Full text
RESEARCH ARTICLE
www.small-jou nal.com
The Clean oom-F ee, Cheap, and Rapid Fab ica ion o
Nanoelec odes wi h Low zM Limi s o De ec ion
Gab iel Ma oli, Ve nalyn Aba in os, And ew Pipe ,* and A ben Me koçi*
Nanoscale elec odes ha e been a opic o in ense esea ch o many decades.
Thei enhanced sensi i i ies, bo n ou o an imp o ed signal- o-noise a io as
elec ode dimensions dec ease, make hem ideal o he de elopmen o
low-concen a ion analy e senso s. Howe e , o da e, nanoelec ode
ab ica ion has ypically equi ed expensi e equipmen and exhaus i e,
ime-consuming ab ica ion me hods ha ha e ende ed hem unsui able o
widesp ead use and comme cializa ion. He ein, a me hod o nanoband
elec ode ab ica ion using low cos ma e ials and equipmen commonly
ound in esea ch labo a o ies a ound he wo ld is epo ed. The ma e ials’
cos o p oduce each nanoband is less han €0.01 and ab ica ion o a ba ch
akes less han 1 h. The de ices can be made o flexible plas ics and hei
designs can be quickly and easily i e a ed. Facile me hods o combining hese
nanobands in o powe ul de ices, such as comple e h ee-elec ode sys ems,
a e also displayed. As a p oo o concep , he elec odes a e unc ionalized o
he de ec ion o a DNA sequence specific o SARS-CoV-2 and ound o display
single molecule sensi i i y.
1. In oduc ion
Fo many yea s now, elec ochemis s ha e been limi ed by he
choice o a ailable elec odes. T adi ional gold, sil e , and ca bon
elec odes a e ou inely used a ound he wo ld and can be pu -
chased o a ew hund ed eu os each. Howe e , hese elec odes
equi e polishing by hand in alumina slu ies, chemical cleaning
in ha sh, en i onmen ally un iendly sol en s (such as pi anha
solu ion), sonica ion, and elec ochemical cycling in s ong acids
(e.g., H2SO4), in o de o clean hem be o e use.[1–3] This is all
done o y and ge he elec odes as clean, fla , and ep oducible
as possible. The oldes al e na i e o hese elec odes is he
G. Ma oli, V. Aba in os, A. Pipe , A. Me koçi
Ca alan Ins i u e o Nanoscience and Nano echnology (ICN2)
UAB Campus
Bella e a, Ba celona 08193, Spain
E-mail: and ew[email p o ec ed]; [email p o ec ed]
G. Ma oli
UIDI-CONICET Uni e sidad Tecnológica Nacional
Buenos Ai es C1041AAJ, A gen ina
The ORCID iden ifica ion numbe (s) o he au ho (s) o his a icle
can be ound unde h ps://doi.o g/10.1002/smll.202302136
© 2023 The Au ho s. Small published by Wiley-VCH GmbH. This is an
open access a icle unde he e ms o he C ea i e Commons A ibu ion
License, which pe mi s use, dis ibu ion and ep oduc ion in any
medium, p o ided he o iginal wo k is p ope ly ci ed.
DOI: 10.1002/smll.202302136
d opping me cu y elec ode,[4] whe e
me cu y is d opped h ough a small
capilla y o cons an ly c ea e a esh
elec odesu aceo adefineda eaa
which measu emen s can be aken. Due
o sa e y conce ns o e wo king wi h
me cu y, hese a e a ely used nowadays.
Mo e mode n al e na i es include inkje
and sc een-p in ed elec odes.[5–8] In such
elec odes, nano-/mic opa icle inks a e
pa e ned on o a subs a e. To p e en ag-
g ega ion, he nanopa icles need o be
s abilized in solu ion by adding bulky o -
ganic ligands o make hem s able col-
loids. The p esence o hese ligands can
impede subsequen elec ode pe o mance
and hei emo al pos -p in ing is diffi-
cul gi en hei size and co alen a ach-
men o he nanopa icles. The p in ed
elec odes a e inc edibly ough and i e-
p oducible, which con ibu es o i ep o-
ducibili y in he in ended applica ions. In
mos cases, he de ices a e no conduc i e
immedia ely a e p in ing and need o be
“sin e ed,” a p ocess by which he conduc i e pa icles mo ph o
inc ease he con ac a ea be ween hem.[9,44] P in ed elec odes
can be pu chased comme cially o se e al eu os pe elec ode,
wi h he exac p ice depending on he elec ode ype.
Al e na i ely, elec odes can be made in clean ooms. These
acili ies a e expensi e o build and hei main enance and
unning cos s a e p ohibi i ely expensi e o many esea ch
and comme cial applica ions. Inside he clean oom, conduc-
i e ma e ials can be deposi ed on subs a es in a highly con-
olled ashion wi h sub-nanome e esolu ion using chemical
o physical apo deposi ion, a omic laye deposi ion (ALD),
o elec on beam e apo a ion (E-beam).[10,11] ALD is a su ace-
con olled and sel -limi ing me hod o deposi ing hin films
om gaseous p ecu so s. This sel -limi ing g ow h mechanism
allows sub-nanome e -le el con ol o film hickness wi h an
excellen con o mi y.[12] Wi h E-beam, an elec on beam is o-
cused on o a a ge me al unde high acuum, apo izing he
me al in a high acuum chambe whe e i can be deposi ed
in a uni o m hin film on a chosen subs a e.[13,14] The cos
o hese ools is in he ange o hund eds o housands o eu-
os. Elec odes made by his me hod offe he bes elec ode
pu i y and smoo hness. Likewise, by ab ica ing in a clean-
oom, pho oli hog aphic p ocesses can be used o make a a i-
e y o elec ode designs and a chi ec u es wi h inc edibly high
esolu ion.
Small 2023,19, 2302136 © 2023 The Au ho s. Small published by Wiley-VCH GmbH
2302136 (1 o 11)
www.ad ancedsciencenews.com www.small-jou nal.com
Figu e 1. A) Schema ic ep esen a ion o he nanoband elec ode ab ica ion showing i) he cleaned p epa ed subs a e ii) a e spu e ing a nanome e
hin laye o conduc i e elec ode ma e ial h ough a mask iii) applica ion o a capping laye i ) cu ing o elie e a nanome e high edge elec ode )
he comple ed de ice wi h a c oss-sec ion schema ic (no o scale). B) Pho og aph o a de ice a s ep (i ), in his pho og aph he de ice was made
wi h a PET subs a e and Kap on ape capping laye . C,D) Scanning elec on mic og aph images o nanoband elec odes made wi h Au spu e ed on o
Kap on and capped wi h Kap on ape, cu wi h su gical g ade scisso s E) is an AFM image o he edge o one o he spu e ed Au de ices on Kap on
(uncapped) wi h fi e co esponding s ep heigh measu emen s om le o igh ac oss he idge in (F) showing ha he Au hickness is ≈30–40 nm and
he oughness o he Au su ace is he same as he Kap on (single nanome e s). G) CV o nanoband elec ode, in 5 ×10−3m po assium e icyanide,
5×10−3m po assium e ocyanide, 100 ×10−3mKNO
3 eco ded a a scan a e o 10 mV s−1 e sus a Ag/AgCl e e ence elec ode and P wi e coun e
elec ode.
