The Influence of DNA ExtractionMethods on Species Identification Results of Seafood Products

Citation: Rodríguez-Riveiro, R.; Velasco, A.; Sotelo, C.G. The Influence of DNA Extraction Methods on Species Identification Results of Seafood Products. Foods 2022,11, 1739. https://doi.org/ 10.3390/foods11121739 Academic Editor: Oscar Núñez Received: 13 April 2022 Accepted: 11 June 2022 Published: 14 June 2022 Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. Copyright: © 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). foods Article The Influence of DNA Extraction Methods on Species Identification Results of Seafood Products Rosalía Rodríguez-Riveiro * , Amaya Velasco and Carmen G. Sotelo Instituto de Investigaciones Marinas (CSIC), Eduardo Cabello 6, 36208 Vigo, Spain; [email protected] (A.V.); [email protected] (C.G.S.) *Correspondence: r[email protected] Abstract: In terms of species identification, the ultimate aim of extracting DNA is the subsequent amplification of the selected marker; therefore, the quality and quantity of the extracted DNA must be sufficient for PCR-based methods. The purpose of this study is to compare five DNA extraction methods according to the parameters of quantity, quality and simplicity, among others, in order to determine the most suitable method for identification for Cephalopoda, Gadiformes and Pleuronectiformes. The Wizard DNA clean-up system kit (Promega), MPure-12 TM automated nucleic acid purification system (MP Biomedicals), Chelex 100 resin (Biorad), DNeasy blood and tissue kit (Qiagen) and a swab method were examined. The obtained DNA quantity was determined by fluorescence, and quality was evaluated with ratios of absorbance of A260/A280 and A260/A230 by agarose gel visualization of the extracts and by analyzing the success of PCR amplifications of 720 bp fragments of cytochrome c oxidase I (COI) for Cephalopods and 465 bp fragments of cytochrome b for Gadiformes and Pleuronectiformes. Statistical results confirmed significant differences between the tested methods according to yield, efficiency and purity and no significant differences with respect to the species employed. The best yields were obtained with the Wizard kit, whereas other methods stand out in terms of their affordability (Chelex) and automation (Mpure). Keywords: DNA extraction methods; Cephalopoda; Gadiformes; Pleuronectiformes; polymerase chain reaction (PCR); sequencing 1. Introduction DNA extraction is of paramount importance in the workflow of any DNA-based methodology [ 1 – 3 ]. Various DNA-based methodologies are applied to a wide variety of problems, and DNA can be obtained from numerous different types of tissues and samples [ 4 , 5 ]. DNA sequence analysis is the gold standard for species authentication and it is often preferred over protein analysis because much more information can be obtained from DNA compared with traditional protein analysis [6]. In terms of species identification, the ultimate aim of isolating DNA is the subsequent amplification of the gene, which implies that the quality of the extracts, in addition to the quantity, must be evaluated [7]. Four steps are indispensable in nucleic acid purification: tissue disruption, nucleoprotein denaturation, nuclease inactivation and removal of contaminants and polymerase chain reaction (PCR) inhibitors [ 8 ]. Once extracted, the isolated DNA can be used in numerous PCR-based applications [ 4 ]. In spite of the ability of PCR tests to work on poor-quality DNA samples, the presence of other molecules, such as inhibitors, in the DNA extracts can interfere with the results of the amplifications [ 2 , 9 ]. Thus, the DNA must be isolated, purified and concentrated by methods that ensure the removal of the inhibitor in the PCR test [ 2 ]. The lower the presence of RNA, PCR inhibitors and DNA fragmentation resulting from the extraction, the more successful the amplification and the method [ 1 ]. In addition, the toxicity, the time required and the price of used material are Foods 2022,11, 1739. https://doi.org/10.3390/foods11121739 https://www.mdpi.com/journal/foods Foods 2022,11, 1739 2 of 16 points that must be considered when choosing an isolation technique [ 7 ]. Additionally, the choice of extraction methodology is of considerable