Clinical and pathological findings associated with Mycobacteriosis in captive syngnathids

Citation: Montero, E.; Rojo-Solís, C.; de Castro, N.; Fernández, M.; Pérez, V.; Corpa, J.M.; Ortega, J. Clinical and Pathological Findings Associated with Mycobacteriosis in Captive Syngnathids. Animals 2022,12, 3259. https://doi.org/10.3390/ ani12233259 Academic Editor: Krzysztof Anusz Received: 14 October 2022 Accepted: 21 November 2022 Published: 23 November 2022 Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Copyright: © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). animals Article Clinical and Pathological Findings Associated with Mycobacteriosis in Captive Syngnathids Estefanía Montero 1, Carlos Rojo-Solís2, Noelia de Castro 3, Miguel Fernández 4, Valentín Pérez 4, Juan M. Corpa 1and Joaquín Ortega 1,* 1 Pathology Group, PASAPTA, Facultad de Veterinaria, Universidad Cardenal Herrera-CEU, CEU Universities, C/Tirant lo Blanc 7, Alfara del Patriarca, 46115 Valencia, Spain 2Veterinary and Laboratory Service, Oceanogràfic, Ciudad de las Artes y las Ciencias, C/Eduardo Primo Yúfera (Cientific) 1B, 46013 Valencia, Spain 3Veterinary Services, Aquarium Finisterrae, Paseo Marítimo Alcalde Francisco Vázquez 34, 15002 La Coruña, Spain 4 Departamento de Sanidad Animal, Instituto de Ganadería de Montaña (CSIC-ULE), Facultad de Veterinaria, Universidad de León, 24071 León, Spain *Correspondence: [email protected] Simple Summary: Syngnathids are teleost fish that include seahorses (Hippocampus ssp.), pipefishes (Syngnathus spp.), common seadragons (Phyllopteryx taeniolatus) and leafy seadragons (Phycodurus eques). Some species are currently threatened. Reproduction and maintenance in aquariaare complicated and highly contagious diseases, such as mycobacteriosis, can trigger numerous casualties. The most frequently common species observed in fish are Mycobacterium marinum,M. fortuitum and M. chelonae, which belong to the group of non-tuberculous mycobacteria. Stress factors, poor water quality, bad management and high population densities are associated with a higher prevalence of this disease. This study describes the clinical signs and granulomatous lesions associated with mycobacteriosis in syngnathids. M. fortuitum and Mycobacterium spp. were isolated in 4 and 14 syngnathids, respectively. Seven samples were positive against M. chelonae and M.marinum common primers. Considering the scarcity of pathological studies in syngnathids, these findings can help to improve the clinical management and survival of these animals in captivity. Abstract: Mycobacteriosis is an important disease that affects captive and wild aquatic fish. Syngnathids are susceptible to infection by non-tuberculous mycobacteria. The aim of this study was to describe clinical signs, and macroscopic and histological lesions in 25 syngnathids and the molecular characterization of the causative mycobacteria. Clinical presentation ranged from sudden death to non-specific signs, including anorexia, poor body condition, weight loss and marked dyspnea with increased respiratory effort and rate. Gross lesions were mostly ulcers on the tail and small white nodules in the liver, coelomic cavity and inside the eye. The most affected organs were gills, liver, intestine and coelomic mesentery. Microscopic lesions consisted of areas of multifocal to diffuse granulomatous inflammation and bacterial emboli with numerous intralesional acid-fast bacilli. Epithelioid cells, multinucleated giant cells, lymphocytes and fibrous connective tissue, which are commonly observed in granulomatous inflammation, were not observed here. In the real-time PCR, M. fortuitum,M. chelonae and M. marinum common primers, Mycobacterium spp. were detected in 4, 7 and 14 individuals, respectively. In addition, this is the first description of mycobacteriosis found in Syngnathus acus. Keywords: granuloma; mycobacteriosis; Mycobacterium chelonae;Mycobacterium fortuitum;Mycobacterium marinum; pathology; pipefish; sea dragon; seahorse; syngnathids Animals 2022,12, 3259. https://doi.org/10.3390/ani12233259 https://www.mdpi.com/journal/animals Animals 2022,12, 