Epigenetic modifier Kdm6a/Utx controls the specification of hypothalamic neuronal subtypes in a sex-dependent manner

Epigenetic modifier Kdm6a/Utx controls the specification of hypothalamic neuronal subtypes in a sex-dependent manner Lucas E. Cabrera Zapata  1 , María Julia Cambiasso  2 , 3 * ‡ and Maria Angeles Arevalo  1 , 4 * ‡ 1 Instituto Cajal (IC), CSIC, Madrid, Spain, 2 Instituto de Investigación Médica Mercedes y Martín Ferreyra, INIMEC-CONICET, Universidad Nacional de Córdoba, Córdoba, Argentina, 3 Facultad de Odontología, Universidad Nacional de Córdoba, Córdoba, Argentina, 4 Centro de Investigación Biomédica en Red de Fragilidad y Envejecimiento Saludable (CIBERFES), Instituto de Salud Carlos III, Madrid, Spain Kdm6a is an X-chromosome-linked H3K27me2/3 demethylase that promotes chromatin accessibility and gene transcription and is critical for tissue/cellspecific differentiation. Previous results showed higher Kdm6a levels in XX than in XY hypothalamic neurons and a female-specific requirement for Kdm6a in mediating increased axogenesis before brain masculinization. Here, we explored the sex-specific role of Kdm6a in the specification of neuronal subtypes in the developing hypothalamus. Hypothalamic neuronal cultures were established from sex-segregated E14 mouse embryos and transfected with siRNAs to knockdown Kdm6a expression (Kdm6a-KD). We evaluated the effect of Kdm6a-KD on Ngn3 expression, a bHLH transcription factor regulating neuronal sub-specification in hypothalamus. Kdm6a-KD decreased Ngn3 expression in females but not in males, abolishing basal sex differences. Then, we analyzed Kdm6a-KD effect on Ascl1,Pomc,Npy,Sf1, Gad1, and Th expression by RT-qPCR. While Kdm6a-KD downregulated Ascl1 in both sexes equally, we found sex-specific effects for Pomc,Npy, and Th.Pomc and Th expressed higher in female than in male neurons, and Kdm6a-KD reduced their levels only in females, while Npy expressed higher in male than in female neurons, and Kdm6a-KD upregulated its expression only in females. Identical results were found by immunofluorescence for Pomc and Npy neuropeptides. Finally, using ChIP-qPCR, we found higher H3K27me3 levels at Ngn3,Pomc, and Npy promoters in male neurons, in line with Kdm6a higher expression and demethylase activity in females. At all three promoters, Kdm6a-KD induced an enrichment of H3K27me3 only in females. These results indicate that Kdm6a plays a sex-specific role in controlling the expression of transcription factors and neuropeptides critical for the differentiation of hypothalamic neuronal populations regulating food intake and energy homeostasis. KEYWORDS KDM6A/UTX, H3K27 demethylation, hypothalamic neuronal subtypes, sex differences, neurogenin (Ngn) 3 OPEN ACCESS EDITED BY Jo Huiqing Zhou, Radboud University, Netherlands REVIEWED BY Shin-ichi Horike, Kanazawa University, Japan Matthew Slattery, University of Minnesota, United States *CORRESPONDENCE María Julia Cambiasso, [email protected]r.edu, Maria Angeles Arevalo, [email protected] ‡ These authors have contributed equally to this work and share last authorship SPECIALTY SECTION This article was submitted to Developmental Epigenetics, a section of the journal Frontiers in Cell and Developmental Biology RECEIVED 06 May 2022 ACCEPTED 07 September 2022 PUBLISHED 04 October 2022 CITATION Cabrera Zapata LE, Cambiasso MJ and Arevalo MA (2022), Epigenetic modifier Kdm6a/Utx controls the specification of hypothalamic neuronal subtypes in a sex-dependent manner. Front. Cell Dev. Biol. 10:937875. doi: 10.3389/fcell.2022.937875 COPYRIGHT © 2022 Cabrera Zapata, Cambiasso and Arevalo. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Frontiers in Cell and Developmental Biology frontiersin.org01 TYPE Original Research PUBLISHED 04 October 2022 DOI 10.3389/fcell.2022.937875 Introduction Obesity and its associated comorbidities such as type 2 diabetes mellitus, cardiovascular disease, dyslipidemia, and chronic inflammation, among others, have become a global health threat and a major socioeconomic burden for modern societies with a tendency toward sedentary lifestyles and diets based on hypercaloric/ ultra-processed food products (Martin-Rodriguez et al., 2015; Khanna et al., 2022;Lustig et al., 2022). Although it is currently well known that significant sex differences exist in the prevalence, incidence, and severity of a broad range of diseases, including obesity and obesity-related diabetes and cardiovascular disease (Seidell, 2005;Global et al., 2016;Hales et al., 2020;Teufel et al., 2021; Tsao et al., 2022), these differences are not well understood due to a combination of the lack of inclusion of sex as an influencing factor in preclinical studies and the underrepresentation of women in clinical trials. Consequently, there is an urgent international call for future research in the area and a better understanding of sex differences and their mechanistic underpinnings in health and disease (VasquezAvila et al., 2021;Regensteiner and Reusch, 2022). The brain plays a pivotal role in the regulation of energy