Generation and characterization of a human iPSC line from a patient with propionic acidemia due to defects in the PCCA gene

Lab Resource: Stem Cell Line Generation and characterization of a human iPSC line from a patient with propionic acidemia due to defects in the PCCA gene Esmeralda Alonso-Barroso a,b,c,d , Sandra Brasil a,b,c,d , Álvaro Briso-Montiano a,b,c,d ,RosaNavarrete b,c,d , Celia Pérez-Cerdá b,c,d , Magdalena Ugarte b,c,d , Belén Pérez a,b,c,d , Lourdes R. Desviat a,b,c,d , Eva Richard a,b,c,d, ⁎ a Centro de Biología Molecular Severo Ochoa UAM-CSIC, Universidad Autónoma, Madrid, Spain b Centro de Diagnóstico de Enfermedades Moleculares (CEDEM), Madrid, Spain c Centro de Investigación Biomédica en Red de Enfermedades Raras (CIBERER), ISCIII, Madrid, Spain d Instituto de Investigación Sanitaria Hospital La Paz (IdiPaz), ISCIII, Madrid, Spain abstractarticle info Article history: Received 13 June 2017 Received in revised form 7 July 2017 Accepted 20 July 2017 Available online 22 July 2017 Human induced pluripotent stem cell (iPSC) line was generated from fibroblasts of a patient with propionic acidemia carrying mutations in the PCCA gene: c.1899+4_1899+7delAGTA; p.(Cys616_Val633del) and c.1430−−?_1643+?del; p.(Gly477Glufs*9). Reprogramming factors OCT3/4,SOX2,KLF4 and c-MYC were delivered using a non-integrative method based on the Sendai virus. Once established, iPSCs have shown full pluripotency, differentiation capacity and genetic stability. © 2017 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Resource table Unique stem cell line identifier UAMi001-A Alternative name of stem cell line PCCA23-FiPS4F8 Institution Centro de Biología Molecular Severo Ochoa UAM-CSIC, Universidad Autónoma de Madrid, CIBERER, IDIPaz, Madrid, Spain Person who created resource Esmeralda Alonso-Barroso, Eva Richard Contact person and email Eva Richard, [email protected] Date archived/stock date September 17, 2016 Origin Human skin cells Type of resource Biological reagent: induced pluripotent stem cells (iPSC); derived from a patient with propionic acidemia due to defects in the PCCA gene Sub-type Human iPSC line Key transcription factors OCT3/4,SOX2,c-MYC,KLF4 (CytoTune®-iPS 2.0 Sendai Reprogramming Kit; Invitrogen by Life Technologies) Authentication Identity and purity of cell line confirmed (Fig. 1) Link to related literature Not available Cell line repository/bank Not applicable Ethics Patient informed consent obtained/Ethics Review Board-competent authority approval obtained Resource utility This iPSC line was generated to differentiate into cardiomyocytes and neurons and obtain new disease models. We will investigate the pathophysiology of propionic acidemia disease and evaluate the effects of therapeutic compounds such as antioxidants. Resource details Propionic acidemia (PA) is an inherited metabolic disease caused by mutations in either the PCCA or PCCB genes (Richard et al., 2015). Fibroblasts from a compound heterozygous PA patient carrying two mutations in the PCCA gene (c.1899+4_1899+7delAGTA; p.(Cys616_Val633del) and c.1430−−?_1643+?del; p.(Gly477Glufs*9)) (Desviat et al., 2009) were reprogrammed using the CytoTune™iPS 2.0 Sendai Reprogramming kit delivering the four human reprogramming factors OCT3/4,SOX2,c-MYC and KLF4 (Takahashi et al., 2007). The iPSC line PCCA23-FiPS4F8 (UAMi001A) displayed a typical round shape ESC-like morphology and growth behaviour (Fig. 1A) and the colonies stained positive for alkaline phosphatase activity (Fig. 1B). The clearance of the vectors and the exogenous reprogramming factor genes was observed by RT-PCR after 8 culture passages (Fig. 1C). Mycoplasma testing by a colorimetry assay revealed a negative result (Supplementary Fig. S1A). To analyze the genetic stability, we confirmedthepresenceofthetwomutationsintheiPSClinebySangersequencing (c.1899+4_1899+7delAGTA; p.