Full text
rsob.royalsocietypublishing.org Research Cite this article: Pinheiro A, Woof JM, Almeida T, Abrantes J, Alves PC, Gorta ´zar C, Esteves PJ. 2014 Leporid immunoglobulin G shows evidence of strong selective pressure on the hinge and CH3 domains. Open Biol. 4: 140088. http://dx.doi.org/10.1098/rsob.140088 Received: 7 May 2014 Accepted: 12 August 2014 Subject Area: genetics/immunology/molecular biology Keywords: rabbit, IGHG, genetic diversity, immunoglobulins constant region, hinge region, evolution Author for correspondence: Pedro J. Esteves e-mail: pjes[email protected] Electronic supplementary material is available at http://dx.doi.org/10.1098/rsob.140088. Leporid immunoglobulin G shows evidence of strong selective pressure on the hinge and CH3 domains Ana Pinheiro1,2,3, Jenny M. Woof4, Tereza Almeida1, Joana Abrantes1, Paulo C. Alves1,2,5, Christian Gorta ´zar3and Pedro J. Esteves1,2,6 1 CIBIO Centro de Investigac¸a ˜o em Biodiversidade e Recursos Gene ´ticos, InBio Laborato ´rio Associado, Universidade do Porto, Campus Agra ´rio de Vaira ˜o, Vaira ˜o 4485-661, Portugal 2 Departamento de Biologia, Faculdade de Cie ˆncias, Universidade do Porto, Porto 4169-007, Portugal 3 SaBio IREC (CSIC-UCLM-JCCM), Ronda de Toledo s/n, Ciudad Real 13071, Spain 4 Division of Cancer Research, Medical Research Institute, University of Dundee Medical School, Ninewells Hospital, Dundee DD1 9SY, UK 5 Wildlife Biology Program, College of Forestry and Conservation, University of Montana, Missoula, MT 59812, USA 6 CESPU, Instituto de Investigac¸a ˜o e Formac¸a ˜o Avanc¸ada em Cie ˆncias e Tecnologias da Sau ´de, Gandra PRD, Portugal 1. Summary Immunoglobulin G (IgG) is the predominant serum immunoglobulin and has the longest serum half-life of all the antibody classes. The European rabbit IgG has been of significant importance in immunological research, and is therefore well characterized. However, the IgG of other leporids has been disregarded. To evaluate the evolution of this gene in leporids, we sequenced the complete IGHG for six other genera: Bunolagus,Brachylagus,Lepus,Pentalagus,Romerolagus and Sylvilagus. The newly sequenced leporid IGHG gene has an organization and structure similar to that of the European rabbit IgG. A gradient in leporid IgG constant domain diversity was observed, with the CH1 being the most conserved and the CH3 the most variable domain. Positive selection was found to be acting on all constant domains, but with a greater incidence in the CH3 domain, where a cluster of three positively selected sites was identified. In the hinge region, only three polymorphic positions were observed. The same hinge length was observed for all leporids. Unlike the variation observed for the European rabbit, all 11 Lepus species studied share exactly the same hinge motif, suggesting its maintenance as a result of an advantageous structure or conformation. 2. Introduction Immunoglobulin G (IgG) is the predominant serum immunoglobulin. IgG participates directly and indirectly to immune responses through its effector functions, elicited through neutralization and binding to Fcgreceptors (FcgRs) and C1q. These functions include antibody-dependent cellular cytotoxicity, antibodydependent cell phagocytosis and/or complement-dependent cytotoxicity [1]. IgG also participates in direct neutralization of toxins and viruses. Furthermore, IgG is the only Ig class that binds to FcRn, the neonatal Fc receptor, which provides passive immunity to newborns as well as protecting this particular Ig class from degradation, granting IgG the longest serum half-life of all Ig classes [2]. In mammals, the number of IgG subclasses ranges from 1 to 7, each subclass differing in effector functions [3]. Four IgG subclasses have been found in humans [4], mice [5] and rats [6], three in cattle [7], six in pigs [8] and seven in horses [9]. In bats, the number of IgG subclasses ranges from 1 to 5 depending on the particular species [10]. Among mammals, the European rabbit is seemingly unique in that it possesses only one IgG subclass [11]. &2014 The Authors. Published by the Royal Society under the terms of the Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, which permits unrestricted use, provided the original author and source are credited. on January 13, 2017http://rsob.royalsocietypublishing.org/Downloaded from
The European rabbit IgG has been extensively studied and its allelic variation characterized in detail. Two loci were distinguished by serology, the dand e, each with two segregating alleles, d11/d12 and e14/e15, respectively [12]. The locus d is correlated to a Thr–Met change at position 9 (IMGT numbering [13]) in the IGHG hinge region. As for locus e,itiscorrelated to an Ala–Thr change at position 92 in the IGHG CH2 (IMGT unique numbering for C-DOMAIN [13]). Serologic studies have found the e15 allotype in species of the genera Oryctolagus, Lepus,Sylvilagus,Romerolagus and Ochotona [14,15], but have failed to identify the d11 and d12 allotypes in Lepus and Sylvilagus genera [16]. Protein and nucleotide sequence data for IGHG in Leporids are scarce. The relationship between serology and protein variation at the elocusor IGHG CH2 domain has been studied byamino acid sequencing of tryptic peptides in various lagomorph species [14,17–20]. The nucleotide sequencing data are limited essentially to the IGHG molecule sequence for the European rabbit, and IGHG hinge and IGHG CH2 domains for a restricted number of Sylvilagus and Lepus species. Sequencing of the IGHG hinge domain in Leporids showed differences between species at residues 8 and 9 (IMGT numbering [13]) [21], whereas in the IGHG CH2 a hotspot of variation was found at position 92 (IMGT numbering) [22] (see figure 1). The family Leporidae comprises 11 genera: Brachylagus, Bunolagus,Caprolagus,Lepus,Nesolagus,Oryctolagus,Pentalagus, Poelagus,Pronolagus,Romerolagus and Sylvilagus) [23,24]. Lepus is a polytypic, cosmopolitan genus, comprising 24–30 currently recognized species [24–26], and most probably originated in North America [27,28]. The remaining genera have more restricted distributions, though having a nearly