homeostasis. Particularly, the hypothalamus, one of the most sexually dimorphic brain structures (McEwen et al., 1979; McEwen, 1981;Bao and Swaab, 2010;Pfaff and Christen, 2013; Krause and Ingraham, 2017), is actively involved in the central control of feeding and energy expenditure, sensing and integrating peripheral metabolic and hormonal signals such as glucose, fatty acids, stomach-secreted ghrelin, pancreas-derived insulin, and adipocyte-derived leptin to regulate food intake, glucose metabolism, and energy balance, thereby ensuring that the nutrient demands of the body are fulfilled (Coll and Yeo, 2013; Timper and Bruning, 2017;Uwaifo, 2021). Two functionally antagonistic types of neurons in the arcuate nucleus of the hypothalamus have been identified as major coordinators of these processes: the neuropeptide Y (Npy) and agouti-related peptide (AgRP)-expressing neurons (Npy+ neurons) and the proopiomelanocortin (Pomc)-expressing neurons (Pomc+ neurons; Vohra et al., 2022). Npy+ neurons are orexigenic, meaning they stimulate appetite/hunger and promote feeding behavior (Leibowitz, 1991;Gropp et al., 2005), whereas Pomc+ neurons are anorexigenic, meaning they suppress appetite and promote satiety (Balthasar et al., 2005;Mountjoy, 2015). The appropriate function of these arcuate neuronal circuits and their coordination with other hypothalamic nuclei and extrahypothalamic brain regions also regulating metabolic homeostasis and feeding behavior critically depend on their correct shaping and integration during brain development, the disruption of which, at different levels, can cause a deficient system for the central control of energy balance, often leading to feeding-related diseases such as obesity, type 2 diabetes, and metabolic syndrome, among others (Bingham et al., 2008;Gautron et al., 2015;Timper and Bruning, 2017;Farooqi, 2022). Hypothalamic development during embryogenesis is tightly controlled by basic helix-loop-helix (bHLH) domain-containing transcription factors, which act in a temporally coordinated sequential cascade to determine the neuronal fate and subsequently promote neuronal differentiation (Huang et al., 2014;Bedont et al., 2015;Baker and Brown, 2018). In this cascade of bHLH genes, proneural Ascl1 (also known as Mash1) is expressed first and is required for the subsequent downstream expression of neurogenin 3 (Ngn3;McNay et al., 2006;Pelling et al., 2011;Aujla et al., 2013), which, in turn, regulates the specification of different neuronal subtypes in the hypothalamus, including the Th+ (dopaminergic tyrosine hydroxylase-expressing neurons), Sf1+ (steroidogenic factor 1-expressing neurons), Pomc+, and Npy+ neuronal lineages (Pelling et al., 2011;Anthwal et al., 2013). Lysinedemethylase6Agene(Kdm6a), also known as Utx,is located on the X chromosome and encodes a histone demethylase involved in chromatin remodeling. By removing repressive dimethyl and trimethyl (me2/3) groups on lysine (K) at position 27 in histone 3 (H3K27me2/3), Kdm6a promotes chromatin accessibility and allows gene expression (Hong et al., 2007;Tran et al., 2020). In XX individuals, it has been demonstrated in different cell types and developmental stages that Kdm6a consistently escapes X chromosome inactivation in both mice and humans and shows transcription from both alleles, leading to higher expression in females (Greenfield et al., 1998;Xu et al., 2008;Armoskus et al., 2014;Berletch et al., 2015;Tukiainen et al., 2017;Davis et al., 2020). Consistent with this, we have previously reported higher levels of Kdm6a expression in XX than in XY hypothalamic neurons and a female-specific requirement for the demethylase in mediating increased axogenesis before brain exposure to gonadal hormones (Cabrera Zapata et al., 2021). While Kdm6a is dispensable for the maintenance of embryonic stem cells, it plays a critical role in the determination of neural stem cells and the subsequent differentiation of these pluripotent cells into neurons and glia (Wang et al., 2012;Lei and Jiao, 2018;Yang et al., 2019;Shan et al., 2020;Subhramanyam et al., 2020), with deletion of Kdm6a leading to impaired dendritic arborization, synaptic formation, electrophysiological activity and cognition (Tang et al., 2017;Tang et al., 2020), and loss-of-function mutations in KDM6A causing cognitive deficits in humans (Miyake et al., 2013;Van Laarhoven et al., 2015;Bogershausen et al., 2016; Faundes et al., 2021). Herein, we investigated the role of Kdm6a in the specification of neuronal subtypes in the developing hypothalamus and its differential requirements in males and females, focusing mainly on Pomc+ and Npy+ neuronal populationsasessentialelementsinthecentralcontroloffood intake and energy homeostasis. Materials and methods Animals CD1 mice raised in our in-house colony at the Instituto Cajal (CSIC, Madrid, Spain) were used for this study. Animals received water and food ad libitum and were kept in controlled Frontiers in Cell and Developmental Biology frontiersin.org02 Cabrera Zapata et al. 10.3389/fcell.2022.937875 macroenvironmental conditions of