigma Plo 10.0 so wa e, whe e i was app op ia e. Plo s ep e-310 sen mean ± SE alues o di e en calli/ he espec i e indi idual311 geno ype. Quan i a i e da a we e subjec ed o s a is ical analysis 312 by wo-way ANOVA. This in ol ed All Pai wise Mul iple Compa i- 313 son P ocedu es (Holm-Sidak me hod) wi h an o e all significance314 le el o 0.05. This me hod allowed o analyze he e ec s o PEG con-315 cen a ions wi hin a single geno ype as well as di e ences be ween316 geno ypes wi hin a single PEG concen a ion. Di e ences we e con- 317 side ed significan a P < 0.05. Fig. 1. Clus e dend og am showing gene ic dis ances be ween Que cus axa in ol ed in his s udy. Resul s 318 Gene ic ela ionships be ween Que cus explan s s udied 319 Explan s used in his s udy o igina ed om six indi idual 320 ma u e ees om he Que cus (=Lepidobalanus) sec ion co- 321 occu ing a he Sík ˝ okú Resea ch Si e (Bükk M s., Hunga y). Lea 322 mo phological ai s o he indi idual ees we e s udied in o de 323 o es ima e hei axonomical iden i y. Based on his, we iden i- 324 fied h ee non-hyb id and h ee hyb id axa (Table 1). In o de 325 o es ima e he gene ic ela edness o selec ed ees a mic osa el- 326 li e analysis was applied. Then gene ic dis ances we e calcula ed 327 be ween indi iduals based on he sha ed allele con en o mul ilo- 328 cus geno ypes de i ed om he six SSR loci analyzed (Fig. 1). This 329 e ealed ha A149 (Q. pe aea) is gene ically dis inc o all o he 330 indi iduals examined, including A75 (Q. pubescens) and B50 (Q. i - 331 giliana). D89, a pu a i e Q. pe aea × Q. pubescens hyb id and A211, 332 a pu a i e hyb id be ween Q. i giliana and Q. polyca pa, appea ed 333 o be in he same clus e wi h B50 and A75. D137, a pu a i e hyb id 334 be ween Q. pe aea and Q. dalechampii was gene ically dis an o 335 A149 and appea ed o be in he same clus e , bu a a ela i ely 336 high dis ance o all o he indi iduals (Fig. 1). 337 The es ablishmen and main enance o issue cul u es om whi e 338 oak explan s 339 We ha e induced and s abilized callus cul u es o he fi s ime 340 om six Que cus geno ypes o igina ing om Sík ˝ okú Resea ch 341 A ea (Table 1). A wide ange o g ow h egula o concen a ions 342 was es ed (see Ma e ials and me hods sec ion). Calli appea ed a e 343 30 ± 3 days o cul u e o young lea explan s. PGR combina ions o 344 callus induc ion and main enance as well as emb yogenesis and 345 o ganogenesis we e geno ype dependen (da a no shown). This is 346 a gene al ule o issue cul u es o ela ed, bu gene ically di e en 347 plan axa (see Duncan e al., 1985; Má hé e al., 2012 o exam- 348 ples). Howe e , we ha e ound a PGR combina ion, whe e all callus 349 samples o igina ing om di e en oak geno ypes we e o simila 350 mo phology (undi e en ia ed s a e), g ow h a e and iabili y. This 351 was WPM medium con aining 4 mg L−1NAA and 0.5 mg L−1BA. A 352 his PGR con en , g ow h o all s able cul u es p o ed o be con- 353 s an since hey we e ini ia ed (a ime pe iod o a leas one yea ), 354 he e o e hey we e sui able o osmo ic s ess expe imen s. 355 I is wo h men ioning, ha we could no es ablish an e ficien 356 mic op opaga ion sys em (i.e. mass plan egene a ion wi hou an 