Altered expression of the immunoregulatory ligand-receptor pair CD200-CD200R1 in the brain of Parkinson’s disease patients

ARTICLE OPEN Altered expression of the immunoregulatory ligand-receptor pair CD200-CD200R1 in the brain of Parkinson’s disease patients Neus Rabaneda-Lombarte 1,2 , José Manuel Vidal-Taboada 2,3 , Tony Valente 1,2 , Mario Ezquerra 4,5,6 , Rubén Fernández-Santiago 4,5,6 , María José Martí 4,5,6 , Yaroslau Compta 4,5,6,7 , Josep Saura 2,7 and Carme Solà 1 ✉ Neuroinflammation, in which activated microglia are involved, appears to contribute to the development of Parkinson’s disease (PD). However, the role of microglial activation and the mechanisms governing this process remain uncertain. We focused on one inhibitory mechanism involved in the control of microglial activation, the microglia inhibitory receptor CD200R1, and its ligand CD200, mainly expressed by neurons. The human CD200R1 gene encodes two membrane-associated and two soluble protein isoforms and the human CD200 gene encodes full-length proteins (CD200full) but also truncated (CD200tr) proteins which act as CD200R1 antagonists. Little is known about their expression in the human brain under pathological conditions. We used human peripheral blood monocytes and monocyte-derived microglia-like cells from control subjects to characterize the expression of the CD200R1 mRNA variants, which showed stimulus-specific responses. We provide evidence of increased CD200R1 (mRNA variants and protein isoforms) and CD200 expression (CD200tr mRNA) in brain tissue of PD patients, mainly in the hippocampus, as well as increased CD200 expression (CD200full and CD200tr mRNAs) in iPSCs-derived dopaminergic neurons generated from skin fibroblasts of PD patients. Our results suggest that CD200-CD200R1 signalling is altered in PD, which may affect the microglial function and constitute a potential target in therapeutic strategies for PD. npj Parkinson’s Disease (2022) 8:27 ; https://doi.org/10.1038/s41531-022-00290-2 INTRODUCTION The contribution of glial cells, mainly activated microglia, to the etiology, and the progression of Parkinson’s disease (PD) has been repeatedly postulated 1–3 . The results of genetic and imaging studies suggest that microglial alterations occur in the brain of PD patients 4–6 , although the precise mechanisms by which they are involved in the development of neuronal damage remain to be elucidated. Preclinical studies show that inhibition of the inflammatory response associated with activated microglial cells is neuroprotective in experimental models of PD. Nevertheless, clinical studies using anti-inflammatory approaches in PD patients have failed to achieve positive results to date, suggesting that new targets or different treatment time windows need to be explored (revised in 7 and 8 ). In homeostasis, several inhibitory mechanisms maintain the microglia in a surveillant phenotype in the central nervous system (CNS). However, the presence of chronic microglial activation in the brain of patients with PD suggests that these inhibitory mechanisms are impaired 9–14 . In the present study, we focused our attention on one of these mechanisms, the CD200-CD200R1 ligand-receptor pair, a potential therapeutic target for controlling inflammation in the human brain 15–17 . The CD200R1 immune inhibitory receptor is expressed by myeloid cells, and therefore in microglial cells in the CNS. In the CNS, CD200 is mainly expressed by neurons, although it is also expressed by astrocytes and oligodendrocytes in pathological conditions. A decrease in the expression of CD200 and/or CD200R1 has been described in the brain of multiple sclerosis 18,19 and Alzheimer’s disease patients 20 . In addition, monocyte-derived macrophages from PD patients show alterations in the regulation of CD200R1 in response to an inflammatory stimulus 21 . Recently, two potential risk polymorphisms for PD have been described in the promoter region of the CD200R1 gene, associated with reduced transcriptional activity of the promoter 22 . Changes in the expression of CD200 and/or CD200R1 have also been described in animal models of neurological disorders 23–26 . In these experimental models, inhibition of the CD200-CD200R1 system has resulted in a negative outcome 27–29 and the stimulation of CD200R1 in a better outcome of the pathology 30,31 . In a recent study, we showed changes in the expression of CD200 and CD200R1 in an experimental mouse model of PD and the neuroprotective