temperature at 22 ± 2°C and a 12 h light/12 h dark periodic cycle. Procedures for care, welfare, and proper use of all experimental animals followed the European Parliament and Council Directive (2010/63/EU) and the Spanish regulation (R.D. 53/2013 and Ley 6/2013, 11th June) and were approved by our Institutional Animal Care and Use Committee (Comité de Ética de Experimentación Animal del Instituto Cajal) and by the Consejería del Medio Ambiente y Territorio (Comunidad de Madrid, PROEX 134/17). Hypothalamic neuronal cultures CD1 mouse embryos at 14 days of gestation (E14, defining E0 as the day of the vaginal plug) were used to establish primary hypothalamic neuronal cultures. Donor embryo age was specifically selected with the purpose of avoiding exposure of neurons to the peak in gonadal testosterone secretion during in utero development, which occurs in male mice around E17 (O’Shaughnessy et al., 2006). Pregnant females were sacrificed by cervical dislocation under CO 2 anesthesia, and embryos were dissected from the uterus. Neurons were cultured separately according to sex by observing the presence/absence of the spermatic artery in the developing gonads of embryos. The ventromedial hypothalamic region was dissected out and stripped off the meninges. Blocks of tissue were incubated for 15 min at 37°C with 0.5% trypsin (Gibco, United States) and then washed three times with Ca 2+ /Mg 2+ -free Hank’s buffered salt solution (Gibco). Finally, tissue was mechanically dissociated into single cells in a 37 °C warm culture medium, and cells were seeded. The medium was phenol red-free Neurobasal (Gibco) to avoid “estrogen-like effects”(Berthois et al., 1986) and was supplemented with B-27, 0.043% L-alanyl-L-glutamine (GlutaMAX-I) and 1% antibiotic-antimycotic containing 10.000 U/ml penicillin, 10.000 μg/ml streptomycin, and 25 μg/ ml amphotericin B (Gibco). Cells were plated on 6-well plates (Falcon, United States ) at a density of 500–1000 cells/mm 2 or on 10 mm glass coverslips (Assistent, Germany) at a density of 800 cells/mm 2 for RT-qPCR/ChIP-qPCR or immunofluorescence, respectively. The surfaces of glass coverslips and plates were pre-coated with 1 μg/μL polyL-lysine (Sigma-Aldrich, United States). Small interfering RNA (siRNA) transfection Neurons were transfected by electroporation or lipofection using a mixture of four different siRNA sequences targeting Kdm6a transcripts at a final concentration of 40 nM total RNA (ON-TARGETplus Mouse Kdm6a set of four siRNA, Dharmacon, UK); procedures and knockdown efficacy were previously described and demonstrated (Cabrera Zapata et al., 2021). A non-targeting siRNA sequence (ntRNA; Dharmacon) was used as a control, and co-transfection with pmaxGFP (Lonza, Switzerland) was performed in all cases for transfected neuron identification. For immunofluorescence, neurons were transfected by lipofection at 3 days in vitro (DIV) with target siRNA or ntRNA using Effectene Transfection Reagent (Qiagen, Germany) according to the manufacturer’s instructions, and after 18 h of knockdown, they were fixed and immunolabeled. For gene expression analysis and ChIP assays, neurons were transfected by electroporation before seeding with target siRNA or ntRNA using a 4D-Nucleofector X Unit and the corresponding P3 Primary Cell nucleofection kit (Lonza) according to the manufacturer’s instructions, seeded, and incubated for three DIV until processing for RNA isolation/ ChIP reactions. RNA isolation and reverse transcription quantitative real-time PCR (RT-qPCR) Total RNA was extracted using TRIzol reagent (Invitrogen, United States), purified, and quantified by spectrophotometry on NanoDrop One (Thermo Fisher Scientific, United States) as previously described (Cisternas et al., 2015). Then, 1 µg of RNA per sample was reverse transcribed to cDNA in a 20 µL reaction using M-MLV reverse transcriptase (Promega, United States) and random primers (Invitrogen), following the manufacturer’s instructions. qPCR reactions were performed on a 7500 real-time PCR system (Applied Biosystems, United States) using TaqMan or SYBR Green Universal PCR Master Mix (Applied Biosystems). TaqMan probes and primers for Ngn3 were assay-on-demand gene expression products (Applied Biosystems). All other primers (Table 1) were designed using the online primer-basic local alignment search tool (PrimerBLAST; National Institutes of Health, United States), selecting primer pairs spanning an exon–exon junction to restrict amplification specifically to mRNA. All primers were verified to amplify with a 95–100% efficiency by performing 4-point calibration curves. Relative quantification of mRNA expression was determined with the ΔΔCt method, using the BestKeeper index (Pfafflet al., 2004) calculated for each sample from the Ct values of Rn18s (18S rRNA) and Rpl13a as control housekeeping genes. Control male samples were used as a reference group. Immunofluorescence Neurons were fixed for 20 min at room temperature (RT) in 4% paraformaldehyde prewarmed to 37°C, rinsed, permeabilized for 10 min with 0.5% Triton X-100 (Bio-Rad, United States ) in phosphate-buffered saline (PBS), blocked 1 h at RT in 1% BSAPBS solution, and incubated for 1 h at RT with the following antibodies diluted 1:1000 in 1% BSA-PBS: anti-Ngn3 mouse monoclonal antibody (F25A1B3, deposited by Madsen, O.D. Frontiers in Cell and Developmental Biology frontiersin.org03 Cabrera Zapata et al. 10.3389/fcell.2022.937875 to the Developmental Studies Hybridoma Bank, NICHD-NIH, maintained at The University of Iowa, Department of Biology, Iowa City, United States ), anti-Pomc rabbit polyclonal antibody (H-029–30, Phoenix Pharmaceuticals, United States ), or antiNpy rabbit polyclonal antibody (T-4070, Peninsula LaboratoriesBMA Biomedicals, Switzerland). After rinsing with PBS, cells were incubated for 1 h at RT with the secondary antibodies HRP goat anti-mouse (1:200 in 1% BSA-PBS) followed by a 10-min amplification reaction with tyramide for the detection of Ngn3 (Tyramide Amplification Kit, 33,003, Biotium, United States ), or Alexa 594 donkey anti-rabbit for the detection of Pomc/Npy (1: 1000 in 1% BSA-PBS; Jackson ImmunoResearch, United States ). Finally, neurons were mounted on glass slides using gerbatol (0.3 g/ml glycerol, 0.13 g/ml Mowiol, 0.2 M Tris-HCl, pH 8.5) plus 1:5000 DAPI for nuclei staining. Imaging and quantitative image analysis Imaging was carried out at ×40 magnification using a standard Leica DMI 6000 fluorescence microscope (Leica, Germany) equipped with a digital camera of the same firm. To quantify fluorescent intensity, the soma of GFP-expressing neurons was outlined, and the area and integrated density were measured in the corresponding channel for Ngn3, Pomc, or Npy immunofluorescence signal using Fiji-ImageJ software (NIH, United States ; freely available at https://imagej.nih.gov/ij/). Background fluorescence was also measured for each neuron and image analyzed. From these values, corrected total cell fluorescence (CTCF) intensity was calculated using the following equation (Martin Fitzpatrick, University of Birmingham, UK, available at https://theolb.readthedocs.io/en/latest/): CTCF integrated density of soma −area of soma × background fluorescence. Thus, 20–40 GFP-expressing (GFP+) neurons were randomly measured per experimental condition and culture (four independent cultures). An equivalent number of nonGFP-expressing (GFP-) neurons transfected with targeting siRNA were randomly measured per culture to confirm that changes in CTCF were not a methodological artifact. Chromatin immunoprecipitation (ChIP) analysis ChIP assays were performed with the ChIP-IT High Sensitivity Kit (Active Motif, United States ) strictly following the manufacturer’s instructions. Briefly, ~7–8 million hypothalamic neurons segregated by sex were cultured during three DIV and then fixed for 15 min with a fixation buffer containing 1.1% formaldehyde (Sigma-Aldrich). Cross-linked cells were scraped, centrifuged, washed three times with cold PBS, and resuspended in ChIP buffer supplemented with PIC (Protease Inhibitor Cocktail; Active Motif) and PMSF (phenylmethylsulfonyl fluoride; Active Motif). Next, cells were homogenized using a Dounce homogenizer with a tight-fitting pestle, and the chromatin was sheared to ~400–800 bp fragments by sonication with a Fisher Scientific Model 705 Sonic Dismembrator ultrasonic processor equipped with a microtip for small volume samples (FB705220, Thermo Fisher Scientific; 30 cycles 30″ON/30″OFF at 4°C). Then, 1% of the total sonicated chromatin was kept as the input DNA and also used to determine the DNA concentration at 260 nm on NanoDrop One (Thermo Fisher Scientific) for each sample. ChIP reactions were carried out overnight at 4 °C with 3 µg of sheared chromatin and 10 μg of anti-H3K27me3 rabbit polyclonal antibody (39155, Active Motif) or anti-mouse IgG as negative control (115001-003, Jackson ImmunoResearch) in ChIP buffer supplemented with PIC. Reactions were then incubated for 3 h with pre-cleared protein G agarose beads on an end-to-end rotator at 4°C. Then, samples were filtered using the kit columns, washed five times while remaining on columns with wash buffer AM1, and centrifuged to elute the ChIP DNA. Reversal of cross-links was performed by TABLE 1 Primer sequences used for qPCR assays. Gene Forward sequence 59‒39 Reverse sequence 59‒39 Ascl1 ACTTTGGAAGCAGGATGGCAG TTAGTGAAGGTGCCCCTGTAG Ascl1 promoter GTGTCCCATTGAAAAGGCGG AATTGCTCTCTCGTTCCCCC Gad1 GTCGCTGAACCGAGCCTG GTGGTCTTGGGGTCTCTACG Ngn3 promoter GCAGAGCAGATAAAGCGTGC TCGCCTGGAGTAAATTGCGT Npy CCATGTGGTGATGGGAAATG ATTGGTGGGACAGGCAGACT Npy promoter CGACAAGGGCGCTCCATA GCCTCTGTGAGAGAAGAGATCC Pomc AGGTGTACCCCAACGTTGCT GACCTGCTCCAAGCCTAATGG Pomc promoter CCAGGAAGGTCACGTCCAAG GTTTGGTCCCTGTCGCTCTT Rn18s CGCCGCTAGAGGTGAAATTCT CATTCTTGGCAAATGCTTTCG Rpl13a TACCAGAAAGTTTGCTTACCTGGG TGCCTGTTTCCGTAACCTCAAG Sf1 GCGGGCATGGACTATTCGTA CTTGAAGAAGCCCTTGCAGC Th AGGGCCTCTATGCTACCCAT AAGCCAGTCCGTTCCTTCAA Frontiers in Cell and Developmental Biology frontiersin.org04 Cabrera Zapata et al. 10.3389/fcell.2022.937875 incubating the samples with proteinase K in a thermocycler at 55°C for 