(Cys616_Val633del) and multiplex ligation probe amplification (MLPA) analysis (c.1430−?_1643+?del; p.(Gly477Glufs*9)) revealing exons 17–18 deletion (Fig. 1D); and we also confirmed by DNA fingerprinting analysis that the line was derived from Stem Cell Research 23 (2017) 173–177 ⁎Corresponding author at: Centro de Biología Molecular Severo Ochoa UAM-CSIC, C/ Nicolás Cabrera N°1, Universidad Autónoma Madrid, 28049 Madrid, Spain. E-mail address: [email protected] (E. Richard). http://dx.doi.org/10.1016/j.scr.2017.07.021 1873-5061/© 2017 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr the patient's fibroblasts (Supplementary Fig. S1B). The iPSC line also displayed a normal karyotype (46, XX) after more than twenty culture passages (Fig. 1E). Expression of key pluripotency genes was observed both at RNA level (transcription factors OCT4,SOX2,REX1,NANOG,CRIPTO and KLF4)byqRT-PCR(Fig. 1F), as well as at protein level (transcription factors OCT4, NANOG and SOX2, and surface markers SSEA3, SSEA4, TRA-1-60 and TRA-1-81) by immunocytochemistry (Fig. 1G) and flow cytometry analysis (Fig. 1H). In addition, methylation analysis of the promoters of the 174 E. Alonso-Barroso et al. / Stem Cell Research 23 (2017) 173–177 pluripotency associated genes, OCT4 and NANOG, revealed a heavy methylation in the original fibroblasts and an almost complete demethylation in the iPSC line (Fig. 1I). Finally, the cells had the capacity to form derivatives of all three germ layers (endoderm, mesoderm and ectoderm) upon embryoid body differentiation (Fig. 1J, Table 1). Materials and methods Non-integrative reprogramming of mutant PCCA fibroblasts into iPSC The present study included available fibroblasts from a PA patient with defects in the PCCA gene. Experimental protocols were approved by the Institutional Ethical Committee of the Universidad Autónoma de Madrid according to Spanish and European Union legislation,and informed consent was obtained from the legal care-givers. Patient-derived fibroblasts were cultured under standard conditions in MEM supplemented with 10% fetal bovine serum, 200 mM glutamine and antibiotics. Fibroblasts were reprogrammed using the CytoTune™iPS 2.0 Sendai Reprogramming kit (Life Technologies) following the manufacturer's instructions. iPSCs were maintained and expanded both on feeder layers and on feeder-free layers. In the first case, human fibroblasts feeders were mitotically inactivated by gamma irradiation (80 Gy). iPSCs were cultured on top of irradiated human fibroblasts changing every day the iPSC medium containing: knockout DMEM (Life Technologies), 10% knockout serum replacement (Life Technologies), 0.5% human serum albumin (Grifols), 2 mM Glutamax ™(Life Technologies), 100 μM non-essential amino acids (Lonza), 100 μMβ-mercaptoethanol (Life Technologies), 50 U/ml penicillin, 50 mg/ml streptomycin (Life Technologies) and 10 ng/ml bFGF (Peprotech). For the propagation of iPSC, mechanical procedures were applied using a “stripper”micropipette and 150 μmtips(MidAtlantic) to carefully lift and aspirate the colony. iPSC were also adapted and cultured in feeder-free conditions on Matrigel® (Corning) using iPSC conditioned medium and, in this case, for the iPSC propagation the enzymatic procedure StemPro® accutase® (Gibco by Life Technologies) was used. iPSC conditioned medium was obtained from feeder