worldwide distribution. Most, with the exception of Nesolagus,Pronoloagus and Sylvilagus, which comprise two, four and more than 16species,respectively,are monotypicgenera [29–34].Somediscrepancies exist between molecular and fossil data, confusing leporid taxonomy [27,28]. Molecular analyses based on nuclear and mitochondrial markers suggest that within Leporidae two groups diverged around 14 Ma: a first group encompasses the genera Nesolagus,Poelagus and Pronolagus, and the second group includes the remaining eight genera. Within this second group, Romerolagus was the first genus to diverge, around 13 Ma, followed by Lepus, which diverged around 12 Ma. Brachylagus and Sylvilagus diverged from a group composed of Bunolagus,Caprolagus,Oryctolagus and Pentalagus around 10 Ma. The Brachylagus–Sylvilagus and Bunolagus–Caprolagus– Oryctolagus–Pentalagus splits are estimated at 9 Ma (approximate times [28]). In this study, we extend the knowledge on this immunoglobulin class in leporids by sequencing the complete IGHG gene for six additional extant leporid genera: Bunolagus, Brachylagus,Lepus,Pentalagus,Romerolagus and Sylvilagus. 3. Material and methods Total genomic DNA specimens of Bunolagus,Brachylagus, Lepus,Pentalagus,Romerolagus and Sylvilagus genera were extracted from frozen liver or ear tissue using an EasySpin Genomic DNA Minipreps Tissue Kit (Citomed). Additionally, six European rabbits were also analysed: two individuals of the subspecies Oryctolagus cuniculus algirus, three individuals of the subspecies Oryctolagus cuniculus cuniculus and a domestic rabbit belonging to the New Zealand White breed. PCR amplification of the four IGHG exons was conducted using primers designed on the basis of European rabbit IGHG available Figure 1. European rabbit (O. cuniculus) IgG DNA sequence of constant and hinge regions (GenBank accession number L29172). The amino acid translation is shown above the nucleotide sequence; for polymorphic positions, other amino acid possibilities are shown below the nucleotide sequence. The IMGT unique numbering for the constant domain [13] and EU numbering (in italic type) are shown on top. rsob.royalsocietypublishing.org Open Biol. 4: 140088 2 on January 13, 2017http://rsob.royalsocietypublishing.org/Downloaded from
sequences (GenBank accession number AY386696 [35]). A fragment containing the IGHG CH1 and hinge domains was amplified using primers FG12 (50TCAGGCCCAGACTGTAGACC 30) and RE [21] under the following conditions: 15 min at 958C followed by 35 cycles at 948C (30 s), 638C (30 s) and 728C (45 s), with a final extension at 608C (20 min). Another fragment containing IGHG CH2 and CH3 exons was amplified using primers F3 [22] and RG31 50TTGGAAGGAATCAGGACAGC 30under the following conditions: 15 min at 958C followed by 35 cycles at 948C (30 s), 608C (30 s) and 728C (45 s), with a final extension at 608C (20 min). Primers were designed so the two fragments overlap in order to obtain the full intron sequence. Sequences were determined by automated sequencing following the Big Dye Terminator Cycle Sequencing protocol (Perkin Elmer, Warrington, UK) using the referred primers. To confirm the hinge length a fragment of the expressed IgG was also sequenced for one Lepus granatensis, one Lepus europaeus and one Sylvilagus floridanus. Total RNA was extracted from spleen samples using RNeasy Mini Kit (Qiagen, Hilden, Germany), following first strand cDNA synthesis using oligo(dT) as primer (Invitrogen, Carlsbad, CA, USA) and SuperScript III reverse transcription (Invitrogen) as recommended by the manufacturer. A mid-CH1 to mid-CH2 fragment was PCR amplified using primers FG1int2 (50CCA GTGACCGTGACTTGGAA 30) and RG2int2 (50GGACTTTG CACTTGAACTCC 30) designed in conserved regions of the leporid IGHG gene segment. A touchdown PCR was performed and the conditions were as follows: 3 min at 988C followed by five cycles at 988C (30 s), annealing starting at 668C with a 18C decrease/cycle until reaching 628C (30 s) and 728C (30 s), followed by 30 cycles at 988C (30 s), 628C (30 s) and 728C (30 s), with a final extension at 728C (5 min). Sequences obtained in this study were edited and aligned using CLUSTAL W [36] as implemented in BIOEDIT software [37] and the amino acid sequences were inferred using BIOEDIT [37]. The obtained sequences were also aligned and compared with leporid sequences available in GenBank. Accession numbers for all sequences are given in table 1. Codon numbering is according to the IMGT unique numbering for C-DOMAIN [13]. Amino acid residue numbering is also defined according to Eu numbering [38]. Sequence nucleotide diversity was estimated using DNASP v. 5.10 [39]. The secondary structure of the leporids IgG heavy chain was analysed using the DiAminoacid Neural Network Application (DiANNA) (http://clavius.bc.edu/~clotelab/DiANNA/) [40–42]. DiANNA predicts the disulfide connectivity using a neural network trained on databases derived from high-quality protein structures that include evolutionary and secondary structure information. First PSIPRED is run to predict the secondary structure, and this information is then used to find pairs of cysteines using a maximum weight matching. The nucleotide sequences’ alignment was screened for recombination as it can mislead positive selection analysis [43,44]. For this, the software GARD (Genetic Algorithm for Recombination Detection) [45,46], available from the DATAMONKEY web server, was used. The best-fitting nucleotide substitution model was determined using the automatic model selection tool available on the server. To identify signatures of selection on leporid IgG, we compared the rate per site of non-synonymous substitution (dN) with the rate per site of synonymous substitutions (dS) in a maximum-likelihood (ML) framework, using six different methods. As each of the methods employs unique algorithms, and as done previously [47–49], we only considered those codons identified by at least two of the ML methods to be positively selected codons (PSCs). Using the CODEML program of the PAML v. 4.4 package [50,51], we compared two disparate models—M8, which allows for Table 1. IGHG