A nanoelec ode is defined as any elec ode ha has a leas
one o i s dimensions on he nanoscale.[15,16] Nanoelec odes
ha e many ad an ages o e con en ional, mac oscopic elec-
odes. Chie among which is hei supe io sensi i i y.[17–20] This
imp o emen in sensi i i y as he elec odes ge smalle can
be a ibu ed o h ee ac o s: The fi s comes om hei en-
hanced mass anspo , which allows hem o measu e a s eady-
s a e cu en ; second, hey ha e smalle double laye s, which
means ha a g ea e p opo ion o he cu en is Fa adaic;
and finally, hey ha e ela i ely smalle iR d ops han la ge
elec odes.[17,20,21] Recen s udies ha e also shown ha nanoscale
elec odes can be unc ionalized h ough he spon aneous o -
ma ion o hiola e sel -assembled monolaye s (SAMs), he mos
common me hod o elec ode unc ionaliza ion, in a ma e o
seconds; a he han he hou s aken o unc ionalize mac oscale
elec odes.[3] This means ha senso de elopmen and ab ica-
ion can be apidly sped up i done on nanoscale elec odes.
A he ime o w i ing, nanoelec odes a e ypically ei he made
using complemen a y me al–oxide semiconduc o ab ica ion
echniques,[13,22] finely con olled chemical g ow h,[23] made in
he o m o nanowi es[24,25] o g own on nanoscale empla es.[26]
These me hods a e ei he expensi e o unsui able o la ge-scale
elec ode manu ac u ing.
He e, we epo aclean oom- eeme hodo nanoelec ode ab-
ica ion using spu e coa e s. Wi h his me hod, we a e able o
deposi me allic hin films wi h sub-nanome e esolu ion, ou -
side o a clean oom, using cheap equipmen ound in mos e-
sea ch labo a o ies on o any subs a e. These hin films a e sand-
wiched be ween he subs a e and a capping laye be o e being
cu o elie e a nanoband elec ode, see Figu e 1. These elec-
odes a e ex emely cheap, wi h aw ma e ials cos ing less han
€0.10 pe de ice, and can be cu mul iple imes in a ma e o
seconds o elie e b and new, p is ine elec odes ha equi e no
cleaning p io o use. By cu ing each de ice mul iple imes, he
cos o each elec ode can be educed o below €0.01. We show
ha hese elec odes possess he cha ac e is ic elec ochemical
p ope ies o nanoelec odes, including be e signal- o-noise a-
ios and as e unc ionaliza ion imes han la ge elec odes. As
a p oo o p inciple, we show he supe io pe o mance o hese
elec odes in he de ec ion o DNA wi h he same sequence es ed
o in he quan i a i e e e se ansc ip ion polyme ase chain e-
ac ion (PCR) diagnosis o SARS-CoV-2; whe e hey exhibi ed su-
pe io sensi i i ies and limi s o de ec ion o con en ional elec-
odes.
These elec odes a e cheap, easy o ab ica e, can be made in
any lab in he wo ld wi h commonplace, affo dable equipmen ,
Small 2023,19, 2302136 © 2023 The Au ho s. Small published by Wiley-VCH GmbH
2302136 (2 o 11)
16136829, 2023, 51, Downloaded om h ps://onlinelib a y.wiley.com/doi/10.1002/smll.202302136 by Csic O ganización Cen al Om (O icialia Mayo ) (U ici), Wiley Online Lib a y on [15/02/2024]. See he Te ms and Condi ions (h ps://onlinelib a y.wiley.com/ e ms-and-condi ions) on Wiley Online Lib a y o ules o use; OA a icles a e go e ned by he applicable C ea i e Commons License
www.ad ancedsciencenews.com www.small-jou nal.com
a e mo e sensi i e han he commonly used elec odes, and can
be unc ionalized o make senso s in minu es. They he e o e
ha e he po en ial o e olu ionize any esea ch ha uses elec-
odes. They a e supe io in e e y way o elec odes made by o he
me hods and ha e he po en ial o eplace exis ing elec odes im-
media ely, wi h li le o no up on capi al cos s. The as e unc-
ionaliza ion imes and lack o equi ed cleaning means ha as-
say de elopmen can be apidly sped up on hese elec odes. Fi-
nally, i is in ended ha he elec odes will allow mo e sensi-
i e poin o ca e senso s o be de eloped, allowing he diagno-
sis and p ognosis o diseases wi h bioma ke s oo low in con-
cen a ion o con en ional senso s o de ec , he ea lie diagno-
sis o diseases (when he concen a ion o bioma ke s is lowe ),
and pe haps e en he amplifica ion- ee de ec ion o nucleic acid
bioma ke s.
2. Resul s and Discussion
2.1. Elec ode Fab ica ion and Cha ac e iza ion
The nanoelec odes in his p ojec we e ab ica ed by spu e ing
gold, using a con en ional spu e coa e , h ough a mask (s en-
cil) on o a ious flexible plas ic subs a es. The subs a es es ed
we e polyimide (Kap on), polye hylene e eph hala e (PET), and
polye hylene naph hala e (PEN). These subs a es we e chosen
because hey a e cheap, widely a ailable, flexible, and easy o cu .
The abili y o o m hese elec odes on any acuum s able sub-
s a e, wi hou any op imiza ion o he ab ica ion, is a majo ad-
an age o his wo k o e al e na i e me hods. The masks used
in his p ojec as s encils we e made o aluminium o any o
he a o emen ioned plas ics, heo e ically hey can be made ou
o any ma e ial ha does no in e e e wi h he spu e ing. The
s encils a e equi ed o ha e sufficien weigh o si flush on he
subs a e and keep i in place du ing he e acua ion o he spu -
e chambe . This is impo an o make elec odes ep oducibly,
as any li ing o de o ma ion o he mask can change he spu -
e ed elec ode dimensions. The abili y o apidly design, cu , and
use masks wi h diffe en layou s allows a as i e a i e app oach
o elec ode design. This is no possible using pho oli hog aphy
whe e new masks ake much longe o design and ab ica e. In
his s udy, a simple design mo i o 1.2 cm wide and 2.4 cm long
ec angles was used, Figu e 1A,B and Figu es S1 and S2 in he
Suppo ing In o ma ion.