importance to avoid time-consuming optimization in downstream analysis. Moreover, it is necessary to take into account the quantity and quality of DNA required according to the application [ 1 , 4 ]. Some factors to consider when choosing an appropriate method include sample characteristics (amount, type, processing degree and origin), cost, length, simplicity of the process (this affects the DNA integrity), equipment required [ 1 , 4 ], toxicity and disposal of reagents, DNA yield and purity [1]. DNA analysis has become widely used in recent years for the identification of seafood [ 10 ]. Because the morphology of some species is transformed during the processing of commercial products, the visual assignment of species in the case of some food products becomes extremely difficult. In addition to the high commercial value of some marine species, this leads to frequent seafood mislabeling [ 6 , 11 ]. Therefore, an accurate authentication method is crucial to avoid fraud in the fishing sector [ 12 , 13 ]. Some comparisons of DNA extraction methods have been carried out for general samples and for food matrices [ 2 , 4 ], but so far, no specific study has been conducted for seafood. Cephalopoda, Gadiformes and Pleuronectiformes are relevant groups in the world seafood trade. Cephalopods are one of the most important groups in terms of catches, with 322,000 tons in 2018 [14]. In recent years, the world catches of the common cuttlefish (Sepia officinalis) ranged between 8500 and 14,000 tons, reaching 24,059 tons in 2019. This species, which is mainly commercialized frozen or fresh, is very appreciated in some countries, such as Japan and Spain [ 15 ]. As an example of Gadiformes, Gadus morhua is one of the most important commercial fishes in the world. It is marketed under a wide variety of presentations, and in 2018, catches totaling 1,218,000 tons were reported [ 14 ]. Merluccius merluccius is also relevant in this group and can be found fresh, frozen, salted, dried and canned in markets of western Europe, reaching a global production of 116,889 tons in 2019. France, Portugal and Spain are the main producers and consumers of Scophthalmus maximus. Spain, the top global producer, accounted for 75.9% of the global production (3847 tons) in 2002 [ 15 ]. However, despite the enforcement of seafood labeling regulations, species substitution remains common [ 11 ]; therefore, it is important to develop fast and reliable methods of effective seafood authentication. The DNA molecule has proven to be stable at different temperatures, owing to its ability to reveal the identity of food species present in different processed foodstuffs [ 10 ]. DNA extraction methods have evolved over the years, so there is now a diverse variety of commercial kits available with different characteristics and targeting different types of samples. The aim of this study is to compare DNA extraction methods in order to determine the most suitable method for identification of relevant groups of seafood species (Cephalopoda, Gadiformes and Pleuronectiformes). This objective is essential because DNA extraction is often the first step in seafood authentication and traceability control methods. To that end, different parameters, such as DNA yield and quality, automation, simplicity and suitability for subsequent amplification, were evaluated. 2. Materials and Methods 2.1. Sampling Specimens of marine invertebrates and vertebrates of the groups Cephalopoda (Sepia officinalis), Gadiformes (Merluccius merluccius,Gadus morhua) and Pleuronectiformes (Scophthalmus maximus) were purchased fresh at a local fish market in Vigo, Spain. Three specimens per species were obtained, for a total of 12 samples used in this study. Specimens were visually identified and photographed before further processing. 2.2. Sample Processing Samples of the edible portion of the specimens (without skin or bones) were cut into small sections, homogenized using a food processor (Thermomix) and distributed in plastic bags, which were stored at − 80 ◦ C for at least 24 h before DNA isolation in order to ensure Foods 2022,11, 1739 3 of 16 the same starting material for the different extraction methods. Homogenized samples were thawed at room temperature before DNA extraction. Because the focus of our study is verifying the authenticity of seafood products, muscle tissue samples were used, as they represent the edible part of most fishery products. 