effect of a CD200R1 agonist 32 . Altogether, these results suggest that the CD200-CD200R1 ligand-receptor pair is a potential pharmacological target for the treatment of neurodegenerative processes. While the murine Cd200r1 gene encodes a single CD200R1 protein 33 , the human CD200R1 gene can generate four mRNA variants through alternative splicing 34 . Variants 1 and 4 (long mRNA variants) encode protein isoforms 1 and 4, which are 1 Department of Cerebral Ischemia and Neurodegeneration, Institut d’Investigacions Biomèdiques de Barcelona-Consejo Superior de Investigaciones Científicas (CSIC), Institut d’Investigacions Biomèdiques August-Pi i Sunyer (IDIBAPS), Barcelona, Spain. 2 Biochemistry and Molecular Biology Unit, School of Medicine, University of Barcelona, IDIBAPS, Barcelona, Spain. 3 Peripheral Nervous System Research Group, Vall d’Hebron Research Institute (VHIR), Barcelona, Spain. 4 Parkinson’s Disease and Movement Disorders Unit, Service of Neurology, Institute of Clinical Neurosciences, Hospital Clínic of Barcelona, Barcelona, Spain. 5 Department of Clinical and Experimental Neurology, Laboratory of Parkinson disease and other Neurodegenerative Movement Disorders: Clinical and Experimental Research, IDIBAPS, University of Barcelona, Barcelona, Spain. 6 Centro de Investigación Biomédica en Red de Enfermedades Neurodegenerativas, CIBERNED, Barcelona, Spain. 7 Institute of Neurosciences, University of Barcelona, Barcelona, Spain. ✉email: [email protected].es www.nature.com/npjparkd Published in partnership with the Parkinson’s Foundation 1234567890():,; transmembrane proteins. Variants 2 and 3 (short mRNA variants) encode protein isoforms 2 and 3, which are soluble truncated proteins that lack the transmembrane and the cytoplasmic domains. Human CD200R1 isoform 4 is homologous to the murine CD200R1 34 . Regarding CD200, both the mouse and human CD200 genes generate full-length (CD200full) and truncated (CD200tr) mRNA variants through alternative splicing 35,36 . CD200full protein, which is the most abundant form, interacts with CD200R1 and activates signal transduction pathways resulting in the inhibition of the pro-inflammatory response or the potentiation of the anti-inflammatory response in microglial cells 16 . However, the CD200tr protein lacks the N-terminal region and, although it interacts with CD200R1, it does not induce signal transduction, and is considered a physiologic antagonist of CD200-induced suppression 35 . Although different functions may be attributed to the membrane and soluble CD200R1 protein isoforms and to the full-length and the truncated CD200 isoforms, there are no studies regarding the possible functional relevance of each CD200 and CD200R1 mRNA variant or protein isoform. In addition, to our knowledge, little attention has been paid to the expression of the different CD200 and CD200R1 mRNA variants or protein isoforms in neurological disorders. The aim of the present work was to study possible changes in the CD200-CD200R1 system in the human brain in the context of PD. To this end, we determined the expression of CD200 and CD200R1 in post-mortem samples of the substantia nigra, frontal cortex, and hippocampus of PD patients, identifying mRNA variants and protein isoforms. Furthermore, we investigated specific correlations with clinical and anatomopathological data. We first used human monocyte cultures obtained from peripheral Fig. 1 CD200R1 expression in human monocytes and microglia-like cells. Representative images of agarose gel electrophoresis illustrating conventional PCR products for CD200R1 mRNA variants after random primer retrotranscription (V1, 616 bp; V2, 468 bp; V3, 417 bp; V4, 565 bp) and CD200R1 protein expression by immunofluorescence (protein isoforms 1 and 4), in human monocytes cultured for 24 h (a) and microglialike cells cultured for 14 days (b). Scale bar: 50 µm. cSchematic diagram of the localization of the mRNA target sequences of the primers used for the quantification of the four human CD200R1 mRNA variants by qRTPCR using gene-specific retrotranscription. Exons are not depicted to scale and are represented as rectangles. The arrows indicate the relative positions of primers: primers for the gene-specific retrotranscription (RT) of i) V1 and V4 long CD200R1 mRNA variants (green arrows) or ii) V2 and V3 short CD200R1 mRNA variants (yellow arrows); forward (Fw) and reverse (Rv) primer pairs for qRT-PCR that generate short amplicons to amplify V1 (blue