sequences accession numbers for sequences used in this study. sequence identification accession number rabbit germline sequences AY386696; L29172 rabbit cDNA sequences DQ402474, M16426, K00752, XM_002723875, J00665 Lepus capensis germline CH2 AJ295218 Lepus californicus germline CH2 AJ295219 Lepus americanus germline CH2 AJ431716 Lepus saxatilis germline CH2 AJ295222 Lepus timidus germline CH2 AJ295216 Sylvilagus cunicularis germline CH2 AJ295223 Sylvilagus floridanus germline hinge DQ206979 this study germline Oryctolagus cuniculus cuniculus KJ807306–KJ807308 Oryctolagus cuniculus algirus KJ807309–KJ807310 Oryctolagus cuniculus New Zealand White breed KJ807311 Lepus californicus KJ807312, KJ807313 Lepus callotis KJ807314, KJ807315 Lepus castroviejoi KJ807316 Lepus europaeus KJ807317–KJ807324 Lepus granatensis KJ807325–KJ807331 Lepus saxatilis KJ807332, KJ807333 Lepus townsendi KJ807334, KJ807335 Lepus americanus KJ807336, KJ807337 Lepus corsicanus KJ807338, KJ807340 Lepus capensis KJ807341, KJ807343 Lepus timidus KJ807344, KJ807345 Pentalagus furnessii KJ807346 Sylvilagus floridanus KJ807347 Sylvilagus bachmanii KJ807348 Bunolagus monticularis KJ807351 Brachylagus idahoensis KJ807350 Romerolagus diazii KJ807349 cDNA Lepus europaeus KJ807353 Lepus granatensis KJ807352 Sylvilagus floridanus KJ807354 rsob.royalsocietypublishing.org Open Biol. 4: 140088 3 on January 13, 2017http://rsob.royalsocietypublishing.org/Downloaded from
codons to evolve under positive selection (dN/dS .1) and M7, which does not (dN/dS 1)—using a likelihood ratio test with 2 d.f. [52,53]. Codons under positive selection for model M8 were identified using a Bayes Empirical Bayes approach [54] and considering a posterior probability of more than 90%. Using MEGA 5 [55], a neighbour-joining phylogenetic tree was used as a working topology, with the pdistance substitution model and the pairwise deletion option to handle gaps and missing data. The obtained tree was in accordance with the accepted lagomorph phylogeny. The five methods for detecting positive selection available from the DATAMONKEY web server [56] were also used: the Single Likelihood Ancestor Counting (SLAC) model, the Fixed Effect Likelihood (FEL) model, the Random Effect Likelihood (REL) model, the Mixed Effects Model of Evolution (MEME) and the Fast Unbiased Bayesian Approximation (FUBAR). For these analyses, the best-fitting nucleotide substitution model was first determined through the automatic model selection tool available on the server. The location within the IgG structure of the residues under positive selection was analysed by mapping the residues onto the solved crystal structures of rabbit IgG–Fab (PDB ID: 4HBC [57]) and Fc (PDB ID: 2VUO [58]). To examine their relation to putative sites of interest, the sites of interaction with FcgRs, FcRn and complement C1q [2,59–61] were also mapped onto the three-dimansional IgG–Fc structure. The NCBI application Cn3D v. 4.1 (www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d. shtml [62]) was used to this purpose. 4. Results The IGHG gene newly sequenced for six leporid genera, Bunolagus,Brachylagus,Lepus,Pentalagus,Romerolagus and Sylvilagus, is similar to the European rabbit (Oryctolagus)IGHG, and thus the intron–exon organization was inferred from available published rabbit IGHG genes. Splicing signals were present at the intron boundaries and hence it is assumed that all studied leporids share the same IGHG exon organization as the European rabbit. 4.1. CH1 domain The CH1 domain is the most conserved among leporid IGHG domains with only 14 amino acid variable positions, the majority of which involve one substitution, and half are conservative regarding the amino acid properties. The European rabbit IgG differs from the IgG of other leporids by the Asn/ Ser change at position 45.3 and by the Thr/Pro change at position 92. Bunolagus IgG has a His for a Glu substitution at position 84.2 and Lepus IgG has a Thr for a Ser change at position 90. Only the substitution at position 84.2 involves changes in amino acid characteristics (figure 2a). 4.2. CH2 domain The CH2 domain of leporid IgGs, though fairly conserved, shows more diversity than the CH1 domain. For the CH2 domain, 15 amino acid variable positions were observed, 11 of which involve one substitution but, contrary to that observed for the CH1 domain, the majority of these polymorphic positions involve changes in amino acid properties. The European rabbit has specific Arg residues at positions 45.4 and 125. The residues Leu17, Pro45.4 and Leu84.1 are specific to Lepus, Brachylagus and Bunolagus, respectively. Romerolagus uniquely has Ala1.6, Leu45.4, Val82 and Leu85.2 residues (figure 2a). 4.3. CH3 domain This is the most diverse of the leporid IGHG domains with 36 variable positions, the majority involving changes in amino acid properties. It also has the highest number of diagnostic positions. In this domain, the European rabbit has specific Pro1.2 and Ala45.2 residues, Bunolagus uniquely has Val1.2, Arg3, Thr17 and Pro35 residues, and Brachylagus has an Asn for a Thr change at position 80. Three diagnostic positions were observed for each of three genera: Lepus at Asn15, Thr105 and Leu125 residues, Pentalagus at Arg1.3, Ser77 and Ala90, and Romerolagus at Lys11, Glu35 and Ala120 as distinctive. Only Sylvilagus lacked specific residues (figure 2b). 4.4. Hinge Three variable positions were found, all involving changes in amino acid properties. Changes at these positions define genera-specific motifs, with the exception of Sylvilagus and Romerolagus, which share the same substitutions: Val1, Pro8 and Leu9 (figure 2a). For all studied leporids, an 11-residue hinge was observed, which, given the high variability observed in IgG hinge length in other mammals, is surprising. To check whether alternative splicing sites could be used by some leporids, the expressed hinge was sequenced for Lepus and Sylvilagus individuals, and each one had the same 11 residues. 