2.3. DNA Extraction The following methodologies based on different principles were used for DNA extraction of all samples. These methods were selected because for their rapidity, safety, affordability and automation, as well as their efficiency in extracting DNA from muscle tissue of the investigated groups of organisms. 2.3.1. Wizard DNA Clean-Up System Kit (Promega, Madison, WI, USA) This methodology involves the use of a resin with DNA binding capacity and subsequent purification. A portion of 0.3 g of tissue was cut, minced with a scalpel and placed in a 1.5 mL Eppendorf tube with 860 µ L of extraction buffer (1% sodium dodecyl sulfate (SDS), 150 mM NaCl, 2 mM ethylenediaminetetraacetic acid (EDTA) and 10 mM Tris-HCl at pH 8), 100 µ l 5M guanidinium thiocyanate and 40 µ L proteinase K (20 mg/mL). After vortexing, samples were incubated for 2 h in a thermomixer at 56 ◦ C and 800 rpm [ 6 ]. Then, the protocol indicated by the manufacturer was followed for DNA isolation. For this method and the others, the conditions of incubation were selected according to the manufacturer’s recommendations and also derived from previous experiments employing this type of method and organisms [ 7 ]. These conditions proved to be the most suitable for proper DNA extraction. 2.3.2. MPure-12TM Automated Nucleic Acid Purification System (MP Biomedicals, Santa Ana, CA, USA) An MPure tissue DNA extraction kit (MP Biomedicals, Santa Ana, CA, USA) was used with an MPure-12 TM automated nucleic acid purification system. The principle of the method involves magnetic bead separation technology. Following the protocol indicated by the manufacturer, 40 mg of tissue were cut with a scalpel and placed in a 1.5 mL Eppendorf tube with 400 µ L of BL2 buffer and 20 µ L proteinase K (20 mg/mL). After vortexing, samples were incubated for 2 h in a thermomixer at 56 ◦ C and 1000 rpm. After digestion, 400 µ L of digested tissue was introduced into the sample tube, and DNA was extracted automatically by the MPure-12 instrument. 2.3.3. Chelex 100 resin (Biorad, Hercules, CA, USA) Chelex resin traps metal ions and other possible contaminants present in the sample, leaving a DNA in solution. Following the protocol indicated by the manufacturer with some modifications according described by Sepp [ 9 ], approximately 10 mg of sample was vortexed in 100 µ L of a 5% Chelex solution. Samples were centrifuged at 14,000 rpm for 2 min and incubated at 95 ◦ C for 20 min. Then, tubes were vortexed and chilled on ice. Finally, DNA suspension was centrifuged at 14,000 rpm for 2 min and stored at 4 ◦C. 2.3.4. DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) The principle of this method is a silica-based extraction in spin columns. Following the protocol indicated by the manufacturer, tissue samples of 25 mg were weighed into a microcentrifuge tube and vortexed with 180 µ L ATL buffer and 20 µ L proteinase K (20 mg/mL). Then, samples were incubated at 56 ◦ C for 2 h, and 200 µ L of AL buffer and 200 µ L of ethanol (96–100%) were added. Samples were then transferred to silica columns, centrifuged and transferred to new collection tubes. Aliquots of 500 µ L of AW1 wash buffer and AW2 wash buffer were added sequentially and centrifuged. Silica columns were transferred to microcentrifuge tubes, and 200 µ L of AE buffer was added to each column. Columns were incubated at room temperature for 1 min and centrifuged DNA elution. Foods 2022,11, 1739 4 of 16 2.3.5. Swab Method This procedure involved no tissue digestion or DNA isolation. A sterile cotton swab was placed into an Eppendorf tube and weighed. Then, the swab was dipped into the homogenized sample and placed in the Eppendorf tube to be weighed again to determine the amount of sample absorbed into the swab. Then, 500 µ L of water was added to the tube, and the swab was manually stirred for 30 s. The stick was then cut off, and only the absorbing part of the swab was left inside the tube. The sample was centrifuged at 14,000 rpm for 5 min without removing the swab, and the supernatant was used for the subsequent PCR test without