Diversity of Microfungi in a High Radon Cave Ecosystem

Frontiers in Microbiology | www.frontiersin.org 1 April 2022 | Volume 13 | Article 869661 ORIGINAL RESEARCH published: 27 April 2022 doi: 10.3389/fmicb.2022.869661 Edited by: Saskia Bindschedler, Université de Neuchâtel, Switzerland Reviewed by: Nihal Dogruöz Güngör, Istanbul University, Turkey Johann Leplat, Laboratoire de Recherche des Monuments Historiques, France *Correspondence: Cesareo Saiz-Jimenez [email protected] Specialty section: This article was submitted to Terrestrial Microbiology, a section of the journal Frontiers in Microbiology Received: 04 February 2022 Accepted: 05 April 2022 Citation: Martin-Pozas T, Nováková A, Jurado V, Fernandez-Cortes A, Cuezva S, Saiz-Jimenez C and Sanchez-Moral S (2022) Diversity of Microfungi in a High Radon Cave Ecosystem. Front. Microbiol. 13:869661. doi: 10.3389/fmicb.2022.869661 Diversity of Microfungi in a High Radon Cave Ecosystem TamaraMartin-Pozas 1, AlenaNováková 2, ValmeJurado 3, AngelFernandez-Cortes 4, SoledadCuezva 5, CesareoSaiz-Jimenez 3* and SergioSanchez-Moral 1 1 Department of Geology, National Museum of Natural Sciences (MNCN-CSIC), Madrid, Spain, 2 Laboratory of Fungal Genetics and Metabolism, Institute of Microbiology of the CAS, Prague, Czechia, 3 Department of Agrochemistry, Environmental Microbiology and Soil Conservation, Institute of Natural Resources and Agricultural Biology (IRNAS-CSIC), Seville, Spain, 4 Department of Biology and Geology, University of Almeria, Almeria, Spain, 5 Department of Geology, Geography and Environment, University of Alcala, Alcala de Henares, Spain Castañar Cave is a clear example of an oligotrophic ecosystem with high hygrothermal stability both seasonal and interannual and the particularity of registering extraordinary levels of environmental radiation. These environmental conditions make the cave an ideal laboratory to evaluate both the responses of the subterranean environment to sudden changes in the matter and energy fluxes with the exterior and also any impact derived from its use as a tourist resource under a very restrictive access regime. In 2008, a fungal outbreak provoked by a vomit contaminated the sediments which were removed and subsequently treated with hydrogen peroxide. Fungal surveys were carried out in 2008 and 2009. The visits were resumed in 2014. Here, 12 years after the outbreak, wepresent an exhaustive study on the cave sediments in order to know the distribution of the different fungal taxa, as well as the prevalence and spatio-temporal evolution of the fungi caused by the vomit over the years under the conditions of relative isolation and high radiation that characterize this cave. Keywords: fungal outbreak, Castañar Cave, radon, ionizing radiation, Ascomycota, Basidiomycota INTRODUCTION Castañar Cave (Castañar de Ibor, Caceres, Spain) was discovered in 1967, declared Natural Monument in 1997 and opened to visits in 2003. The interest of this cavity lies in its great variety of speleothems formed mainly by aragonite and calcite of low magnesium (Alonso-Zarza et al., 2011) and in its very high concentrations of radon (222Rn) in air with annual average above 30 kBq/m3 (Lario et al., 2006; Garcia-Guinea et al., 2013). These values are much higher than the average 222Rn concentrations found in most caves studied around the world (0.5–8.3 kBq/ m3; Cigna, 2005; Somlai et al., 2011). 222Rn was used as tracer for assessing ventilation of Castañar Cave because its variations depend only on the exchange of air with the exterior (Fernandez-Cortes et al., 2009). The slates hosting the cave contain uranium (39.2 ± 5.2 mg.kg−1; Garcia-Guinea et al., 2013), so that its disintegration to radon and the subsequently 222Rn exhalation from bedrock entails a continuous source of this gas to cave atmosphere. The weathering leakage processes of the bedrock also favor the remobilization of radionuclides via leaching and their later settlement into the cave environment associated to mineral phases of cave deposits (Garcia-Guinea et al., 2013). This favors maintaining the high 222Rn activity of cave air since Published: 27 April 2022 Frontiers in Microbiology | www.frontiersin.org 2 April 2022 | Volume 13 | Article 869661 Martin-Pozas et al. Microfungi in High Radon Cave there is a continuous regeneration of this