4.5. Intron diversity The intronic regions between CH1–hinge, hinge–CH2 and CH2–CH3 were fully sequenced. Overall nucleotide diversity for these regions is similar to that observed for the coding regions (Pi introns ¼0.03704; Pi exons ¼0.03277). The major differences observed between leporid genera are insertions and deletions (indels), which reflect the accepted leporid phylogeny. Indeed, in the intronbetween CH1 and hinge exons,a 20 bp deletion is shared by Bunolagus,Oryctolagus and Pentalagus, whereas Romerolagus has a unique 10 bp deletion. Similarly, in the intron between CH2 and CH3 exons, a 1 bp deletion is shared by Brachylagus and Sylvilagus,whereasOryctolagus has two characteristic 1 bp deletions and Romerolagus has an insertion of 13 bp (electronic supplementary material). 4.6. Leporid IgG heavy chain structure All immunoglobulin heavy chains are organized into globular domains, a structure stabilized by intra-chain disulfide bonds between conserved cysteines in each domain at positions 23 and 104 in each domain. As expected, all studied leporids share these cysteines. The European rabbit IgG further has two additional cysteines in the CH1 domain at positions 10 and 11 (Cys131 and Cys132; Eu numbering) and a further two in the hinge, at positions 5 and 10. The CH1 domain Cys at position 10 (Cys131; Eu numbering) bonds to the light chain Cys, the CH1 Cys at position 11 (Cys132; Eu numbering) bonds to the Cys at position 5 in the hinge, and the other hinge Cys forms the inter-chain disulfide bridge with its equivalent in the other heavy chain. rsob.royalsocietypublishing.org Open Biol. 4: 140088 4 on January 13, 2017http://rsob.royalsocietypublishing.org/Downloaded from
(b) (a) Figure 2. Variable codons and amino acid physico-chemical properties for leporid IGHG (a) CH1 and CH2 domains and hinge region, and (b) CH3 domain. The codons identified as under positive selection by each one of the six methods used are indicated; only those codons identified by at least two methods are considered to be PSCs. The codon numbering is according to the IMGT unique numbering for the constant domain [13]. The colours represent amino acid properties: polar neutral (green), polar positive (yellow), polar negative (orange), non-polar neutral (purple), non-polar aliphatic (blue) and non-polar aromatic (light pink). Occ, Oryctolagus cuniculus cuniculus;OcD,domesticrabbit New Zealand White breed; Oca, Oryctolagus cuniculus algirus;Lcalif,Lepus californicus;Lcall,Lepus callotis;Lcas,Lepus castroviejoi; Lcor, Lepus corsicanus;Leur,L. europaeus;Lgra, L. granatensis;Lsax,Lepus saxatilis;Ltwn,Lepus townsendi;Lam,Lepus americanus;Lcap,Lepus capensis;Ltim,Lepus timidus;Pfur,Pentalagus furnessii;Sflo,S. floridanus;Sbac, Sylvilagus bachmanii;Rdia,Romerolagus diazii;Bida,Brachylagus idahoensis;Bmon,Bunolagus monticularis. rsob.royalsocietypublishing.org Open Biol. 4: 140088 5 on January 13, 2017http://rsob.royalsocietypublishing.org/Downloaded from
Again, conserved cysteines at these positions are shared by all studied leporids, suggesting that the IgG heavy chain structure is maintained across leporids. However, extra cysteines were found in the CH2 domain at position 1.5 (Cys232; Eu numbering) of two Lepus capensis alleles and in the CH3 domain at position 124 (Cys444; Eu numbering) for one L. granatensis allele. Disulfide bond prediction analysis indicates that the extra CH2 cysteine does not establish any bond. However, for the allele with the additional CH3 Cys, different bonds to those described above are predicted for the CH2 and CH3 domains. The CH2 domain Cys at position 23 (Cys261; Eu numbering) is now predicted to bond with the CH3 domain Cys at position 104 (Cys425; Eu numbering), and the CH3 domain Cys at position 23 (Cys367; Eu numbering) is predicted to bond with the CH3 domain Cys at position 124 (Cys444; Eu numbering). However, the physiological relevance of these predictions remains unclear. Glycosylation is also important for protein structure and function. The European rabbit IgG Fc has an N-glycosylation site at CH2 84.4 (Asn297; Eu numbering), which was found to be conserved in all studied leporids, and indeed all vertebrate IgG. No other N-glycosylation sites were predicted. O-linked glycans (i.e. glycans linked to Ser/Thr residues in Ser/Thr/Pro-rich domains are known on human IgA1 and IgD hinges) and also on the rabbit IgG hinge, for which the Thr residue at hinge position 9 of d12 rabbits is O-glycosylated (d11 rabbits hinge position 9 have a Met residue) [16,63,64]. This O-glycan confers protection against cleavage of the rabbit IgG hinge [63]. Putative O-glycosylation sites are present on Lepus and Bunolagus hinge position 8, and Pentalagus hinge positions 8 and 9, all occupied by Ser residues. 4.7. Signatures of positive selection on leporid immunoglobulin G The comparison of the two disparate models implemented in CODEML revealed evidence for positive selection acting on the leporid IgG, with the model allowing sites to evolve under positive selection (M8) showing a significantly better fit than the model that did not (M7) (lnL M7/lnL M8 ¼ 22850.1/22817.1; 22DlnL ¼33; a ,0.01). Comparing the sites recognized by each of the six employed methods led to the identification of seven PSCs. One locates to the CH1 domain, two to the CH2 domain and four to the CH3 domain. All of these residues show changes in amino acid characteristics and occupy exposed positions on the European rabbit IgG structure. Interestingly, four of these codons locate near sites of interaction with ligands: the CH1 residue 1.3 (residue 119; Eu numbering) is in the immediate vicinity of the VH domain, the CH2 residue 1.5 (residue 232; Eu numbering) lies in the region of residues that interact with FcgRs, and the CH2 92 residue (residue 309; Eu numbering) and CH3 45.2 residue (residue 387; Eu numbering) locate on the region of residues that interact with FcRn. Of note, the CH3 domain residues at positions 98, 100 and 101 (residues 419, 421 and 422; Eu numbering) form an exposed cluster in the C-terminal portion of this domain (figure 3). 