further isolation, resulting in an extract that was ready to use. 2.4. DNA Quantity and Quality Determination 2.4.1. Yield and Efficiency The extracted double-stranded DNA was quantified with and Invitrogen Qubit 4 fluorometer (ThermoFisher Scientific, Waltham, MA, USA) using a Qubit dsDNA BR assay kit (Invitrogen, Waltham, MA, USA). DNA yield was calculated by multiplying the DNA concentration value by the final volume of DNA extracted by each method. Moreover, due to the differences in the initial amount of tissue among methods according to the recommendations of manufacturers and previous studies [ 7 ], the method efficiency was determined by dividing the DNA yield by the tissue weight (wet basis). DNA yield (ng) = [DNA] (ng/µL) ×DNA extracted (µL) Method efficiency (ng/mg) = DNA yield (ng)/tissue weight (mg) 2.4.2. Purity Purity was determined with a Nanodrop 2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA) with ratios of absorbance of A260/A280 and A260/A230 [ 2 ]. The ranges considered optimal were 1.8–2.0 for the ratio A260/A280 and 1.8–2.2 for the ratio A260/A230 [16]. 2.4.3. Integrity of Extracted DNA Extract quality in terms of DNA fragmentation was determined by running extracts through a 1% (w/v) agarose gel. For each sample, 10 microliters was loaded [200 ng]. This concentration was selected on the basis of a test to determine the minimum concentration of DNA extract that can be visualized in the gel. The size of the DNA was estimated according to the GeneRuler 100 bp DNA ladder standards (ThermoFisher Scientific, Waltham, MA, USA) and the Lambda DNA/HindIII marker (ThermoFisher Scientific, Waltham, MA, USA). 2.5. Handling Time and Total Extraction Time The total extraction time required for each DNA extraction methodology was calculated from the sum of the digestion time and the handling time. In this study, the digestion time was always 2 h, but the handling time depended on the protocol. Because of technical specifications of the Wizard and Mpure-12 protocols, these methods were applied simultaneously to 10 and 12 samples, respectively, with the protocols optimized for these quantities; therefore, the handling time for one sample was similar to the time spent for 10 or 12 samples individually. 2.6. PCR Amplification and Sequencing 2.6.1. PCR To test the suitability of the extracted DNA for amplification, polymerase chain reactions were carried out in a Veriti thermal cycler (Applied Biosystems, Waltham, MA, USA). Because it is an universal technique for the identification of all species and the routine method used in most control laboratories, PCR was the chosen technique [ 17 , 18 ]. The importance of including very genetically distant groups of species, such as cephalopods Foods 2022,11, 1739 5 of 16 and fish, implied the selection of different pairs of primers for each group. For cephalopods, Folmer primers [ 19 ] were chosen to amplify a 720-base-pair (bp) fragment of cytochrome c oxidase I (COI) (LCO1490-5 0 GGTCAACAAATCATAAAGATATTGG3 0 and HCO2198-5 0 TAAACTTCAGGGTGACCAAAAAATCA3 0 ). PCR was conducted under the following thermal cycling conditions: a preheating step of 94 ◦ C for 5 min, followed by 35 cycles of 94 ◦ C for 40 s, 48 ◦ C for 1 min 20 s, 72 ◦ C for 1 min 20 s and a final extension at 72 ◦ C for 7 min. For Gadiformes and Pleuronectiformes groups, Burgonet primers [ 20 ] were used to amplify a 465 bp fragment of cytochrome b (L14735-5 0 AAAAACCACCGTTGTTATTCAACTA3 0 and H15149ad-5 0 GCICCTCARAATGAYATTTGTCCTCA3 0 ). In this case, the thermal conditions were as follows: initial denaturation at 94 ◦C for 5 min, followed by 35 cycles of denaturation at 94 ◦ C for 40 s, primer annealing at 55 ◦ C for 1 min 20 s and chain elongation at 72 ◦ C for 1 min 20 s, with a final extension at 72 ◦ C for 7 min. PCR reactions (final volume, 25 µ L) were prepared with Illustra PuReTaq Ready-To-Go PCR beads (GE Healthcare, Chicago, IL, USA), with 1 µ L (10 µ M) of each primer and 2–5 µ L (50 ng/ µ L) of template DNA, depending on the concentration of DNA obtained with the extraction method used. In addition, a negative PCR control without template DNA was included in all tests. For the determination of the amplification success, PCR products were visualized in a 2% (w/v) agarose gel with a 5 µ L loading of each PCR product. The size of the amplified fragments was estimated from the molecular marker GeneRuler 100 bp DNA ladder (ThermoFisher Scientific, Waltham, MA, USA). 