gas due to the longlived of these radionuclides of the radium radioactive decay chain. The morning of August 26, 2008, on the cave walls and ground sediments appeared long, white fungal mycelia as the result of the vomit of a visitor, 40 h before. The vomit area was located at 17 m from the cave entrance and the ground sediments exhibited a widespread fungal colonization after the disturbance. In the following days, visitors stepped on the sediments colonized by the fungi, and detritus, mycelia and spores were distributed along the touristic trail, as evidenced by the presence of patches of fungal growth farther than the vomit area (Jurado etal., 2010). To help to control the outbreak, the entire area directly affected by vomiting was cleaned and subsequently treated with hydrogen peroxide and the visits were cancelled on September 11, 2008, 16 days after the spillage. In 2009, the cave was only visited by scientists and staff people for controlling the fungal outbreak. The cave was reopened in 2014 but the number of visitors/year was reduced from 1,500 to 1,600in 2008, to an annual maximum of 450 visitors. Besides, since the cave re-opened, in order to minimize the entrance of external material, the visitors uses clean and uncontaminated suits and shoe covers. In Castañar Cave, we had the opportunity to carry out extensive microbiological studies on 2008 and 2009, up to 12 months after the fungal outbreak, and again 12 years after the outbreak in a subsequent and exhaustive study carried out in 2020. Castañar Cave is a natural environment with high levels of ionizing radiation but also a low energy cave and high environmental stability throughout the annual cycle (Fernandez-Cortes et al., 2011) which make it more sensitive to the entry of matter and energy from outside. There are a few reports about the dominance of microbial communities in radioactive environments such as the International Space Station and Chernobyl reactor (Dadachova and Casadevall, 2008; Van Houdt et al., 2012; Romsdahl et al., 2018). These works give some examples of microbial species and melanized fungi with a high tolerance to radioactivity. However, research works in natural environments with high ionizing radiation and on the evolution of microbial populations in these environments are very scarce (Siasou et al., 2017). The direct control that environmental conditions exert on the distribution of fungi in subterranean ecosystems has recently been demonstrated (Jurado et al., 2021; Sanchez-Moral et al., 2021). The objective of this study is to know the distribution of the different fungal taxa throughout Castañar Cave, as well as the prevalence and spatio-temporal evolution of the fungi caused by the vomit over the years under conditions of high isolation of the cave atmosphere from the outside and an outstanding radon activity. MATERIALS AND METHODS Site Castañar Cave (SW Spain, 39°37′40´´N, 5°24′59´´W, 590 m.a.s.l.) is currently located under a natural olive grove that grows in a temperate and semi-arid climate with a rainfall regime of less than 500 mm per year, long periods of drought in summer and maximum rains in autumn. Outside, the annual average temperature is 15.9°C and the average relative humidity is 62.5%. The cave was developed by dissolution of dolomite strata interbedded in shales and greywackes of the Precambrian Age (Alonso-Zarza and Martin-Perez, 2008). Castañar Cave is a small karstic cavity with a cumulative length of 2,135 m, distributed in six main and wider halls (e.g., Sala Nevada) and some narrow galleries connecting them, with heights of less than 3 m in any case (Figure 1). The cave entrance is a unique vertical access, 9 m long over an area of 1.5 m2, with a quasi-hermetic door installed at the entrance. All these characteristics make Castañar a low energy cave with very high 222Rn gas concentration and high environmental stability throughout the annual cycle (Fernandez-Cortes et al., 2011). Environmental Surveys Variations in 222Rn concentration and air temperature are two key environmental parameters to determine the exchange rates of matter and energy and the main connection pathways between the exterior and the cavity. A set of five autonomous thermohygrometer recorders (Tinytag TGP-4500) and five nuclear track-etch passive detectors equipped with a solid