scieee AI-readable full text Open interactive document viewer

NADPH Oxidase 5 (NOX5) Upregulates MMP-10 Production and Cell Migration in Human Endothelial Cells

Marqués, Javier,Ainzúa, Elena,Orbe, Josune,Martínez-Azcona, María,Martínez-González, José,Zalba, Guillermo

Abstract

This work was supported by the departments of Health (40/2021) University, Innovation and Digital Transformation (Proyectos I + D colaborativos 2020-PC159/160/161, NOXICTUS) from the Government of Navarra, by the Spanish Ministry of Science and Innovation (Instituto de Salud Carlos III-Fondo de Investigaciones Sanitarias, PI22/01450; PID2021-122509OB-I00 funded by MCIN/AEI/10.13039/501100011033 and by “ERDF A way of making Europe”). E.A. and J.M. were supported by an FPU PhD Grant from the Spanish Ministry of Universities (FPU21/03340 and FPU19/01807, respectively).

Full text

Citation: Marqués, J.; Ainzúa, E.; Orbe, J.; Martínez-Azcona, M.; Martínez-González, J.; Zalba, G. NADPH Oxidase 5 (NOX5) Upregulates MMP-10 Production and Cell Migration in Human Endothelial Cells. Antioxidants 2024,13, 1199. https://doi.org/10.3390/ antiox13101199 Academic Editor: Alessandra Napolitano Received: 4 July 2024 Revised: 26 September 2024 Accepted: 29 September 2024 Published: 3 October 2024 Copyright: © 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). antioxidants Article NADPH Oxidase 5 (NOX5) Upregulates MMP-10 Production and Cell Migration in Human Endothelial Cells Javier Marqués1,2,† , Elena Ainzúa1,2,†, Josune Orbe 1,3,4 , María Martínez-Azcona 1,2, JoséMartínez-González 5,6,7 and Guillermo Zalba 1,2,* 1Navarra Institute for Health Research (IdiSNA), 31008 Pamplona, Spain; [email protected] (J.M.); [email protected] (E.A.); [email protected] (J.O.); [email protected] (M.M.-A.) 2Department of Biochemistry and Genetics, University of Navarra, 31009 Pamplona, Spain 3Atherothrombosis Laboratory, Cardiovascular Diseases Program, CIMA (University of Navarra), 31008 Pamplona, Spain 4RICORS-Ictus, Carlos III Health Institute, 28029 Madrid, Spain 5Instituto de Investigaciones Biomédicas de Barcelona-Consejo Superior de Investigaciones Científicas (IIBB-CSIC), 08036 Barcelona, Spain; [email protected] 6CIBER de Enfermedades Cardiovasculares (CIBERCV), Instituto de Salud Carlos III (ISCIII), 28029 Madrid, Spain 7Institut de Recerca Sant Pau (IR SANT PAU), 08041 Barcelona, Spain *Correspondence: [email protected]; Tel.: +34-948-425-600 †These authors contributed equally to the work. Abstract: NADPH oxidases (NOXs) have been described as critical players in vascular remodeling, a mechanism modulated by matrix metalloproteinases. In this study, we describe for the first time the upregulation of MMP-10 through the activation of NOX5 in endothelial cells. In a chronic NOX5 overexpression model in human endothelial cells, MMP-10 production was measured at different levels: extracellular secretion, gene expression (mRNA and protein levels), and promoter activity. Effects on cell migration were quantified using wound healing assays. NOX5 overexpression increased MMP-10 production, favoring cell migration. In fact, NOX5 and MMP-10 silencing prevented this promigratory effect. We showed that NOX5-mediated MMP-10 upregulation involves the redox-sensitive JNK/AP-1 signaling pathway. All these NOX5-dependent effects were enhanced by angiotensin II (Ang II). Interestingly, MMP-10 protein levels were found to be increased in the hearts of NOX5-expressing mice. In conclusion, we described that NOX5-generated ROS may modulate the MMP-10 expression in endothelial cells, which leads to endothelial cell migration and may play a key role in vascular remodeling. Keywords: oxidative stress; NADPH oxidase 5; MMP-10; AP-1; cell migration; endothelial cells 1. Introduction Oxidative stress is one of the molecular mechanisms that triggers inflammation and causes endothelial dysfunction. Among all the reactive oxygen species (ROS) sources, NADPH oxidases (NOXs) play a relevant role in the human vascular wall [ 1 , 2 ]. NOXs have also been proposed as key players in endothelial inflammation, with different roles depending on the specific isoform [ 3 ]. Indeed, while NOX1 and NOX2 play pathological roles in atherosclerosis [4–8], NOX4 seems to be protective [9,10]. NOX5 is the most recently discovered and least studied member of the NOX family. However, its regulation by vascular and inflammatory stimuli such as glucose, angiotensin II (Ang II), or interferonγ suggests a potential role in endothelial dysfunction [ 11 ]. The NOX5 protein has been localized in immune cell-infiltrated areas of human atherosclerotic plaques [ 12 ], and both NOX5 expression and activity have been found to be increased in carotid artery disease [ 13 ]. Our group has recently linked NOX5 overexpression with endothelial dysfunction. In endothelial cells, NOX5 promotes apoptosis, mitochondrial Antioxidants 2024,13, 1199. https://doi.org/10.3390/antiox13101199 https://www.mdpi.com/journal/antioxidants Antioxidants 2024,13, 1199 2 of 19 dysfunction, and cell migration but inhibits cell proliferation [ 14 ]. We have demonstrated that NOX5 promotes an inflammatory response in immortalized human aortic endothelial cells by increasing cyclooxygenase-2 expression and prostaglandin E2secretion [15]. Matrix metalloproteinases (MMPs) regulate the composition of the extracellular matrix (ECM). The balance between MMPs and their inhibitors (TIMPs) modulates vascular ECM; however, the disturbance of this balance can lead to vessel wall damage and atherosclerosis [ 16 , 17 ]. For instance, MMP-10 has been linked to valve calcifications in patients with aortic stenosis [ 18 ]. MMP-10 also seems to be involved in the genesis of atherosclerotic plaques. In a knock-out model for ApoE and MMP-10, a reduction in the atherosclerotic lesion size, plaque calcification, and the expression of inflammatory markers were observed. In the same study, MMP-10 expression was associated with calcified areas of atherosclerotic plaques. Additionally, MMP-10 serum levels correlated with coronary calcification in subjects with subclinical atherosclerosis [19]. ROS production derived from NOXs has been associated with MMP activity in the ECM and the vascular context. NOXs play a role in vascular structure by modulating the MMP-12/TIMP-1 expression ratio [ 20 ]. Additionally, NOX2 inhibition reduced atherosclerotic plaque development, which was accompanied by a decrease in MMP-9 activity [ 21 ]. There is scarce information on a potential relationship between NOX5 and any MMP. Nonetheless, high glucose-induced