arrows) or V4 (red arrows) in i) and V2 (blue arrows) or V3 (red arrows) in ii). dComparative mRNA expression of the four CD200R1 mRNA variants in monocytes and microglia-like cells by qRT-PCR after gene-specific retrotranscription. GAPDH and RPS18 were used as reference genes. Individual points are represented and bars indicate the positions of the mean ± SEM of 7 independent experiments. *p< 0.05 and **p< 0.01; two-tailed unpaired Student’st-test. N. Rabaneda-Lombarte et al. 2 npj Parkinson’s Disease (2022) 27 Published in partnership with the Parkinson’s Foundation 1234567890():,; blood and monocyte-derived microglia-like cell cultures to characterize the expression of CD200R1 mRNA variants in human myeloid cells. In addition, we also determined the expression of CD200full and CD200tr mRNAs in induced pluripotent stem cell (iPSC)-derived dopaminergic (DAn) and non-dopaminergic neurons (non-DAn) obtained from PD patients and their corresponding controls as an independent validation in a humanized PD neural system. RESULTS Differential expression of CD200R1 mRNA variants in human monocytes and monocyte-derived microglia-like cells Although CD200 is highly expressed in the brain, mainly by neurons, the level of CD200R1 expression, which is only expressed by myeloid cells, is very low in this organ. Microglia, the most abundant myeloid cells in the brain, only account for 10–15% of all brain cells. This fact and the existence of four CD200R1 mRNA variants resulting from alternative splicing and encoding protein isoforms with potentially different functions make the detection of the different CD200R1 mRNA variants and protein isoforms in brain tissue challenging. For this reason, we first set up and optimized the detection of the four CD200R1 mRNA variants in human myeloid cell cultures. To this end, we used primary human monocyte cell cultures obtained from peripheral blood. Then, we also studied the expression of CD200R1 mRNA variants in human microglia-like cells obtained by differentiation of the peripheral blood monocytes. We first detected the four CD200R1 mRNA variants in monocyte cultures by random primer retrotranscription followed by conventional PCR (Fig. 1a). We also detected V1 and V4 but not V2 and V3 CD200R1 mRNAs in microglia-like cells (Fig. 1b). We then corroborated the presence of CD200R1 protein in monocyte (Fig. 1a) and microglia-like cell cultures (Fig. 1b) by immunofluorescence, although the antibodies commercially available detect only the long transmembrane protein isoforms. As these experimental approaches are not quantitative, we next determined the expression of each CD200R1 mRNA by qRT-PCR. However, because of the overlapping sequences of the four human CD200R1 mRNA variants (Fig. 1c), optimal primers (75–200 bp amplicon size) cannot be designed to individually quantify them by qRT-PCR after random primer retrotranscription. To quantify the expression of each variant, we designed an alternative approach based on gene-specific primer retrotranscription, which consists of specific primers for the retrotranscription of a) V1 and V4 variants (long mRNA variants) or b) V2 and V3 variants (short mRNA variants) (Fig. 1c), and primer pairs for qRTPCR that generate short amplicons (75–200 bp) to amplify V1 or V4 in a) and V2 or V3 in b) (Fig. 1c) (Table 1). We first validated this approach using primary human monocyte cell cultures and we then compared the expression of each variant in monocytes and microglia-like cells. While V1 and V4 were similarly expressed in both cell types, microglia-like cells showed lower expression of V2 Table 1. Primers used for conventional PCR and qRT-PCR. Target mRNA Accession number Forward primer (5’→3’) Reverse primer (5’→3’) Amplicon size CD200R1 PRIMERS USED FOR CONVENTIONAL PCR V1 CD200R1 NM_138806.4 GGTGCTGCTCAACCAAACAA CCTCCCAGTGGCATGTACTCT 616 bp V2 CD200R1 NM_138939.3 GGTGCTGCTCAACCAAACAA CCTCAATATATGATGCTCCT 468 bp V3 CD200R1 NM_138940.3 TTAGTGGCCGCTTCAAGCAG CCTCAATATATGATGCTCCT 417 bp V4 CD200R1 NM_170780.3 TTAGTGGCCGCTTCAAGCAG CCTCCCAGTGGCATGTACTCT 565 bp Reference gene: RPS18 NM_022551.3 CCTGAAAAGTTCCAGCATATTTTGC TTTATTAACAGACAAGGCCTACAGAC 470 bp PRIMERS USED FOR qRT-PCR After gene-specific retrotranscription: V1 and V2 CD200R1 NM_138806.4 NM_138939.3 ATCTTCTTAGTGGCCGAAGC GCACAGCATTTGTAGCCATC 193 bp V3 and V4 CD200R1 NM_138940.3 NM_170780.3 CTTCTTAGTGGCCGCTTCAA TAGGAGGGCAACAAAGCACA 137 bp After non-specific gene retrotranscription: V1 and V4 CD200R1 NM_138806.4 