3259 2 of 13 1. Introduction Mycobacteriosis is a potentially fatal bacterial disease in wild and captive fish caused by the bacteria of the non-tuberculous mycobacteria (NTM) group [ 1 ]. Mycobacterium spp. belong to the family Mycobacteriaceae, order Actinomycetales [ 2 ]. They are non-motile, aerobic and pleomorphic bacilli usually identified with the Ziehl–Neelsen stain [ 3 ]. Many fish species are susceptible to severe fatal NTM infections [ 2 , 4 ]. Currently, Mycobacterium marinum,M fortuitum,M chelonae are the most common species in captive aquatic animals [2], together with M triviale,M avium,M abscessus and M peregrinum, which have been regularly reported in ornamental fish [ 5 – 8 ]. Generally, in fish species, the histological presentations are granulomas, formed by an occasional necrotic core bordered by a zone of epithelioid macrophages, few giant multinucleated cells, and lymphocytes. All these are surrounded by thin bands of fibrous connective tissue [ 9 , 10 ]. Mycobacteriosis is reported to be an acute to chronic disease in captive syngnathids, such as seahorses, sea dragons and pipefish, and is one of the main causes of mortality in these species [ 11 ]. In addition, syngnathids present an atypical granulomatous lesion compared to other teleosts with necrosis and large numbers of macrophages, but without giant cells, lymphocytes, epithelioid cells or fibrosis [ 3 , 12 ]. However, very few reports confirm these findings. Nowadays, all seahorse species are included in Appendix II of endangered species by CITES, which restricts the legal import and export of these animals [ 13 , 14 ]. Wild syngnathid populations currently face many threats, including habitat loss, pollution, climate change, competition with invasive species and direct exploitation in the form of overfishing and by-catches [ 15 , 16 ]. Given these circumstances, profound concern is voiced about their populations’ long-term viability in the wild, with some species classified as critically endangered, endangered, vulnerable and near-threatened by the IUCN [ 15 – 17 ]. Captive breeding and re-introduction programs have been applied for the last few decades in an attempt to reverse this trend [ 18 ]. However, the captive breeding of many species of syngnathids remains a challenge due to their susceptibility to diseases and management issues such as stress control, water quality management and high population densities [ 19 , 20 ]. As very little is known about the development of diseases in these animals in captivity, the objectives of this work were to: (i) provide a detailed description of the clinical and pathological findings associated with mycobacterial infections; (ii) identify the causative etiological agents. 2. Materials and Methods 2.1. Case Selection A search was conducted in the Veterinary Pathology Service facilities of the CEU Cardenal Herrera University (Valencia, Spain) from 2010 to 2022. All the animals were necropsied, and a full histological examination was performed. Out of 393 sygnathids, 25 showed histological lesions and special stains results consistent with mycobacteriosis and were included in this study. The selected syngnathids were referred from the Oceanogràfic Aquarium (Valencia, Spain) and the Finisterrae Aquarium (La Coruña, Spain). 2.2. Animal Husbandry Conditions Animals were maintained in aquarium display tanks or quarantine tanks in the differentaquaria, provided with artificial decoration and substrates. Water quality was warranted by mechanical and biological filtration systems, and was monitored daily by a multiparametric physical analysis, including temperature, pH, salinity, density, dissolved oxygen (DO) and oxidation reduction potential (ORP); biochemical analyses twice weekly, including ammonia (NH3), nitrite (NO2) and nitrate (NO3) concentrations. Water salinity and temperature settings varied depending on species, based on the normal characteristics found at their original geographical distribution; lighting was provided with LED lamps in a 12-h light-darkness cycle. Water disinfection was achieved with UV or ozone. Total aerobic mesophilic bacteria