30 min plus 2 h at 80°C. Finally, DNA was purified using purification columns and buffers supplied in the kit. Immunoprecipitated DNA was quantified by real-time qPCR using primer pairs for the promoter regions of Ascl1, Ngn3, Pomc,andNpy (Table 1) and the SYBR Green Master Mix and device detailed earlier. ChIP-qPCR data were normalized to the input DNA and expressed as a percent of the input. Statistical analysis Data are presented as mean ± SEM and were statistically evaluated by two-way analysis of variance (ANOVA) with treatment/ChIP and gonadal sex as independent variables. The statistical significance of the effects of each independent variable and their interactions was tested. Posthoc comparisons of means by Fisher’s least significant difference (LSD) test were performed for those variables/interactions for which ANOVA p-values were statistically significant. Statistical analysis was performed entirely with Statistica 8 software (StatSoft Inc., United States ). P <0.05 was considered statistically significant. Sample size (n) is indicated in the figure legends and was 3–6 independent cultures for RT-qPCR/ ChIP-qPCR experiments or 40–100 transfected neurons from at least four independent cultures for immunofluorescence analysis. The number of independent cultures corresponds to the number of pregnant mothers from which embryos were obtained. Results Kdm6a is female-specifically required for the expression of higher levels of Ngn3 in female than in male hypothalamic neurons We have previously reported higher levels of expression of Kdm6a in hypothalamic neurons carrying two X chromosomes compared to those carrying one X and one Y chromosome regardless of gonadal sex, as well as a requirement for this higher Kdm6a expression and H3K27 demethylation activity in females for the increased expression of Ngn3 in females compared to male hypothalamic neurons at a transcriptional (mRNA) level (Cabrera Zapata et al., 2021). Herein, we first proved the effectiveness of siRNAs designed to knockdown Kdm6a expression by transfecting hypothalamic neuronal cultures derived from sex-segregated E14 mice and measuring the effect on Kdm6a mRNA levels (Figure 1A; two-way ANOVA: F (1, 19) = 18.12, p=0.0004).In addition, as previously described (Cabrera Zapata et al., 2021), we confirmed the effect of Kdm6a knockdown on decreasing Ngn3 mRNA levels in females but not in male neurons (Figure 1A;twoway ANOVA, sex-treatment interaction effect: F (1, 10) = 6.169, p= 0.032). Finally, to determine whether Kdm6a is also required for the sexually dimorphic expression of Ngn3 at the protein level, hypothalamic neuronal cultures were transfected with the Kdm6a-targeting siRNAs, and the effect of Kdm6a knockdown on Ngn3 protein expression was analyzed by immunofluorescence. Remarkably, consistent with results evaluating mRNA levels, Kdm6a silencing led to a significant decrease in Ngn3 protein levels only in female-derived neurons without affecting male cultures, abolishing the sex differences for Ngn3 expression observed under control conditions (Figures 1B and C; two-way ANOVA, sex-treatment interaction effect: F (2, 358) = 32.18, p<0.0000001). Kdm6a is required for Ascl1 transcription and regulates the expression of Th, Pomc, and Npy in a sexually dimorphic manner Ngn3 has been shown to play an essential role in the specification of different neuronal subtypes in the hypothalamus, having opposing effects such as promotion of Pomc+ and Sf1+ and repression of Npy+ and Th+ fate (Pelling et al., 2011;Anthwal et al., 2013). However, such effects have not been properly addressed by considering sex as a crucial factor in hypothalamus development. Since we have demonstrated that Kdm6a has a sexually dimorphic expression pattern itself and that it is specifically required in female-derived hypothalamic neurons to upregulate Ngn3 expression, then we analyzed by RTqPCR the effect of Kdm6a downregulation by siRNAs on mRNA expression levels of Ascl1,Pomc,Npy,Th,Gad1, and Sf1, all of them being molecular markers of different hypothalamic neuronal lineages (Romanov et al., 2020). Whereas Kdm6a knockdown downregulated mRNA levels of the transcription factor Ascl1 in both sexes equally (Figure 2; two-way ANOVA, treatment main effect: F (1, 15) = 10.05, p= 0.006), sex-specific effects were found for Pomc,Npy, and Th. Interestingly, Pomc and Th were significantly more expressed in neurons derived from females than from males, and Kdm6a silencing reduced their mRNA levels only in females (Figure 2; two-way ANOVA, sex-treatment interaction effect: Pomc: F (1, 14) = 5.76, p= 0.031; Th: F (1, 12) = 9.625, p= 0.009), while Npy expression was higher in male than in female-derived neurons in control conditions, and Kdm6a knockdown upregulated its expression only in females (Figure 2; two-way ANOVA, sex-treatment interaction effect: F (1, 13) = 6.46, p= 0.025). No effects of sex or Kdm6a knockdown on Sf1 or Gad1 mRNA levels were found (Figure 2). Having found sexually dimorphic mRNA expression patterns for Pomc and Npy regulated by Kdm6a in a sexspecific