NM_170780.3 GTTGTTGAAAGTCAATGGCTGC CACTTTGTAATGCCTCAGATGCC 164 bp V2 and V3 CD200R1 NM_138939.2 NM_138940.3 TTCAGATTCGTACCGTGGCC CCTCAATATATGATGCTCCT 125 bp CD200full Chen et al. 36a CAGCCTGGTTTGGGTCATG GCAGAGAGCATTTTAAGGAAGCA 113 bp CD200tr Chen et al. 36b GATGGAGAGGCTGTGCAAGTG GCAGAGAGCATTTTAAGGAAGCA 79 bp Reference genes: ACTB NM_001101.5 AGAGCTACGAGCTGCCTGAC AGCACTGTGTTGGCGTACAG 184 bp GAPDH NM_002046.7 GAAGGTGAAGGTCGGAGTCA GTTAAAAGCAGCCCTGGTGA 67 bp RPS18 NM_022551.3 GATGGGCGGCGGAAAAT CTTGTACTGGCGTGGATTCTGC 174 bp ACTB Actin beta, CD200full full-length CD200, CD200tr truncated CD200, CD200R1 CD200 receptor 1, GAPDH glyceraldehyde-3-phosphate dehydrogenase, RPS18 ribosomal protein S18, V1-V4 CD200R1 CD200 receptor 1 mRNA splice variant 1–4. a The sequences correspond to the primers published by Chen et al. 36 . Recent sequence updates show that they recognize 8 CD200 mRNA variants: variant 1, NM_005944.7; variant 2, NM_001004196.4; variant 3, NM_00131826.2; variant 6, NM_001365851.2; variant 7, NM_001365852.1; variant 8, NM_001365853.1; variant 9, NM_001365854.1; variant 10, NM_001365855.1. However, CD200 mRNA variants 3 and 10 encode a single CD200tr protein isoform (the same as CD200 mRNA variant 5). b The sequences correspond to the primers published by Chen et al. 36 . Recent sequence updates show that they recognize 2 CD200 mRNA variants: variant 4, NM_001318828.2; variant 5, NM_001318830.2. They encode two CD200tr protein isoforms. N. Rabaneda-Lombarte et al. 3 Published in partnership with the Parkinson’s Foundation npj Parkinson’s Disease (2022) 27 and V3 than monocytes (Fig. 1d). Altogether, these results suggest that CD200R1 is differentially expressed in peripheral blood monocytes and microglia. We also studied the expression of each CD200R1 mRNA variant in response to different stimuli, such as the pro-inflammatory stimulus LPS and the anti-inflammatory stimulus IL4. A significant decrease in the expression of V3 and V4 CD200R1 mRNA variants was observed in microglia-like cells treated with LPS for 24 h (Fig. 2a). On the contrary, a significant increase in V1 CD200R1 mRNA expression was detected 24 h after IL4 treatment (Fig. 2b). Changes in CD200R1 and CD200 mRNA expression in Parkinson’s disease When analyzing each CD200R1 mRNA variant in post-mortem human brain tissue by conventional PCR, we detected V1 and V2 but not V3 and V4 mRNA variants. Then, using the same strategy as in monocytes and microglia-like cells to distinguish the four CD200R1 mRNA variants by qRT-PCR, we were able to detect the V1 mRNA variant, but not the other three CD200R1 mRNA variants. A low level of expression together with a dilution effect of microglial mRNAs in the human brain tissue mRNAs may be responsible for the lack of detection of all the CD200R1 mRNA variants. Given the singularity of CD200R1 expression in humans, where four mRNA variants are described instead of the one variant found in mice, we decided to study the expression of the two long variants together (V1+V4, which encode membrane-bound proteins) and the two short variants together (V2+V3, which encode soluble proteins). To this end, we used random primer retrotranscription followed by qRT-PCR with primers for long or short mRNA variants (Table 1). Using this methodology, we were able to detect the two types of variants in the agarose gel electrophoresis and also quantify them by qRT-PCR. Long and short CD200R1 mRNA variants were not differentially expressed in the substantia nigra and frontal cortex of PD subjects compared to age-matched controls, although a trend to increase was observed in the frontal cortex (Fig. 3a, b). However, short mRNA variants were significantly increased in the hippocampus of PD patients, where a trend to increase in long mRNA variants was also observed (Fig. 3c). As regards CD200, CD200full mRNA expression showed no differences between control individuals and PD patients in any of the three areas analyzed (Fig. 3a–c). On the contrary, CD200tr mRNA levels were strongly increased in the hippocampus from PD patients compared to control individuals (Fig. 3c). Changes in CD200R1 and CD200 protein expression in Parkinson’s disease We next studied the protein expression of CD200R1 and CD200 in the substantia nigra, frontal cortex, and hippocampus of PD patients and their corresponding controls. In the case of CD200R1, the antibodies commercially available detect CD200R1 long isoforms. In the case of CD200, the antibodies commercially