357 in e media y callus s age) om he a o emen ioned oak geno ypes. 358 Howe e he choose o PGRs (NAA and BA ins ead o 2,4-d and359 kine in) excluded somaclonal a iabili y du ing callus induc ion 360 Please ci e his a icle in p ess as: Deme e Z, e al. Osmo ic s ess esponses o indi idual whi e oak (Que cus sec ion, Que cus subgenus) geno ypes cul u ed in i o. J Plan Physiol (2013), h p://dx.doi.o g/10.1016/j.jplph.2013.09.013 ARTICLE IN PRESS G Model JPLPH 51807 1–9 Z. Deme e e al. / Jou nal o Plan Physiology xxx (2013) xxx– xxx 5 Fig. 2. The e ec o PEG concen a ion on esh weigh changes o calli wi h di e - en axonomic/gene ic o igin. Cul u es we e g own on WPM medium con aining 4 mg L−1NAA and 0.5 mg L−1BA. (A) FW changes a e PEG ea men s; (B) FW changes du ing eco e y o PEG ea ed calli. Mean ± SE alues o di e en calli/ he espec i e indi idual geno ype a e plo ed. As e iscs ep esen significan di e - ences be ween PEG ea men s o a single geno ype, while le e codes ep esen di e ences be ween callus lines wi hin a single PEG ea men . Di e ences we e conside ed o be significan a P < 0.05. and main enance, hus callus cul u es p o ed o be sui able o 361 osmo ic s ess expe imen s. 362 The e ec s o PEG6000 on wa e loss and eco e y o Que cus363 callus cul u es364 Two-way ANOVA e ealed ha he e was a significan ela ion-365 ship (P < 0.05) be ween he geno ype o indi idual oak ees and he366 e ec s o PEG ea men s conce ning all physiological pa ame e s367 (g ow h, eco e y and enzyme ac i i ies) s udied (Figs. 2–5).368 The measu emen o FW a e ea men wi h he osmo icum369 e ealed ha o A149, significan wa e loss occu ed a 10% 370 PEG6000 and inc eased p og essi ely and significan ly as PEG6000371 concen a ions inc eased. In con as , A75 and B50 we e ole an 372 o osmo ic ea men and significan wa e loss occu ed only a 373 40% PEG6000 (Fig. 2A). Pu a i e hyb ids we e in e media e wi h 374 espec o he e ec s o he osmo icum: wa e loss occu ed a 20%375 PEG6000 and inc eased a 40% PEG6000 (Fig. 2A). A eco e y a e 376 osmo ic s ess, changes o FW showed ha o A149, callus g ow h377 was sligh ly s imula ed by 10% PEG6000, bu inhibi ed significan ly 378 a highe concen a ions, while o A211 and B50 he e was a an-379 sien s imula ion a 5–10% PEG6000 (Fig. 2B). A e washou o he380 osmo icum he e was a significan inhibi ion in he g ow h o A211 381 calli p e ea ed wi h 40% PEG6000 and p e ea men wi h 20–40% 382 PEG6000 inhibi ed he g ow h o B50 calli. Thus he e was no eco - 383 e y in hese cases. In case o cul u e lines D137, D89 and A75, he e384 was a gene al inhibi ion o callus g ow h by PEG6000 (Fig. 2B).385 S a is ical analysis o da a e ealed ha PEG6000 induced wa e 386 loss o A75 calli was significan ly di e en o all o he callus lines.387 Pai wise compa ison showed significan di e ences in PEG6000 388 induced wa e loss be ween A149, B50 and A211 only a highe 389 (20–40%) concen a ions (Fig. 2A). Conce ning callus g ow h du - 390 ing eco e y expe imen s, al hough significan di e ences we e 391 obse ed be ween callus lines a ce ain PEG6000 concen a ions 392 (Fig. 2B), significan ly highe g ow h a e o A75 and B50 calli as 393 compa ed o lines