layers, supplemented with 10 ng/ml bFGF and filtered. Phosphatase alkaline analysis iPSC colonies were picked and plated onto a P-100 plate with feeders. After six days, direct phosphatase alkaline activity was determined using the Phosphatase Alkaline Blue Membrane Substrate Solution kit (Sigma-Aldrich) following manufacturer's instructions. Detection of Sendai virus genome and transgenes After 8 passages, iPSC line was tested for Sendai virus (SeV) residues. Total RNA was isolated using TRIzol® Reagent (Life Technologies) and 1 μg of RNA was retrotranscribed using NZY First-Strand cDNA Synthesis kit (NZY Tech). RNA from the transduced cell pool at passage zero was used as positive control. PCR was performed using the primers indicated in Table 2 and following the instructions as recommended by the manufacturer. Mutation analysis Genomic DNA from the patient-derived fibroblasts and iPSCs was isolated using MagNA Pure Compact DNA Isolation kit and MagNA Pure Compact instrument (Roche). Subsequently, amplification by PCR of the PCCA region containing the c.1899+4_1899+7delAGTA; p.(Cys616_Val633del) mutation was carried out using the primers indicated in Table 2, and amplified PCR fragments were sequenced in an ABI3730 sequencer (Applied Biosystems). Detection of c.1430− ?_1643+?del; p.(Gly477Glufs*9) mutation was performed using the SALSA MLPA P278-C1-PCCA probemix (MRC-Holland) for copy number detection. Karyotype analysis Karyotype analysis of the iPSC line was carried out using cells with more than twenty culture passages which were processed using standard cytogenetic techniques. Briefly, cells were treated with 10 μg/ml of Colcemid® Solution (Irvine Scientific) for 90 min at 37 °C, dissociated by accutase, treated with hypotonic solution and fixed with Carnoy's fixative. Cells were then dropped on a microscope glass slide and dried. Metaphase cells were G banded using Wright staining. At least 20 metaphases were karyotyped. Karyotype analysis was performed at Instituto de Genética Médica y Molecular del Hospital Universitario de La Paz, Madrid, Spain. Quantitative PCR analysis Total RNA from the fibroblasts and iPSCs was isolated using TRIzol® Reagent (Life Technologies). RT-PCR was performed using High Capacity RNA to cDNA kit (Applied Biosystems), and real-time PCR was performed using SYBR® Green Master Mix (Applied Biosystems) and LightCycler 480 instrument (Roche), at Parque Científico de Madrid, Campus de Cantoblanco, UAM, Madrid, Spain. Amplification efficiency and sample-to-sample variation were normalized by monitoring GAPDH. The expression levels of several pluripotency associated genes (OCT4,SOX2,REX1,NANOG,CRIPTO and HLF4) were quantified. Primer sequences were described by (Aasen et al., 2008)(Table 2). Immunofluorescence analysis iPSC were grown on feeder layers on 15 μ-Slide 8 well culture plates (Aasen et al., 2008)andfixed with Formaline Solution 10% (Sigma-Aldrich). The following antibodies were used: TRA-1-60 (Millipore; MAB4360; 1:200); TRA-1-81 (Millipore; MAB4381; 1:200); SOX2 (Thermo Scientific, PA1-16968, 1:100); NANOG (RD Systems, AF1997, 1:25); SSEA-4 (DSHB, MC-813-70, 1:3); SSEA-3 (DSHB, MC-631, 1:3); OCT4 (Santa Cruz Biotechnology, sc-5279, 1:60); β-III Tubulin Tuj1 (Covance, MMS-435P, 1:500); α-1 Fetoprotein (Dako, A0008, 1:400); α-Smooth muscle actin (Sigma-Aldrich, A5228, 1:400) (Table 2). Secondary antibodies used were from Alexa Fluor Series from Jackson Immunoresearch, Thermo Fisher Scientificand Invitrogen (1:200) (Table 2). For nucleus staining DAPI (Invitrogen, 1:10,000) was used. Images were taken using a Zeiss confocal microscope. Fig. 1. Generation and molecular and functional characterization of the PCCA23-FiPS4F8 iPSC line. (A) Typical embryonic stem cell-like colony morphology obtained after fibroblasts reprogramming. (B) Alkaline phosphatase enzymatic activity staining (right) and unstained iPS colony (left). (C) RT-PCR for the detection of the exogenous reprogramming factors and Sendai virus vectors. C+: transduced cell pool at passage zero; C–: non-template control. (D) Electropherogram showing mutation c.1899+4_1899+7delAGTA; p.