way, and considering the opposing roles of Pomc+ and Npy+ hypothalamic neurons in regulating food intake and energy balance in mammals (Morton et al., 2006;Chen et al., 2022), we decided to analyze the effect of Kdm6a silencing on Pomc and Npy protein expression levels by immunolabeling neurons co-transfected with siRNAs and pmaxGFP. Fluorescence intensity analysis for Pomc and Npy proteins in Frontiers in Cell and Developmental Biology frontiersin.org05 Cabrera Zapata et al. 10.3389/fcell.2022.937875 FIGURE 1 Kdm6a is required for the sexually dimorphic expression of proneural Ngn3. (A) Kdm6a knockdown effect on Kdm6a and Ngn3 gene expression analyzed by RT-qPCR in maleand female-derived hypothalamic neurons transfected with a control non-targeting siRNA sequence (ntRNA) or siRNA targeting Kdm6a (siRNA). Kdm6a and Ngn3 showed higher expression levels in female than in male neurons under control conditions. siRNA targeting Kdm6a was effective in downregulating the demethylase mRNA levels in both male and female neurons. Kdm6a knockdown by siRNA decreased Ngn3 mRNA levels only in female neurons. (B) Representative fluorescence images of female (F) and male (M) hypothalamic neurons co- (Continued ) Frontiers in Cell and Developmental Biology frontiersin.org06 Cabrera Zapata et al. 10.3389/fcell.2022.937875 GFP-expressing hypothalamic neurons showed results consistent with the previous assessment at the mRNA level. As shown in Figure 3, Pomc protein expression was significantly decreased after Kdm6a knockdown in female but not in male-derived hypothalamic neurons, erasing the sex differences in the expression levels of this neuropeptide observed in control conditions (two-way ANOVA, sex-treatment interaction effect: F (2, 361) = 9.52, p= 0.0001). Regarding Npy, male hypothalamic neurons expressed significantly higher levels of this neuropeptide than female neurons under control conditions, whereas Kdm6a silencing had opposite effects in each sex, leading to increased Npy expression in females and decreased expression in males (Figure 4; two-way ANOVA, sex-treatment interaction effect: F (2, 365) = 8.2, p= 0.0003). Kdm6a actively controls H3K27me3 demethylation at Ngn3,Pomc, and Npy promoters in female hypothalamic neurons Given the results clearly demonstrating that Kdm6a regulates Ascl1, Ngn3, Pomc, and Npy expression in hypothalamic neurons in a sex-dependent manner in all cases except for FIGURE 1 transfected with ntRNA and GFP or siRNA and GFP at three DIV for 18 h. Ngn3 protein expression (red) was determined by immunofluorescence staining in transfected GFP+ neurons (green). Nuclei were stained with DAPI (blue). Arrowheads point to representative measured neuronal somas. (C) Quantification of fluorescence intensity for Ngn3 expressed as corrected total cell fluorescence (CTCF). Kdm6a knockdown by siRNA eliminated sex differences in Ngn3 protein expression by downregulating the proneural factor only in female-derived neurons. Data are mean ± SEM. n= 40–100 neurons from four independent cultures for each sex and treatment. ns, not significant; *p<0.05; **p<0.01; ****p<0.0001. FIGURE 2 Kdm6a regulates gene expression of molecular markers of different hypothalamic neuronal lineages in a sex-specific manner. Kdm6a knockdown effect on Ascl1,Pomc,Npy,Th,Gad1, and Sf1 gene expression analyzed by RT-qPCR in maleand female-derived hypothalamic neurons transfected with a control non-targeting siRNA sequence (ntRNA) or siRNA targeting Kdm6a (siRNA). Data are mean ± SEM. n = 4–6 independent cultures for each sex and treatment. *p<0.05; **p<0.01. Frontiers in Cell and Developmental Biology frontiersin.org07 Cabrera Zapata et al. 10.3389/fcell.2022.937875 FIGURE 3 Kdm6a is required for Pomc sexually dimorphic expression. (A) Representative fluorescence images of female (F) and male (M) hypothalamic neurons co-transfected with a non-targeting siRNA sequence (ntRNA) and GFP or siRNA targeting Kdm6a (siRNA) and GFP at three DIV for 18 h. Pomc protein expression (red) was determined by immunofluorescence staining in transfected GFP+ neurons (green). Nuclei were stained with DAPI (blue). Arrowheads point to representative measured neuronal somas. (B) Quantification of fluorescence intensity for Pomc expressed as corrected total cell fluorescence (CTCF). Kdm6a knockdown by siRNA abolished sex differences in Pomc protein expression by downregulating the neuropeptide only in female-derived neurons. Data are mean ± SEM. n = 55–80 neurons from four independent cultures for each sex and treatment. ns, not significant; ****p<0.0001. Frontiers in Cell and Developmental Biology frontiersin.org08 Cabrera Zapata et al. 10.3389/fcell.2022.937875 FIGURE 4 Kdm6a is required for Npy sexually dimorphic expression. (A) Representative fluorescence images of female (F) and male (M) hypothalamic neurons co-transfected with a non-targeting siRNA sequence (ntRNA) and GFP or siRNA targeting Kdm6a (siRNA) and GFP at three DIV for 18 h. Npy protein expression (red) was determined by immunofluorescence staining in transfected GFP+ neurons (green). Nuclei were stained with DAPI (blue). Arrowheads point to representative measured neuronal somas. (B) Quantification of fluorescence intensity for Npy expressed as corrected total cell fluorescence (CTCF). Npy expressed higher in male than in female hypothalamic neurons, and Kdm6a knockdown by siRNA increased the neuropeptide expression in females while decreasing it in males. Data are mean ± SEM. n=60–90 neurons from four independent cultures for each sex and treatment. ns, not significant; *p<0.05; ****p<0.0001. Frontiers in Cell and Developmental Biology frontiersin.org09 Cabrera Zapata et al. 10.3389/fcell.2022.937875 homeostasis and impairs postnatal survival. J. Clin. Invest. 