state LR-115 type film (Kodak) were installed inside the cave, distributed according to the geomorphological characteristics of the subterranean galleries and the distance to the entrance (Figure 1). This monitoring network makes it possible to obtain monthly mean values of the 222Rn concentration of the subterranean air and a continuous thermo-hygrometric record at each point. Microbiological Analysis On December 3, 2020, seven sediment samples (approximately 3–4 cm depth) were collected in Castañar Cave (P1-P7) and one from the exterior soil (E) near the cave entrance (Figure1). All samples were collected using sterile spatulas and immediately suspended in DNA/RNA Shield™ into sterile polypropylene tubes. Then, the samples were stored at 4°C, in the dark during transportation and were kept at −80°C until processing. Total DNA was extracted from environmental samples using the QIAGEN Power Soil Kit, following the manufacturer’s instructions. Two independent DNA extractions were carriedout for each sampling point, except in P1 where weonly collected one sample. Extracted DNA was used as template for generating PCR-amplicons. The internal transcribed spacer 2 (ITS2) of the nuclear ribosomal DNA (about 400 bp)wasamplified using the primers ITS86F (5 ‘GTGAATCATCGAATCTTTGAA 3′; Turenne etal., 1999) and ITS4 (5 ‘TCCTCCGCTTATTGATATGC 3′; White etal., 1990). Amplifications settings were as follows: 95°C for 5 min followed by 35 cycles consisting of 95°C for 30s, 49°C for 30 s, and 72°C for 30s and a 10-min elongation step at 72°C. PCR-amplicons were sequenced by high-throughput sequencing at AllGenetics Company (A Coruña, Spain) on Martin-Pozas et al. Microfungi in High Radon Cave Frontiers in Microbiology | www.frontiersin.org 3 April 2022 | Volume 13 | Article 869661 the Illumina MiSeq platform using the paired-end reads 2 × 300 bp reagent kit, according to the manufacturer’s instructions. Extraction and PCR blanks were used. To analyze fungal community composition, Raw fastq files were processed with QIIME2 (Bolyen et al., 2019). Briefly, DADA2 (Callahan etal., 2016) filtered the raw data according to the quality, generating an amplicon sequence variant (ASV) table. Then, taxonomic assignments were determined for ASVs using qiime2-feature-classifier classify-sklearn against the UNITE fungal ITS database (version 8.0; UNITE Community, 2019) and trained with Naive Bayes classifier on the full reference sequences. Taxa were also blasted (BlastN) against GenBank for fungal verification. All fungal names were reported according to the MycoBank Database. The sequencing data was further imported into the R environment 3.6.0 and processed using the phyloseq package (McMurdie and Holmes, 2013). Barplots and clustered heat maps by euclidean distance were prepared using ggplot and pheatmap packages to illustrate the composition of fungal communities in Castañar Cave. Alpha diversity was calculated using Shannon diversity index and Faith’s Phylogenetic Diversity, directly using QIIME2. The raw reads were deposited into the NCBI Sequence Read Archive (SRA) database under accession number PRJNA802044. RESULTS Environmental Parameters Figure2 shows the annual mean values and the annual oscillation ranges of 222Rn concentration of the monitored area. The spatiotemporal distribution of tracer gases is directly related to morphology and cave air circulation. The results show that the entire cave has a very high level of natural radiation throughout the year, higher than 30 kBq/m3, ranging from 32,440 Bq/m3 in the Jardin area (P5-P6) to 34,940 Bq/m3 (P1-P7). The highest mean concentrations and the maximum variations (in red tones) are recorded in the area near the entrance (P1) and in Sala Blanca (P7) – Sala Final, the end of the cave. On the contrary, the most stable area throughout the year is Sala Nevada (P4) with an intra-annual variation of 19,942 Bq/m3. In the case of air temperature (Figure 3), the annual mean values range from 17.08°C in the internal zone (P5-P6) to 17.81°C in the areas near the entrance (P1). The data show the high environmental stability of the cave which annual variation ranges below 0.25°C at all measurement points except in the entrance area (P1, 0.71°C of annual amplitude, red tones), where the external direct influence is evident. These data indicate that the