5. Discussion Rabbit IgG has been extensively studied and its genetic diversity thoroughly characterized, but, despite the relevance of IgG as a crucial component of the host immune response and the uniqueness of rabbit IgG, the extension of this knowledge to other leporids has been neglected. In this work, we extended knowledge on the evolution of leporid IgG by analysing six extant genera. The results obtained in this study reveal that the leporids share considerable sequence similarity for their IGHG (approx. 94%). A gradient in constant domain diversity is observed with the CH1 domain being the most conserved of leporid IGHG domains and the CH3 domain the most variable. In fact, there are twice as many variable amino acid sites 1.3 1.5 92 45.2 98 100 101 hinge hinge (b)(a) Figure 3. Leporid residues encoded by PSCs in the three-dimensional structure of rabbit IgG. (a) Rabbit IgG–Fab (PDB ID 4HBC). (b) Rabbit IgG–Fc (PDB ID 2VUO). The light chain is in the background coloured grey, the heavy chain variable domain is in the foreground coloured light blue and the heavy chain constant domains are coloured dark blue. Positively selected codons are represented in red dots. Residues significant for FcgR interaction are highlighted in dark green, residues significant for FcRn interaction are in light blue and residues significant for C1q complement interaction are in light green. Residue numbering is according to IMGT unique numbering for the constant domain [13]. The N-glycan attached to CH2 84.4 (Asn297; Eu numbering) is shown in ball and stick representation. rsob.royalsocietypublishing.org Open Biol. 4: 140088 6 on January 13, 2017http://rsob.royalsocietypublishing.org/Downloaded from
and number of diagnostic substitutions in the CH3 domain compared with the CH1 and CH2 domains, making the CH3 the most informative domain for leporid species identification. The CH3 domain has been identified as the most diagnostic domain to distinguish between IgG isotypes for swine [8] and primate species [65]. The divergence previously found for IgG CH3 domains between macaques and human species that diverged around 32 Ma [66] is similar to the divergence found between Oryctolagus and Romerolagus, genera that separated around 13 Ma [28], and thus it seems that either the leporid IgG CH3 domain is evolving under selective pressure to change or that evolutionary constraints are conserving primate IgG CH3 domains. Despite the overall conservation found for leporid IGHG, hotspots of variability exist in the hinge and CH2 and CH3 domains, and we found evidence of positive selection acting on all IgG constant domains. Previous studies of leporid IGHG described the hinge position 9 and CH2 position 92 as hotspots of variability [21,22]. Our results, including more genera and species than former studies, confirm that hinge position 9 is a leporid hotspot of variability, while the CH2 position 92 residue (residue 309; Eu numbering) proves to be a Lepus-specific hotspot, with four different residues in this genus but only 2 in other leporids. Additionally, we can pinpoint as having high amino acid diversity the CH2 position 45.4 (residue 387; Eu numbering) and CH3 position 100 (residue 421; Eu numbering), each having five different residues in the studied leporids. These hotspots of variability, and also the seven positions identified as positively selected, exhibit changes in amino acid physicochemical properties, which may impact on the IgG conformation and structure. Changes at the positively selected CH1 1.3 residue (residue 119; Eu numbering) may impact on the antigen-binding site conformation. This would possibly improve leporid antigen-binding possibilities given that the usage of the VH1 gene in 90% of VDJ rearrangements in leporids confers a somewhat restricted diversity to the leporid VH domain [67–70]. On the other hand, changes at PSCs CH2 1.5 (residue 232; Eu numbering), CH2 92 residue (residue 309; Eu numbering) and CH3 45.2 residue (residue 387; EU numbering) may influence binding of IgG to Fc receptors. In particular, the positively selected CH2 position 1.5 (residue 232; Eu numbering) lies in close vicinity to CH2 residues 1.3–1 (234–237; Eu numbering), which in human IgG form the core of the interaction site for FcgR [60,71]. As IgG from the European rabbit binds human FcgRI with affinity comparable with human IgGs [72], consistent with a similar interaction mode across species, one might speculate that variation at this position may prove adaptive by influencing binding of IgG to rabbit receptors. The changes at PSCs CH2 1.5, CH2 92 and CH3 45.2 may also confer some resistance against proteins produced by some bacterial pathogens that target the lower hinge–proximal CH2 region (e.g. IdeS [73]) and the CH2–CH3 interface (e.g. Staphylococcal protein A and Streptococcal protein G [74]). Interestingly, it has been noted that bacterial pathogens in different mammalian species also target this same interdomain region in immunoglobulins [75], so it is possible that bacterial species evolved to infect leporids may employ a similar evasion strategy of production of proteins that bind the CH2–CH3 interface. In contrast to what was found for mammalian IgA, where the Ca3 domain showed less evidence of having evolved under positive selection than Ca1orCa2 [48], the leporid IgG CH3 domain has the highest number of positively selected sites of all IgG constant domains, showing that this domain is evolving under positive selection. Areas across the surface of the CH3 domain have been implicated in the formation of hexameric IgG that assembles at antigenic cell surfaces, recruits C1q and activates complement [76]. Thus, the cluster of PSCs observed in this region suggests that the C-terminal CH3 has some functional relevance in the leporids and could be related to protective complement-mediated mechanisms against specific pathogens. The hinge region shows considerable variability both in amino acid composition and length among IgA and IgG subclasses and alleles, and across species (e.g. [8,10,77]). The hinge is the preferential target region for proteolytic cleavage by numerous bacterial proteases (discussed in [68,78]), which could explain the great variability observed for this antibody region. Given this context, the lack of variation observed in this study for the Lepus IgG hinge is particularly interesting. Previous studies by Esteves et al. [21] indicated that leporids share the same hinge length and have amino acid differences at only two hinge positions, 8 and 9 (IMGT numbering). The European rabbit shows two residues at position 9, Met and Thr, which correlate with the serological allotypes d11 and d12 [12,79]. The d12 Thr residue is O-glycosylated, conferring protection against cleavage of the rabbit IgG hinge [63]. Thus, the glycosylation of rabbit, Lepus,Bunolagus and Pentalagus hinge may protect the IgG from effects of proteases of pathogens and tumour cells. Despite this increased resistance against proteolytic attack of the d12 allotype, both allotypes interact with FcgR equally well (e.g.