2.6.2. Sanger Sequencing Positive PCR reactions were purified with an Illustra ExoProStar one-step kit (GE Healthcare, Chicago, IL, USA) following the manufacturer’s protocol. After PCR purification, both strands were sequenced in an ABI 3730 xl automatic sequencer (Applied Biosystems, Waltham, MA, USA). 2.6.3. Sequence Quality Determination For the study of sequence quality, sequences were trimmed with the Geneious program (Bioinformatics Software for Sequence Data Analysis) to ensure a consistent consensus read length (372 bp for Cytochrome b and 619 bp for COI) in order to obtain an estimation of the average quality for each sequence. 2.6.4. Species Authentication The obtained sequences were also used for authentication of individuals by FINS (forensically informative nucleotide sequencing). Phylogenetic trees were created using the neighbor-joining method with the Tamura–Nei model with 1000 bootstrap replicates [ 21 ].The sequences were also checked with the BLAST tool of the NCBI (National Center for Biotechnology Information) to confirm the species. 2.7. Complementary Parameters 2.7.1. Safety The safety of the DNA extraction kits was estimated based on the specifications of each method. Hazardous components and substance classifications of each method were checked for comparison. 2.7.2. Affordability The affordability the methodologies varied depending on the specific materials and equipment required to carry them out. The cost per sample was calculated, and the value of the materials associated with each extraction method was studied for later comparison. 2.7.3. Simplicity The working complexity of each DNA extraction method was evaluated from a technical point of view. Foods 2022,11, 1739 6 of 16 2.7.4. Automation The possibility of automating the methodologies was investigated—an important parameter to consider when working with a large number of samples. 2.8. Statistical Analyses Yield, efficiency and purity data were statistically analyzed using the SPSS Statistical Software System 28.0.1.0 (142). First, the Kolmogorov–Smirnov test was carried out to test the normality of the data distribution. A logarithmic function was used to transform the data that did not follow a normal distribution. To compare significant differences of yield, efficiency and purity obtained with the different extraction methods, a one-way analysis of variance (ANOVA) was used. The same statistical analysis was performed to compare data among species. In both cases, when significant differences were observed, the Bonferroni correction for multiple comparisons was used to determine the effect of the interactions. In addition, to study the method–species interaction, a two-way ANOVA was carried out, and the Tukey test was used to verify the interactions of the values with significant differences. Differences were considered statistically significant at the 5% level (p< 0.05). Replicates were considered as individual samples in all the statistical analyses. 3. Results 3.1. DNA Quantity and Quality 3.1.1. Yield and Efficiency The different DNA extraction methods were compared in terms of total DNA extracted (yield) and efficiency. Figure 1a presents the yield for each method studied. The highest yield was obtained with the Wizard method (12,979 ± 2805 ng). Despite the low yield obtained with the Chelex method, it was the method with the highest efficiency ( 83 ±44 ng DNA/mg wet tissue ), closely followed by MPure-12 (82 ± 35 ng DNA/mg wet tissue). The efficiency of these two methods differs significantly from that obtained with the swab methodology (Figure 1b). Foods 2022, 11, x FOR PEER REVIEW 7 of 16 (a) (b) Figure 1. (a) Yield (ng) of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. Non-identical subscript letters (A, B, C, D) indicate a statistically significant difference (p < 0.05). (b) Method efficiency (ng DNA/mg wet tissue) of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. Non-identical subscript letters (A, B, C, D) indicate a statistically significant difference (p < 0.05). Figure 2. Yield (ng) of the tested methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). 