available recognize CD200full and probably CD200tr as well. We observed higher levels of CD200R1 in the substantia nigra and hippocampus of PD patients than in age-matched controls, but no differences were detected in the frontal cortex (Fig. 4a–c). CD200 protein levels were not modified in the substantia nigra, frontal cortex, or hippocampus of PD patients when compared to controls (Fig. 4a–c). Correlation with clinical and anatomopathological data To further study the expression of CD200 and CD200R1 in the brain of PD patients, we assessed whether the levels of expression correlated with specific clinical and anatomopathological data (Table 2). Fig. 2 CD200R1 expression in human microglia-like cells treated with inflammatory stimuli. mRNA expression of the four CD200R1 mRNA variants in microglia-like cells treated for 24 h with LPS (100 ng/mL) (a) or IL4 (50 ng/mL) (b) by qRT-PCR after gene-specific retrotranscription. GAPDH and RPS18 were used as reference genes. Individual points are represented and bars indicate the positions of the mean ± SEM of 3–4 independent experiments. *p< 0.05 and **p< 0.01; two-tailed paired Student’st-test. N. Rabaneda-Lombarte et al. 4 npj Parkinson’s Disease (2022) 27 Published in partnership with the Parkinson’s Foundation In an analysis of our cohort according to clinical and demographic data, we considered parameters such as gender, age at death, age of onset of the disease, duration of the disease, and the presence of dementia. In PD patients, the age of onset was negatively correlated with the duration of the disease (r=−0.7502, p< 0.01, n=15, Spearman correlation) while it was positively correlated with the age at death (r=0.7359, p< 0.01, n=15, Spearman correlation). In general, we observed no correlations between the level of expression of CD200R1, CD200full, and CD200tr and gender, age at death, age of PD onset, duration of the disease or presence of dementia. The only exception was that CD200tr mRNA levels in the frontal cortex of PD patients were positively correlated with age of onset (r= 0.5273, p< 0.05, n=15, Spearman correlation) (Fig. 5). Multiple regression analysis showed that this effect was not driven by the age at death. We then analyzed whether the levels of CD200R1 and CD200 expression in PD patients were associated with anatomopathological alterations (Fig. 6). Thus, we first examined whether they were influenced by the stage of Lewy pathology (LP stage) (Fig. 6a–d). Lewy pathology staging was based on the classification of Braak et al. 37 : LP 1 stage, Lewy pathology in medulla oblongata; Fig. 3 CD200R1 and CD200 mRNA expression in the post-mortem brain of Parkinson’s disease patients. Expression of long (V1 +V4) and short (V2 +V3) CD200R1 mRNA variants, and CD200full and CD200tr mRNAs in the substantia nigra (SN) (a), frontal cortex (b) and hippocampus (c) tissue homogenates from control individuals (C, n=6–8) and Parkinson’s disease patients (PD, n=19–21) by qRT-PCR. GAPDH and RPS18 were used as reference genes. Data are expressed as fold change relative to C and are depicted as individual points with bars showing means ± SEM. *p< 0.05 and ***p< 0.001 vs. C; Mann-Whitney test. A maximum of one outlier or exceptionally two outliers were removed from each experimental group (Grubb’s test). N. Rabaneda-Lombarte et al. 5 Published in partnership with the Parkinson’s Foundation npj Parkinson’s Disease (2022) 27 LP 2 stage, LP 1 plus pontine tegmentum; LP 3 stage, LP 2 plus midbrain; LP 4 stage, LP 3 plus basal prosencephalon and mesocortex; LP 5 and LP 6 stages, LP 4 plus neocortex. All the patients in our cohort presented LP 4-LP 6 stages, with the exception of one patient who presented LP 3 stage. In the substantia nigra and frontal cortex, no differences in CD200R1 and CD200 expression were found among the different LP stages. However, we observed higher levels of all CD200R1 mRNAs in the hippocampus of PD patients at advanced LP stages (LP 5 and LP 6) than at early LP stages (LP 4 and LP 4-5) (Fig. 6a, b); this effect was not observed at the protein level, which already showed a significant increase at LP 4 and LP 4-5 stage (Fig. 6c). In addition, CD200tr mRNA was similarly increased in the hippocampus of PD patients at all LP stages (Fig. 6d). Next, we determined the influence of Alzheimer’s diseaserelated pathology, such as neurofibrillary tangles and neuritic plaques, on the results obtained (Fig. 6e–h). Firstly, the levels of CD200R1 and CD200 expression