and Vibrio sp. concentrations were determined once every 3 months using standardized methods for water microbial analyses. Animals 2022,12, 3259 3 of 13 The food offered also varied with species but was composed mainly of live or frozen mysids (Mysis sp.) and live or frozen artemia (Artemia salina). Live mysids were collected from naturally occurring salt evaporation ponds or other tanks in aquaria, while artemia was reared from commercially available eggs hatched in the facilities and used in the larval (nauplii) or adult stages depending on syngnathid age and size. Artemia was enriched with fatty acids or garlic extract, offered alternately toward a more complete diet. Healthy and sick animals were checked daily by the aquarium staff. 2.3. Necropsy and Histology All animals used on this study were deceased syngnathids, on which a complete external examination, including skin scrapes and gills biopsy, was carried out by the referring veterinarians at the Oceanogràfic Aquarium, Valencia, Spain (C. Rojo-Solís) and the Finisterrae Aquarium, A Coruña, Spain (N. Castro). Animals were classified as adults or juveniles based on the snout to tail-tip length and sex determined based on the presence/absence of brood pouch. In this study, all animals were adults (over 3 cm of snout to tail-tip length), the coelomic cavity was opened and the whole carcass was immersed in 10% neutral-buffered formalin for 24 h. Time from death to post-mortem examination and fixation was less than 12 h. All the syngnathids fixed specimens were sent to the Veterinary Pathology Service at the CEU Cardenal Herrera University (Valencia, Spain). After fixation, specimen necropsy was performed. The skeleton was decalcified using 4% nitric acid for 1–4 h depending on the animal’s size. Animals measuring less than 5 cm in length decalcified within 1 h. In contrast, animals that exceeded 5 cm in length up to 15 cm were decalcified for 2–4 h. All the tissues were processed routinely, embedded in paraffin and hematoxylin and eosin (H & E)-stained. Additional stains on selected tissues, including acid-fast Ziehl–Neelsen (ZN) and Gram stains, were performed. The histological sections were examined by light microscopy. Animals were considered infected if acid-fast bacilli were found during the microscopic examination. The most common diagnostic tool for mycobacterioses in fish involves culture. However, the culture in this study is not possible because the samples were fixed in formalin. 2.4. Molecular Identification DNA was extracted from ZN-positive and paraffin-embedded samples with Maxwell ® RSC FFPE Plus DNA Kit (Promega ® , Madison, WI, USA) following manufacturer’s instructions for later testing with mycobacteria-specific Real Time (RT)-PCR assays. Extracted DNA was diluted at 50 ng µ L −1 . Products were stored at − 20 ◦ C prior to mycobacteria detection. The employed primers were designed for the screening of Mycobacterium avium subsp. paratuberculosis IS900; Mycobacterium avium subsp. avium IS901; Mycobacterium marinum,M chelonae and M fortuitum shared 16S-23S internal transcribed spacer (ITS); M lepraemurium and M fortuitum ITS sequences. PCR reactions were performed using 20 µ L of the SYBR ® Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 0.2 µ M of each primer, and 50 ng of diluted DNA samples in the ABI 7500 fast Real-time PCR system (Applied Biosystems ® , Waltham, MA, USA) with the following parameters 95 ◦ C for 30 s (sec) ( × 1); 95 ◦ C for 5 sec ( × 1); 60 ◦ C for 34 sec ( × 40); 95 ◦ C for 15 sec and 60 ◦ C for 1 min and cold for store (Table 1). Animals 2022,12, 3259 4 of 13 Table 1. Primers designed for the different sequences used in this study. Reverse and primer concentrations: 0.2 µM. PCR master mix final volume: 20 µL. Amplification product size: 254-bp. Species (Gene) Primer Design Mycobacterium avium subsp. paratuberculosis (IS900) [21]F:GATCGGAACGTCGGCTGGTCAGG R:GATCGCCTTGCTCATCGCTGCCG Mycobacterium avium subsp. avium (IS901) [22]F:AAGCCGAGGTGGTGTATGT R:AGCGAAGATGGCGGTGAGCAT Mycobacterium marinum (16S-23S ITS) [23]F:CACCACGAGAAACACTCCAA R:ACATCCCGAAACCAACAGAG M marinum-M fortuitum-M