sectors close to the FIGURE1 | Map of Castañar Cave with location of sampling points, passive radon dosimeters and thermohygrometer recorders for environmental monitoring. EXT: Exterior. Martin-Pozas et al. Microfungi in High Radon Cave Frontiers in Microbiology | www.frontiersin.org 4 April 2022 | Volume 13 | Article 869661 entrance show the highest rates of air renewal and consequently of matter and energy exchange with the outside atmosphere. On the contrary, the most stable area with the least energy exchange with the exterior is located in P5-P6 (Sala del Jardin, in light blue tones). Fungal Communities in 2020 Six samples from the cave sediments were taken in December 2020 along the touristic trail and one soil sample outside the cave, which were used for molecular studies. Sample P-3 was not studied. Supplementary Table S1 shows the alpha diversity indices and how fungal diversity decreased in the cave environment when compared to the topsoil. Inside the cave, the lowest fungal diversity was observed in the internal zone (P5-P6), while the highest was found in Sala de Entrada, near the cave entrance. These data indicate that fungal diversity increased with the entry of external organic matter and only a few species survive in the most oligotrophic areas (P5-P6). Figure4 shows phyla distribution in the different samples. In general, there is an uneven distribution between the phyla Ascomycota and Basidiomycota, with a predominance of FIGURE2 | Spatial distribution in Castañar Cave of mean annual radon concentration and maximum amplitude of annual variation expressed in Bq/m3. FIGURE3 | Spatial distribution in Castañar Cave of mean annual air temperature and maximum amplitude of annual variation expressed in degrees centigrade (°C). Martin-Pozas et al. Microfungi in High Radon Cave Frontiers in Microbiology | www.frontiersin.org 5 April 2022 | Volume 13 | Article 869661 ascomycetes in the exterior soil (E) and the first part of the trail from Sala de Entrada (P1) to Sala Nevada (P4), which reversed in the last part of the trail, especially in P5 with a majority of Basidiomycota. At the end of the trail, Sala del Jardin (P6) and Sala Blanca (P7) the relative abundances of both phyla were equivalent. Other abundant phyla were Mortierellomycota in P4 and Glomeromycota in the soil (E). The quantities of other phyla were negligible, below 1%, except for Monoblepharomycota that reached 2.1% in the soil (E). Figure5 and Supplementary Table S2 illustrate the relative abundance of major fungi (higher than 1% in at least one sample) at the species level. Thirty five fungi were identified at the species level, while 14 were only at genus level. The most abundant species was Candida parapsilosis followed by Sistotrema oblongisporum, Cephalotrichum microsporum, Cystobasidium slooffiae, Mortierella alpina, Omphalotus olearius, Neocosmospora solani (= Fusarium solani), Trichophyton ajelloi, Stereum hirsutum, and Malassezia globosa. Other species identified, although with relative abundance below 5% were Pseudopithomyces chartarum, Bahusandhika caligans, Aspergillus tamari, Conocybe ingridiae, and Solicoccozyma aeria, which were only found in the soil (E), and Penicillium simplicissimum, Pseudogymnoascus pannorum, Meyerozyma guilliermondii, Leptobacillium leptobactrum, Fusarium oxysporum, Acremonium furcatum, Skeletocutis nivea, and Basidioascus persicus in different halls. Among the unidentified members of genera and families were predominant Buckleyzyma, Diaporthe, Preussia, Purpureocillium, Glomeraceae and Mortierella. With relative abundance below 5% were members of the genera Massarina, Paraphoma, Aspergillus, Claroideoglomus and Glomus in the soil (E) and Talaromyces in the cave. DISCUSSION Fungi in Castañar Cave 12 Years After a Fungal Outbreak Only three fungi retrieved from previous surveys in sediments (2008–2009) were found again in the 2020 campaign: Neocosmospora solani, Fusarium oxysporum, and Mortierella alpina. It must be noticed that the comparison was made within isolates and NGS sequences, which could create some bias. Nevertheless, their presence in the cave despite the extensive cleaning of sediments carried after the spillage suggests that these three fungi are resistant and well adapted to the oligotrophic and high radiation conditions of the cave. The