The a e o Au deposi ion by spu e ing is well epo ed in he
li e a u e, and ou measu emen s o he elec ode hickness as
a unc ion o ime and deposi ion cu en we e ound o be in
ag eemen wi h o he publica ions.[27,28] This me hod allows o
he con olled deposi ion o nanome e hin me allic films wi h
sub-nanome e p ecision; using cheap equipmen ha is ou-
inely ound in mos labo a o ies a ound he wo ld, since spu e
coa e s a e used in scanning elec on mic oscope (SEM) sample
p epa a ion. In his wo k, we spu e ed me allic laye s 50–100 nm
hick. The a ionale behind his was o make he de ices hick
enough o ensu e a good connec ion h ough a c ocodile clip on
he bond pad, o ensu e a homogenous co e age o he subs a e
and o ha e he same hicknesses as simila clean oom- ab ica ed
nanoelec odes p esen in he li e a u e.[3,17,18,27–29]
The deposi ed me al (in his case Au) was ini ially es ed wi h a
ou -poin p obe o assess i s conduc i i y. The mask allowed us
o make fi e de ices on each subs a e, see Figu e S2 in he Sup-
po ing In o ma ion, he shee esis ances o he spu e ed me al
films on diffe en subs a e ha e been p o ided in Table S1 in he
Suppo ing In o ma ion, as well as ha o E-beamed Au on Kap-
on, o e e ence. All he measu ed alues a e he same o de o
magni ude (mΩsq−1) wi h he E-beamed Au ha ing a shee esis-
ance abou hal ha o he spu e ed Au. The e is no significan
diffe ence be ween he esis ances o he gold spu e ed on o any
o he diffe en subs a es, his is pleasing as i e idences ha he
subs a e does no affec he elec ochemical pe o mance o he
de ices.
In o de o c ea e nanoelec odes, he spu e ed me al needed
o be “capped” and cu . Se e al capping me hods we e es ed, in-
cluding: co e ing wi h Kap on ape, sp ay coa ing wi h ac ylic,
and lamina ing wi h an office lamina o . All we e ound o wo k,
Figu es S3–S6 in he Suppo ing In o ma ion, and may be sui ed
o diffe en applica ions. The equi emen s o a good capping
laye a e ha i s ongly adhe es o bo h he elec ode ma e ial
and he subs a e, is chemically ine in he media in which i will
be es ed, o ms a good physical and dielec ic ba ie , and does
no damage he unde lying elec ode. I should also be easy o cu
wi h he in ended cu ing me hod. In his p ojec , we a o ed us-
ing he Kap on ape because i was quicke o make de ices wi h
his han he o he me hods which need o be le o d y (ac ylic)
o hea ed (lamina ion).
Once he de ices a e capped, hey mus be cu o elie e
nanoband elec odes. The cu ing was pe o med wi h scisso s,
scalpels, o a pape guillo ine, see Figu e S4 in he Suppo ing
In o ma ion, all we e capable o p oducing nanoband elec odes.
In o de o make unc ioning elec odes, he blades in each o he
cu ing me hods need o be as sha p and clean as possible (e.g.,
i is necessa y o use su gical g ade o mic oscopy scisso s a he
han office scisso s). I he blade was blun , i would cause a de-
o ma ion o he laye s, Figu e S7 in he Suppo ing In o ma ion.
Finally, he capping laye s do no all se ha d and should be cu
ace down o d ag he adhesi e away om he elec ode, so as no
o co e i .
Cyclic ol ammog ams (CVs) o each subs a e ype, wi h each
capping laye and cu ing me hod ha e been included in Figu e
S6 in he Suppo ing In o ma ion. I is clea om he wa e-like
shapes o he CVs and he low capaci ances o he elec odes ha
hey a e all nanoelec odes. F om Figu e S6 in he Suppo ing
In o ma ion, he mos ep oducible cu ing me hod was he p e-
cision cu e , ollowed by he scisso s and finally he scalpel. This
end can be explained by he me hods ha allow o he mos hu-
man e o causing he mos i ep oducibili y. When cu ing wi h
he scalpel, he angle, p essu e, and s aigh ness o he cu a e
mo e i ep oducible han wi h he o he cu ing me hods.
Rega ding he capping laye s, he ac ylic is he mos ep o-
ducible owing o he ac ha i se s he ha des . The so e se ing
adhesi es o he ape and mel laye o he lamina e a e p one o
being smea ed on he elec odes du ing cu ing. This is why i is
impo an o cu he elec odes in a ashion ha d ags he adhe-
si e away om he elec ode. Al hough some damage is s ill pos-
sible, which is why he p ecision cu e ga e no only he mos e-
p oducible cu s, see Figu e S6 in he Suppo ing In o ma ion, bu
also consis en ly yielded elec odes wi h a highe a ea; as he e is
less adhesi e on he elec odes. Examples o he adhesi e smea -
ing can be seen in Figu e S8 and he ideo in he Suppo ing
Small 2023,19, 2302136 © 2023 The Au ho s. Small published by Wiley-VCH GmbH
2302136 (3 o 11)
16136829, 2023, 51, Downloaded om h ps://onlinelib a y.wiley.com/doi/10.1002/smll.202302136 by Csic O ganización Cen al Om (O icialia Mayo ) (U ici), Wiley Online Lib a y on [15/02/2024]. See he Te ms and Condi ions (h ps://onlinelib a y.wiley.com/ e ms-and-condi ions) on Wiley Online Lib a y o ules o use; OA a icles a e go e ned by he applicable C ea i e Commons License
www.ad ancedsciencenews.com www.small-jou nal.com
In o ma ion. In all expe imen s, he subs a es es ed had no dis-
ce nible impac on he final elec ode quali y.
The ime aken o make a single ba ch o elec odes, includ-
ing spu e ing, capping, and cu ing was less han 1 h. Once he
de ices a e made, esh elec odes can be made by cu ing in
a ma e o seconds. This is a c ucial ad ancemen o e o he
clean oom- ee nanoelec ode ab ica ion me hods such as hose
epo ed by he Whi e g oup,[30] in which subs a es a e spu -
e coa ed h ough a mask and hen encapsula ed in esin which
akes 24 h o d y, be o e being mechanically polished o hou s
o c ea e p is ine fla elec odes. A ideo showing he en i e ab-
ica ion p ocess has been made o accompany his publica ion.
The equipmen used is commonly ound in mos labo a o ies
a ound he wo ld bu he up- on capi al cos s a e also e y low
i hey do need o be pu chased. Table S2 in he Suppo ing In o -
ma ion summa izes hese capi al cos s and he cos o consum-
ables used o elec ode ab ica ion. I he up on equipmen
cos s a e excluded, hen he ma e ials’ cos pe elec ode is below
€0.01, on he condi ion ha he de ices a e cu a minimum o en
imes each, o yield a leas en elec odes pe de ice. This makes
hese elec odes cheap and he e o e inhe en ly disposable, i is
cheape o cu and c ea e a new elec ode a he han ying o
clean and e-use hem. The abili y o cu one de ice se e al imes
o make mul iple elec odes is a no el ad an age o hese de ices.
The de ices can ake up o an hou o make bu cu ing and mak-
ing a esh nanoelec ode akes seconds.
To confi m ha he ab ica ed elec odes a e uly nano in na-
u e, he bands we e imaged by SEM, Figu e 1C,D, he heigh
o he uncapped spu e ed me al edges was measu ed by a omic
o ce mic oscopy (AFM), Figu e 1E,F, and he nanoscale elec-
ochemical esponses o he bands we e e alua ed. The SEM
images clea ly show a nanoscale conduc i e band be ween he
subs a e and capping laye . Using he SEM so wa e (xT mic o-
scope Con ol), he heigh o his band could be es ima ed and
was ound o be be ween 40 and 45 nm, which was sligh ly below
he 50 nm a ge ed spu e ing hickness o hese de ices. This
sligh a ia ion is a ibu ed o expe imen al e o s in he spu -
e ing since he AFM measu emen s o uncapped Au laye s spu -
e ed on o Kap on also had a s ep heigh o abou 40 nm.