chelonae (16S-23S ITS) [24]F:GCTGGATCACCTCCTTTCTA R:AGATGCTCGCAACCACTAT M lepraemurium (16S rRNA) [25]F:GAATATTGCACAATGGGCGCAG R: AAACCCGGACCTTCGTCGATA oneM fortuitum (16S-23S ITS) [26]F:GACTGCCAGACACACTATTGG R:GTGAGACCACACGATTCTGC Superscripts [21–26]: references of each specie’s primer design. The RT-PCR results were analyzed using 7500 Software v2.0.6 (Applied Biosystems ® , Waltham, MA, USA). Furthermore, positive results were considered when dissociation peak (Tm) was 89.1 ± 1.5 ◦ C and threshold cycles (Ct) were < 37. Positive samples from ruminants, bird, Nile crocodile, environment and cat have been included for each etiology sought. 3. Results 3.1. Clinical Signs and Management The clinical presentation in the affected animals varied from sudden death without previous symptoms (n = 9 animals) to nonspecific clinical signs (n = 16 animals), including anorexia, poor body condition and weight loss, marked dyspnea with increased respiratory effort and rate and, finally, prostration and death. As making an ante-mortem diagnosis is difficult in these species, treatment was attempted in some individuals under the critical condition with broad-spectrum antibiotics (ceftazidime), vitamin supplements (vitamin B complex) and corticoids (dexamethasone), but was unsuccessful. In the moderately dyspneic individuals, water hyperoxygenation was performed. Nonetheless, animals died a few weeks later. Animals from both sexes were evenly affected. 3.2. Gross and Histopathological Findings Upon external examination of unfixed specimens and necropsy, only eight (32%) of the 25 animals presented macroscopic findings. Gross findings consisted of large amounts of mucus in gills (n = 8), poor body condition due to loss of fatty deposits (n = 7), soft exoskeleton (n = 4) and 2–5 mm ulcers on tails (n = 4) (Figure 1a). Variable sized nodules were observed in the eye (n = 2), coelomic cavity (n = 1) and the liver (n = 1). In the eye, white nodules (1–2 mm) were observed inside the eye to cause exophthalmia (Figure 1b). One seahorse showed a whitish, irregular and slightly raised area of skin at the level of the coelomic cavity (Figure 1c). A longitudinal section revealed a 1 cm diameter nodule attached to the coelomic wall that raised the skin (Figure 1c; insert). In the liver, 1–2 mm nodules with a multifocal to coalescent distribution and raised contour were also observed, which deepened in the section (Figure 1d). In all the other infected animals (n = 17), no gross lesions were observed. Animals 2022,12, 3259 5 of 13 Animals 2022, 12, x FOR PEER REVIEW 5 of 13 Figure 1. Gross lesions of syngnathids with mycobacteriosis. (a) Hippocampus reidi with a 4 mm diameter red ulcer on the tail (arrow). (b) Seahorse H. guttulatus with mild exophthalmia and opaque appearance of the right eye. Inset: Cross-section of the white eye shows a 3 mm retrobulbar white nodule displacing the eye (arrow). (c) H.s guttulatus with white and raised skin due to the presence of a 1 cm nodule in the coelomic cavity (arrow). Inset: Cross-section reveals a 1 cm nodule with raised contour and firm consistency originating from coelomic cavity the wall (asterisk). (d) Weedy seadragon (Phyllopteryx taeniolatus) with 1 mm white multifocal to coalescing nodules in the liver (asterisk). All the animals in the study (n = 25) showed histological lesions located in gills (n = 22), the liver (n = 18), intestine (n = 15), coelomic mesentery (n = 15), kidney (n = 9), heart (n = 8), skeletal muscle (n = 4), skin (n = 4), brain (n = 3), eye (n = 2), gas gland (n = 1), swim bladder (n = 1) and ovary (n = 1) (Table 2). In the aforementioned organs, histological lesions were similar and characterized by a nodular to diffuse granulomatous inflammation composed of acid-fast bacteria-laden macrophages admixed with cellular debris and bacterial emboli (Figure 2a–c). Nodules were expansive and poorly demarcated due to the absence of external fibrous tissue. No multinucleated giant cells, lymphocytes or epithelioid cells were observed. Gills were the most affected organ, where granulomatous inflammation with a nodular pattern was observed, and