[72]). We have confirmed that all seven studied leporid genera have an 11-residue hinge, like Oryctolagus, and that this hinge is expressed by Lepus and Sylvilagus. Thus, one can assume that most likely all leporids use a short 11-residue hinge. The existence of more than one IgG in leporids other than the European rabbit has so far not been assessed. Thus, despite having found no evidence for the existence of more than one IGHG copy in the studied leporid genera during the course of this work, we cannot exclude the possibility of additional IgG genes in leporids, although it seems highly unlikely. Unlike the variation observed for the European rabbit, all 11 Lepus species studied share exactly the same hinge motif, indicating that it may be maintained due to an advantageous structure or conformation. Acknowledgements. The authors would like to thank Martin Flajnik (University of Maryland) for his helpful comments on this paper, and Antonio Lavazza and Nicola Martinelli (IZSLER, Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna) for kindly providing the S. floridanus samples. Funding statement. The Portuguese Foundation for Science and Technology (FCT) supported the doctoral fellowship of A.P. (SFRH/BD/ 71252/2010); J.A. is supported by an FCT Investigator grant no. IF/01396/2013. This work was partially funded by FEDER (Fundo Europeu de Desenvolvimento Regional) funds through the Programa Operacional Factores de Competitividade (COMPETE programme; FCOMP-01–0124-FEDER-028286) and Portuguese national funds through FCT (research project PTDC/BIA-ANM/3963/2012)– Quadro de Refere ˆncia Estrate ´gico Nacional (QREN) funds from the European Social Fund and Portuguese Ministe ´rio da Educac¸a ˜oe Cie ˆncia. ‘Genomics Applied to Genetic Resources’, cofinanced by North Portugal Regional Operational Programme 2007/2013 (ON.2—O Novo Norte), under the National Strategic Reference Framework (NSRF), through the European Regional Development Fund (ERDF), supported this work. rsob.royalsocietypublishing.org Open Biol. 4: 140088 7 on January 13, 2017http://rsob.royalsocietypublishing.org/Downloaded from
References 1. Strohl WR. 2009 Optimization of Fc-mediated effector functions of monoclonal antibodies. Curr. Opin. Biotechnol. 20, 685–691. (doi:10.1016/j. copbio.2009.10.011) 2. Roopenian DC, Akilesh S. 2007 FcRn: the neonatal Fc receptor comes of age. Nat. Rev. Immunol. 7, 715–725. (doi:10.1038/nri2155) 3. Schroeder Jr HW, Cavacini L. 2010 Structure and function of immunoglobulins. J. Allergy Clin. Immunol. 125, S41–S52. (doi:10.1016/j.jaci.2009.09.046) 4. Flanagan JG, Rabbitts TH. 1982 Arrangement of human immunoglobulin heavy chain constant region genes implies evolutionary duplication of a segment containing gamma, epsilon and alpha genes. Nature 300, 709–713. (doi:10.1038/ 300709a0) 5. Shimizu A, Takahashi N, Yaoita Y, Honjo T. 1982 Organization of the constant-region gene family of the mouse immunoglobulin heavy chain. Cell 28, 499–506. (doi:10.1016/0092-8674(82)90204-5) 6. Bruggemann M, Free J, Diamond A, Howard J, Cobbold S, Waldmann H. 1986 Immunoglobulin heavy chain locus of the rat: striking homology to mouse antibody genes. Proc. Natl Acad. Sci. USA 83, 6075–6079. (doi:10.1073/pnas.83.16.6075) 7. Knight KL, Suter M, Becker RS. 1988 Genetic engineering of bovine Ig: construction and characterization of hapten-binding bovine/murine chimeric IgE, IgA, IgG1, IgG2, and IgG3 molecules. J. Immunol. 140, 3654–3659. 8. Butler JE, Wertz N, Deschacht N, Kacskovics I. 2009 Porcine IgG: structure, genetics, and evolution. Immunogenetics 61, 209–230. (doi:10.1007/ s00251-008-0336-9) 9. Wagner B, Miller DC, Lear TL, Antczak DF. 2004 The complete map of the Ig heavy chain constant gene region reveals evidence for seven IgG isotypes and for IgD in the horse. J. Immunol. 173, 3230–3242. (doi:10.4049/jimmunol.173.5.3230) 10. Butler JE, Wertz N, Zhao Y, Zhang S, Bao Y, Bratsch S, Kunz TH, Whitaker Jr JO, Schountz T. 2011 The two suborders of chiropterans have the canonical heavy-chain immunoglobulin (Ig) gene repertoire of eutherian mammals. Dev. Comp. Immunol. 35, 273–284. (doi:10.1016/j.dci.2010.08.011) 11. Knight KL, Burnett RC, McNicholas JM. 1985 Organization and polymorphism of rabbit immunoglobulin heavy chain genes. J. Immunol. 134, 1245–1250. 12. Hamers R, Hamers-Casterman C. 1965 Molecular localization of A chain allotypic specificities in rabbit IgG (7S gamma-globulin). J. Mol. Biol. 14, 288–289. (doi:10.1016/S0022-2836(65)80249-2) 13. Lefranc MP et al. 2005 IMGT unique numbering for immunoglobulin and T cell receptor constant domains and Ig superfamily C-like domains. Dev. Comp. Immunol. 29, 185–203. (doi:10.1016/j.dci. 2004.07.003) 14. Cazenave PA, Bennamar A, Sogn JA, Kindt TJ. 1987 Immunoglobulin genes in feral population. In The rabbit in contemporary immunological research (ed. S Dubiski), p. 148. Harlow, UK: Longman Scientific and Technical Publications. 15. van der Loo W, Hamers-Casterman C. 1979 Phylogeny of the rabbit immunoglobulin allotypes: rabbit anti e-locus antisera detect two allelic forms of IgG molecules in Romerolagus diazi.Ann. Inst. Pasteur Immunol. C 130, 761. 16. Hamers-Casterman C, Wittouck E, van der Loo W, Hamers R. 1979 Phylogeny of the rabbit gammachain determinants: a d12-like antigenic determinant in Pronolagus rupestris.J. Immunogenet. 