(Cys616_Val633del) (top) and MLPA analysis showing the deletion of exons 17 and 18 (mutation c.1430−?_1643+?del; p.Gly477fs) (bottom) of the iPSC line. (E) Karyotype analysis. (F) qPCR showing the relative gene expression of the endogenous pluripotency associated markers OCT4,SOX2,REX1,NANOG,CRIPTO and KLF4. (G) Immunofluorescence analysis with typical embryonic stem cell markers such as transcription factors OCT4, NANOG and SOX2, and surface markers SSEA3, TRA-1-81, SSEA4 and TRA-1-60; scale bars: 100 μm. (H) Expression analysis of pluripotent markers (SSEA4, TRA-1-81 and TRA-1-60) by flow cytometry analysis. (I) Bisulfite sequencing analysis of OCT4 and NANOG promoters. Each horizontal row of circles represents the methylation status of each CpG in one clone. Open circles indicate unmethylated CpG dinucleotides and filled circles, methylated. (J) Immunofluorescence analysis with specific markers of all three primary germ layers after in vitro differentiation. Endoderm: α-1-Fetoprotein; mesoderm: α-Smooth muscle actin; ectoderm: β-III-Tubulin Tuj1; scale bars: 50 μm. 175E. Alonso-Barroso et al. / Stem Cell Research 23 (2017) 173–177 Flow cytometry analysis We analysed the pluripotency-associated markers SSEA4, TRA-1-60 and TRA-1-81 by flow cytometry. iPSC were dissociated by incubation with accutase for 5 min. Then, cells were suspended in PBS/2%BSA to a cell density of 1.5 × 10 5 cells per 100 μl and incubated with the specific primary antibody (1/100 for TRA-1-60 and TRA-1-81, and no dilution for SSEA4) for 20 min at 4 °C. Cells were washed with PBS/2%BSA and incubated with Alexa Fluor® 647 (1/600) for 20 min at 4 °C. Finally, cells were washed with PBS/2%BSA and analysed using a FACSCanto A (Becton Dickinson) and FlowJo 10.2 software program. An irrelevant isotype-match antibody was always used as a negative control. Bisulfite sequencing Bisulfite modification of genomic DNA was performed with EZ DNA Methylation-Gold™kit (Zymo Research) following the manufacturer's instructions. Converted DNA was amplified by PCR using primers previously published (Freberg et al., 2007) and Immolase™Red DNA Polymerase (Bioline). PCR conditions were 95 °C for 8 min and 40 cycles of 94 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min, followed by 10 min at 72 °C. PCR products were cloned into bacteria by pGEM®-T Easy Vector (Promega) and sequenced using T7 primer. Sequences of 5 bacterial clones per genomic region examined are represented as rows of circles in Fig. 1H with each circle symbolizing the methylation state of one CpG. Table 1 Characterization and validation. Classification Test Result Data Morphology Photography Visual record of the line: normal Fig. 1 panel A Phenotype Immunocytochemistry Assess staining/expression of pluripotency and cell surface markers: OCT4, NANOG, SOX2, SSEA3, TRA-1-81, SSEA4 and TRA-1-60 Fig. 1 panel G Flow cytometry Assess staining/expression of pluripotency markers: SSEA4, TRA-1-60, TRA-1-81 Fig. 1 panel H Genotype Karyotype (G-banding) and resolution 46XX, Resolution 450–500 Fig. 1 panel E Identity Microsatellite PCR (mPCR) Not performed STR analysis 16 sites tested and all of them matched Supplementary Fig. 1 panel B Mutation analysis (IF APPLICABLE) Sequencing and MLPA analysis c.1899+4_1899+7del AGTA; p.