Typical CVs o mac oelec odes ha e peaks ha o m as he
cu en becomes limi ed by he mass anspo o he edox
molecule o he elec ode su ace. The esponse o nanoelec-
odes is diffe en ,[24,31] because he elec odes a e so small,
a hemisphe ical diffusion p ofile is apidly es ablished.[15,32]
The e o e, wa es a he han peaks a e obse ed in he CVs
o nanoscale elec odes.[33–35] The nanoband elec odes de el-
oped in his p ojec exhibi elec ochemical esponses ypical o
nanoscale elec odes, Figu e 1G. Likewise, he cu en anges ob-
se ed a e in good ag eemen wi h nanobands o simila dimen-
sions in simila buffe s epo ed by o he g oups.[30] Ano he
in e es ing elec ochemical ea u e o he nanoelec odes is he
ex emely low capaci ances ha hey display, in his sys em he
only capaci ance p esen is he double laye capaci ance (Cdl). The
magni ude o he Cdl is gi en by he Helmhol z equa ion, Equa-
ion (1)[31]
C=
𝜀0𝜀 A
H(1)
whe e Cis he capaci ance in Fa ads, 𝜖0is he dielec ic pe mi -
i i y o a acuum, 𝜖 is he dielec ic pe mi i i y o he mea-
su emen solu ion, Ais he a ea o he elec ode, and His he
sepa a ion dis ance be ween he pla es in he model. In aqueous
sys ems, Hcan be aken as he inne Helmhol z plane ( he di-
ame e o a wa e molecule in pu e wa e ).[31] I is possible o ap-
p oxima e he elec ochemical su ace a ea o he nanoband elec-
odes using Equa ion (1), since he Cdl ollows he elec ode su -
ace e y accu a ely and he o he alues can all be aken om he
li e a u e o pu e wa e (𝜖0=8.854 ×10−12 Fm
−1;𝜖 =78.3; H
=2.75 Å).[31] In hese expe imen s, 75 nm hick elec odes we e
spu e ed, wi h a geome ic elec ode su ace a ea o 9 ×10−4
mm2. We calcula ed he a ea o ou elec ode, om i s ol amme -
ic capaci ance, Figu e S9 in he Suppo ing In o ma ion, o be
13.5 ×10−4±0.6 ×10−4mm2, wi hin expe imen al e o he
same as he geome ic a ea. These da a u he e idence he
nanoscale na u e o he elec odes. Likewise, he s anda d de i-
a ion was ob ained om h ee elec odes cu on a single de ice,
showing he ep oducibili y o he cu ing me hod and he uni-
o mi y o he spu e ed Au o e he en i e de ice. The sligh ly
la ge elec ochemical su ace a ea han geome ic su ace a ea
is a ibu ed o su ace oughness and he e ogenei y.[36] I is sa is-
ying ha ou so-called “ oughness ac o ” is 1.5, which is be e
han epo ed o o he elec ode ypes in he li e a u e.[37] In his
sys em, we pos ula e ha as he capping laye adhesi e is se ing,
i may mo e (du ing handling), d agging he Au laye ou o he
de ice, much like he filling in a sandwich when i is p essed.
This heo y is based on he SEM da a, Figu e 1D, whe e films ap-
pea o p o ude om he de ice. This is u he suppo ed by he
findings ha he signals om he ha des se ing capping laye s
(ac ylic) ga e he mos ep oducible elec odes. Also, anecdo ally,
he elec ode ep oducibili y could be imp o ed by lea ing any o
he capping laye ypes o ex ended pe iods o ime (days/weeks
depending on he capping ma e ial), o allow hem o se ha de .
To u he cha ac e ize he elec ochemical esponse o he
nanobands, hey we e analyzed by elec ochemical impedance
spec oscopy. The Nyquis plo om hese expe imen s has been
p o ided in Figu e S12 in he Suppo ing In o ma ion, wi hin an
inse showing he equi alen ci cui o which i has been fi . This
is he es ablished equi alen ci cui o nanoelec odes.[3,15,35] The
fi ed alues o he fi , epo ed in Table S5 in he Suppo ing In-
o ma ion, include an Rc o 29 980 Ω±3.5% (e o om he
fi ing). This was used o de e mine an elec on ans e a e o
8.03 cm s−1, he de i a ion o which is included in Figu e S13 in
he Suppo ing In o ma ion, which is in ag eemen wi h o he
nanoelec odes in he li e a u e.[32,35,38]
2.2. Diffe en Elec ode Designs
One o he ad an ages o making elec odes using his me hodol-
ogy is he abili y o apidly i e a e diffe en elec ode designs and
configu a ions. New plas ic masks can be made quickly (in unde
20 min) and easily using cu ing plo e s (o by hand) o change
he pa e n and size o he me allic coa ings o sui diffe en ap-
plica ions. Likewise, i is e y easy o combine elec odes o diffe -
en designs and ypes o c ea e cus omized de ices o diffe en
applica ions. I is easy o ab ica e a lib a y o elec odes o diffe -
en pa e ns and hicknesses, spu e ed om diffe en ma e ials.
Small 2023,19, 2302136 © 2023 The Au ho s. Small published by Wiley-VCH GmbH
2302136 (4 o 11)
16136829, 2023, 51, Downloaded om h ps://onlinelib a y.wiley.com/doi/10.1002/smll.202302136 by Csic O ganización Cen al Om (O icialia Mayo ) (U ici), Wiley Online Lib a y on [15/02/2024]. See he Te ms and Condi ions (h ps://onlinelib a y.wiley.com/ e ms-and-condi ions) on Wiley Online Lib a y o ules o use; OA a icles a e go e ned by he applicable C ea i e Commons License
www.ad ancedsciencenews.com www.small-jou nal.com
Figu e 2. Schema ics (no o scale), pho og aphs, and SEM images o he diffe en LEGO b ick designs ab ica ed and es ed in his p ojec . A) S icking
comple ed de ices on op o each o he : i) a cleaned subs a e, ii) is spu e coa ed wi h a nanome e hin film o Au, iii) be o e being capped, and i )
he bond pads cu so ha each will open o he en i onmen in he final 3D de ice, ) mul iple sepa a e de ices a e s acked and s uck o each o he ,
i, iii) be o e he h ee nanobands a e exposed by cu ing. iii) A pho og aph o one such comple ed de ice, ix) as well as a schema ic and x) SEM o he
Small 2023,19, 2302136 © 2023 The Au ho s. Small published by Wiley-VCH GmbH
2302136 (5 o 11)
16136829, 2023, 51, Downloaded om h ps://onlinelib a y.wiley.com/doi/10.1002/smll.202302136 by Csic O ganización Cen al Om (O icialia Mayo ) (U ici), Wiley Online Lib a y on [15/02/2024]. See he Te ms and Condi ions (h ps://onlinelib a y.wiley.com/ e ms-and-condi ions) on Wiley Online Lib a y o ules o use; OA a icles a e go e ned by he applicable C ea i e Commons License
www.ad ancedsciencenews.com www.small-jou nal.com
These indi idual componen s can hen be easily combined o de-
elop new de ices o diffe en applica ions, including hose wi h
diffe en numbe s o elec odes, such as wo-elec ode sys ems
o o mul iplexed sensing applica ions. Much like LEGO b icks,
hese can be a ached oge he o c ea e an endless possibili y o
designs. As a p oo o p inciple o his “LEGO-b ick” concep ,
comple e h ee-elec ode sys ems ha e been de eloped by a num-
be o diffe en me hods. The au ho s would like o s ess ha
his is simply a p oo o concep and ha an endless numbe
o designs a e possible. Pho og aphs, schema ics, and SEMs o
hese diffe en me hods o combining de ices ha e been shown
in Figu e 2. Fi s , i is possible o s ick mul iple capped de ices
on op o each o he using adhesi es, see Figu e 2A. Second, i
is possible o build he de ices up e ically by spu e ing di ec ly
on o he capping laye s, using masks o sepa a e he diffe en
bond pads o he diffe en laye s, Figu e 2B. Thi d, i is possible
o design a mask in which he h ee elec odes a e in he same 2D
plane and simply sepa a ed om each o he by he mask design,
Figu e 2C. The CVs o hese de ices, Figu e S10 in he Suppo ing
In o ma ion, show ha he e is a shi in he hal -wa e po en ial
( om +0.175 o +0 V) when swi ching om a Ag/AgCl e e ence
elec ode o a spu e ed Au pseudo e e ence elec ode, as would
beexpec ed. O he han his, he e is no diffe encein he ob ained
elec ochemical signal, p o ing ha unc ioning comple e h ee-
elec ode sys ems can be p oduced by his “Lego-b ick” me hod.