oxidative stress in human glomerular mesangial cells via NOX5 activation promoted the accumulation of ECM-related proteins (collagen I, collagen IV, and fibronectin), effects that were prevented by NOX5 silencing [ 22 ]. NOX5 expression in vascular smooth muscle cells (VSMCs) and mesangial cells had similar effects on ECM-related protein levels in diabetic Akita mice [ 23 ]. Furthermore, ECM proteins accumulated in a diabetic nephropathy model of mice expressing NOX5 in the mesangial cells [24]. Collectively, these studies indicate that NOX5 plays a role in ECM remodeling. In a recent study, a transcriptomic array analysis showed that MMP-10 was the most upregulated MMP transcript in human aortic endothelial cells overexpressing NOX5 [ 25 ]. These data suggest that NOX5 could impact ECM remodeling by activating MMP-10 production. Interestingly, several studies demonstrate that Ang II is a key factor in ECM remodeling mediated by MMP activation [ 26 ]. Based on this evidence, we hypothesize that NOX5-derived ROS might regulate MMP-10 production, potentially modulating ECM composition. 2. Materials and Methods 2.1. Cell Culture Human aortic endothelial cells immortalized via hTERT expression (TeloHAEC) were purchased from ATCC ® (American Type Culture Collection, Manassas, VA, USA). TeloHAEC were maintained and grown using vascular cell basal medium with Endothelial Cell Growth kit-VEGF (ATCC ® ) at 37 ◦ C and 5% CO 2 . The cell medium was supplemented with penicillin, streptomycin, and gentamicin (Sigma Aldrich, Saint Louis, MO, USA). From this clonal cell line three different in vitro approaches were performed: (i) teloHAEC silenced with siRNA against NOX5 (siNOX5) or MMP-10 (siMMP-10); (ii) teloHAEC infected with NOX5β adenoviral particles to generate an acute overexpression model; and (iii) teloHAEC transfected with a NOX5β expression plasmid to generate a chronic overexpression model. 2.2. MMP-10 and NOX5 Specific Silencing Three different siRNAs were used: siMMP-10 (sc-41555, Santa Cruz Biotechnology, Dallas, TX, USA), siNOX5 (5 ′ -GGAGUGUGACAAUGAGAAAUC-3 ′ ) (designed by the group), and the non-targeting siCtrl (Thermo Fisher Scientific Inc. ® ). Transfection was performed using lipofectamine 3000 (Thermo Fisher Scientific Inc. ® ) and 50 nM of siRNA as a final concentration in the cell medium. Antioxidants 2024,13, 1199 3 of 19 2.3. NOX5 Acute Overexpression Model A NOX5-encoding adenovirus was used to generate the acute overexpression model. This adenovirus codifies for NOX5β cDNA sequence and has previously been used in this cell line [ 15 ]. Briefly, adenoviral particles were diluted in vascular cell basal medium (ATCC ® ) supplemented with 2% fetal bovine serum and antibiotics. This solution was added to teloHAEC for 3 h at a multiplicity of infection 50 (MOI50). After that time, the solution was replaced with a fresh medium. Infection timings are calculated from the moment when adenoviruses are added to the cell culture in a solution of vascular cell basal medium. 2.4. NOX5 Chronic Overexpression Model TeloHAEC were transfected with pcDNA3.2-NOX5β expression vector [ 27 ], or with the pcDNA3.2 control vector (Mock), an approach that allowed us to generate the tHNOX5 and tHMock cell lines, respectively. Half a million teloHAEC cells were seeded in two different wells and were transfected with 1 µ g of plasmid using the Lipofectamine 3000 TM system (L3000001, Thermo Fisher Scientific Inc. ® , Waltham, MA, USA). Transfected cells were selected with 100 µ g/mL geneticin (11811023, Gibco TM , Thermo Fisher Scientific Inc. ® ) for two months. Sequences of the plasmids used for cell line generation are included in the Supplementary Materials section. 2.5. Cell Culture Reagents Ang II (A-9525, Sigma Aldrich) was used at a final concentration of 0.1 µ M to stimulate NOX5-infected cells and 0.25 µ M to stimulate the stable cell lines. The p38 MAPK inhibitor (ab145872, Abcam ® , Waltham, MA, USA), JNK MAPK inhibitor (JNK-IN-8, SML1246, Sigma Aldrich), and ERK MAPK inhibitor (PD98059, 9900S, Cell Signaling Technology, Danvers, MA, USA) were used at final concentrations of 5 µM in the cell medium. 2.6. Wound Healing Assay In this assay 500,000 cells/well were seeded overnight. The day after, three scratches were performed in each well, and pictures were taken at different timings using a Nikon SMZ18 light microscope (Nikon, Tokyo, Japan). In the cases where Ang II stimulation or MAPK inhibition was used, they were added right after making the wound. Migration capacity was measured as the % of scratched surface healed between the captured images, which was quantified using Image J®(v 1.53) software (NIH, Bethesda, MD, USA). 2.7. RNA Isolation, Reverse-Transcription and qPCR Total RNA was extracted from 500,000 cells seeded in 6-well plates. The cell medium was removed, and the cells were washed with pre-cold PBS (10010023, Gibco TM ). Subsequently, 1 mL of TRIzol (15595026, Thermo Scientific ® ) was added per well. RNA was extracted using standard protocols with organic solvents and was resuspended in 20 µ L of DEPC-treated water (AM9915G, Thermo Scientific ® ). One µ g of each RNA sample was used for reverse transcription with SuperScript III Synthesis Kit (18080085, Thermo Scientific ® ). These cDNA samples were used for quantitative PCR (qPCR) with iQ SYBR Green (1708880, Bio-Rad ® , Hercules, CA, USA) in an iQ5 Multicolor Real-Time PCR Detection System (Bio-Rad ® ). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene, and each reaction was performed in triplicate. The specific primers for cDNA amplification are summarized in Table 1. 