(Cys616_Val633del) and c.1430−?_1643+?del; p.(Gly477Glufs*9) Fig. 1 panel D Southern Blot OR WGS Not performed Microbiology and virology Mycoplasma Mycoplasma testing by a colorimetric assay: negative Supplementary Fig. 1 panel A Differentiation potential Embryoid body formation Expression of smooth muscle actin, β-III-tubulin Tuj1 and α−1 fetoprotein Fig. 1 panel J Donor screening (OPTIONAL) HIV 1 + 2 Hepatitis B, Hepatitis C Not performed Genotype additional info (OPTIONAL) Blood group genotyping Not performed HLA tissue typing Not performed Table 2 Reagents details. Antibodies used for immunocytochemistry Antibody Dilution Company Cat# and RRID Pluripotency markers Mouse IgG anti-OCT4 1:60 Santa Cruz Cat# sc-5279, AB_628051 Rat IgM anti-SSEA3 1:3 Hybridoma Bank Cat# MC-631, AB_528476 Rabbit IgG anti-SOX2 1:100 Fisher Thermo Scientific Cat# PA1-16968, AB_2195781 Mouse IgG anti-SSEA4 1:3 HYBRIDOMA Bank Cat# MC-813-70, AB_528477 Mouse IgM anti-TRA-1-60 1:200 Millipore Cat# MAB4360, AB_2119183 Goat IgG anti-NANOG human 1:25 R&D Cat# AF1997, AB_355097 Mouse IgM anti-TRA-1-81 1:200 Millipore Cat# MAB4381, AB_177638 Differentiation markers Rabbit IgG anti-α-Fetoprotein 1:400 Dako Cat# A0008, AB_2650473 Mouse IgG anti-β-III-Tubulin Tuj1 1:500 Covance Cat# MMS-435P, AB_231377 Mouse IgG anti-α-smooth muscle actin 1:400 Sigma-Aldrich Cat# A5228, AB_262054 Secondary antibodies Alexa 555 Donkey anti-Mouse IgG 1:200 Thermo Fischer Cat# A-31570, AB_2536180 Alexa 488 Goat anti-Rat IgM 1:200 Thermo Fischer Cat# A-21212, AB_2535798 Alexa 488 Donkey anti-Rabbit IgG 1:200 Thermo Fischer Cat# A-31572, AB_162543 Alexa 555 Donkey anti-Mouse IgG 1:200 Thermo Fischer Cat# A-31570, AB_2536180 Alexa 647 Goat anti-Mouse IgM 1:200 Thermo Fischer Cat# A-21238, AB_2535807 Alexa 647 Donkey anti-Goat IgG 1:200 Thermo Fischer Cat# A-21447, AB_2535864 Alexa 55 Donkey anti-Mouse IgM Cy3 1:200 Jackson Cat# 715-165-140, Primers Target Forward/Reverse primer (5′-3′) Reverse transcription-PCR SeV genome GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC KOS transgene ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG KLF4 transgene TTCCTGCATGCCAGAGGAGCCC/AATGTATCGAAGGTGCTCAA c-MYC transgene TAACTGACTAGCAGGCTTGTCG/TCCACATACAGTCCTGGATGATGATG Pluripotency Markers (Qpcr) OCT4 GGAGGAAGCTGACAACAATGAAA/GGCCTGCACGAGGGTTT SOX2 TGCGAGCGCTGCACAT/TCATGAGCGTCTTGGTTTTCC NANOG ACAACTGGCCGAAGAATAGCA/GGTTCCCAGTCGGGTTCAC CRIPTO CGGAACTGTGAGCACGATGT/GGGCAGCCAGGTGTCATG REX1 CCTGCAGGCGGAAATAGAAC/GCACACATAGCCATCACATAAGG KLF4 CGAACCCACACAGGTGAGAA/GAGCGGGCGAATTTCCAT House-keeping genes (qPCR) GAPDH GCACCGTCAAGGCTGAGAAC/AGGGATCTCGCTCCTGGAA Targeted mutation analysis/sequencing (PCR) PCCA-exon 21 TTGATGGACATTTGGGTTTTT/AGCAGTAATGAAGCCAAGTTCA 176 E. Alonso-Barroso et al. / Stem Cell Research 23 (2017) 173–177 In vitro differentiation To perform in vitro differentiation analysis, iPSC colonies were first cultured in suspension so that they form large aggregates called embryoid bodies (EBs). EBs differentiate spontaneously to different cell types derived from the three germ layers. iPSCs from a P100 plate treated with matrigel (80% confluency) were dissociated into a single cell suspension with accutase, and resuspended in 12 ml of conditioned medium.EBs formation was induced by seeding120 μl of theiPSC suspension in each well of 96-well v-bottom low attachment plates, and by centrifuging the plates at 800gfor 10 min to aggregate