lamellar capillaries were distended and occluded by bacterial nodules (Figure 2b). In addition to emboli, thrombi were observed to produce vasculitis in the coelomic mesentery (Figure 2d). The hearts of all the animals presented numerous bacterial emboli, which were even observed both with routine stains (H & E) and with ZN within the heart chambers (Figure 2e). Skin presented granulomatous inflammation with a more diffuse pattern (Figure 2f). In the three cases in which the brain was affected, the presence of asymmetric inflammation in both cerebral hemispheres replaced the nervous tissue (Figure 2g). In two eyes, asymmetry was observed due to the Figure 1. Gross lesions of syngnathids with mycobacteriosis. ( a )Hippocampus reidi with a 4 mm diameter red ulcer on the tail (arrow). ( b ) Seahorse H. guttulatus with mild exophthalmia and opaque appearance of the right eye. Inset: Cross-section of the white eye shows a 3 mm retrobulbar white nodule displacing the eye (arrow). ( c )H.s guttulatus with white and raised skin due to the presence of a 1 cm nodule in the coelomic cavity (arrow). Inset: Cross-section reveals a 1 cm nodule with raised contour and firm consistency originating from coelomic cavity the wall (asterisk). ( d ) Weedy seadragon (Phyllopteryx taeniolatus) with 1 mm white multifocal to coalescing nodules in the liver (asterisk). All the animals in the study (n = 25) showed histological lesions located in gills (n = 22), the liver (n = 18), intestine (n = 15), coelomic mesentery (n = 15), kidney (n = 9), heart (n = 8), skeletal muscle (n = 4), skin (n = 4), brain (n = 3), eye (n = 2), gas gland (n = 1), swim bladder (n = 1) and ovary (n = 1) (Table 2). In the aforementioned organs, histological lesions were similar and characterized by a nodular to diffuse granulomatous inflammation composed of acid-fast bacteria-laden macrophages admixed with cellular debris and bacterial emboli (Figure 2a–c). Nodules were expansive and poorly demarcated due to the absence of external fibrous tissue. No multinucleated giant cells, lymphocytes or epithelioid cells were observed. Gills were the most affected organ, where granulomatous inflammation with a nodular pattern was observed, and lamellar capillaries were distended and occluded by bacterial nodules (Figure 2b). In addition to emboli, thrombi were observed to produce vasculitis in the coelomic mesentery (Figure 2d). The hearts of all the animals presented numerous bacterial emboli, which were even observed both with routine stains (H & E) and with ZN within the heart chambers (Figure 2e). Skin presented granulomatous inflammation with a more diffuse pattern (Figure 2f). In the three cases in which the brain was affected, the presence of asymmetric inflammation in both cerebral hemispheres Animals 2022,12, 3259 6 of 13 replaced the nervous tissue (Figure 2g). In two eyes, asymmetry was observed due to the presence of inflammation, which affected the periocular area that compressed and infiltrated eyes. Inflammation extended to the choroid and cornea and caused the retina to rupture (Figure 2h). Table 2. Animals, samples studied and mycobacterial identification by PCR. Syngnathids Species Sex Date of Sampling Acute or Chronic Presentation Clinical Signs and Gross Changes Affected Tissue Bacterial Load Identified Microorganism 1 Seahorse Hippocampus guttulatus Female 03/11/2020 Chronic Dyspnea mucus in gills, tail ulcer Liver, skin, kidney, gills, intestine, heart Mild to moderate M chelonae, M marinum 2Hippocampus guttulatus Female 30/09/2020 Acute Sudden death Liver, intestine, heart Moderate M fortuitum 3Hippocampus guttulatus Male 19/02/2021 Chronic Dyspnea, mucus in gills Liver, heart, intestine, gills Moderate M chenolae, M marinum 4Hippocampus guttulatus Male 17/02/2021 Chronic Dyspnea, mucus in gills tail ulcer, poor body condition Liver, intestine, skeletal muscle, kidney, skin, gills, heart, blood vessel Moderate M chelonae, M marinum 5Hippocampus guttulatus Female 17/03/2021 Chronic Dyspnea, mucus in gills, white eye, exophthalmia Liver, intestine, kidney, gills, eye Mild to moderate M fortuitum 6Hippocampus