2.3. DNA De ec ion
In o de o assess he sensing pe o mance o he elec odes, hey
we e unc ionalized wi h an ssDNA p obe o he de ec ion o a
DNA sequence specific o SARS-CoV-2. The au ho s would like
o s ess ha his is a p oo -o -concep expe imen , in ended o
asce ain he pe o mance o he nanoband elec odes and com-
pa e hem o exis ing comme cial elec odes. As such, i was
deemed sui able o de ec a syn he ic complimen a y DNA se-
quence a he han RNA om eal samples and he au ho s wish
o s ess ha no claims a e being made ha an amplifica ion-
ee SARS-CoV-2 senso has been de eloped. The mode o op-
e a ion o he senso is shown schema ically in Figu e 3. Fi s ,
he elec ochemical esponse o a clean (ba e) elec ode is mea-
su ed in a solu ion o 5 ×10−3mK[Fe(CN)6]3−and 5 ×10−3
mK[Fe(CN)6]4−in 1 ×phospha e-buffe ed saline (PBS) wi h
10 ×10−3mMgCl
2. Nex , he elec odes we e unc ionalized by
he spon aneous o ma ion o a mixed sel -assembling mono-
laye om an aqueous solu ion con aining 6-me cap ohexan-1-ol
and a hiol-C6-modified ssDNA p obe. This p ocess akes a min-
imum o 2 h on mac oscopic elec odes bu was possible in less
han 2 min on he nanoband elec odes. This is inag eemen wi h
p e ious publica ions and u he e idences he nanoscale p op-
e ies o hese elec odes.[3] When placed back in he edox agen -
con aining solu ion and he elec ochemis y was e-measu ed,
he e is a clea dec ease in he limi ing cu en , Figu e 3. This
is because he cha ge ans e a he elec ode is impeded by he
s e ic blocking o he edox molecules by he SAM film, as well as
he elec os a ic epulsion o he anionic Fe species by he nega-
i ely cha ged phospha e backbone o he DNA. A con ol expe i-
men was un o assess he s abili y o he SAM o e he imescale
o an assay, Figu e S11 in he Suppo ing In o ma ion, in his
con ol expe imen , he unc ionalized nanobands we e dipped
in o solu ions o DNA- ee wa e . In he main expe imen , he
unc ionalized elec odes we e fi s placed in a solu ion o deion-
ized wa e and hen le o si in he measu emen solu ion o
20 min o make su e he p obe monolaye was also s able. A -
e which, i was placed consecu i ely in solu ions con aining in-
c easing concen a ions o a ge DNA be o e being insed wi h,
and measu ed in, he measu emen solu ion. The washing was
impo an o emo e any nonspecifically bound DNA om he
su ace. As he a ge DNA sequence binds o he p obe laye , i
u he impedes he cha ge ans e a he elec ode su ace caus-
ing a dec ease in cu en ha is p opo ional o he amoun o
a ge DNA bound o he su ace.
The CV and squa e wa e ol amme y da a om hese ex-
pe imen s on mac o and nanoband elec odes a e p o ided in
Figu e 3. The Langmui iso he m was chosen as he simples
and mos app op ia e model o fi hese da a o and om he
fi s, he echnical limi o de ec ion (LoD) o he mac oelec odes
was ound o be 92.4 ×10−12 ±30.4 ×10−12 m. Howe e , he
pe o mance o he nanoband elec odes is significan ly diffe -
en , showing a clea sensi i i y enhancemen wi h a LoD o
97.1 ×10−21 ±23.7 ×10−21 m(1zM=× 10−21 m) ob ained
in one o he epea s. While hese limi s o de ec ion a e e y
low, he e is e idence in he li e a u e o o he nanoelec ode
and nanoelec ode ensembles exhibi ing simila sensi i i ies, in-
cluding o DNA de ec ion.[39–42] A ogad o’s numbe is 6.022 ×
1023, meaning ha a 10 ×10−21 m solu ion will con ain 6000
molecules pe li e . The e o e, a 2 mL solu ion o a ge DNA
(as was being used he e) should heo e ically con ain 12 a ge
DNA s ands. This means ha wi h an LoD o 97 ×10−21 m, as
ew as 117 molecules in he 2 mL sample can be de ec ed. How-
e e , he au ho s would emphasize cau ion on his on , hese
a ge DNA concen a ions we e made up by se ial dilu ions and
he e is ob iously an e o in oduced by he pipe ing. Table S4
in he Suppo ing In o ma ion shows he e o in he final DNA
concen a ion when diffe en pipe ing e o s a e aken in o ac-
coun . E en a 1% e o (which is low o e en he bes o pipe es)
could esul in significan ly mo e (o less) DNA in he low a ge
DNA concen a ions han is quo ed he e. The e o e, he au ho s
would like o emphasize ha he sensi i i y o hese elec odes
is hough o be in he low zM ange, based on hese da a and
a e no claiming single molecule de ec ion limi s. The e a e also
conce ns abou whe he o no 20 min is sufficien o such low
amoun s o analy e o diffuse o he elec ode su ace and bind o
c oss-sec ion ha e also been p o ided. B) Spu e ing di ec ly on o he capping laye s. i) A cleaned subs a e, ii) is spu e coa ed wi h a nanome e hin
Au coa ing h ough a mask ha also pa e ns he con ac pad, iii) i is hen capped, i – i) be o e spu e ing and capping a e epea ed, using diffe en
masks o sepa a e he con ac pads, ii) he de ices a e hen cu o elie e he nanobands. I is possible o lea e he op laye uncapped so when dipped
in solu ion i s a ea is much la ge han he o he elec odes, allowing i o be used as a coun e elec ode. ix) A pho og aph and x) c oss-sec ional
schema ics and xi) an SEM image o his ype o de ice. C) 2D de ices. i) A cleaned subs a e is spu e coa ed ii) wi h Au h ough a mask ha pa e ns
sepa a e de ices on he subs a e su ace. These can hen be iii) capped and i ) cu o elie e mul iple elec odes wi h a iable shapes and o ien a ions
in he same plane. ) Pho og aphs and i) c oss-sec ional schema ics and ii) SEMs ha e been p o ided.