2.8. gDNA Extraction and Cell Line Genotyping For genomic DNA (gDNA) extraction, 500,000 cells were seeded in 6-well plates overnight. The following day, trypsin was added, and cells were detached and centrifuged for 5 min at 130 × g. Cell pellets were resuspended in 1 × KAPPA Extraction Buffer, and the KAPPA ® Express Extract kit (KK7103, Kapa Biosystems, Merck KGaA ® , Darmstadt, Antioxidants 2024,13, 1199 4 of 19 Germany) was used for gDNA obtention. DNA concentration and quality were measured using a Nanodrop ND-1000 spectrophotometer (Thermo Scientific®). Table 1. Specific primers were used for qPCR amplification. Gene Name Accession Number Sequence (5′-3′)Product Size (bp) Annealing T (◦C) NOX1 NM_007052.5 Forward CTACCTCCCACCCCAAGTCT 227 60 Reverse TGACTGCTCAAACCTGACGA NOX2 NM_000433.4 Forward CTGTGAATGAGGGGCTCTCC 340 60 Reverse GCAATGGTGTGAATCGCAGA NOX4 NM_016931.5 Forward CTGTATTTTCTCAGGCGTGCAT 113 60 Reverse CCTCATCTCGGTATCTTGCTGC NOX5 NM_024505.4 Forward TAAGAGGCTGTCGAGGAGTGT 71 60 Reverse CCAAAAGTATCTCAGAGCCCTTG SOD1 NM_000454.5 Forward GAAGAGAGGCATGTTGGAGAC 240 59 Reverse GAATGTTTATTGGGCGATCC SOD2 NM_000636.4 Forward GTTGGCCAAGGGAGATGTT 171 61 Reverse TCAAAGGAACCAAAGTCACG MMP-1 NM_002421.4 Forward CAAAGGGAATAAGTACTGGGCTGT 375 60 Reverse TTCCTGCAGTTGAACCAGCT MMP-2 NM_004530.6 Forward GCGGTCACAGCTACTTCTTC 153 59 Reverse TATCGAAGGCAGTGGAGAGG MMP-10 NM_002425.3 Forward TTGCAGTTAAAGAACATGGAGACT 181 59 Reverse GAGTGGCCAAGTTCATGAGC MMP-14 NM_004995.4 Forward TCCAGCAACTTTATGGGGGT 130 59 Reverse TTCCCGTCACAGATGTTGGG TIMP-1 NM_003254.3 Forward AGAGACACCAGAGAACCCACC 373 61 Reverse GCAAGAGTCCATCCTGCAGT TIMP-2 NM_003255.5 Forward CAGATGTAGTGATCAGGGCCAA 201 59 Reverse TCTTTCCTCCAACGTCCAGC AT1R NM_000685.5 Forward TCGGCACCAGGTGTATTT 245 60 Reverse GCCACAGTCTTCAGCTTCAT AT2R NM_000686.5 Forward GAAGAAGGCATAAGAACTAGGAGC 384 60 Reverse CACAGGTCCAAAGAGCCAGT GAPDH NM_001289726.1 Forward CCAAGGTCATCCATGACAAC 157 59 Reverse TGTCATACCAGGAAATGAGC NOX1: NADPH oxidase 1. NOX2: NADPH oxidase 2. NOX4: NADPH oxidase 4. NOX5: NADPH oxidase 5. SOD1: superoxide dismutase 1. SOD2: superoxide dismutase 2. MMP-1: matrix metalloproteinase 2. MMP2: matrix metalloproteinase 2. MMP-10: matrix metalloproteinase 10. MMP-14: matrix metalloproteinase 14. TIMP-1: metalloproteinase inhibitor 1. TIMP-2: metalloproteinase inhibitor 2. AT1R: angiotensin II type 1 receptor. AT2R: angiotensin II type 2 receptor. GAPDH: Glyceraldehyde 3-phosphate dehydrogenase. Conventional PCR using HotStartTaq DNA Polymerase (203205, QIAGEN ® GmbH, Hilden, Germany) was performed to detect if the pcDNA3.2-NOX5β and the pcDNA3.2 control plasmids were present in the genome of these cells. Three specific primers were designed with this purpose: P1 (5 ′ -CGTGTACGGTGGGAGGTCTA-3 ′ ), P2 (5 ′ -CCATCTTCTCC TGCAATGGT-3 ′ ), and P3 (5 ′ -AGGGAAGAAAGCGAAAGGAG-3 ′ ). The PCR reaction protocol consisted of the enzyme activation for 15 min at 95 ◦ C, followed by 35 amplification cycles (20 s at 95 ◦ C, 20 s at 60 ◦ C, and 20 s at 72 ◦ C). P1 is a sense primer that hybridizes with both plasmids, P2 is an antisense primer that hybridizes in the expression cassette of the pcDNA3.2-NOX5β plasmid, and P3 is an antisense primer located after the expression cassette, common to both plasmids. This primer combination amplifies a 218 bp fragment of the pcDNA3.2-NOX5β plasmid using P1 and P2 primers; a 449 bp fragment Antioxidants 2024,13, 1199 5 of 19 of the pcDNA3.2-Mock plasmid using P1 and P3 primers; and a 2818 bp fragment of the pcDNA3.2-NOX5β plasmid using P1 and P3 primers, the latter prevented by reducing the extension time in each PCR cycle. 2.9. Protein Extraction and Immunodetection For protein extraction, cells were washed with pre-cold PBS (10010023, Gibco TM ). After that, cells were lysed by scraping in 100 µ L of RIPA Buffer (1% NP-40, 150 mM NaCl, 50 mM Tris pH = 8, 0.1% SDS, and 0.5% sodium deoxycholate) supplemented with protease inhibitors (11697498001, Merck KGaA ® ). Finally, samples were sonicated, and their concentration was quantified using a PierceTM BCA Protein Assay Kit (23225, ThermoFisher®). Thirty µ g of proteins from each sample were diluted in RIPA buffer, and 10% β - mercaptoethanol-Laemmli buffer (1610747, BioRad ® ). Electrophoresis was performed in 10% acrylamide gels for 100 min at a constant 120 V. Then, proteins were transferred to 0.45 µ m pore nitrocellulose membranes (GE10600003, Merck KGaA ® ) for 70 min at 350 mA and 4 ◦ C. Membranes were blocked with 1% BSA (A9418, Merck KGaA ® ) in 0.05% TweenPBS for 1 h at room temperature. The blocking solution was replaced with either 1:500 MMP10 (MAB910, R&D Systems, Minneapolis, MN, USA) or NOX5 (191010, Abcam®) primary antibodies, and membranes were incubated at 4 ◦ C overnight. Membranes were washed three times with 0.05% Tween-PBS solution and incubated for 60 min with the pertinent secondary antibody diluted 1:2000 in blocking solution. Secondary antibodies against rabbit (NA934V, GE Healthcare, Merck KGaA ® ) and mouse (NA931V, GE Healthcare, Merck KGaA ® ) Ig constant fractions were used. Finally, membranes were washed three times, and blots were visualized with ECL Prime Western Blotting Detection Reagent TM (GE28980926, Merck KGaA ® ). β -actin protein was used for protein expression normalization, with the primary antibody (A5441, Sigma Aldrich ® ) diluted 1:10,000 in 5% non-fat milk in 0.05% Tween-PBS solution. Blots were quantified using Image J ® software (v1.53, NIH, Bethesda, MD, USA). Protein expression levels were expressed as the protein ratio over β -actin of each sample. In the case of the in vivo samples, heart lysates were incubated with the MMP-10 primary antibody (ab261733, Abcam®) at 1:500 in 5%BSA in 0.05% Tween-PBS solution. 2.10. Extracellular MMP-10 Detection by ELISA Supernatant samples from cell cultures were obtained from wells containing 500,000 teloHAEC in 1.5 mL of complete medium. In order to produce a reliable measurement over time, 50 µ L of supernatant was removed from each well after 6, 12, 24, 36, and 48 h. These samples were diluted 1:4 in PBS (10010023, Gibco TM ) before being assayed using the Human Total MMP-10 DuoSet ELISA kit (DY910, R&D Systems®). 2.11. MMP-10 Promoter Activity Assays Previously, a 2.0-kb fragment of the human MMP-10 promoter in a pGL-3 vector expressing the Firefly luciferase was cloned and several constructions were generated [ 28 ]. This promoter was transfected together with a Renilla luciferase reporter plasmid in tHMock and tHNOX5 cell lines. Luciferase activity was measured in cell lysates using a tube luminometer and the Luciferase Assay Kit (E1501, Promega ® , Madison, WI, USA) following the manufacturer’s indications. Results were calculated as the ratio between Firefly and Renilla luciferase activities. 