guttulatus Male 24/05/2021 Acute Sudden death Liver, intestine, gills, heart Moderate M chenolae, M marinum 7Hippocampus guttulatus Male 05/09/2021 Chronic Tail ulcer, soft exoskeleton, mucus in gills Liver, intestine, gills, heart, skin Mild to moderate Mycobacterium sp. 8Hippocampus guttulatus Male 11/08/2021 Chronic Coelomic cavity mass, poor body condition Liver, intestine, skeletal muscle, kidney, gills Mild to moderate M chenolae, M marinum 9Hippocampus guttulatus Male 25/08/2021 Chronic White eye, exophthalmia, mucus in gills Liver, intestine, skeletal muscle, kidney, skin, heart, gills, blood vessel, brain Moderate M chenolae, M marinum 10 Hippocampus reidi Female 08/12/2020 Acute Sudden death Gills, blood vessel Moderate to severe Mycobacterium sp. 11 Hippocampus reidi Female 13/01/2021 Acute Sudden death Liver, gills Moderate Mycobacterium sp. 12 Hippocampus reidi Male 02/02/2021 Chronic Poor body condition Liver, intestine, gills, blood vessel Moderate Mycobacterium sp. 13 Hippocampus reidi Male 14/4/2021 Chronic Soft exoskeleton Liver, intestine, skeletal muscle, gills, brain Moderate Mycobacterium sp. 14 Hippocampus reidi Female 12/03/2021 Chronic Poor body condition Liver, intestine, kidney, gills, brain Mild to moderate Mycobacterium sp. 15 Hippocampus reidi Female 18/08/2021 Chronic Tail ulcer, soft exoskeleton, mucus in gills Kidney, skin, gills, brain, blood vessel Moderate Mycobacterium sp. Animals 2022,12, 3259 7 of 13 Table 2. Cont. Syngnathids Species Sex Date of Sampling Acute or Chronic Presentation Clinical Signs and Gross Changes Affected Tissue Bacterial Load Identified Microorganism 16 Seahorse Hippocampus reidi Female 16/09/2021 Chronic Dyspnea, mucus in gills Liver, kidney, gills, brain Moderate Mycobacterium sp. 17 Hippocampus abdominalis Male 18/05/2018 Acute Sudden death Liver, intestine, gills Moderate Mycobacterium sp. 18 Hippocampus abdominalis Female 11/07/2018 Chronic Poor body condition Gills, eye, swim bladder Mild to moderate Mycobacterium sp. 19 Hippocampus abdominalis Female 26/02/2021 Acute Sudden death Gills, blood vessel Moderate to severe Mycobacterium sp. 20 Hippocampus abdominalis Male 23/04/2021 Acute Sudden death Gills, blood vessel Moderate M fortuitum 21 Pipe fish Syngnathus acus Female 11/07/2018 Acute Sudden death Gills, blood vessel Moderate Mycobacterium sp. 22 Syngnathus acus Female 05/04/2021 Chronic Soft exoskeleton Liver, intestine, gills, gas gland Mild to moderate Mycobacterium sp. 23 Syngnathoides biaculeatus Male 16/07/2018 Acute Sudden death Gills, blood vessel Moderate M chenolae, M marinum 24 Seadragon Phyllopteryx taeniolatus Female 8/07/2018 Chronic Poor body condition Liver, kidney, ovary Mild to moderate Mycobacterium sp. 25 Phyllopteryx taeniolatus Female 25/01/2021 Chronic Poor body condition Liver, intestine, gills, heart, kidney Mild to moderate M fortuitum Animals 2022,12, 3259 8 of 13 Animals 2022, 12, x FOR PEER REVIEW 8 of 13 Figure 2. Microscopic lesions of syngnathids with mycobacteriosis. (a) Coelomic mesentery. Phyllopteryx taeniolatus with nodular to diffuse granulomatous inflammation and necrotic debris (asterisk). H & E stain 40x. (b) Gills. Syngnathus acus with lamellar capillary distended and occluded by bacterial emboli (arrow). H & E; 60x. (c) Liver with numerous acid-fast bacteria-laden macrophages (). Ziehl–Neelsen stain; 60x. (d) Mesenteric tissue. Syngnathus acus with a thrombus formed by macrophages adhered to the wall of a mesenteric tissue vessel (arrow). (e) Heart. Syngnathus acus with Figure 2. Microscopic lesions of syngnathids with mycobacteriosis. ( a ) Coelomic mesentery. Phyllopteryx taeniolatus with nodular to diffuse granulomatous inflammation and necrotic debris (asterisk). H & E stain 40 × . ( b ) Gills. Syngnathus acus with lamellar capillary distended and occluded by bacterial emboli (arrow). H & E; 60 × . ( c ) Liver with numerous acid-fast bacteria-laden macrophages. Animals 2022,12, 3259 9 of 13 Ziehl–Neelsen stain; 60 × . ( d ) Mesenteric tissue. Syngnathus acus with a thrombus formed by macrophages adhered to the wall of a mesenteric tissue vessel (arrow). ( e ) Heart. Syngnathus acus with bacterial emboli in the lumen of the heart ventricle (asterisk). H & E; 10 × . ( f )Hippocampus reidi with replacement of collagen fibers in the skin by macrophages and necrosis (arrow). H & E stain; 20 × . ( g ) Brain. Hippocampus guttulatus showing an asymmetric inflammation in cerebral hemispheres composed of macrophages and necrotic debris that replace the neuropil (asterisk). H & E stain; 2 × . ( h ) Eye. Hippocampus guttulatus with asymmetrical eyes due to the presence of periocular granulomatous inflammation that infiltrated and ruptured the right eye (arrow). H & E stain; 2×. 