0 2,000 4,000 6,000 8,000 10,000 12,000 14,000 16,000 18,000 Wizard Chelex DNeasy Mpure-12 Swab Yield (ng) A B C D C Figure 1. ( a ) Yield (ng) of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. Non-identical subscript letters (A, B, C, D) indicate a statistically significant difference (p< 0.05). ( b ) Method efficiency (ng DNA/mg wet tissue) of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. Non-identical subscript letters (A, B, C, D) indicate a statistically significant difference (p< 0.05). The Wizard method was found to be the most suitable protocol to achieve high yields for all of the tested species, with the best yield value of all samples obtained for Sepia officinalis (14,817 ± 625) by Wizard extraction (Figure 2). Among all tested methods, Chelex was, on Foods 2022,11, 1739 7 of 16 average, the extraction method with the best efficiency (Figure 3). However, the MPure12 method showed similar results and worked better for Sepia officinalis (128 ±42 ng/mg). Foods 2022, 11, x FOR PEER REVIEW 7 of 16 (a) (b) Figure 1. (a) Yield (ng) of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. Non-identical subscript letters (A, B, C, D) indicate a statistically significant difference (p < 0.05). (b) Method efficiency (ng DNA/mg wet tissue) of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. Non-identical subscript letters (A, B, C, D) indicate a statistically significant difference (p < 0.05). Figure 2. Yield (ng) of the tested methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). 0 2,000 4,000 6,000 8,000 10,000 12,000 14,000 16,000 18,000 Wizard Chelex DNeasy Mpure-12 Swab Yield (ng) A B C D C Figure 2. Yield (ng) of the tested methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). Foods 2022, 11, x FOR PEER REVIEW 8 of 16 Figure 3. Method efficiency (ng DNA/mg wet tissue) of the tested methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). 3.1.2. Purity The purity of the extracted DNA was verified by measuring its absorbance at 230, 260 and 280 and evaluating the ratios 260/280 and 260/230. In the case of the ratio 260/280, the method with the closest values to the optimal 1.8–2 range was Wizard (Figure 4a), although no significant differences were observed between the Wizard, DNeasy and MPure-12 methods. However, in the case of the 260/230 ratio, only the results from DNeasy and MPure-12 are close to the optimal range (1.8–2.2) (Figure 4b). (a) (b) Figure 4. (a) Purity (260/280) of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. Non-identical subscript letters (A, B) indicate a statistically significant difference (p < 0.05). (b) Ratio 260/230 of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. The analysis per species of the purity of the DNA extracts is presented in Figure 5. The extraction protocol that performed the best for all species was the Wizard method (260/280). However, for Merluccius merluccius and Sepia officinalis, the Chelex and MPure12 methods, respectively, generated DNA within the optimal purity range (260/280). Most of the DNA extractions of the tested species showed values that indicate the presence of 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Wizard Chelex DNeasy Mpure-12 Swab Purity (260/280) A A A B B 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Wizard Chelex DNeasy Mure-12 Swab 260/230 Figure 3. Method efficiency (ng DNA/mg wet tissue) of the tested methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). 3.1.2. Purity The purity of the extracted DNA was verified by measuring its absorbance at 230, 260 and 280 and evaluating the ratios 260/280 and 260/230. In the case of the ratio 260/280, the method with the closest values to the optimal 1.8–2 range was Wizard (Figure 4a) , although no significant differences were observed between the Wizard, DNeasy and Foods 2022,11, 1739 8 of 16 MPure-12 methods . However, in the case of the 260/230 ratio, only the results from DNeasy and MPure-12 are close to the optimal range (1.8–2.2) (Figure 4b). Foods 2022, 11, x FOR PEER REVIEW 8 of 16 Figure 3. Method efficiency (ng DNA/mg wet tissue) of the tested methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). 