Small 2023,19, 2302136 © 2023 The Au ho s. Small published by Wiley-VCH GmbH
2302136 (6 o 11)
16136829, 2023, 51, Downloaded om h ps://onlinelib a y.wiley.com/doi/10.1002/smll.202302136 by Csic O ganización Cen al Om (O icialia Mayo ) (U ici), Wiley Online Lib a y on [15/02/2024]. See he Te ms and Condi ions (h ps://onlinelib a y.wiley.com/ e ms-and-condi ions) on Wiley Online Lib a y o ules o use; OA a icles a e go e ned by he applicable C ea i e Commons License
www.ad ancedsciencenews.com www.small-jou nal.com
Small 2023,19, 2302136 © 2023 The Au ho s. Small published by Wiley-VCH GmbH
2302136 (7 o 11)
16136829, 2023, 51, Downloaded om h ps://onlinelib a y.wiley.com/doi/10.1002/smll.202302136 by Csic O ganización Cen al Om (O icialia Mayo ) (U ici), Wiley Online Lib a y on [15/02/2024]. See he Te ms and Condi ions (h ps://onlinelib a y.wiley.com/ e ms-and-condi ions) on Wiley Online Lib a y o ules o use; OA a icles a e go e ned by he applicable C ea i e Commons License
www.ad ancedsciencenews.com www.small-jou nal.com
he p obes. We p opose ha bulk solu ion mo emen s, such as
con ec ion and he agi a ion o he solu ion when he elec odes
a e inse ed by hand, accoun o he e being a sufficien amoun
o p obe a ge hyb idiza ion in he 20 min es ed.
Wha is clea , howe e , is ha he sensi i i y o hese nanoband
elec odes is a supe io o ha o he mac oelec odes and com-
pa able o he bes esul s o nanoelec odes epo ed in he
li e a u e.[40] The a ia ion in he nanoelec ode signal, a fi s
glance, appea s o be g ea e han ha o he mac oelec odes.
Howe e , i should be no ed ha he x-axis is loga i hmic, and he
pipe ing e o s a e la ge o he lowe analy e concen a ions,
he e o e he sp ead o he da a canno be solely a ibu ed o a i-
a ion in he elec odes which we e p e iously shown o be e y
ep oducible. The difficul y in ep oducibly making he calib a-
ion solu ions wi h such low concen a ions means ha i is no
possible o ob ain linea anges om he da a shown in Figu e 3F.
The only conclusions ha can be d awn a e ha hese nanoband
elec odes a e ex emely sensi i e, capable o de ec ing DNA
down a low zM le els. Un il me hods o ep oducibly making
solu ions wi h such low concen a ions o analy e a e de eloped,
accu a e calib a ion cu es will be impossible o ob ain.
3. Conclusions
He ein, we ha e epo ed he clean oom- ee ab ica ion o
nanoband elec odes. The nanoscale na u e o he elec odes has
been p o en elec ochemically as well as by SEM and AFM. These
de ices a e ex emely cheap, wi h aw ma e ials’ cos o €0.01
pe elec ode and can be made immedia ely in mos labs a ound
he wo ld using commonplace, low-cos equipmen . The elec-
odes exhibi supe io pe o mance compa ed o con en ional
elec odes, no jus in e ms o cos , bu hey a e easy o manu-
ac u e in cus omizable design mo i s, equi e no cleaning, can
be made ou o a wide ange o ma e ials, and a e ex emely
sensi i e. In he p oo -o -p inciple DNA senso shown he e, he
nanoband elec odes we e able o achie e low zM le els o de ec-
ion; ma kedly be e han he pM de ec ion limi s o he same
sys em on a mac oscopic elec ode. We belie e ha gi en hese
ad an ages, his wo k and hese elec odes ha e he po en ial
o e olu ionize he fields o elec ochemis y and poin -o -ca e
sensing. The low LoDs o hese de ices means ha hey can be
used o de elop senso s o bioma ke s p esen in samples a e y
low concen a ions. Me hods o making he elec odes sui able
o eal wo ld sample analysis, such as mic ofluidics and an i oul-
ing s a egies will be he ocus o u u e wo k.
Fo decades now, comme cial poin -o -ca e biosenso s ha e
been limi ed o he de ec ion o highly abundan bioma ke s such
as glucose, lac a e, p oges e one, and i ions. I is hoped ha he
lowe LODs o hese cheap nanoband elec odes will kick s a he
de elopmen o biosenso s o a wide ange o low-concen a ion
bioma ke s. This could no only lead o he ea lie diagnosis o
diseases, when he bioma ke s a e less abundan , bu also o
he de elopmen o poin -o -ca e de ices o disease s a es wi h
bioma ke s oo dilu e o cu en ly de ec . This could include, bu
is no limi ed o, bioma ke s ha c oss he blood b ain ba ie o
c oss he placen a om a e al o a mo he ’s bloods eam. Like-
wise, as has been shown by he de ec ion o DNA he e, i may be
possible o eplace PCR es s wi h amplifica ion- ee DNA sen-
so s using his echnology.
4. Expe imen al Sec ion
Ma e ials and Equipmen :A Mini Spu e Coa e (model SC7620, Quo-
um Technologies) and he gold spu e a ge we e pu chased om
ANAME Ins umen ación Cien ífica (Mad id, Spain). The h ee subs a es
used we e PET ( hickness 75 μm), PEN ( hickness 125 μm), and Dupon
g ade Kap on HN ( hickness 75 μm), all we e pu chased om Good ellow
GmbH (Spain). The capping laye s we e 3 m Kap on ape 5413(Digi-Key),
Ac ylic Va nish CRC – Clea B illian (RS Componen s Spain), and Fellowes
Enhance 80 mic on lamina ion shee s (Amazon, Spain). The cu ing was
pe o med wi h a flin onic A4 Pape Cu e (Amazon, Spain), scalpels,
o su gical scisso s pu chased om VWR, Spain. Aluminum masks we e
made in house. A G aph ec ce6000-40 cu ing plo e was used o ab ica e
masks ou o he a o emen ioned Kap on ha was also used as a subs a e.