6, 373–381. (doi:10.1111/j.1744-313X) 17. Aggarwal SJ, Mandy WJ. 1976 Lagomorph IgG hinge region: allotype associated amino acid sequence variations. Immunochemistry 13, 215–220. (doi:10.1016/0019-2791(76)90218-4) 18. Appella E, Chersi A, Mage R, Dubiski S. 1971 Structural basis of the A14 and A15 allotypic specificities in rabbit IgG. Proc. Natl Acad. Sci. USA 68, 1341–1345. (doi:10.1073/pnas.68.6. 1341) 19. Teherani J, Capra JD, Aggarwal S, Mandy WJ. 1979 Amino acid sequence analysis of group e allotyperelated peptides derived from lagomorph IgG. Eur. J. Immunol. 9, 690–695. (doi:10.1002/eji. 1830090906) 20. Teherani J, Capra JD, Mandy WJ. 1982 Amino acid sequence of the CH2 domain from various lagomorph IgGs. Mol. Immunol. 19, 841–846. (doi:10.1016/0161-5890(82)90349-2) 21. Esteves PJ, Carmo C, Godinho R, van der Loo W. 2006 Genetic diversity at the hinge region of the unique immunoglobulin heavy gamma (IGHG) gene in leporids (Oryctolagus,Sylvilagus and Lepus). Int. J. Immunogenet. 33, 171–177. (doi:10.1111/j. 1744-313X.2006.00588.x) 22. Esteves PJ, Alves PC, Ferrand N, van der Loo W. 2002 Hotspot variation at the CH2-CH3 interface of leporid IgG antibodies (Oryctolagus,Sylvilagus and Lepus). Eur. J. Immunogenet. 29, 529–535. (doi:10. 1046/j.1365-2370.2002.00355.x) 23. Chapman J, Flux J. 1990 Introduction and overview of the lagomorphs. In Rabbits, hares and pikas: status, survey and conservation action plan (eds J Chapman, J Flux), pp. 1–6. Gland, Switzerland: IUCN. 24. Alves PC, Hackla ¨nder K. 2008 Lagomorph species: geographical distribution and conservation status. In Lagomorph biology (eds PC Alves, N Ferrand, K Hackla ¨nder), pp. 395–405. Berlin, Germany: Springer. 25. Corbet GB, Hill JE. 1980 A world list of mammalian species. Oxford, UK: Oxford University Press. 26. Flux JEC, Angermann R. 1990 The hares and jackrabbits. In Rabbits, hares and pikas: status conservation action plan (eds JA Chapman, JEC Flux), pp. 61–94. Gland, Switzerland: IUCN. 27. Lopez-Martinez N. 2008 The lagomorph fossil record and the origin of the European rabbit. In Lagomorph biology (eds PC Alves, N Ferrand, K Hackla ¨nder), pp. 27–46. Berlin, Germany: Springer. 28. Matthee CA, van Vuuren BJ, Bell D, Robinson TJ. 2004 A molecular supermatrix of the rabbits and hares (Leporidae) allows for the identification of five intercontinental exchanges during the Miocene. Syst. Biol. 53, 433–447. (doi:10.1080/ 10635150490445715) 29. Surridge AK, Timmins RJ, Hewitt GM, Bell DJ. 1999 Striped rabbits in Southeast Asia. Nature 400, 726. (doi:10.1038/23393) 30. Can DN, Abramov AV, Tikhonov AN, Averianov AO. 2001 Annamite striped rabbit Nesolagus timminsi in Vietnam. Acta Theriol. 46, 437–440. 31. Chapman JA, Cramer KL, Dippenaar NJ, Robinson TJ. 1992 Systematics and biogeography of the New England cottontail, Sylvilagus transitionalis (Bangs, 1895), with the description of a new species from the Appalachian Mountains. Proc. Biol. Soc. Washington 105, 841–866. 32. Frey JK, Fisher RD, Ruedas LA. 1997 Identification and restriction of the type locality of the Manzano Mountains cottontail, Sylvilagus cognatus Nelson, 1907 (Mammalia: Lagomorpha: Leporidae). Proc. Biol. Soc. Washington 110, 329–331. 33. Whiteford CEM. 1995 Molecular phylogeny of the genus Pronolagus (Mammalia: Lagomorpha) and the use of morphological and molecular characters in the delineation of P. rupestris. MSc thesis, University of Pretoria, Pretoria, South Africa. 34. Matthee CA, Robinson TJ. 1996 Mitochondrial DNA differentiation among geographical populations of Pronolagus rupestris, Smith’s red rock rabbit (Mammalia: Lagomorpha). Heredity 76, 514–523. (doi:10.1038/hdy.1996.74) 35. Ros F, Puels J, Reichenberger N, van Schooten W, Buelow R, Platzer J. 2004 Sequence analysis of 0.5 Mb of the rabbit germline immunoglobulin heavy chain locus. Gene 330, 49–59. (doi:10.1016/ j.gene.2003.12.037) 36. Thompson JD, Higgins DG, Gibson TJ. 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nuclic Acids Res. 22, 4673–4680. (doi:10. 1093/nar/22.22.4673) 37. Hall TA. 1999 bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nuclic Acids Symp. Ser. 41, 95–98. 38. Kabat EA, Wu TT, Bilofsky H, Reid-Miller M, Perry H. 1983 Sequences of proteins of immunological interest. Washington, DC: US Department of Health and Human Services, National Institutes of Health. 39. Librado P, Rozas J. 2009 DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25, 1451–1452. (doi:10.1093/ bioinformatics/btp187) rsob.royalsocietypublishing.org Open Biol. 4: 140088 8 on January 13, 2017http://rsob.royalsocietypublishing.org/Downloaded from
40. Ferre F, Clote P. 2005 DiANNA: a web server for disulphide connectivity prediction. Nuclic Acids Res. 33, W230–W232. (doi:10.1093/nar/gki412) 41. Ferre F, Clote P. 2005 Disulphide connectivity prediction using secondary structure information and diresidue frequencies. Bioinformatics 21, 2336–2346. (doi:10.1093/bioinformatics/bti328) 42. Ferre F, Clote P. 2006 DiANNA 1.1: an extension of the DiANNA web server for ternary cysteine classification. Nuclic Acids Res. 34, W182–W185. (doi:10.1093/nar/gkl189) 43. Anisimova M, Bielawski JP, Yang Z. 2001 Accuracy and power of the likelihood ratio test in detecting adaptive molecular evolution. Mol. Biol. Evol. 18, 1585–1592. (doi:10.1093/oxfordjournals.molbev. a003945) 44. Posada D, Crandall KA. 2002 The effect of recombination on the accuracy of phylogeny estimation. J. Mol. Evol. 54, 396–402. (doi:10. 1007/s00239-001-0034-9) 45. Kosakovsky Pond SL, Posada D, Gravenor MB, Woelk CH, Frost SD. 2006 Automated phylogenetic detection of recombination using a genetic algorithm. Mol. Biol. Evol. 23, 1891–1901. (doi:10. 1093/molbev/msl051) 46. Kosakovsky Pond SL, Posada D, Gravenor MB, Woelk CH, Frost SD. 2006 GARD: a genetic algorithm for recombination detection. Bioinformatics 22, 3096–3098. (doi:10.1093/bioinformatics/btl474) 47. Areal H, Abrantes J, Esteves PJ. 2011 Signatures of positive selection in Toll-like receptor (TLR) genes in mammals. BMC Evol. Biol. 11, 368. (doi:10.1186/ 1471-2148-11-368) 48. Pinheiro A, Woof JM, Abi-Rached L, Parham P, Esteves PJ. 2013 Computational analyses of an evolutionary arms race between mammalian immunity mediated by immunoglobulin A and its subversion by bacterial pathogens. PLoS ONE 8, e73934. (doi:10.1371/journal.pone.0073934) 49. Wlasiuk G, Nachman MW. 2010 Adaptation and constraint at Toll-like receptors in primates. Mol. Biol. Evol. 27, 2172–2186. (doi:10.1093/molbev/ msq104) 50. Yang Z. 1997 PAML: a program package for phylogenetic analysis by maximum likelihood. Comput. Appl. Biosci. 