3.1.2. Purity The purity of the extracted DNA was verified by measuring its absorbance at 230, 260 and 280 and evaluating the ratios 260/280 and 260/230. In the case of the ratio 260/280, the method with the closest values to the optimal 1.8–2 range was Wizard (Figure 4a), although no significant differences were observed between the Wizard, DNeasy and MPure-12 methods. However, in the case of the 260/230 ratio, only the results from DNeasy and MPure-12 are close to the optimal range (1.8–2.2) (Figure 4b). (a) (b) Figure 4. (a) Purity (260/280) of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. Non-identical subscript letters (A, B) indicate a statistically significant difference (p < 0.05). (b) Ratio 260/230 of the tested DNA extraction methods. Data are presented as mean ± SD of samples per method. The analysis per species of the purity of the DNA extracts is presented in Figure 5. The extraction protocol that performed the best for all species was the Wizard method (260/280). However, for Merluccius merluccius and Sepia officinalis, the Chelex and MPure12 methods, respectively, generated DNA within the optimal purity range (260/280). Most of the DNA extractions of the tested species showed values that indicate the presence of 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Wizard Chelex DNeasy Mpure-12 Swab Purity (260/280) A A A B B 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Wizard Chelex DNeasy Mure-12 Swab 260/230 Figure 4. ( a ) Purity (260/280) of the tested DNA extraction methods. Data are presented as mean ±SD of samples per method. Non-identical subscript letters (A, B) indicate a statistically significant difference (p< 0.05). ( b ) Ratio 260/230 of the tested DNA extraction methods. Data are presented as mean ±SD of samples per method. The analysis per species of the purity of the DNA extracts is presented in Figure 5. The extraction protocol that performed the best for all species was the Wizard method (260/280). However, for Merluccius merluccius and Sepia officinalis, the Chelex and MPure-12 methods, respectively, generated DNA within the optimal purity range (260/280). Most of the DNA extractions of the tested species showed values that indicate the presence of contaminants, regardless of the method used (260/230) (Figure 6). The values of the A260/A230 ratio (1.8–2.2) were within the optimal range only when extraction was performed using the DNeasy method with Scophthalmus maximus and Sepia officinalis samples [22]. Foods 2022, 11, x FOR PEER REVIEW 9 of 16 contaminants, regardless of the method used (260/230) (Figure 6). The values of the A260/A230 ratio (1.8–2.2) were within the optimal range only when extraction was performed using the DNeasy method with Scophthalmus maximus and Sepia officinalis samples [22]. Figure 5. Purity (260/280) of the tested DNA extraction methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). Figure 6. Ratio 260/230 of the tested DNA extraction methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). 3.1.3. Integrity of Extracted DNA Another important variable that can influence the PCR performance of a DNA extract is integrity, defined as the level of degradation of the DNA extract, i.e., a degradation process in which DNA is broken down by biological (nucleases activity), chemical and physical processes. Knowing whether the DNA has been degraded with processing is important when designing downstream applications; therefore, analysis of the extracted DNA is crucial. DNA integrity was evaluated in this study by agarose gel electrophoresis Figure 5. Purity (260/280) of the tested DNA extraction methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). Foods 2022,11, 1739 9 of 16 Foods 2022, 11, x FOR PEER REVIEW 9 of 16 contaminants, regardless of the method used (260/230) (Figure 6). The values of the A260/A230 ratio (1.8–2.2) were within the optimal range only when extraction was performed using the DNeasy method with Scophthalmus maximus and Sepia officinalis samples [22]. Figure 5. Purity (260/280) of the tested DNA extraction methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). Figure 6. Ratio 260/230 of the tested DNA extraction methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). 