2.12. ROS Production ROS production was measured using the AmpliFluRed TM kit (90101, Sigma Aldrich ® ) in intact cells cultured in 96-well format plates. The different stimuli were added in 50 µ L of Krebs–Ringer buffer (K4002, Merck KGaA ® ) for 5 min. These stimuli were ionomycin (Io) (I0634, Sigma Aldrich ® ), phorbol 12-myristate 13-acetate (PMA) (P1585, Sigma Aldrich ® ), and Ang II. After the incubation time, following manufacturer instructions, fluorescence intensity was measured at 544 nm excitation and 590 nm emission wavelengths in a microplate fluorescence reader (PolarStar®, BMG Labtech, Ortenberg, Germany). Antioxidants 2024,13, 1199 6 of 19 2.13. Real-Time Proliferation Measurement Proliferation was measured using the Real-Time Cell Analyzer xCELLigence (Agilent Technologies, Santa Clara, CA, USA). Briefly, 15,000 endothelial cells were seeded per well in the assay plates provided by the manufacturer. The automatic monitoring was performed every 15 min for a total time of 48 h. 2.14. In Vivo Studies In vivo experiments were performed in accordance with European Community Council Directives (2010/63/EU) guidelines for the care and use of laboratory animals and were approved by the University of Navarra Animal Research Review Committee (Protocol 106-17). Mice were maintained in the conventional animal facility of the Universidad de Navarra, with controlled temperature and humidity conditions, fed ad libitum, and with 12-h light cycles. Our in vivo model consisted of a conditional endothelial knock-in model in a C57BL6/J male. As NOX5 is absent in the rodent genome, this model introduced in an inducible manner the human NOX5 protein in endothelial cells. A transgenesis process, and thus the expression of NOX5 protein in endothelial cells was induced with three tamoxifen injections in 3 doses at non-consecutive days at a dose of 40 mg/kg/day. 2.15. Statistical Analysis Firstly, data normality was studied to check if the results followed a parametric distribution. Then, in the case of the 2 group comparisons, a t-test or Mann–Whitney U analysis was used. However, in the case of 4 or more group comparisons generated from the analysis of 2 variables, two-way ANOVA tests were used, and the effect of each variable, the interaction between them, and group differences were analyzed. In the specific case of time-dependent MMP-10 ELISAs, a paired t-test was used, and the area under the curve was also analyzed. Results were expressed as median and interquartile range (IQR) or as mean ± standard error of the mean (SEM), and statistical significance was established as p< 0.05 . For statistical analysis and graphical illustrations of the results, GraphPad Prism 8 was used (GraphPad®, San Diego, CA, USA). 3. Results 3.1. NOX5 Enhances MMP-10 Production and Cell Migration in Human Endothelial Cells Initially, we studied whether NOX5 overexpression could promote MMP-10 upregulation in endothelial cells. TeloHAEC infection with NOX5 adenovirus produced a five-fold increase in MMP-10 mRNA levels, an effect that increased up to 15-fold when Ang II was added (Figure 1A). The extracellular secretion of MMP-10 protein also increased in cells infected with NOX5 adenovirus, although this increase was only statistically significant in cells stimulated with Ang II (Figure 1B). Cell migration was studied as a phenotype modulated by MMPs-related genes. As shown in Figure 1C,D, NOX5 accelerated teloHAEC migration, which was even faster when Ang II was added. Finally, other MMP-related genes such as MMP-14, TIMP-1, and TIMP-2 were upregulated through Ang II activation in NOX5-infected cells (Figure S1). These results suggest that, besides MMP-10, NOX5 can regulate the expression of other MMPs. 3.2. MMP-10 Is Involved in Cell Migration in Human Endothelial Cells To further investigate whether MMP-10 could be involved in endothelial cell migration, MMP-10 expression was silenced in teloHAEC using a specific siRNA (siMMP-10). siMMP-10 effectively reduced MMP-10 expression at mRNA, as well as intracellular and secreted protein levels in teloHAEC (Figure 2A–C). Furthermore, MMP-10 silencing reduced teloHAEC migratory capacity compared with cells transfected with a control siRNA (siCtrl) (Figure 2D,E). These results indicate that MMP-10 is involved in TeloHAEC migration. Antioxidants 2024,13, 1199 7 of 19 Antioxidants 2024, 13, x FOR PEER REVIEW 7 of 20 modulated by MMPs-related genes. As shown in Figure 1C,D, NOX5 accelerated teloHAEC migration, which was even faster when Ang II was added. Finally, other MMPrelated genes such as MMP-14, TIMP-1, and TIMP-2 were upregulated through Ang II activation in NOX5-infected cells (Figure S1). These results suggest that, besides MMP-10, NOX5 can regulate the expression of other MMPs. Figure 1. NOX5-β promotes MMP-10 production and cell migration in endothelial cells: (A) MMP-10 mRNA levels after 24 h of infection and 16 h of Ang II stimulation (n = 6). (B) MMP-10 protein levels in cell supernatants after 24 h of infection and 24 h of Ang II stimulation (n = 3). (C) Representative images of the wound-healing assay of teloHAEC after 24 h of infection and Ang II stimulation. The wound was performed 24 h after the infection when Ang II was added (0 h) and was monitored for 32 h. (D) Wound-healing assay quantification (n = 6). GFP: teloHAEC infected with GFP-encoding adenovirus. NOX5: teloHAEC infected with NOX5-encoding adenovirus. Ctrl: non-stimulated cells. Ang II: cells stimulated with 0.1 µM Ang II. ns: not significant differences. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Data are presented as median and IQR. 3.2. MMP-10 Is Involved in Cell Migration in Human Endothelial Cells To further investigate whether MMP-10 could be involved in endothelial cell migration, MMP-10 expression was silenced in teloHAEC using a specific siRNA (siMMP-10). siMMP-10 effectively reduced MMP-10 expression at mRNA, as well as intracellular and secreted protein levels in teloHAEC (Figure 2A–C). Furthermore, MMP-10 silencing reduced teloHAEC migratory capacity compared with cells transfected with a control siRNA (siCtrl) (Figure 2D,E). These results indicate that MMP-10 is involved in TeloHAEC migration. Ctrl Ang II 0 500 1000 1500 2000 2500 MMP-10 secretion [pg/mL] GFP NOX5 ** ** A B C D Ctrl Ang II 0 20 40 60 80 100 Wound healing (%) GFP NOX5 **** ns * *** 0 h 32 h GFPNOX5 ControlControl Ang IIAng II Ctrl Ang II 0 10 20 30 MMP-10 mRNA levels (fold change) GFP NOX5 * * ns **** Figure 1. NOX5β promotes MMP-10 production and cell migration in endothelial cells: (A) MMP10 mRNA levels after 24 h of infection and 16 h of Ang II stimulation (n= 6). (B) MMP-10 protein levels in cell supernatants after 24 h of infection and 24 h of Ang II stimulation (n= 3). (C) Representative images of the wound-healing assay of teloHAEC after 24 h of infection and Ang II stimulation. The wound was performed 24 h after the infection when Ang II was added (0 h) and was monitored for 32 h. (D) Wound-healing assay quantification (n= 6). GFP: teloHAEC infected with GFP-encoding adenovirus. NOX5: teloHAEC infected with NOX5-encoding adenovirus. Ctrl: non-stimulated cells. Ang II: cells stimulated with 0.1 µ M Ang II. ns: not significant differences. * p< 0.05, ** p< 0.01, *** p< 0.001, **** p< 0.0001. Data are presented as median and IQR. 3.3. NOX5 Chronic