were analyzed versus the stages of neurofibrillary tangle pathology (NFT) defined by Braak et al. taking into account the topographical distribution pattern of the neurofibrillary lesions 38 : NFT I and NFT II stages, transentorhinal areas; NFT III and NFT IV stages, limbic areas; NFT V and NFT VI stages, isocortical areas. None of the patients in our cohort presented NFT V or NFT VI stages. In the substantia nigra and the hippocampus, the increased levels of CD200R1 protein observed in PD patients did not depend on the NFT stage. However, the increased CD200tr mRNA levels detected in the hippocampus of PD patients were higher in patients without neurofibrillary pathology or with NFT I +NFT II stage than with higher NFT stages (Fig. 6e). No relation between CD200 or CD200R1 levels of expression and stage of neurofibrillary degeneration in the frontal cortex was detected. Finally, we analyzed the data taking into account the neuritic plaque score in the PD patients according to CERAD (Consortium Fig. 4 CD200R1 and CD200 protein levels in the post-mortem brain of Parkinson’s disease patients. Expression of CD200R1 protein isoforms 1 and 4 and CD200 proteins in the substantia nigra (SN) (a), frontal cortex (b), and hippocampus (c) tissue homogenates from control individuals (C, n=4–8) and Parkinson’s disease patients (PD, n=11–21) by western blot. Representative immunoblots are presented. Protein levels were normalized relative to βtubulin. Data are expressed as fold change relative to C and are depicted as individual points with bars showing means ± SEM. *p< 0.05 and **p< 0.01 vs. C; Mann-Whitney test. N. Rabaneda-Lombarte et al. 6 npj Parkinson’s Disease (2022) 27 Published in partnership with the Parkinson’s Foundation to Establish a Registry for Alzheimer’s Disease) criteria 39 : sparse neuritic plaques (NP A), moderate neuritic plaques (NP B), and frequent neuritic plaques (NP C). None of the patients in our cohort presented NP C. We observed that in the substantia nigra and the hippocampus of PD patients, the highest increases in CD200R1 protein were detected in cases with NPA (Fig. 6f and g). Similarly, the highest increases in CD200tr mRNA in the hippocampus were detected in cases without Alzheimer’s disease-related pathology or with NP A (Fig. 6h). CD200 expression in iPSCs from controls and PD patients Finally, we determined the expression of CD200full and CD200tr mRNAs in iPSC-derived DAn generated from skin fibroblasts from PD patients and controls. This experimental approach is an interesting tool used to estimate the gene expression of specific neural cell types not necessarily representing end-stage disease nor being influenced by post-mortem factors such as postmortem delay. We considered both patients bearing mutations in leucine-rich repeat kinase 2 (LRRK2) and sporadic idiopathic PD Table 2. Clinical and anatomopathological data of cases. Case No. Gender Age (years) PMD (hours) Anatomopathological examination Clinical diagnosis Age of onset (years) C1 Male 78 6:00 Multi-infarct Leukoencephalopathy C2 Male 83 13:00 AgD I (mild) C3 Female 56 14:00 Brain metastasis oat cell lung cancer +NFT I-II C4 Female 86 4:00 Right vertebral thrombosis + cerebellar bulbar ictus +NFT III C5 Female 82 20:00 AgD III +NFT III +vascular encephalopathy C6 Female 90 12:20 Brainstem haemorrhage +SVD +ARP IIIB +TDP43 CA1 C7 Male 78 6:00 iLBD Braak 1 +NFT I-II +SVD C8 Male 76 11:30 AgD I (minimal) PD1 Male 85 12:15 LP 5 +capillary CAA +glial tau PD +dementia Unknown PD2 Male 82 7:15 LP 4-5 +AgD III +ARP IV B + microinfarcts PD +dementia Unknown PD3 Male 76 17:10 LP 5 +ARP IVB PD +dementia, DBS 51 PD4 Female 86 16:04 LP 6 +ARP IIIB Parkinsonism 81 PD5 Female 82 13:10 LP 4 +ARP IB PD 54 PD6 Male 79 11:30 LP 3 +NFT II PD Unknown PD7 Male 50 16:30 LP 5 +hypoxic neuronal damage PD, pallidum and subthalamic nucleus DBS 27 PD8 Male 81 5:00 LP 5 +AgD I RBD +PD +dementia 71 (RBD) 74 (PD) PD9 Female 87 7:00 LP 6 +ARP IVB PD +dementia 67 PD10 Male 77 12:00 LP 4 +NFT II RBD +PD +mild cognitive impairment 74 PD11 Female 78 18:00 LP 5 +glial tau +diffuse hypoxia PD +Arnold Chiari I +IBM 56 PD12 Male 74 8:00 LP 5 +ARP IIIB +moderate CAA PD 55 PD13 Male 87 15:15 LP 5 +ARP IIA PD +dementia 71 PD14 Male 78 5:15 LP 5 +ARP IIB PD +dementia Unknown PD15 Male 71 5:00 LP 4 +ARP IB PD +dementia Unknown PD16 Male 74 14:03 Mild LP 5 +complex tauopathy PD +dementia + hallucinations, Right pallidotomy 39 PD17 Male 81 7:20 LP 4-5 +ARP IIA +capillary