3.1.3. Integrity of Extracted DNA Another important variable that can influence the PCR performance of a DNA extract is integrity, defined as the level of degradation of the DNA extract, i.e., a degradation process in which DNA is broken down by biological (nucleases activity), chemical and physical processes. Knowing whether the DNA has been degraded with processing is important when designing downstream applications; therefore, analysis of the extracted DNA is crucial. DNA integrity was evaluated in this study by agarose gel electrophoresis Figure 6. Ratio 260/230 of the tested DNA extraction methods per species. Data are presented as mean ± SD of individuals per species. Scophthalmus maximus (SMAX), Merluccius merluccius (MMER), Sepia officinalis (SOFF) and Gadus morhua (GMOR). 3.1.3. Integrity of Extracted DNA Another important variable that can influence the PCR performance of a DNA extract is integrity, defined as the level of degradation of the DNA extract, i.e., a degradation process in which DNA is broken down by biological (nucleases activity), chemical and physical processes. Knowing whether the DNA has been degraded with processing is important when designing downstream applications; therefore, analysis of the extracted DNA is crucial. DNA integrity was evaluated in this study by agarose gel electrophoresis of DNA extracts; however, only the Wizard and MPure-12 methods provided enough DNA to allowing this analysis. In the Supplementary Materials, Figures S1 and S2 present the electrophoresis of DNA samples extracted with these two methods. The results were similar in terms of the range of fragment sizes obtained: between 9000 and 24,000 bp; this result guarantees that PCR amplification would not be limited by the integrity of the DNA present in the extract [ 8 ]. In the gel, it was possible to observe some differences regarding the species analyzed; in the case of hake (M. merluccius) and cod (G. morhua), a band with a value higher than 9416 bp was clearly distinguished. However, this band was not detected in the case of the other species analyzed. 3.2. Handling Time and Total Extraction Time The total DNA extraction time varied considerably depending on the methodology used (Table 1). Chelex and swab extraction were very fast compared to the other methods. Table 1. Digestion time, handling time and total extraction time of the tested methods. Method Digestion Time Handling Time Total Extraction Time Wizard 2 h 3 h 5 h * Chelex - 1 h 30 min 1 h 30 min DNeasy 2 h 2 h 4 h MPure 2 h 1 h 3 h * Swab - 1 h 1 h * Wizard and MPure methods are standardized to 10 and 12 samples, respectively. Foods 2022,11, 1739 16 of 16 17. Sotelo, C.G.; Velasco, A.; Perez-Martin, R.I.; Kappel, K.; Schröder, U.; Verrez-Bagnis, V.; Jérôme, M.; Mendes, R.; Silva, H.; Mariani, S.; et al . Tuna labels matter in Europe: Mislabelling rates in different tuna products. PLoS ONE 2018 ,13, e0196641. [CrossRef] [PubMed] 18. Mariani, S.; Griffiths, A.M.; Velasco, A.; Kappel, K.; Jérôme, M.; Perez-Martin, R.I.; Schröder, U.; Verrez-Bagnis, V.; Silva, H.; Vandamme, S.G.; et al. Low mislabeling rates indicate marked improvements in European seafood market operations. Front. Ecol. Environ. 2015,13, 536–540. [CrossRef] 19. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994,3, 294–299. 20. Burgener, M. Molecular Species Differentiation of Fish and Mammals. Ph.D. Thesis, University of Bern, Bern, Switzerland, 1997. 21. Kumar, S.; Dudley, J.; Nei, M.; Tamura, K. MEGA: A biologist-centric software for evolutionary analysis of DNA and proteinsequences. Brief. Bioinform. 2008,9, 299–306. [CrossRef] 22. Yalçınkaya, B.; Yumbul, E.; Mozio˘glu, E.; Akgoz, M. Comparison of DNA extraction methods for meat analysis. Food Chem. 2017 , 221, 1253–1257. [CrossRef] 23. Besbes, N.; Sáiz-Abajo, M.J.; Sadok, S. Comparative study of DNA extraction to initiate harmonized protocol for a simple method of species identification: Fresh and canned Tuna case study. CyTA-J. Food 2022,20, 39–49. [CrossRef] 24. Singer-Sam, J.; Tanguay, R.L.; Riggs, A.D. Use of Chelex to improve the PCR signal from a small number of cells. Amplifications 1989,3, 11. 25. Meissner, H.; Fevolden, S.E.; Amundsen, P.A.; Præbel, K. Evaluation of three methods for high throughput extraction of DNA from challenging fish tissues. Conserv. Genet. Resour. 2013,5, 733–735. [CrossRef]