120 (5), 1708–1721. doi:10.1172/JCI40794 Miyake, N., Mizuno, S., Okamoto, N., Ohashi, H., Shiina, M., Ogata, K., et al. (2013). KDM6A point mutations cause Kabuki syndrome. Hum. Mutat. 34 (1), 108–110. doi:10.1002/humu.22229 Morton, G. J., Cummings, D. E., Baskin, D. G., Barsh, G. S., and Schwartz, M. W. (2006). Central nervous system control of food intake and body weight. Nature 443 (7109), 289–295. doi:10.1038/nature05026 Mountjoy, K. G. (2015). Pro-Opiomelanocortin (POMC) neurones, POMCderived peptides, melanocortin receptors and obesity: How understanding of this system has changed over the last decade. J. Neuroendocrinol. 27 (6), 406–418. doi:10.1111/jne.12285 O’Lone, R., Frith, M. C., Karlsson, E. K., and Hansen, U. (2004). Genomic targets of nuclear estrogen receptors. Mol. Endocrinol. 18 (8), 1859–1875. doi:10.1210/me. 2003-0044 O’Shaughnessy, P. J., Baker, P. J., and Johnston, H. (2006). The foetal Leydig cell-- differentiation, function and regulation. Int. J. Androl. 29 (1), 90–95. discussion 105-108. doi:10.1111/j.1365-2605.2005.00555.x Pelling, M., Anthwal, N., McNay, D., Gradwohl, G., Leiter, A. B., Guillemot, F., et al. (2011). Differential requirements for neurogenin 3 in the development of POMC and NPY neurons in the hypothalamus. Dev. Biol. 349 (2), 406–416. doi:10. 1016/j.ydbio.2010.11.007 Pfaff, D. W., and Christen, Y. (2013). Multiple origins of sex differences in brain : neuroendocrine functions and their pathologies. New York: Springer. Pfaffl, M. W., Tichopad, A., Prgomet, C., and Neuvians, T. P. (2004). Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26 (6), 509–515. doi:10.1023/b:bile. 0000019559.84305.47 Phoenix, C. H., Goy, R. W., Gerall, A. A., and Young, W. C. (1959). Organizing action of prenatally administered testosterone propionate on the tissues mediating mating behavior in the female Guinea pig. Endocrinology 65, 369–382. doi:10.1210/ endo-65-3-369 Regensteiner, J. G., and Reusch, J. E. B. (2022). Sex differences in cardiovascular consequences of hypertension,obesity,anddiabetes:JACC focus seminar 4/7. J. Am. Coll. Cardiol. 79 (15), 1492–1505. doi:10.1016/j.jacc. 2022.02.010 Rhoda, J., Corbier, P., and Roffi, J. (1984). Gonadal steroid concentrations in serum and hypothalamus of the rat at birth: aromatization of testosterone to 17 beta-estradiol. Endocrinology 114 (5), 1754–1760. doi:10.1210/endo-114-51754 Romanov, R. A., Tretiakov, E. O., Kastriti, M. E., Zupancic, M., Haring, M., Korchynska, S., et al. (2020). Molecular design of hypothalamus development. Nature 582 (7811), 246–252. doi:10.1038/s41586-020-2266-0 Ruiz-Palmero, I., Ortiz-Rodriguez, A., Melcangi, R. C., Caruso, D., GarciaSegura,L.M.,Rune,G.M.,etal.(2016).Oestradiolsynthesizedbyfemale neurons generates sex differences in neuritogenesis. Sci. Rep. 6, 31891. doi:10. 1038/srep31891 Scerbo,M.J.,Freire-Regatillo,A.,Cisternas,C.D.,Brunotto,M.,Arevalo, M. A., Garcia-Segura, L. M., et al. (2014). Neurogenin 3 mediates sex chromosome effects on the generation of sex differences in hypothalamic neuronal development. Front. Cell. Neurosci. 8, 188. doi:10.3389/fncel.2014. 00188 Seidell, J. C. (2005). Epidemiology of obesity. Semin. Vasc. Med. 5 (1), 3–14. doi:10.1055/s-2005-871737 Shan, Y., Zhang, Y., Zhao, Y., Wang, T., Zhang, J., Yao, J., et al. (2020). JMJD3 and UTX determine fidelity and lineage specification of human neural progenitor cells. Nat. Commun. 11 (1), 382. doi:10.1038/s41467-019-14028-x Shpargel, K. B., Sengoku, T., Yokoyama, S., and Magnuson, T. (2012). UTX and UTY demonstrate histone demethylase-independent function in mouse embryonic development. PLoS Genet. 8 (9), e1002964. doi:10.1371/journal.pgen.1002964 Son, J. E., Dou, Z., Kim, K. H., Wanggou, S., Cha, V. S. B., Mo, R., et al. (2021). Irx3 and Irx5 in Ins2-Cre(+) cells regulate hypothalamic postnatal neurogenesis and leptin response. Nat. Metab. 3 (5), 701–713. doi:10.1038/s42255-021-00382-y Subhramanyam, C. S., Cao, Q., Wang, C., Heng, Z. S. L., Zhou, Z., and Hu, Q. (2020). Role of PIWI-like 4 in modulating neuronal differentiation from human embryonal carcinoma cells. RNA Biol. 17, 1613–1624. doi:10.1080/15476286.2020. 1757896 Sueda, R., Imayoshi, I., Harima, Y., and Kageyama, R. (2019). High Hes1 expression and resultant Ascl1 suppression regulate quiescent vs. active neural stem cells in the adult mouse brain. Genes Dev. 33 (9-10), 511–523. doi:10.1101/gad.323196.118 Tang, G. B., Zeng, Y. Q., Liu, P. P., Mi, T. W., Zhang, S. F., Dai, S. K., et al. (2017). The histone H3K27 demethylase UTX regulates synaptic plasticity and cognitive behaviors in mice. Front. Mol. Neurosci. 