A149, D137, D89 and A211 was no de ec ed. 394 Conce ning he p esence o iable, compac , g een callus issue 395 du ing eco e y expe imen s, we ha e made he ollowing obse - 396 a ions. Fo A149 (Q. pe aea), his ype o issue was no p esen a 397 p e ea men wi h 10–40% PEG6000: i was eplaced by nec o ic- 398 like, b owning issue ha sugges ed he accumula ion o phenolic 399 compounds as a s ess eac ion (Fig. 3). In con as , o A75 (Q. 400 pubescens) and B50 (Q. i giliana), issue iabili y pe sis ed e en 401 a 40% PEG (Fig. 3). D89 as a pu a i e hyb id be ween Q. pe aea 402 and Q. pubescens, was in e media e in his espec : callus iabili y 403 was los only a 20–40% PEG. The pu a i e hyb ids D137 and A211 404 beha ed simila ly o A75 and B50 (Fig. 3). 405 Osmo ic s ess- ela ed enzyme ac i i ies 406 Ac i i y gels e ealed ha SSP nuclease isoenzyme(s) wi h 407 molecula weigh (s) in he ange o 45–55 kDa we e p esen and 408 ac i e in all cul u e lines. One dominan band o 50 kDa was 409 de ec ed (Fig. 4A). In con ol cul u es, his ac i i y was weake 410 in lines A149, D137 and D89 as compa ed o A211, B50 and A75 411 (Fig. 4A). The e ec s o PEG6000 ea men s we e dependen on 412 cul u e line/geno ype. Excep A75 (Q. pubescens) cul u es, osmo ic 413 s ess induced ansien inc eases in nuclease ac i i ies as com- 414 pa ed o con ols, wi h maximal ac i i ies a 5–20% PEG6000. 415 Significan inc eases we e de ec ed o D89 (5–10% PEG6000), A149 416 (10–20% PEG6000) and A211 (20% PEG6000). In case o B50 (Q. i - 417 giliana) he e was only a sligh s imula ion o SSP nuclease ac i i y 418 by PEG (Fig. 4A and B). In case o A75, PEG6000 did no inc ease 419 no ably he enzyme ac i i y, bu a 5–10% PEG6000, wo bands wi h 420 s ong ac i i ies we e de ec able in he molecula weigh ange o 421 50 kDa (Fig. 4A and B). 5–20% PEG6000 induced he appea ance o 422 one addi ional band wi h ela i ely weak ac i i y in case o B50 and 423 A211 (Fig. 4A). 424 Two-way ANOVA e ealed significan di e ences be ween SSP 425 nuclease ac i i ies o PEG6000 ea ed A149 and D137, B50, A75, 426 espec i ely. A 20% PEG, A149 was cha ac e ized by significan ly 427 highe SSP nuclease ac i i y han he es o callus lines. Besides 428 A149, a 10% PEG6000, enzyme ac i i y o A211 was significan ly 429 highe as compa ed o A75 (Fig. 4B). 430 Conce ning guaiacol pe oxidase ac i i ies, one band wi h s ong 431 ac i i y appea ed in all cul u es. PEG6000 dec eased his enzyme 432 ac i i y in A149 (Q. pe aea), al hough his dec ease was no sig- 433 nifican (Fig. 5A and B). A non-significan dec easing e ec was 434 obse ed in he case o pu a i e hyb ids D89 and A211 as well, 435 bu ansien inc eases we e de ec able a 10% and 5–10% PEG6000, 436 espec i ely (Fig. 5A and B). PEG ea men s inc eased guaiacol pe - 437 oxidase ac i i ies in he pu a i e hyb id D137, Q. i giliana (B50) 438 and Q. pubescens (A75) wi h peaks a 5% (D137, B50) and 20% 439 PEG6000 (A75) (Fig. 5A and B). An addi ional band o weak pe - 440 oxidase ac i i y was obse ed in case o D89, A211 and A75. Fo 441 A75, his band was p esen only a e ea men s wi h 20% PEG6000 442 (Fig. 5A). 