3.3. Bacterial Identification by PCR Of the total of 25 samples studied by RT-PCR, seven samples were positive after using M. chelonae,M. fortuitum and M. marinum common 16-23S primers. Among them, four were also confirmed positive after the amplification of M. fortuitum primers. There were also unspecific samples (n = 14), only designated as Mycobacterium sp. since late Ct value was seen both for M. avium avium and M. marinum primers. None of the studied etiologies were found in the rest of the animals (n = 10) (Table 2). Positive results were considered when dissociation peak (Tm) was 89.1 ± 1.5 ◦ C and threshold cycles (Ct) were < 37 for each target and amplification plot. 4. Discussion The infections caused by non-tuberculous mycobacteria are common throughout aquatic species, probably due to their ubiquitous presence, particularly in the aquatic environment [ 2 ]. Although all fish species can be susceptible to mycobacteriosis, members of the families Anabantidae, Characidae, Cyprinidae, Cichlidae and Syngnathidae are most commonly reported [3,18,21]. Syngnathids are highly valuable teleosts and mycobacteriosis is an important disease [ 18 ]. In our study, the presence of animals with mycobacteriosis accounted for only 6.4% of the cases (25 out of 393), which is a much lower rate than similar previously reported studies (15%, 25 out of 172) [ 11 ]. This difference could be related to the tank conditions in the different aquaria because water treatment with UV or ozone can decrease the prevalence of Mycobacteria. The species of syngnathids in which mycobacteriosis was observed included H. guttulatus,H. reidi,H. abdominalis,S. acus,S. biaculeatus and P. taeniolatus. To the authors’ knowledge, mycobacteriosis has not been previously described in S. acus, which would mean that this is its first description in this species. The clinical presentation observed in this study was variable and appeared in two main manifestations: an acute presentation without apparent clinical signs causing sudden death and a chronic course. The chronic course was associated with weight loss, anorexia, marked dyspnea with increased respiratory effort and rate, and prostration. Variability of clinical signs between species has been shown and may be related to the immunity, bacterial quantity, location and severity of the lesion. As these clinical findings are very nonspecific, the diagnosis of mycobacteriosis cannot be made, or even suspected, without performing a necropsy and histological studies. Some of the above-cited clinical signs in syngnathids, including lethargy, poor appetite, abdominal swelling, ascites, scale loss and dermal ulcerative necrosis, exophthalmia, blindness and pale gills, as well as skeletal deformities, such as spinal curvature or stunted growth, are similar in other teleosts with mycobacteriosis [ 2 ]. It is important to highlight the importance of the acute clinical presentation observed in our study, which is contrary to what occurs in other animal species. Syngnathids that did not show clinical signs are likely to be associated with an acute presentation, whereas animals that did show clinical signs are likely to be associated with a chronic presentation. Animals with an acute presentation presented moderate to severe bacterial load affecting few organs. On the other hand, animals with chronic presentation showed a moderate bacterial load affecting many organs. Therefore, there could be an association between the clinical signs, the course of the pathology (acute