10, 267. doi:10.3389/fnmol.2017.00267 Tang, Q. Y., Zhang, S. F., Dai, S. K., Liu, C., Wang, Y. Y., Du, H. Z., et al. (2020). UTX regulates human neural differentiation and dendritic morphology by resolving bivalent promoters. Stem Cell Rep. 15, 439–453. doi:10.1016/j.stemcr.2020.06.015 Teufel,F.,Seiglie,J.A.,Geldsetzer,P.,Theilmann,M.,Marcus,M.E.,Ebert,C.,etal. (2021). Body-mass index and diabetes risk in 57 low-income and middle-income countries: a cross-sectional study of nationally representative, individual-level data in 685 616 adults. Lancet 398 (10296), 238–248. doi:10.1016/S0140-6736(21)00844-8 Tie, F., Banerjee, R., Conrad, P. A., Scacheri, P. C., and Harte, P. J. (2012). Histone demethylase UTX and chromatin remodeler BRM bind directly to CBP and modulate acetylation of histone H3 lysine 27. Mol. Cell. Biol. 32 (12), 2323–2334. doi:10.1128/MCB.06392-11 Timper, K., and Bruning, J. C. (2017). Hypothalamic circuits regulating appetite and energy homeostasis: Pathways to obesity. Dis. Model. Mech. 10 (6), 679–689. doi:10.1242/dmm.026609 Tran, N., Broun, A., and Ge, K. (2020). Lysine demethylase KDM6A in differentiation, development, and cancer. Mol. Cell. Biol. 40 (20), 003411–e420. doi:10.1128/MCB.00341-20 Tsao, C. W., Aday, A. W., Almarzooq, Z. I., Alonso, A., Beaton, A. Z., Bittencourt, M. S., et al. (2022). Heart disease and stroke statistics-2022 update: A report from the American heart association. Circulation 145 (8), e153–e639. doi:10.1161/CIR. 0000000000001052 Tukiainen, T., Villani, A. C., Yen, A., Rivas, M. A., Marshall, J. L., Satija, R., et al. (2017). Landscape of X chromosome inactivation across human tissues. Nature 550 (7675), 244–248. doi:10.1038/nature24265 Uwaifo, G. I. (2021). The human hypothalamus - anatomy, dysfunction and disease management. Cham: Humana Press, Springer Nature Switzerland AG. Van Laarhoven, P. M., Neitzel, L. R., Quintana, A. M., Geiger, E. A., Zackai, E. H., Clouthier, D. E., et al. (2015). Kabuki syndrome genes KMT2D and KDM6A: functional analyses demonstrate critical roles in craniofacial, heart and brain development. Hum. Mol. Genet. 24 (15), 4443–4453. doi:10.1093/hmg/ddv180 Vasquez-Avila, K., Pacheco-Barrios, K., de Melo, P. S., and Fregni, F. (2021). Addressing the critical role of gender identity and sex in the planning, analysis, and conduct of clinical trials. Princ. Pract. Clin. Res. 7(2),59–62. doi:10.21801/ppcrj. 2021.72.7 Vohra, M. S., Benchoula, K., Serpell, C. J., and Hwa, W. E. (2022). AgRP/ NPY and POMC neurons in the arcuate nucleus and their potential role in treatment of obesity. Eur. J. Pharmacol. 915, 174611. doi:10.1016/j.ejphar. 2021.174611 Wang, C., Lee, J. E., Cho, Y. W., Xiao, Y., Jin, Q., Liu, C., et al. (2012). UTX regulates mesoderm differentiation of embryonic stem cells independent of H3K27 demethylase activity. Proc. Natl. Acad. Sci. U. S. A. 109 (38), 15324–15329. doi:10.1073/pnas.1204166109 Wang, S. P., Tang, Z., Chen, C. W., Shimada, M., Koche, R. P., Wang, L. H., et al. (2017). A UTX-MLL4-p300 transcriptional regulatory network coordinately shapes active enhancer landscapes for eliciting transcription. Mol. Cell 67 (2), 308–321. doi:10.1016/j.molcel.2017.06.028 Wang, Y. R., Xu, N. X., Wang, J., and Wang, X. M. (2019). Kabuki syndrome: review of the clinical features, diagnosis and epigenetic mechanisms. World J. Pediatr. 15 (6), 528–535. doi:10.1007/s12519-019-00309-4 Xie, G., Liu, X., Zhang, Y., Li, W., Liu, S., Chen, Z., et al. (2017). UTX promotes hormonally responsive breast carcinogenesis through feed-forward transcription regulation with estrogen receptor. Oncogene 36 (39), 5497–5511. doi:10.1038/onc. 2017.157 Xu, J., Deng, X., Watkins, R., and Disteche, C. M. (2008). Sex-specific differences in expression of histone demethylases Utx and Uty in mouse brain and neurons. J. Neurosci. 28 (17), 4521–4527. doi:10.1523/JNEUROSCI.5382-07.2008 Yang, X., Xu, B., Mulvey, B., Evans, M., Jordan, S., Wang, Y. D., et al. (2019). Differentiation of human pluripotent stem cells into neurons or cortical organoids requires transcriptional co-regulation by UTX and 53BP1. Nat. Neurosci. 22 (3), 362–373. doi:10.1038/s41593-018-0328-5 Yaswen, L., Diehl, N., Brennan, M. B., and Hochgeschwender, U. (1999). Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nat. Med. 5 (9), 1066–1070. doi:10.1038/12506 Yoo, S., and Blackshaw, S. (2018). Regulation and function of neurogenesis in the adult mammalian hypothalamus. Prog. Neurobiol. 170, 53–66. doi:10.1016/j. pneurobio.2018.04.001 Yu, X. X., Qiu, W. L., Yang, L., Li, L. C., Zhang, Y. W., and Xu, C. R. (2018). Dynamics of chromatin marks and the role of JMJD3 during pancreatic endocrine cell fate commitment. Development 145 (6), dev163162. doi:10.1242/dev.163162 Frontiers in Cell and Developmental Biology frontiersin.org16 Cabrera Zapata et al. 10.3389/fcell.2022.937875