443 Two-way ANOVA e ealed significan di e ences be ween pe - 444 oxidase ac i i ies o PEG6000 ea ed A149 and D137, B50, A75, 445 espec i ely (Fig. 5B). A 5% PEG6000, he enzyme ac i i y o B50 446 was significan ly highe , han A75. Conce ning o e all e ec s o he 447 osmo icum, pe oxidase ac i i ies o he pu a i e hyb id D89 did no 448 di e significan ly o A149, bu i had significan ly lowe ac i i ies, 449 Please ci e his a icle in p ess as: Deme e Z, e al. Osmo ic s ess esponses o indi idual whi e oak (Que cus sec ion, Que cus subgenus) geno ypes cul u ed in i o. J Plan Physiol (2013), h p://dx.doi.o g/10.1016/j.jplph.2013.09.013 ARTICLE IN PRESS G Model JPLPH 51807 1–9 6Z. Deme e e al. / Jou nal o Plan Physiology xxx (2013) xxx– xxx Fig. 3. Rep esen a i e eco e y expe imen s wi h Que cus issue cul u es o di e en axonomic/gene ic o igin. PEG ea men s we e ollowed by washou o he osmo icum and u he cul u e on a medium supplemen ed wi h 4 mg L−1NAA and 0.5 mg L−1BA. Scale ba : 5 mm. han D137 and B50. A211 had significan ly lowe ac i i ies, han450 B50 and D137 (Fig. 5B). 451 Discussion452 We ha e es ablished six no el s able callus lines om oak geno-453 ypes belonging o he Que cus sec ion (=Lepidobalanus)o Que cus 454 subgenus. These cul u es we e sui able o compa ing di e ences 455 in osmo ic s ess esponses among geno ypes. Based on p e ious456 wo k on he p oduc ion o s able issue cul u es o Q. obu (Cuenca457 e al., 1999; To ibio e al., 2004), we es ablished he p ope cul u e458 media sui able o d ough s ess expe imen s wi h PGR con en o 459 4 mg L−1NAA and 0.5 mg L−1BA.460 Clea dis inc ion om molecula ma ke s be ween Q. pe aea461 and Q. pubescens is o en di ficul (Sal ini e al., 2009). Howe e ,462 mic osa elli e and isoenzyme da a ha e p e iously demons a ed463 ha Q. pe aea and Q. pubescens a e dis inc species, bu c oss-464 ing be ween hem is possible (Samuel e al., 1995; B uschi e al.,465 2000). By applying 6 mic osa elli e loci, in his s udy he selec ed466 Q. pe aea indi idual ee could be clea ly dis inguished om all 467 o he Que cus (=Lepidobalanus) indi iduals, including Q. pubescens468 and pu a i e hyb ids (Fig. 1). Thus, significan gene ic dis ances469 could be obse ed be ween indi iduals cha ac e ized by di e en 470 lea mo phological ai s. This is o pa icula impo ance, since di - 471 e en lea mo phologies o oaks do no necessa ily eflec no able472 gene ic di e ences (Cu u e al., 2007). The clea dis inc ion o Q.473 pe aea o all o he indi iduals s udied was confi med by in i o 474 mo phogenesis expe imen s as well: his indi idual explan could 475 no egene a e oo s, in con as o all o he explan s s udied, whe e 476 e ficien oo p oduc ion was egula ly obse able ( o be published477 elsewhe e). Na i e gels e ealed a single main pe oxidase ac i i y478 band o all cul u e lines. In case o D89, A211 and A75 a mino 479 addi ional band appea ed. In e es ingly, his band was inducible480 by PEG in case o A75, ha is, i was de ec able only du ing osmo ic 481 s ess (Fig. 5A, a owheads). This addi ional band u he suppo ed 482 mic osa elli e da a: in case o he gene ically mo e dis inc lines 483 A149 (Q. pe aea) and D137 i was no p esen , while i appea ed in 484 gene ically ela ed cul u e lines men ioned. In