13, 555–556. 51. Yang Z. 2007 PAML 4: phylogenetic analysis by maximum likelihood. Mol. Biol. Evol. 24, 1586–1591. (doi:10.1093/molbev/msm088) 52. Nielsen R, Yang Z. 1998 Likelihood models for detecting positively selected amino acid sites and applications to the HIV-1 envelope gene. Genetics 148, 929–936. 53. Yang Z, Swanson WJ, Vacquier VD. 2000 Maximumlikelihood analysis of molecular adaptation in abalone sperm lysin reveals variable selective pressures among lineages and sites. Mol. Biol. Evol. 17, 1446–1455. (doi:10.1093/oxfordjournals. molbev.a026245) 54. Yang Z, Wong WS, Nielsen R. 2005 Bayes Empirical Bayes inference of amino acid sites under positive selection. Mol. Biol. Evol. 22, 1107–1118. (doi:10. 1093/molbev/msi237) 55. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011 MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. (doi:10. 1093/molbev/msr121) 56. Pond SL, Frost SD. 2005 Datamonkey: rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics 21, 2531–2533. (doi:10.1093/bioinformatics/bti320) 57. Arai H, Glabe C, Luecke H. 2012 Crystal structure of a conformation-dependent rabbit IgG Fab specific for amyloid prefibrillar oligomers. Biochim. Biophys. Acta 1820, 1908–1914. (doi:10.1016/j.bbagen. 2012.08.016) 58. Girardi E, Holdom MD, Davies AM, Sutton BJ, Beavil AJ. 2009 The crystal structure of rabbit IgG–Fc. Biochem. J. 417, 77–83. (doi:10.1042/BJ20081355) 59. Schneider S, Zacharias W. 2012 Atomic resolution model of the antibody Fc interaction with the complement C1q component. Mol. Immunol. 51, 66–72. (doi:10.1016/j.molimm.2012.02.111) 60. Sondermann P, Huber R, Oosthuizen V, Jacob U. 2000 The 3.2-A crystal structure of the human IgG1 Fc fragment-FcgRIII complex. Nature 406, 267–273. (doi:10.1038/35018508) 61. Rayner LE, Kadkhodayi-Kholghi N, Heenan RK, Gor J, Dalby PA, Perkins SJ. 2013 The solution structure of rabbit IgG accounts for its interactions with the Fc receptor and complement C1q and its conformational stability. J. Mol. Biol. 425, 506–523. (doi:10.1016/j.jmb.2012.11.019) 62. Wang Y, Geer LY, Chappey C, Kans JA, Bryant SH. 2000 Cn3D: sequence and structure views for Entrez. Trends Biochem. Sci. 25, 300–302. (doi:10.1016/ S0968-0004(00)01561-9) 63. Goodman JW. 1965 Heterogeneity of rabbit gamma-globulin. Biochemistry 4, 2350–2357. (doi:10.1021/bi00887a013) 64. Arnold JN, Wormald MR, Sim RB, Rudd PM, Dwek RA. 2007 The impact of glycosylation on the biological function and structure of human immunoglobulins. Annu. Rev. Immunol. 25, 21–50. (doi:10.1146/annurev.immunol.25.022106.141702) 65. Jacobsen FW, Padaki R, Morris AE, Aldrich TL, Armitage RJ, Allen MJ, Lavallee JC, Arora T. 2011 Molecular and functional characterization of cynomolgus monkey IgG subclasses. J. Immunol. 186, 341–349. (doi:10.4049/jimmunol.1001685) 66. Perelman P et al. 2011 A molecular phylogeny of living primates. PLoS Genet. 7, e1001342. (doi:10. 1371/journal.pgen.1001342) 67. Esteves PJ, Lanning D, Ferrand N, Knight KL, Zhai SK, van der Loo W. 2005 The evolution of the immunoglobulin heavy chain variable region (IgVH) in Leporids: an unusual case of transspecies polymorphism. Immunogenetics 57, 874–882. (doi:10.1007/s00251-005-0022-0) 68. Esteves PJ, Lanning D, Ferrand N, Knight KL, Zhai SK, van der Loo W. 2004 Allelic variation at the VHa locus in natural populations of rabbit (Oryctolagus cuniculus, L.). J. Immunol. 172, 1044–1053. (doi:10.4049/jimmunol.172.2.1044) 69. Pinheiro A, Lanning D, Alves PC, Mage RG, Knight KL, van der Loo W, Esteves PJ. 2011 Molecular bases of genetic diversity and evolution of the immunoglobulin heavy chain variable region (IGHV) gene locus in leporids. Immunogenetics 63, 397–408. (doi:10.1007/s00251-011-0533-9) 70. Pinheiro A, de Mera IG, Alves PC, Gortazar C, de la Fuente J, Esteves PJ. 2013 Sequencing of modern Lepus VDJ genes shows that the usage of VHn genes has been retained in both Oryctolagus and Lepus that diverged 12 million years ago. Immunogenetics 65, 777–784. (doi:10.1007/ s00251-013-0728-3) 71. Woof JM, Burton DR. 2004 Human antibody-Fc receptor interactions illuminated by crystal structures. Nat. Rev. Immunol. 4, 89–99. (doi:10. 1038/nri1266) 72. Woof JM, Partridge LJ, Jefferis R, Burton DR. 1986 Localisation of the monocyte-binding region on human immunoglobulin G. Mol. Immunol. 23, 319–330. (doi:10.1016/0161-5890(86)90059-3) 73. Brezski RJ, Jordan RE. 2010 Cleavage of IgGs by proteases associated with invasive diseases: an evasion tactic against host immunity? MAbs 2, 212–220. (doi:10.4161/mabs.2.3.11780) 74. Sauer-Eriksson AE, Kleywegt GJ, Uhlen M, Jones TA. 1995 Crystal structure of the C2 fragment of streptococcal protein G in complex with the Fc domain of human IgG. Structure 3, 265–278. (doi:10.1016/S0969-2126(01)00157-5) 75. Lewis MJ, Meehan M, Owen P, Woof JM. 2008 A common theme in interaction of bacterial immunoglobulin-binding proteins with immunoglobulins illustrated in the equine system. J. Biol. Chem. 283, 17 615–17 623. (doi:10.1074/ jbc.M709844200) 76. Diebolder CA et al. 2014 Complement is activated by IgG hexamers assembled at the cell surface. Science 343, 1260–1263. (doi:10.1126/science. 1248943) 77. Burnett RC, Hanly WC, Zhai SK, Knight KL. 1989 The IgA heavy-chain gene family in rabbit: cloning and sequence analysis of 13 C alpha genes. EMBO J. 8, 4041–4047. 78. Woof JM, Russell MW. 2011 Structure and function relationships in IgA. Mucosal Immunol. 4, 590–597. (doi:10.1038/mi.2011.39) 79. Prahl JW, Mandy WJ, Todd CW. 1969 The molecular determinants of the A11 and A12 allotypic specificities in rabbit immunoglobulin. Biochemistry 8, 4935–4940. (doi:10.1021/bi00840a042) rsob.royalsocietypublishing.org Open Biol. 4: 140088 9 on January 13, 2017http://rsob.royalsocietypublishing.org/Downloaded from