CAA PD Unknown PD18 Female 83 4:00 LP 4-5 +ARP IIA PD +dementia + hallucinations 60 (right hand tremor) 76 (hallucinations +cognitive impairment) PD19 Male 80 16:30 LP 4 +ARP II PD +bilateral subthalamic nucleus DBS 40 PD20 Male 62 13:30 LP 5 +ARP IIA PD +dementia 49-50 (PD) 58 (dementia) PD21 Male 92 16:40 LP 4-5 +ARP IIIA +SVD PD 76 (motor symptoms) Cases identification: C1-C8, control cases; P1-P21, Parkinson’s disease cases. AgD Argyrophilic grain disease, ARP Alzheimer’s disease-related pathology: classification of neurofibrillary tangle (NFT) pathology based on Braak staging 38 (I-VI) and classification of neuritic plaques based on CERAD criteria (A-C) 39 ; CAA: Cerebral amyloid angiopathy; CT: control; DBS: deep brain stimulation; IBM: Inclusion body myositis; LP: Lewy-pathology staging, studies based on the classification of Braak 37 (1–6); iLBD: incidental Lewy body disease; PD: Parkinson’s disease; RBD: REM sleep behaviour disorder; PMD: post-mortem delay; SVD: small vessel disease; TDP43 CA1: TAR DNA binding protein 43 in hippocampal CA1 region. N. Rabaneda-Lombarte et al. 7 Published in partnership with the Parkinson’s Foundation npj Parkinson’s Disease (2022) 27 patients (Fig. 7a). We observed a significant increase in CD200full mRNA expression in DAn from PD patients, which was linked to both LRRK2-associated and sporadic idiopathic PD (Fig. 7b). CD200tr mRNA expression was also significantly increased in iPSC-derived DAn of all PD patients, an effect that was also significant when LRRK2-associated and sporadic idiopathic PD samples were analysed separately in independent comparisons (Fig. 7c). In contrast, CD200full and CD200tr mRNA expression were not significantly modified in iPSC-derived cultures notenriched-in-DAn from the same PD patients relative to controls (Fig. 7d, e). These results show that the increased CD200 mRNA levels observed in iPSCs-derived neurons from PD patients are specifically associated with DAn. DISCUSSION The aim of the present study was to investigate possible alterations in the expression of the microglial inhibitory receptor CD200R1 and its ligand CD200 in the brain of PD patients. The existence of different mRNA variants encoding these proteins was taken into account, given the potential different functional significance of the resulting proteins. We used human monocyte and microglia-like cell cultures to optimize the protocol to quantify the four human CD200R1 mRNA variants by qRT-PCR. In the brain of PD patients, we detected an increase in the expression of CD200R1 and CD200tr when compared to controls. Among the three brain regions analyzed (substantia nigra, frontal cortex, and hippocampus), the hippocampus presented the most marked changes in expression in PD patients. Finally, we detected an increase in the expression of CD200full and CD200tr in iPSCderived cultures of DAn generated from skin fibroblasts of PD patients when compared to controls. The CD200-CD200R1 ligand-receptor pair plays an inhibitory role in the control of microglial activation in the CNS, contributing to the maintenance of microglial cells in a resting/surveillant condition under physiological conditions 15–17 . A decreased expression of CD200 and/or CD200R1 in the brain of Alzheimer’s disease 20 and multiple sclerosis patients 18,19 suggests that this inhibitory mechanism has been overloaded in these neurological disorders. Nevertheless, these studies do not discriminate between CD200full and CD200tr or among the different CD200R1 mRNA variants and the resulting protein isoforms. To our knowledge, this is the first time that the mRNA expression of all the components described in the human CD200-CD200R1 system (CD200full, CD200tr, and the CD200R1 variants) have been analyzed. Quantification of the mRNA expression of each CD200R1 variant is not possible using random primer retrotranscription followed by qRT-PCR in optimal conditions (75–200 bp amplicon size) because of their overlapping sequences. Consequently, we designed a method based on gene-specific retrotranscription that we validated using human monocyte and microglia-like cell cultures. While monocytes clearly expressed the four CD200R1 mRNA variants, microglia-like cells presented V1 and V4 mRNA levels similar to monocytes but V2 and V3 mRNA levels much lower than in monocytes. In addition, the expression of CD200R1 mRNA variants in microglia-like cells was differentially affected by proand anti-inflammatory stimuli. These results indicate