case o SSP nuclease 485 ac i i y pa e ns, in he gene ically ela ed lines A211, B50 and A75, 486 wo bands appea ed a PEG6000 ea men s, bo h in he molecu- 487 la weigh ange o 45–55 kDa (Fig. 4). I should be no ed howe e , 488 ha many nucleases a e glycop o eins and he p esence o absence 489 o glycoside esidues depends on he physiological s a e o cells 490 (Desai and Shanka , 2003). The e o e i is possible ha double 491 bands de ec ed eflec a single p o ein wi h di e en glycosyla ion 492 s a es. 493 D ough /osmo ic s ess, as a significan numbe o abio ic 494 s esses, leads o he inc ease o ROS in plan cells (Mi le , 2002). 495 Resis ance o d ough in ol es an inc eased capaci y o sca - 496 enging ROS h ough supe oxide dismu ases (SOD), ca alases and 497 pe oxidases (Wang e al., 2003). Non-enzyma ic and enzyma ic 498 sca enging mechanisms a e s imula ed du ing summe midday 499 cha ac e ized by high ligh exposu e, empe a u e and wa e defi- 500 ciency in Q. sube (Fa ia e al., 1996). In con as , o d ough and sal 501 sensi i e Q. obu , among ROS sca enging sys ems, only supe ox- 502 ide dismu ase (SOD) ac i i y and isoenzyme pa e n was modified 503 a exposu e o NaCl (Sehme e al., 1995). D ying o ecalci an 504 Q. obu aco ns is leading o he loss o emb yo iabili y, associ- 505 a ed wi h he accumula ion o ROS and low le els o sca enging 506 enzymes (Hend y e al., 1992). In case o a d ough ole an Q. obu 507 geno ype, ele a ed le els o ROS sca enging enzyme (SOD, asco - 508 ba e pe oxidase, ca alase, dehyd oasco ba e educ ase, glu a hione 509 educ ase) ac i i ies we e de ec ed (Schwanz and Polle, 2001). In 510 he absence o a p ope sca enging capaci y, cellula s uc u es and 511 mac omolecules including DNA (single s and b eaks) a e signifi- 512 can ly damaged (Reddy e al., 2004). Following oxida i e damage 513 Please ci e his a icle in p ess as: Deme e Z, e al. Osmo ic s ess esponses o indi idual whi e oak (Que cus sec ion, Que cus subgenus) geno ypes cul u ed in i o. J Plan Physiol (2013), h p://dx.doi.o g/10.1016/j.jplph.2013.09.013 ARTICLE IN PRESS G Model JPLPH 51807 1–9 Z. Deme e e al. / Jou nal o Plan Physiology xxx (2013) xxx– xxx 7 Fig. 4. The e ec o PEG on SSP DNase ac i i ies o Que cus calli o di e en gene ic o igin, g own on a medium supplemen ed wi h 4 mg L−1NAA and 0.5 mg L−1BA. (A) Rep esen a i e gels. A ows indica e he p esence o addi ional bands; (B) enzyme ac i i ies ep esen ed by ela i e band in ensi ies as measu ed wi h CP A las so - wa e. Mean ± SE alues o di e en calli/ he espec i e indi idual geno ype a e plo ed. As e iscs ep esen significan di e ences be ween PEG ea men s o a single geno ype, while le e codes ep esen di e ences be ween callus lines wi hin a single PEG ea men . Di e ences we e conside ed o be significan a P < 0.05. o DNA, cells a e cha ac e ized by he ac i i y o nucleases in ol ed514 in epai (Roldán-A jona and A iza, 2009).515 Se e al SSP nucleases inducible by d ough /osmo ic/sal s ess516 ha e been iden ified. Fo example, ba ley BnucI is a sal s ess517 inducible ype I nuclease, a pu a i e glycop o ein sligh ly smalle 518 han 36 kDa om ba ley (Mu amo o e al., 1999). Hyd ogen pe -519 oxide