Po assium hexacyano e a e (III) (K3[Fe(CN)6]) and po assium
hexacyano e a e (II) 3-hyd a e (K4[Fe(CN)6]·3H2O) we e pu chased
om Pan eac AppliChem. T is(2-ca boxye hyl)phosphine (TCEP), 2-
me cap ohexanol, 2-p opanol (IPA), ace one, and PBS, po assium ni a e
(KNO 3), and magnesium chlo ide (MgCl2) we e pu chased om Me ck
KGaA, Ge many. Gold wo king elec odes (CH101), Ag/AgCl e e ence
elec odes (CH111), and pla inum wi e coun e elec odes (CH115) we e
pu chased om CH ins umen s. Au/Au/Au sc een-p in ed elec odes
we e pu chased om D opSense, Spain. The 0.3 μm alumina low iscosi y
polishing slu y (ET034), 0.05 μm alumina low iscosi y polishing slu y
(ET033), mic opolishing clo hs (ET032), and glass polishing slides
(ET031) we e pu chased om eDAQ (Poland). Concen a ed sul u ic
acid (96%, ITW, Spain) and hyd ogen pe oxide 50% (Sigma Ald ich,
Spain) we e used o make pi anha solu ion o elec ode cleaning. An
O an Ul asonic 3L ba h was pu chased om O an (Spain). All aqueous
solu ions we e p epa ed using deionized wa e om a Milli-Q Ad an age
A10 Wa e Pu ifica ion Sys em wi h 0.22 μm fil e s MPGP04001 (18.2 MΩ
cm, Me ck-Millipo e, Spain). The elec ochemical measu emen s we e
ca ied ou wi h a Me ohm Au olab PGSTAT12 wi h NOVA 2.1 so wa e.
All he da a analysis was pe o med in he NOVA 2.1 so wa e o O igin
2018, unless s a ed o he wise.
Nanoelec ode Fab ica ion—Spu e ing:The chosen subs a e
(Kap on, PEN o PET) was cu in o 6 cm x 6 cm squa es wi h he
cu ing plo e . These dimensions we e chosen o fi unde nea h
he mask and inside he spu e coa e . The mask pa e n was c e-
a ed using Au oCAD so wa e, e sion 2021 om Au odesk. The
design was c ea ed wi h 0 mm s okes o gene a e a ec o file.
The Kap on masks we e p oduced using a G aph ec ce6000-40
plo e , while he aluminum masks we e machined using a Haas
1 CNC milling machine. The subs a e was cleaned by soaking in ace one
o 5 min, insed unde a s eam o IPA o emo e he ace one be o e
being comple ely imme sed in a ba h o IPA o ano he 5 min. Finally,
he subs a e was insed wi h ul apu e wa e . No e, poo cleaning
can affec he adhesion o he spu e ed me al o he subs a e. The
cleaned subs a e and he mask we e placed in he spu e coa e wi h
a p eloaded Au spu e a ge . Vacuum was applied un il a p essu e
<0.8 mba was achie ed. The chambe was flushed h ee imes wi h
A o emo e any emaining oxygen. The A inle was opened and a
Figu e 3. A) Schema ic illus a ion o how he DNA sensing mechanism wo ks. B) O e layed CVs o he DNA sensing sys em esponse o diffe en a ge
DNA concen a ions on a mac oelec ode. O e layed wi h Squa e Wa e Vol amme y (SWV) da a om he expe imen s, shown in (C). The esul s o he
same expe imen , wi h lowe DNA a ge concen a ions on nanoband elec odes a e shown in (D) and (E). The condi ions o hese expe imen s a e se
ou in de ail in he expe imen al sec ion. F) The calib a ion cu es om he mac o and nanoelec ode epea s wi h co esponding fi s o he Langmui
iso he m. The ecip ocal o he peak signal was no malized be ween 0 and 1 p io o plo ing and fi ing.
Small 2023,19, 2302136 © 2023 The Au ho s. Small published by Wiley-VCH GmbH
2302136 (8 o 11)
16136829, 2023, 51, Downloaded om h ps://onlinelib a y.wiley.com/doi/10.1002/smll.202302136 by Csic O ganización Cen al Om (O icialia Mayo ) (U ici), Wiley Online Lib a y on [15/02/2024]. See he Te ms and Condi ions (h ps://onlinelib a y.wiley.com/ e ms-and-condi ions) on Wiley Online Lib a y o ules o use; OA a icles a e go e ned by he applicable C ea i e Commons License
www.ad ancedsciencenews.com www.small-jou nal.com
po en ial was applied o c ea e he a gon plasma and begin spu e ing.
By con olling he gas p essu e in he chambe (wi h he inle al e), he
cu en could be al e ed, which de e mined he a ge me al deposi ion
a e. In his p ojec , a 10 mA cu en was chosen and a deposi ion a e
o 5 nm min−1was p oduced. The du a ion o he spu e ing could
hen be used wi h his deposi ion a e o make de ices any desi ed
hickness. Once he spu e ing p ocess was finished, he chambe was
en ed and he subs a e was emo ed, see he Suppo ing In o ma ion
ideo.
Capping—Adhesi e ape:The eshly spu e ed de ice was fixed on o a
fla su ace. The ape was aligned and a small po ion was s uck o he wo k
su ace o aid he alignmen . The ape was hen d agged ac oss he su ace
o he de ice by hand, unde cons an p essu e o a oid he o ma ion o
bubbles. The excess ape was emo ed and he de ices we e aken on o
he nex s ep.
Sp ay Coa ing:The de ice was fixed on o a fla su ace. A plas ic mask
was used o define he a ea o be sp ay coa ed. The sp ay coa ing (in
his p ojec ac ylic) was applied as pe he manu ac u e ’s ins uc ions,
by shaking igo ously be o e use and sp aying om 20 cm abo e he de-
ice. The sp ay coa ing was epea ed h ice o ensu e a comple e co e ing
o he de ices be o e hey we e le o d y unde ambien condi ions o
20 min p io o use.
Lamina ion:The eshly spu e ed de ices we e placed on a shee o
pape . A p e-pa e ned lamina ion shee (PET, wi h an e hylene inyl ac-
e a e, EVA, inne coa ing) wi h pieces was cu ou o lea e exposed con ac
pads on he finished de ices, was aligned and placed on o he de ices. The
ensemble was hen un h ough a Lamiga o IQ (Renz, Spain), o lamina e
he de ices in a ho lamina ion p ocess whe e he EVA ac ed as a mel ad-
hesi e.
Cu ing:The diffe en cu ing me hods in es iga ed in his p ojec
we e o cu wi h a scalpel, scisso s, and a flin onic A4 pape cu e .
The blades o each de ice we e insed wi h IPA and d ied wi h N2p io
o each cu . A e epea ed use, he blades could ge blun and ei he
needed o be eplaced o sha pened. I is i al o ha e he capping lay-
e s acing away om he di ec ion o a el o he blade o a oid any
adhesi e being d agged o e he wo king a ea o he nanoband being
c ea ed.
Scalpel Cu ing:The de ices we e fixed ace down (wi h ape) on a
Model c a cu ing ma (RS componen s, Spain). A clean scalpel was used
o cu he de ices by hand by applying as e en and uni o m a p essu e as
possible wi h he blade pe pendicula o he ma in a single swi s oke
using he ma kings on he cu ing ma o guide he alignmen o he cu .
Scisso Cu ing:Mic oscopy (su gical) g ade scisso s we e needed as
con en ional office scisso s a e no sha p enough o his applica ion. The
de ices we e placed ace down wi h he egion ha was in ended o be cu
es ing on he bo om blade o he scisso s. The uppe blade was closed
quickly and smoo hly keeping i as pe pendicula o he de ice as possible.