Overexpression Enhances MMP-10 Production and the Associated Cell Migration in Human Endothelial Cells The NOX5 adenoviral model in TeloHAEC could be considered extreme, far from the pathophysiological range of NOX5 overexpression that could be found in human health and disease [ 15 ]. For that reason, to better mimic the pathophysiological levels of this oxidase, an alternative chronic overexpression model was developed. We generated a chronic NOX5 overexpression cell line (tHNOX5) and the respective control line (tHMock). These cells were selected and grown after their transfection with the pertinent plasmids until stably expressing cell lines were obtained. First, we demonstrated that the plasmids were integrated into the gDNA of tHMock and tHNOX5 cells using PCR (Figure S2A). Second, a significant increase in NOX5 (both mRNA and protein) was found in tHNOX5 cells (Figure S2B–D). Third, ROS production was higher in tHNOX5 than in tHMock cells, although this increase was not statistically significant. Nevertheless, ROS production increased in response to different pharmacological stimuli such as Io or PMA in tHNOX5 cells (Figure S2E–G). Finally, several pro-oxidant and antioxidant enzymes were analyzed to Antioxidants 2024,13, 1199 8 of 19 assess NOX5 effects on redox homeostasis. Within the NOX family, NOX5 overexpression produced an increase in NOX4 mRNA expression (Figure S3A–C). Within the antioxidant enzymes, NOX5 overexpression produced an increase in SOD2 expression (Figure S3E). Collectively, these data demonstrate that the tHNOX5 cell line stably overexpresses a functional NOX5 protein that responds to pharmacological stimuli (PMA and Io) by increasing ROS generation. Next, we found that tHNOX5 cells exhibited increased MMP-10 expression (Figure 3A,B) . This upregulation was accompanied by enhanced MMP-10 secretion to the extracellular medium (Figure 3C). Finally, the tHNOX5 cell line presented an increase in endothelial cell migration in the wound-healing assay (Figure 3D). Interestingly, tHNOX5 cells presented significantly lower proliferation levels compared to tHMock cells (Figure 3E), supporting the idea of a promigratory phenotype of these cells. Antioxidants 2024, 13, x FOR PEER REVIEW 8 of 20 Figure 2. MMP-10 silencing decreases MMP-10 expression and secretion as well as endothelial cell migration: (A) MMP-10 mRNA levels 24 h after MMP-10 silencing (n = 3). (B) Immunoblot of MMP-10 and β-actin 24 h after silencing (n = 2). (C) MMP-10 protein levels in cell supernatants 24 h after silencing. (D) Representative images of teloHAEC silenced with siCtrl or siMMP-10 0 h and 48 h after the scratch of the wound-healing assay. (E) Quantification of the wound-healing assay (n = 6). siCtrl: teloHAEC silenced with a Ctrl siRNA. siMMP-10: teloHAEC silenced with a siMMP-10. * p < 0.05, **** p < 0.0001. Data are presented as median and IQR. 3.3. NOX5 Chronic Overexpression Enhances MMP-10 Production and the Associated Cell Migration in Human Endothelial Cells The NOX5 adenoviral model in TeloHAEC could be considered extreme, far from the pathophysiological range of NOX5 overexpression that could be found in human health and disease [15]. For that reason, to better mimic the pathophysiological levels of this oxidase, an alternative chronic overexpression model was developed. We generated a chronic NOX5 overexpression cell line (tHNOX5) and the respective control line (tHMock). These cells were selected and grown after their transfection with the pertinent plasmids until stably expressing cell lines were obtained. First, we demonstrated that the plasmids were integrated into the gDNA of tHMock and tHNOX5 cells using PCR (Figure S2A). Second, a significant increase in NOX5 (both mRNA and protein) was found in tHNOX5 cells (Figure S2B–D). Third, ROS production was higher in tHNOX5 than in tHMock cells, although this increase was not statistically significant. Nevertheless, ROS production increased in response to different pharmacological stimuli such as Io or PMA in tHNOX5 cells (Figure S2E–G). Finally, several pro-oxidant and antioxidant enzymes were analyzed to assess NOX5 effects on redox homeostasis. Within the NOX family, NOX5 overexpression produced an increase in NOX4 mRNA expression (Figure S3A–C). Within the antioxidant enzymes, NOX5 overexpression produced an increase in SOD2 expression (Figure S3E). Collectively, these data demonstrate that the tHNOX5 cell line stably overexpresses a functional NOX5 protein that responds to pharmacological stimuli (PMA and Io) by increasing ROS generation. AB C siCtrl siMMP-10 MMP-10, 42 kDa β-actin, 42 kDa D E 0 h 24 h siCtrl siMMP-10 siCtrl siMMP-10 0 20 40 60 80 100 Wound healing (%) * siCtrl siMMP-10 0.0 0.5 1.0 1.5 2.0 MMP-10 mRNA levels (fold change) * Figure 2. MMP-10 silencing decreases MMP-10 expression and secretion as well as endothelial cell migration: (A) MMP-10 mRNA levels 24 h after MMP-10 silencing (n= 3). (B) Immunoblot of MMP-10 and β -actin 24 h after silencing (n= 2). (C) MMP-10 protein levels in cell supernatants 24 h after silencing. (D) Representative images of teloHAEC silenced with siCtrl or siMMP-10 0 h and 48 h after the scratch of the wound-healing assay. (E) Quantification of the wound-healing assay (n= 6) . siCtrl: teloHAEC silenced with a Ctrl siRNA. siMMP-10: teloHAEC silenced with a siMMP-10. *p< 0.05, **** p< 0.0001. Data are presented as median and IQR. Antioxidants 2024,13, 1199 9 of 19 Antioxidants 2024, 13, x FOR PEER REVIEW 9 of 20 Next, we found that tHNOX5 cells exhibited increased MMP-10 expression (Figure 3A,B). This upregulation was accompanied by enhanced MMP-10 secretion to the extracellular medium (Figure 3C). Finally, the tHNOX5 cell line presented an increase in endothelial cell migration in the wound-healing assay (Figure 3D). Interestingly, tHNOX5 cells presented significantly lower proliferation levels compared to tHMock cells (Figure 3E), supporting the idea of a promigratory phenotype of these cells. Figure 3. NOX5 chronic overexpression promotes MMP-10 expression and endothelial cell migration: (A) MMP-10 mRNA levels of tHMock and tHNOX5 cell lines (n = 6). (B) MMP-10 and βactin immunoblots of tHMock and tHNOX5 cell lines and their quantification (n = 3). (C) MMP-10 protein levels in cell supernatants from tHMock and tHNOX5 cultures (n = 6). (D) Representative images of teloHAEC, tHMock, and tHNOX5 cells in the wound-healing assay 0 h and 24 h after the scratch and their quantification (n = 6). (E) Cell proliferation level of tHMock and tHNOX5 cells measured using xCelligence technology (n = 6). * p < 0.05 vs. tHMock cell line, ** p < 0.01 vs. tHMock cell line, *** p < 0.001 vs. tHMock cell line, **** p < 0.0001 vs. tHMock cell line, # p < 0.05 vs. teloHAEC cell line. Data are presented as median and IQR. Further, we found that the tHNOX5 cell line expressed higher levels of MMP-1 and MMP-2 and lower levels of TIMP-1 and TIMP-2 compared to the tHMock control line (Figure S3F–H). These data demonstrate that chronic NOX5 overexpression increases Figure 3. NOX5 chronic overexpression promotes MMP-10 expression and endothelial cell migration: (A) MMP-10 mRNA levels of tHMock and tHNOX5 cell lines (n= 6). (B) MMP-10 and β -actin immunoblots of tHMock and tHNOX5 cell lines and their quantification (n= 3). (C) MMP-10 protein levels in cell supernatants from tHMock and tHNOX5 cultures (n= 6). (D) Representative images of teloHAEC, tHMock, and tHNOX5 cells in the wound-healing assay 0 h and 24 h after the scratch and their quantification (n= 6). (E) Cell proliferation level of tHMock and tHNOX5 cells measured using xCelligence technology (n= 6). * p< 0.05 vs. tHMock cell line, ** p< 0.01 vs. tHMock cell line, *** p< 0.001 vs. tHMock cell line, **** p< 0.0001 vs. tHMock cell line, # p< 0.05 vs. teloHAEC cell line. Data are presented as median and IQR. Further, we found that the tHNOX5 cell line expressed higher levels of MMP-1 and MMP-2 and lower levels of TIMP-1 and TIMP-2 compared to the tHMock control line (Figure S3F–H) . These data demonstrate that chronic NOX5 overexpression increases MMP-10 production and modulates other MMP-related genes, which could impact endothelial cell migration. To verify whether NOX5 chronic overexpression is involved in MMP-10 upregulation and cell migration, NOX5 was silenced in tHMock and tHNOX5 cells using a specific siRNA (siNOX5). NOX5 silencing reduced MMP-10 expression in tHNOX5 cells, reaching levels similar to those of tHMock cells (Figure 4A). Interestingly, silencing abrogated the Antioxidants 2024,13, 1199 16 of 19 the NOX5/MMP-10 axis could have a preconditioning effect, preventing pathological alterations produced by Ang II or other stimuli. Supporting this preconditioning role, our endothelial NOX5 in vivo model was demonstrated to regulate pro-inflammatory genes in both cardiac and cerebral tissues [ 15 , 47 ]. New studies should be developed to deep into this role of NOX5 in vivo. 5. Conclusions To sum up, we found that MMP-10 production is upregulated by NOX5-mediated ROS in endothelial cells. The NOX5-MMP-10 axis impairs endothelial cell migration, being JNK and AP-1 key regulatory factors involved in this process. Interestingly, Ang II enhances the effects of NOX5 overexpression on MMP-10 expression and migration of teloHAEC. In addition, NOX5 endothelial expression increases MMP-10 cardiac protein levels in mice. Collectively, these results allow us to speculate on a possible role of NOX5 in the composition of the vascular ECM, which could lead to the establishment of endothelial dysfunction and the development of complications in cardiovascular diseases. Supplementary Materials: The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antiox13101199/s1, Figure S1: Ang II-mediated NOX5β stimulation upregulates genes related to extracellular matrix remodeling; Figure S2: The stable teloHAEC cell line expressing NOX5 (tHNOX5) serves as model of chronic NOX5 overexpression; Figure S3: NOX5 chronic overexpression affects other redox and MMP-related genes; Figure S4: NOX5 chronic overexpression seems to affect Ang II receptors (AT1R and AT2R) expression, with a more intense effect on ATR2; Figure S5: Ang II potentiates the endothelial cell migration of NOX5-overexpressing cells. NOX5; Figure S6: MAPK, MEK/ERK, and JNK pathways are involved in NOX5-dependent endothelial cell migration; Figure S7: p38 MAPK, ERK, and JNK pathways are involved in the MMP-10 secretion and endothelial cell migration triggered by Ang II-mediated NOX5 activation. Author Contributions: Conceptualization, E.A., J.M. and G.Z.; methodology, E.A., J.M.-G., M.M.-A., J.O. and J.M.; software, E.A., J.M.; formal analysis, E.A., J.M. and G.Z.; investigation, E.A., J.M.-G., M.M.-A. and J.M.; resources, J.O., J.M.-G. and G.Z.; data curation, E.A. and G.Z.; writing—original draft preparation, J.M.; writing—review and editing, E.A., J.O., M.M.-A., J.M.-G., G.Z. and J.M.; supervision, J.M. and G.Z.; project administration, G.Z.; funding acquisition, J.O. and G.Z. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported by the departments of Health (40/2021) University, Innovation and Digital Transformation (Proyectos I + D colaborativos 2020-PC159/160/161, NOXICTUS) from the Government of Navarra, by the Spanish Ministry of Science and Innovation (Instituto de Salud Carlos III-Fondo de Investigaciones Sanitarias, PI22/01450; PID2021-122509OB-I00 funded by MCIN/AEI/10.13039/501100011033 and by “ERDF A way of making Europe”). E.A. and J.M. were supported by an FPU PhD Grant from the Spanish Ministry of Universities (FPU21/03340 and FPU19/01807, respectively). Institutional Review Board Statement: In vivo experiments were approved by the Ethical Committee of the University de Navarra and were performed in accordance with European Community Council Directives (2010/63/EU) guidelines for the care and use of laboratory animals and were approved by the University of Navarra Animal Research Review Committee (Protocol 106-17). Informed Consent Statement: Not applicable. Data Availability Statement: Data will be made available on request. Acknowledgments: The authors thank Íñigo Izal for his contribution to the design and drawing of the discussion scheme. Conflicts of Interest: The authors declare no conflicts of interest. Antioxidants 2024,13, 1199 17 of 19 References 1. Sorescu, D.; Weiss, D.; Lassègue, B.; Clempus, R.E.; Szöcs, K.; Sorescu, G.P.; Valppu, L.; Quinn, M.T.; Lambeth, J.D.; Vega, J.D.; et al. Superoxide production and expression of nox family proteins in human atherosclerosis. Circulation 2002,105, 1429–1435. [CrossRef] [PubMed] 2. Azumi, H.; Inoue, N.; Takeshita, S.; Rikitake, Y.; Kawashima, S.; Hayashi, Y.; Itoh, H.; Yokoyama, M. Expression of NADH/NADPH oxidase p22phox in human coronary arteries. Circulation 1999,100, 1494–1498. [CrossRef] [PubMed] 3. Muñoz, M.; López-Oliva, M.E.; Rodríguez, C.; Martínez, M.P.; Saénz-Medina, J.; Sánchez, A.; Climent, B.; Benedito, S.; GarcíaSacristán, A.; Rivera, L.; et al. Differential contribution of Nox1, Nox2 and Nox4 to kidney vascular oxidative stress and endothelial dysfunction in obesity. Redox Biol. 2020,28, 101330. [CrossRef] [PubMed] 4. Youn, J.Y.; Gao, L.; Cai, H. The p47phoxand NADPH oxidase organiser 1 (NOXO1)-dependent activation of NADPH oxidase 1 (NOX1) mediates endothelial nitric oxide synthase (eNOS) uncoupling and endothelial dysfunction in a streptozotocin-induced murine model of diabetes. Diabetologia 2012,55, 2069–2079. [CrossRef] [PubMed] 5. Youn, J.Y.; Zhou, J.; Cai, H. Bone morphogenic protein 4 mediates NOX1-dependent eNOS uncoupling, endothelial dysfunction and COX2 induction in type 2 diabetes mellitus. Mol. Endocrinol. 