and d ough s ess induces he ac i i y o se e al nuclease520 Fig. 5. The e ec o PEG on guaiacol pe oxidase ac i i ies o Que cus calli o di e en gene ic o igin, g own on a medium supplemen ed wi h 4 mg L−1NAA and 0.5 mg L−1 BA. (A) Rep esen a i e gels. A owheads indica e he p esence o addi ional bands. (B) Enzyme ac i i ies ep esen ed by ela i e band in ensi ies as measu ed wi h CP A las so wa e. Mean ± SE alues o di e en calli/ he espec i e indi idual geno- ype a e plo ed. As e iscs ep esen significan di e ences be ween PEG ea men s o a single geno ype, while le e codes ep esen di e ences be ween callus lines wi hin a single PEG ea men . Di e ences we e conside ed o be significan a P < 0.05. isoenzymes using ssDNA as subs a e o molecula weigh s ang- 521 ing be ween 26 and 38 kDa in cauliflowe seedlings. Two o hem 522 appea ed be he same enzyme, inducible by bo h s ess ac o s 523 (Le´ sniewicz e al., 2010). The main nuclease isoenzyme p o ed o 524 be modula ed by osmo ic s ess in his s udy appea ed o ha e a525 molecula weigh o 50 kDa (Fig. 4). To ou bes knowledge, nucle- 526 ases o simila molecula weigh , wi h changing ac i i y a abio ic 527 s esses a e unusual in plan s. I should be no ed howe e , ha a528 significan numbe o nucleases consis o subuni s o lowe size 529 (see Desai and Shanka , 2003 o a e iew). Thus, he na u e o 530 Que cus nuclease o 50 kDa needs u he in es iga ion. 531 In case o d ough sensi i e indi iduals (A149, D89), PEG- 532 induced inc ease o SSP nuclease ac i i y was accompanied by, 533 no significan changes o dec eases o guaiacol-pe oxidase ac i - 534 i ies in callus. In con as , o d ough - ole an axa (A75, B50), 535 PEG ea men s led o unchanged o sligh ly inc easing SSP nucle- 536 ase ac i i ies oge he wi h inc eases o pe oxidase ac i i ies 537 (Figs. 4 and 5, see de ails below). This means ha ROS canno 538 Please ci e his a icle in p ess as: Deme e Z, e al. Osmo ic s ess esponses o indi idual whi e oak (Que cus sec ion, Que cus subgenus) geno ypes cul u ed in i o. J Plan Physiol (2013), h p://dx.doi.o g/10.1016/j.jplph.2013.09.013 ARTICLE IN PRESS G Model JPLPH 51807 1–9 8Z. Deme e e al. / Jou nal o Plan Physiology xxx (2013) xxx– xxx Table 3 O e iew o po en ial osmo ic s ess/d ough ole ance o PEG6000 ea ed oak callus lines as shown by di e en physiological pa ame e s. This classifica ion was based on significan di e ences in physiological esponses as e ealed by wo-way ANOVA. Physiological pa ame e s FW G ow h ( eco e y) Viabili y ( eco e y) ssDNase ac i i y Guaiacol-pe oxidase ac i i y Po en ially d ough ole an B50, A75 n.d. A211, B50, A75 B50, A75 D137, B50, A75 Po en ially d ough sensi i e A149, D89 n.d. A149, D89 A149, D89, A211 A149, D89 Is he di e ence be ween A75 and B50 significan ? Only a 40% PEG6000 Yes No No Yes n.d., no de ec able on he basis o a ailable da a. be sca enged in d ough -sensi i e axa, ollowed by DNA s and539 b eaks leading o ac i i y inc eases o nucleases p obably in ol ed540 in epai . D ough - ole an axa a e expec ed o be able o sca -541 enging ROS e ficien ly, hus DNA s and b eaks occu p obably542 wi h less equency. Howe e , changes (inc eases o dec eases) 543 o