Flin onic Pape Cu e :The de ices we e s uck ace down on he cu -
e su ace, using he alignmen ma kings on he su ace o ensu e he
blade was cu ing as s aigh ac oss he de ice as possible. The blade was
pushed down and d agged h ough he de ice a a uni o m speed and
p essu e. In his ins ance, i was held pe pendicula o he de ice by he
design o he ool.
Shee Resis ance o he Me als:The shee esis ances o he Au spu -
e ed on o diffe en subs a es we e measu ed using a Kei hley DMM6500
mul ime e in a 4-poin p obe mode. Pogo pins wi h a p essu e o 120 g
and a sepa a ion o 2.54 mm we e used. As is equi ed o de e min-
ing he shee esis ance o hin laye s, a co ec ion ac o o 4.53 and
a geome ic co ec ion ac o o 0.78 we e used when pe o ming hese
expe imen s.[43]
The e-beamed samples used as a con ol we e spu e ed on o a 4″Kap-
on subs a e using he same mask as was used in he spu e coa e .
35 nm o Au was deposi ed h ough he mask on o he subs a e using
an ATC-8E O ion e apo a o (AJA In e na ional Inc., USA).
AFM and SEM:The samples we e moun ed on SEM sample s ubs
using double sided conduc i e ca bon ape (TED Pella, INC), hese we e
hen loaded in o a The mo Fishe ( o me ly FEI) Quan a 650 FEG ESEM
o image acquisi ion using he backsca e elec ons de ec o unde low
acuum condi ions. In all he figu es p esen ed, he elec on beam in en-
si y, wo king dis ance, and magnifica ion we e s a ed.
AFM images we e ob ained h ough Molecula Imaging’s PicoPlus
modula Scanning P obe Mic oscope (SPM) sys em in combina ion wi h
he PicoScan Con olle and magne ic MAC Mode. PicoView 1.20 so wa e
was used du ing da a acquisi ion bu he analysis and co ec ions we e
pe o med in Gwyddion 2.61.
Elec ochemical Cha ac e iza ion:The elec odes we e cha ac e ized
by CV, squa e wa e ol amme y, and elec ochemical impedance spec-
oscopy. Unless s a ed o he wise, he ba e elec odes we e es ed in solu-
ions o 5 ×10−3m po assium e icyanide, 5 ×10−3m po assium e o-
cyanide, and 1x PBS e sus a sil e /sil e chlo ide e e ence elec ode and
P wi e coun e elec ode. CVs we e un be ween −0.1 and +0.45 V a a
scan a e o 10 mV s−1, o a o al o ou cycles. The squa e wa e ol am-
me y was un in he same se up immedia ely a e he CVs om −0.15
o +0.6 V e sus he open ci cui po en ial wi h a 9 mV s ep, a modula-
ion ampli ude o 20 mV, and a equency o 2.5 Hz. The elec ochemical
impedance spec oscopy was un wi h a dc ol age equal o he measu ed
open ci cui po en ial, wi h a 10 mV sinusoidal AC ol age o e a equency
ange o 100 kHz o 0.1 Hz, eco ding 10 equencies sp ead loga i hmi-
cally pe decade.
DNA Sensing:The DNA p obe was a hiol agged p ime app o ed by
he Cen e o Disease Con ol (CDC) o he de ec ion o SARS-CoV-2. The
sequences we e o de ed om Me ck (Spain) and we e as ollows:
P obe 5´- ACCCCGCATTACGTTTGGTGGACC-(C6SH)-3’
Ta ge 5´- GGTCCACCAAACGTAATGCGGGGT - 3’
The elec odes we e placed in an aqueous solu ion con aining 30 ×10−6
m 6-me cap ohexanol (MCH), 150 ×10−6m TCEP, and 1.5 ×10−6mo
he p obe DNA. The mac oelec odes we e le in his solu ion o he sel -
assembled monolaye o o m o 2 h, whe eas he nanoelec odes we e
le o 2 min, p io o insing wi h a s eam o wa e o emo e physiso bed
hiols.
Be o e and a e p obe film o ma ion, he elec odes we e placed in a
solu ion o 1x PBS wi h 10 ×10−3m MgCl2,5×10−3m po assium hex-
acyano e a e (III) and 5 ×10−3m po assium hexacyano e a e (II). CVs
we e un be ween −0.1 and +0.45 V e sus a Ag/AgCl e e ence elec ode
(mac o) o Au pseudo e e ence elec ode (nano) and P wi e coun e elec-
ode, a a scan a e o 10 mV s−1, o a o al o ou cycles. The squa e
wa e ol amme y was un in he same se up immedia ely a e he CVs
om −0.15 o +0.6 V e sus he open ci cui po en ial wi h a 9 mV s ep, a
modula ion ampli ude o 20 mV, and a equency o 2.5 Hz.
A e he p obe film was o med he unc ionalized elec odes we e
placed in solu ions con aining inc easing concen a ions o DNA a ge ,
o 20 min each. Be ween a ge incuba ions, he elec odes we e placed
in he measu emen solu ion, le o 20 min, and he elec ochemical mea-
su emen s we e epea ed. The DNA a ge concen a ions es ed we e di -
e ed o he mac o and nanoelec odes. Fo he mac oelec odes, he a -
ge DNA concen a ions es ed we e: 0 m, 1 ×10−15,1×10−12, 500 ×
10−12,1×10−9, 500 ×10−9,and1×10−6m. Fo he nanoelec odes, he
a ge concen a ions es ed we e 0 m, 10 ×10−21, 100 ×10−21, 500 ×
10−21,1×10−18,and1×10−15 m.
A con ol expe imen was un whe e he unc ionalized nanoelec odes
we e placed in MQ wa e a he han he inc easing DNA concen a ions,
o he same numbe o epea s. A second con ol was un whe e he unc-
ionalized elec odes we e exposed o noncomplimen a y DNA a ge se-
quences.
Lego-B ick Concep :The diffe en ab ica ion me hods o he diffe en
2D s acking designs (Lego b ick) assemblies o he nanoband elec odes
a e desc ibed below. In all hese cases, he subs a e cleaning, spu e ing,
and capping we e pe o med as desc ibed abo e.
2D Design:A mask was made ou o Kap on, see Figu e S2B in he
Suppo ing In o ma ion, in which h ee elec odes could be pa e ned on
a single de ice, unning pa allel o one ano he down he leng h o he
de ice. The h ee elec odes we e able o be used as a wo king elec ode,
pseudo e e ence elec ode, and coun e elec ode. In he mask shown in
Figu e S2B in he Suppo ing In o ma ion, he elec odes we e designed
o be he same size, 3 mm wide and 21 mm long wi h 1.5 mm sepa a ions
be ween hem.
Small 2023,19, 2302136 © 2023 The Au ho s. Small published by Wiley-VCH GmbH
2302136 (9 o 11)
16136829, 2023, 51, Downloaded om h ps://onlinelib a y.wiley.com/doi/10.1002/smll.202302136 by Csic O ganización Cen al Om (O icialia Mayo ) (U ici), Wiley Online Lib a y on [15/02/2024]. See he Te ms and Condi ions (h ps://onlinelib a y.wiley.com/ e ms-and-condi ions) on Wiley Online Lib a y o ules o use; OA a icles a e go e ned by he applicable C ea i e Commons License