2015,29, 1123–1133. [CrossRef] [PubMed] 6. Douglas, G.; Bendall, J.K.; Crabtree, M.J.; Tatham, A.L.; Carter, E.E.; Hale, A.B.; Channon, K.M. Endothelial-specific Nox2 overexpression increases vascular superoxide and macrophage recruitment in ApoE − / − mice. Cardiovasc. Res. 2012,94, 20–29. [CrossRef] 7. Hu, X.F.; Xiang, G.; Wang, T.J.; Ma, Y.B.; Zhang, Y.; Yan, Y.B.; Zhao, X.; Wu, Z.X.; Feng, Y.F.; Lei, W. Impairment of type H vessels by NOX2-mediated endothelial oxidative stress: Critical mechanisms and therapeutic targets for bone fragility in streptozotocin-induced type 1 diabetic mice. Theranostics 2021,11, 3796–3812. [CrossRef] 8. Birk, M.; Baumm, E.; Zadeh, J.K.; Manicam, C.; Pfeiffer, N.; Patzak, A.; Helmstädter, J.; Steven, S.; Kuntic, M.; Daiber, A.; et al. Angiotensin II Induces Oxidative Stress and Endothelial Dysfunction in Mouse Ophthalmic Arteries via Involvement of AT1 Receptors and NOX2. Antioxidants 2021,10, 1238. [CrossRef] 9. Gray, S.P.; Di Marco, E.; Kennedy, K.; Chew, P.; Okabe, J.; El-Osta, A.; Calkin, A.C.; Biessen, E.A.L.; Touyz, R.M.; Cooper, M.E.; et al. Reactive Oxygen Species Can Provide Atheroprotection via NOX4-Dependent Inhibition of Inflammation and Vascular Remodeling. Arterioscler. Thromb. Vasc. Biol. 2016,36, 295–307. [CrossRef] 10. Yuan, S.; Hahn, S.A.; Miller, M.P.; Sanker, S.; Calderon, M.J.; Sullivan, M.; Dosunmu-Ogunbi, A.M.; Fazzari, M.; Li, Y.; Reynolds, M.; et al. Cooperation between CYB5R3 and NOX4 via coenzyme Q mitigates endothelial inflammation. Redox Biol. 2021, 47, 102166. [CrossRef] 11. Escudero, P.; Martinez de Marañón, A.; Collado, A.; Gonzalez-Navarro, H.; Hermenegildo, C.; Peiró, C.; Piqueras, L.; Sanz, M.J. Combined sub-optimal doses of rosuvastatin and bexarotene impair angiotensin II-induced arterial mononuclear cell adhesion through inhibition of Nox5 signaling pathways and increased RXR/PPAR α and RXR/PPAR γ interactions. Antioxid. Redox Signal. 2015,22, 901–920. [CrossRef] [PubMed] 12. Vlad, M.L.; Manea, S.A.; Lazar, A.G.; Raicu, M.; Muresian, H.; Simionescu, M.; Manea, A. Histone Acetyltransferase-Dependent Pathways Mediate Upregulation of NADPH Oxidase 5 in Human Macrophages under Inflammatory Conditions: A Potential Mechanism of Reactive Oxygen Species Overproduction in Atherosclerosis. Oxidative Med. Cell. Longev. 2019,2019, 3201062. [CrossRef] [PubMed] 13. Guzik, T.J.; Chen, W.; Gongora, M.C.; Guzik, B.; Lob, H.E.; Mangalat, D.; Hoch, N.; Dikalov, S.; Rudzinski, P.; Kapelak, B.; et al. Calcium-dependent NOX5 nicotinamide adenine dinucleotide phosphate oxidase contributes to vascular oxidative stress in human coronary artery disease. J. Am. Coll. Cardiol. 2008,52, 1803–1809. [CrossRef] [PubMed] 14. Marqués, J.; Fernández-Irigoyen, J.; Ainzúa, E.; Martínez-Azcona, M.; Cortés, A.; Roncal, C.; Orbe, J.; Santamaría, E.; Zalba, G. NADPH Oxidase 5 (NOX5) Overexpression Promotes Endothelial Dysfunction via Cell Apoptosis, Migration, and Metabolic Alterations in Human Brain Microvascular Endothelial Cells (hCMEC/D3). Antioxidants 2022,11, 2147. [CrossRef] [PubMed] 15. Marqués, J.; Cortés, A.; Pejenaute, Á.; Ansorena, E.; Abizanda, G.; Prósper, F.; Martínez-Irujo, J.J.; de Miguel, C.; Zalba, G. Induction of Cyclooxygenase-2 by Overexpression of the Human NADPH Oxidase 5 (NOX5) Gene in Aortic Endothelial Cells. Cells 2020,9, 637. [CrossRef] 16. Simões, G.; Pereira, T.; Caseiro, A. Matrix metaloproteinases in vascular pathology. Microvasc. Res. 2022,143, 104398. [CrossRef] 17. Rodriguez, J.A.; Orbe, J.; Martinez de Lizarrondo, S.; Calvayrac, O.; Rodriguez, C.; Martinez-Gonzalez, J.; Paramo, J.A. Metalloproteinases and atherothrombosis: MMP-10 mediates vascular remodeling promoted by inflammatory stimuli. Front. Biosci. 2008, 13, 2916–2921. [CrossRef] 18. Matilla, L.; Roncal, C.; Ibarrola, J.; Arrieta, V.; García-Peña, A.; Fernández-Celis, A.; Navarro, A.; Álvarez, V.; Gainza, A.; Orbe, J.; et al. A Role for MMP-10 (Matrix Metalloproteinase-10) in Calcific Aortic Valve Stenosis. Arterioscler. Thromb. Vasc. Biol. 2020, 40, 1370–1382. [CrossRef] 19. Purroy, A.; Roncal, C.; Orbe, J.; Meilhac, O.; Belzunce, M.; Zalba, G.; Villa-Bellosta, R.; Andrés, V.; Parks, W.C.; Páramo, J.A.; et al. Matrix metalloproteinase-10 deficiency delays aterosclerosis progression and plaque calcification. Atherosclerosis 2018,278, 124–134. [CrossRef] 20. Wang, H.; Albadawi, H.; Siddiquee, Z.; Stone, J.M.; Panchenko, M.P.; Watkins, M.T.; Stone, J.R. Altered vascular activation due to deficiency of the NADPH oxidase component p22phox. Cardiovasc. Pathol. 2014,23, 35–42. [CrossRef] Antioxidants 2024,13, 1199 18 of 19 21. Quesada, I.M.; Lucero, A.; Amaya, C.; Meijles, D.N.; Cifuentes, M.E.; Pagano, P.J.; Castro, C. Selective inactivation of NADPH oxidase 2 causes regression of vascularization and the size and stability of atherosclerotic plaques. Atherosclerosis 2015,242, 469–475. [CrossRef] [PubMed] 22. Li, Y.; Li, Y.; Zhen, S. Inhibition of NADPH oxidase 5 (NOX5) suppresses high glucose-induced oxidative stress, inflammation and extracellular matrix accumulation in human glomerular mesangial cells. Med. Sci. Monit. 2020,26, e919399. [CrossRef] [PubMed] 23. Jha, J.C.; Dai, A.; Holterman, C.E.; Cooper, M.E.; Touyz, R.M.; Kennedy, C.R.; Jandeleit-Dahm, K.A.M. Endothelial or vascular smooth muscle cell-specific expression of human NOX5 exacerbates renal inflammation, fibrosis and albuminuria in the Akita mouse. Diabetologia 2019,62, 1712–1726. [CrossRef] [PubMed] 24. Jha, J.C.; Banal, C.; Okabe, J.; Gray, S.P.; Hettige, T.; Chow, B.S.M.; Thallas-Bonke, V.; De Vos, L.; Holterman, C.E.; Coughlan, M.T.; et al. NADPH Oxidase Nox5 Accelerates Renal Injury in Diabetic Nephropathy. Diabetes 2017,66, 2691–2703. [CrossRef] [PubMed] 25. Cortés, A.; Pejenaute, Á.; Marqués, J.; Izal, Í.; Cenoz, S.; Ansorena, E.; Martínez-Irujo, J.J.; de Miguel, C.; Zalba, G. NADPH Oxidase 5 Induces Changes in the Unfolded Protein Response in Human Aortic Endothelial Cells and in Endothelial-Specific Knock-in Mice. Antioxidants 2021,10, 194. [CrossRef] [PubMed] 26. Lan, T.H.; Huang, X.Q.; Tan, H.M. Vascular fibrosis in atherosclerosis. Cardiovasc. Pathol. 