that myeloid cell types differ in their relative expression of the CD200R1 mRNA variants and suggest a stimulus-specific regulation of human CD200R1 mRNA variants. However, the function of each human CD200R1 protein isoform remains to be elucidated. Because of its amino acid sequence identity with murine CD200R1 34 , human protein isoform 4 most likely has similar functions to murine CD200R1. In post-mortem brain tissue, we only detected the expression of V1 and V2 mRNAs by conventional PCR. It is necessary to take into account that the CD200R1 gene is only faintly expressed in microglial cells, which are present at a low percentage in the brain tissue. Consequently, the V3 and V4 variants may be present but the methodology may not be sensitive enough to detect them individually. Isolation of microglia from brain tissue to obtain pure microglia mRNA would be of relevance to study the expression of the CD200R1 mRNA variants in these cells. However, Vieites and collaborators described the presence of the four mRNA variants in different human tissues including the brain by conventional PCR 34 . These authors did not specify which region of the brain was analyzed. Differential expression of each CD200R1 mRNA variant in different brain regions could explain these discrepancies. Given the singularity of CD200R1 expression in humans, where the CD200R1 gene encodes not only long transmembrane protein isoforms but also short soluble protein isoforms, and not ruling out the possible presence of the four CD200R1 mRNA variants in the brain tissue, we decided to study the possible differences between the mRNA expression of membrane vs. soluble mRNA variants. Thus, we quantified by qRT-PCR the long mRNA variants together (V1 +V4) and the short mRNA variants together (V2 + V3) in post-mortem brain from PD patients and the corresponding controls. The results obtained are summarized in Table 3.We detected increased expression in the short CD200R1 mRNAs (V2 + V3) encoding soluble forms of CD200R1 in the hippocampus of PD patients and a trend to increase in the frontal cortex. A trend to increase in CD200R1 mRNAs encoding the long transmembrane forms (V1 +V4) was also observed in the hippocampus and frontal cortex of PD patients; the increase was statistically significant in the hippocampus of PD patients with advanced stages of Lewy pathology (LP 5+LP 6). CD200R1 protein levels were increased in substantia nigra and hippocampus. An increase in the expression of the CD200R1 membrane forms may be interpreted as a potentiation of the CD200-CD200R1 system in the context of inflammation resolution and reparative response. On the contrary, although the physiological meaning of the CD200R1 soluble isoforms remains unknown, an increase might result in inhibition of the CD200-CD200R1 system by preventing the binding of cells expressing the ligand to cells carrying the membrane receptor, acting as decoy receptors. Few studies have considered the expression of CD200full and CD200tr separately, albeit only CD200full is thought to induce immunosuppression. Interestingly, Chen et al. 36 showed that the susceptibility of different mouse strains to lung pathology after viral (MHV-1) infection is correlated with an increase in the CD200full/CD200tr ratio, because the balance shifts towards the immunosuppressive form. In addition, CD200tr expression in tumor cells stimulates tumor immunity and results in fewer Fig. 5 Significant correlation between CD200tr mRNA levels and age of onset in the frontal cortex in PD patients. Spearman’s correlation coefficient (r) and the corresponding p value are indicated. N. Rabaneda-Lombarte et al. 8 npj Parkinson’s Disease (2022) 27 Published in partnership with the Parkinson’s Foundation metastases 40,41 . In the CNS, Matsumoto et al. 42 described the presence of CD200 +macrophages in the ischemic regions of a rat stroke model; however, CD200tr was expressed at higher levels in the ischemic core and CD200full in the contralateral and periischemic regions, suggesting that macrophages in the lesion core escape the suppression induced by CD200-CD200R1 interactions. In the experimental autoimmune encephalomyelitis model of multiple sclerosis, we detected changes in CD200 expression in several spinal cord regions, mainly a decrease in Cd200full mRNA expression and an increase in Cd200tr mRNA levels 24 . N. Rabaneda-Lombarte et al. 9 Published in partnership with the Parkinson’s Foundation npj Parkinson’s Disease (2022) 27