SSP nuclease ac i i ies we e no p opo ional wi h changes o 544 pe oxidase ac i i ies o all geno ypes and/o PEG concen a ions545 (Figs. 4 and 5). This indica es ha besides ROS le els, o he mech- 546 anisms could modula e nuclease ac i i ies.547 In case o callus line A149 (Q. pe aea), ea men s wi h PEG6000548 induced concen a ion-dependen wa e loss, as seen by he549 dec ease o callus esh weigh . The capaci y o calli o g ow and 550 o p oduce g een, iable issues dec eased a e emo al o 20–40%551 and 10–40% PEG6000 espec i ely, as shown by eco e y expe -552 imen s (Figs. 2 and 3). Meanwhile, pe oxidase ac i i y dec eased 553 and SSP nuclease ac i i y inc eased (Figs. 4 and 5). All hese e ec s554 o osmo ic s ess in a model expe imen (Table 3) confi m p e-555 ious findings (Thomas e al., 2002) and ou hypo hesis, ha is,556 sessile oak is gene ally a d ough /osmo ic s ess sensi i e species. 557 In con as , cul u es o A75 (Q. pubescens) and B50 (Q. i giliana)558 a e esis an o PEG6000 induced wa e loss and hey a e able559 o eco e e en a e ea men s wi h high concen a ions o he560 osmo icum (e en hough hei inc ease in esh weigh is inhib- 561 i ed by PEG in eco e y expe imen s, Figs. 2 and 3). Osmo ic s ess562 inc eases pe oxidase ac i i ies and induces only sligh inc eases o 563 SSP nuclease ac i i ies in hese cul u es. O e all, hese esul s con-564 fi m p e ious findings and ou hypo hesis, ha is, issue cul u es565 o Q. pubescens and Q. i giliana o igin a e d ough /osmo ic s ess 566 ole an (Table 3). Mo eo e , mic osa elli e da a show a close ela - 567 edness be ween A75 and B50 (Fig. 1). Fo D89, PEG6000 induced568 wa e loss was in e media y as compa ed o A149 and A75, as569 shown by changes o callus esh weigh and he pe sis ence o 570 callus eco e y a e ea men wi h 10% PEG (Figs. 2A and 3). On571 he o he hand, osmo ic s ess induced he inc ease o ssDNase572 ac i i y and excep ea men s wi h 10% PEG, he dec ease o pe - 573 oxidase ac i i y (Figs. 4 and 5). O e all, hese pa ame e s sugges 574 ha d ough esponse o D89 is in e media y be ween A149 and575 A75, adding u he p oo o he idea ha D89 is a hyb id be ween576 Q. pe aea and Q. pubescens. Howe e , all physiological pa ame e s 577 sugges ha cul u es o D89 a e mo e ole an o d ough , han578 A149, bu s ill can be conside ed as d ough sensi i e (Table 3).579 Pe oxidase ac i i ies o PEG6000 ea ed D137 calli inc eased as o 580 d ough esis an geno ypes (Fig. 5 and Table 3), e en hough we581 ha e ini ially hypo hesized ha as a hyb id be ween Q. pe aea and582 Q. dalechampii, his geno ype is ela i ely d ough sensi i e. Indeed,583 mic osa elli e da a confi med ha D137 is gene ically close o 584 he clus e con aining Q. pubescens, han o Q. pe aea (Fig. 1). On585 he o he hand, Q. dalechampii lineage could also explain a highe 586 d ough ole ance. Conce ning A211, i s wa e loss and abili y o587 eco e was in e media y be ween d ough sensi i e A149 and 588 ole an A75 (Figs. 2A, 3 and Table 3), bu PEG6000 induced SSP589 nuclease and pe oxidase ac i i y changes we e simila o A149 590 (Figs. 4 and 5). Mo phological and mic osa elli e da a we e no com- 591 pa able o his cul u e line. Lea mo phology ai s da a sugges ed 592 ha A211 is a hyb id be ween Q. i giliana and Q. polyca pa, bu 593 he analysis o SSR ma ke s sugges ed i s close ela edness o he 594 analyzed Q. pubescens ee (Table 1 and Fig. 1). Thus, e en hough 595 his indi idual ee is pu a i e hyb id be ween a d ough sensi i e 596 and a d ough esis an oak axon, genes/p o eins esponsible o 597 d ough ole ance seem o be weakly exp essed. 