2013,22, 401–407. [CrossRef] 27. Andueza, A.; Garde, N.; García-Garzón, A.; Ansorena, E.; López-Zabalza, M.J.; Iraburu, M.J.; Zalba, G.; Martínez-Irujo, J.J. NADPH oxidase 5 promotes proliferation and fibrosis in human hepatic stellate cells. Free Radic. Biol. Med. 2018,126, 15–26. [CrossRef] 28. Orbe, J.; Rodríguez, J.A.; Calvayrac, O.; Rodríguez-Calvo, R.; Rodríguez, C.; Roncal, C.; Martínez de Lizarrondo, S.; Barrenetxe, J.; Reverter, J.C.; Martínez-González, J.; et al. Matrix metalloproteinase-10 is upregulated by thrombin in endothelial cells and increased in patients with enhanced thrombin generation. Arterioscler. Thromb. Vasc. Biol. 2009,12, 2109–2116. [CrossRef] 29. Howe, M.D.; Zhu, L.; Sansing, L.H.; Gonzales, N.R.; McCullough, L.D.; Edwards, N.J. Serum Markers of Blood-Brain Barrier Remodeling and Fibrosis as Predictors of Etiology and Clinicoradiologic Outcome in Intracerebral Hemorrhage. Front. Neurol. 2018,9, 746. [CrossRef] 30. Spychalowicz, A.; Wilk, G.; ´ Sliwa, T.; Ludew, D.; Guzik, T.J. Novel therapeutic approaches in limiting oxidative stress and inflammation. Curr. Pharm. Biotechnol. 2012,13, 2456–2466. [CrossRef] 31. Casas, A.I.; Kleikers, P.W.; Geuss, E.; Langhauser, F.; Adler, T.; Busch, D.H.; Gailus-Durner, V.; Hrabêde Angelis, M.; Egea, J.; Lopez, M.G.; et al. Calcium-dependent blood-brain barrier breakdown by NOX5 limits postreperfusion benefit in stroke. J. Clin. Investig. 2019,129, 1772–1778. [CrossRef] [PubMed] 32. Goettsch, C.; Goettsch, W.; Muller, G.; Seebach, J.; Schnittler, H.J.; Morawietz, H. Nox4 overexpression activates reactive oxygen species and p38 MAPK in human endothelial cells. Biochem. Biophys. Res. Commun. 2009,380, 355–360. [CrossRef] [PubMed] 33. Li, W.J.; Liu, Y.; Wang, J.J.; Zhang, Y.L.; Lai, S.; Xia, Y.L.; Wang, H.X.; Li, H.H. “Angiotensin II memory” contributes to the development of hypertension and vascular injury via activation of NADPH oxidase. Life Sci. 2016,15, 18–24. [CrossRef] [PubMed] 34. Sarkar, J.; Chowdhury, A.; Chakraborti, T.; Chakraborti, S. Cross-talk between NADPH oxidase-PKC α -p(38)MAPK and NFκ B-MT1MMP in activating proMMP-2 by ET-1 in pulmonary artery smooth muscle cells. Mol. Cell. Biochem. 2016,415, 13–28. [CrossRef] [PubMed] 35. Manea, A.; Manea, S.A.; Florea, I.C.; Luca, C.M.; Raicu, M. Positive regulation of NADPH oxidase 5 by proinflammatory-related mechanisms in human aortic smooth muscle cells. Free Radic. Biol. Med. 2012,52, 1497–1507. [CrossRef] 36. Pandey, D.; Patel, A.; Patel, V.; Chen, F.; Qian, J.; Wang, Y.; Barman, S.A.; Venema, R.C.; Stepp, D.W.; Rudic, R.D.; et al. Expression and functional significance of NADPH oxidase 5 (Nox5) and its splice variants in human blood vessels. Am. J. Physiol. Heart Circ. Physiol. 2012,302, 1919–1928. [CrossRef] 37. Gole, H.K.A.; Tharp, D.L.; Bowles, D.K. Upregulation of intermediate-conductance Ca 2+ -activated K + channels (KCNN4) in porcine coronary smooth muscle requires NADPH oxidase 5 (NOX5). PLoS ONE 2014,9, e105337. [CrossRef] 38. Salazar, G. NADPH Oxidases and Mitochondria in Vascular Senescence. Int. J. Mol. Sci. 2018,19, 1327. [CrossRef] 39. Valente, A.J.; Yoshida, T.; Murthy, S.N.; Sakamuri, S.S.V.P.; Katsuyama, M.; Clark, R.A.; Delafontaine, P.; Chandrasekar, B. Angiotensin II enhances AT1-Nox1 binding and stimulates arterial smooth muscle cell migration and proliferation through AT1, Nox1, and interleukin-18. Am. J. Physiol. Heart Circ. Physiol. 2012,303, 282–296. [CrossRef] 40. Li, X.; Wang, H.F.; Li, X.X.; Xu, M. Contribution of acid sphingomyelinase to angiotensin II-induced vascular adventitial remodeling via membrane rafts/Nox2 signal pathway. Life Sci. 2019,219, 303–310. [CrossRef] 41. Moraes, J.A.; Frony, A.C.; Dias, A.M.; Renovato-Martins, M.; Rodrigues, G.; Marcinkiewicz, C.; Assreuy, J.; Barja-Fidalgo, C. Alpha1beta1 and integrin-linked kinase interact and modulate angiotensin II effects in vascular smooth muscle cells. Atherosclerosis 2015,243, 477–485. [CrossRef] [PubMed] 42. Yu, W.; Xiao, L.; Que, Y.; Li, S.; Chen, L.; Hu, P.; Xiong, R.; Seta, F.; Chen, H.; Tong, X. Smooth muscle NADPH oxidase 4 promotes angiotensin II-induced aortic aneurysm and atherosclerosis by regulating osteopontin. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165912. [CrossRef] 43. Harrison, C.B.; Trevelin, S.C.; Richards, D.A.; Santos, C.X.C.; Sawyer, G.; Markovinovic, A.; Zhang, X.; Zhang, M.; Brewer, A.C.; Yin, X.; et al. Fibroblast Nox2 (NADPH Oxidase-2) Regulates ANG II (Angiotensin II)-Induced Vascular Remodeling and Hypertension via Paracrine Signaling to Vascular Smooth Muscle Cells. Arterioscler. Thromb. Vasc. Biol. 2021,41, 698–710. [CrossRef] Antioxidants 2024,13, 1199 19 of 19 44. Montezano, A.C.; Burger, D.; Paravicini, T.M.; Chignalia, A.Z.; Yusuf, H.; Almasri, M.; He, Y.; Callera, G.E.; He, G.; Krause, K.H.; et al. Nicotinamide adenine dinucleotide phosphate reduced oxidase 5 (Nox5) regulation by angiotensin II and endothelin-1 is mediated via calcium/calmodulin-dependent, rac-1-independent pathways in human endothelial cells. Circ. Res. 2010,106, 1363–1373. [CrossRef] [PubMed] 45. Zhao, G.J.; Zhao, C.L.; Ouyang, S.; Deng, K.Q.; Zhu, L.; Montezano, A.C.; Zhang, C.; Hu, F.; Zhu, X.Y.; Tian, S.; et al. Ca 2+ - Dependent NOX5 (NADPH Oxidase 5) Exaggerates Cardiac Hypertrophy Through Reactive Oxygen Species Production. Hypertension 2020,76, 827–838. [CrossRef] [PubMed] 46. Nguyen Dinh Cat, A.; Montezano, A.C.; Burger, D.; Touyz, R.M. Angiotensin II, NADPH oxidase, and redox signaling in the vasculature. Antioxid. Redox Signal. 2013,19, 1110–1120. [CrossRef] [PubMed] 47. Cortés, A.; Solas, M.; Pejenaute, Á.; Abellanas, M.A.; Garcia-Lacarte, M.; Aymerich, M.S.; Marqués, J.; Ramírez, M.J.; Zalba, G. Expression of Endothelial NOX5 Alters the Integrity of the Blood-Brain Barrier and Causes Loss of Memory in Aging Mice. Antioxidants 2021,10, 1311. [CrossRef] 48. Elbatreek, M.H.; Sadegh, S.; Anastasi, E.; Guney, E.; Nogales, C.; Kacprowski, T.; Hassan, A.A.; Teubner, A.; Huang, P.H.; Hsu, C.Y.; et al. NOX5-induced uncoupling of endothelial NO synthase is a causal mechanism and theragnostic target of an age-related hypertension endotype. PLoS Biol. 2020,18, e3000885. [CrossRef] 49. Baraibar-Churio, A.; Bobadilla, M.; Machado, F.J.D.; Sáinz, N.; Roncal, C.; Abizanda, G.; Prósper, F.; Orbe, J.; Pérez-Ruiz, A. Deficiency of MMP-10 aggravates the diseased phenotype of aged dystrophic mice. Life 2021,11, 1398. [CrossRef] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.