the cells. After 2 days, the EBs were transferred to untreated P60 culture plates for 2 days. Subsequently, the EBs were transferred to 15 μ-Slide 8 well culture plates previously treated with matrigel for 1 h at room temperature, and cultured in differentiation medium (DMEM supplemented with 20% fetal bovine serum, 2 mM Glutamax™,100μM non-essential amino acids, 100 μMβ-mercaptoethanol, and 50 U/ml penicillin, 50mg/ml streptomycin)for2–3 weeks to allow spontaneous endoderm formation. For mesoderm differentiation, EBs were maintained for 2– 3 weeks in differentiation medium supplemented with 100 μMascorbic acid (A4403, Sigma-Aldrich). For ectoderm differentiation, EBs were cultured in a special differentiation medium containing (50% DMEM F12, 50% neurobasal medium, 2 mM Glutamax™, 1× N2 supplement, 1× B27 supplement and 50 U/ml penicillin, 50 mg/ml streptomycin, all from Gibco by Life Technologies) for 2–3 weeks. In all cases, the medium was changed every two days. Mycoplasma detection Cells were screened for mycoplasma contamination using a colorimetric assay, PlasmoTest™Mycoplasma Detection Kit (InvivoGen), following the manufacturer's protocol. DNA fingerprinting analysis DNA fingerprinting analysis was performed using the AmpFLSTR® Identifiler® PCR Amplification Kit (Thermo Fisher Scientific). A total of 1 ng of DNA was used and highly polymorphic regions containing short tandem repeated sequences were evaluated by the amplification of the following markers (D8S1179, D21S11, D7S820, CSF1P0, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, D5S818, FGA and Amelogenin for sex determination) by PCR. Samples were run on a 3730 DNA Analyzer (Applied Biosystems) and the analysis was performed using GeneMapper® v4.0, at Parque Científico de Madrid, Campus Moncloa, UCM, Madrid, Spain. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.scr.2017.07.021. Acknowledgments This work was supported by Spanish Ministry ofEconomy and Competitiveness and European Regional Development Fund (grant numbers SAF2013-43005-R and SAF2016-76004-R). The authors thank INDEPF (Instituto de investigación y desarrollo social de enfermedades poco frecuentes), and E. Mansilla for her excellent assistance in the karyotype analysis (Instituto de Genética Médica y Molecular del Hospital Universitario de La Paz, Madrid, Spain). Centro de Biología Molecular Severo Ochoa receives an institutional grant from Fundación Ramón Areces (grant number CNXVII). References Aasen, T., Raya, A., Barrero, M.J., Garreta, E., Consiglio, A., Gonzalez, F., Vassena, R., Bilic, J., Pekarik, V., Tiscornia, G., Edel, M., Boue, S., Izpisua Belmonte, J.C., 2008. Efficient and rapid generation of induced pluripotent stem cells from human keratinocytes. Nat. Biotechnol. 26 (11), 1276–1284. Desviat, L.R., Sanchez-Alcudia, R., Perez, B., Perez-Cerda, C., Navarrete, R., Vijzelaar, R., Ugarte, M., 2009. High frequency of large genomic deletions in the PCCA gene causing propionic acidemia. Mol. Genet. Metab. 96 (4), 171–176. Freberg, C.T., Dahl, J.A., Timoskainen, S., Collas, P., 2007. Epigenetic reprogramming of OCT4 and NANOG regulatory regions by embryonal carcinoma cell extract. Mol. Biol. Cell 18 (5), 1543–1553. Richard, E., Perez, B., Perez-Cerda, C., Desviat, L.R., 2015. Understanding molecular mechanisms in propionic acidemia and investigated therapeutic strategies. Expert Opin. Orphan Drugs 3 (12), 1427–1438. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., Yamanaka, S., 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131 (5), 861–872. 177E. Alonso-Barroso et al. / Stem Cell Research 23 (2017) 173–177