598 I should be no ed ha a gi en oak species can be cha ac e - 599 ized by high in a-popula ional gene ic a iabili y (He zog, 1996)600 and as a consequence, di e ences be ween physiological esponses 601 o indi iduals may occu . Thus, in a-popula ional spec um o 602 d ough ole ance o oaks in he Sík ˝ okú LTER a ea needs u he 603 s udies. 604 Table 3 shows he es ima ed osmo ic s ess/d ough ole ance o 605 he six oak cul u e lines s udied as shown by significan physiologi- 606 cal esponses o PEG ea men s. All physiological changes induced 607 by osmo ic s ess indica ed ha d ough sensi i i y o Q. pe aea, Q. 608 pubescens, and Q. i giliana cul u es confi med p e ious labo a o y 609 and field s udies including ecological equi emen s o hei pop- 610 ula ions (Cocha d e al., 1992; Damesin and Rambal, 1995; Gallé 611 e al., 2007; Siam e al., 2009; Rod íguez-Calce ada e al., 2010; 612 Ofle ea e al., 2011) and p o ed ou hypo hesis: such in i o cul- 613 u es can be addi ional model sys ems o s udying s ess esponses 614 o axa wi h unknown d ough esponses (D89, D137 and A211 615 in he p esen s udy). In e es ingly, B50 (Q. i giliana) and A75 (Q. 616 pubescens) had significan ly di e en esponses in eco e y expe - 617 imen s and conce ning pe oxidase ac i i ies (Figs. 2, 3 and 5 and 618 Table 3), e en hough ou da a and p e ious findings sugges ha 619 bo h Q. pubescens and Q. i giliana a e d ough ole an species (see 620 Table 3; Siam e al., 2009; Ofle ea e al., 2011 o example). In gen- 621 e al, mic osa elli e da a confi med ela i ely high gene ic dis ances 622 be ween d ough sensi i e and d ough ole an oak indi iduals. 623 The p esen wo k o e s an in i o model o s udying physiologi- 624 cal esponses o oak o d ough , by using issue cul u es es ablished 625 om selec ed indi idual ees wi h di e en axonomic iden i y co- 626 occu ing in he same o es s and. Fu he s udies bo h in he field 627 and labo a o y, he la e conce ning issue cul u es om di e en 628 indi iduals om he same popula ion will e eal na u al a iabili y 629 in d ough ole ance o whi e oaks. We sugges ha in i o callus 630 cul u es as simplified expe imen al sys ems a e help ul ools con- 631 ibu ing o he modeling o d ough ole ance o field g own oak 632 plan s wi h di e en gene ic backg ound and could be o gene al 633 applicabili y o plan s ess biology esea ch. 634 Acknowledgemen s 635 The s udy was suppo ed by Na ional Resea ch Founda ion 636 (OTKA No. K68397 and K101552) and Eu opean Union and he 637 Eu opean Social Fund co-financed p ojec TÁMOP-4.2.2/B-10/1- 638 2010-0024. 639 Re e ences 640 Aas G. Mo phologische und ökologische Va ia ion mi eleu opäische Que cus- 641 A en: Ein Bei ag zum Ve s ändnis de Biodi e si ä . Lib i Bo anici: Band 19. 642 Eching: IHW-Ve lag; 1998. p. 213. 643