occurrence of Neocosmospora solani was detected in three sediment samples (Galeria Principal, Sala Nevada and Sala Blanca) and seems to bea permanent inhabitant of Castañar Cave, present in all samplings since 2008. From a point of view of cave conservation, Neocosmospora solani is a dangerous fungus and has been widely reported in relation to cave outbreaks (Dupont et al., 2007; Bastian et al., 2009), and particularly in Castañar Cave (Jurado et al., 2010). In some caves Fusarium oxysporum was associated with Neocosmospora solani (Jiang etal., 2017; Popkova and Mazina, 2019), as they are in Castañar Cave. Fusarium oxysporum is widely found as a plant pathogen, endophyte, and soil saprobe and was isolated from Chernobyl (Urbaniak et al., 2019). Mortierella alpina and other Mortierella species were usually abundant in bat dung samples collected in caves (Degawa and Gams, 2004). Mortierella species were reported to be present in all of the 39 samples collected across five habitats, including sediments, weathered rocks, bat guano, drip waters, and air in Heshang Cave, China (Man et al., 2018). In addition to Fusarium, Mortierella species have been isolated from bat A B FIGURE4 | Fungal abundance at phylum level in Castañar Cave, in the December 2020 campaign. (A) Barplot illustrating fungal abundance at phylum level in P1-P7, and exterior soil E. Phyla with abundances below 1% are represented as Other. (B) Spatial distribution of Ascomycota in the December 2020 campaign. Martin-Pozas et al. Microfungi in High Radon Cave Frontiers in Microbiology | www.frontiersin.org 6 April 2022 | Volume 13 | Article 869661 carcasses found in caves (Karunarathna etal., 2020; Nováková, 2021). In Castañar Cave no bats have been reported, but rodents, geckos and their feces were found. We have detected brushite (hydrated calcium phosphate) in the sediments, a mineral from guano-rich caves (Hill and Forti, 1997; Giurgiu and Tamas, 2013). However, brushite is also excreted by rats (Khan, 1998). Regarding the most abundant taxa (>10%) found in 2020 (Figure5) 17 taxa stand out. Candida parapsilosis was previously isolated from organs and viscera of bats captured in Brazilian urban forests (Ludwig etal., 2023). Other different and abundant Candida spp. were isolated from guano and intestinal contents of bats captured in Mexican caves (Ulloa et al., 2006). The occurrence in Castañar Cave is likely associated with the feces of rodents inhabiting the cave. The genus Cephalotrichum seems to be dominant in some caves (Nováková, 2009; Nováková et al., 2018; Vanderwolf et al., 2019). Jiang et al. (2017) isolated 30 strains of Cephalotrichum from a Chinese cave, and three were described as new species. Cephalotrichum microsporum, a fungus not detected in 2008, was FIGURE5 | Fungal heat map in Castañar Cave samples. Scales bar show the relative abundance at species level, white squared represents the least abundant species and red the most abundant. Branching patterns on top of each heat map group sediment samples by shared species relative abundance patterns. Bars on the left and the legend on the right indicate the classification at the class level. The species with abundances below 1% are not included. Martin-Pozas et al. Microfungi in High Radon Cave Frontiers in Microbiology | www.frontiersin.org 7 April 2022 | Volume 13 | Article 869661 one of the most abundant in the 2020 sampling (Supplementary Table S2; Figure5), and is a saprophytic fungus often reported from animal dung and soils (Heredia etal., 2018; Supplementary Tables S3, S4). However, its abundance represents a potential risk for the conservation of the cave. As well as Candida parapsilosis its presence could be associated with animal dung. The connection from Sala Nevada to Sala del Jardin (P5) is characterized by the dominance of an unidentified species of Diaporthe, followed by Trichophyton ajelloi, and Penicillium citrinum, among ascomycetes. Diaporthe is a genus mainly composed of plant pathogens, responsible for diseases on a wide range of plants, in addition to endophytes and saprobes (Gomes et al., 2013). Diaporthe spp. have been isolated from the air in caves from China (Zhang etal., 2017), Brazil (Cunha et al., 2020), Spain (Sanchez-Moral et al., 2021), and from bats in Malaysian caves (Wasti etal., 2020). Trichophyton ajelloi (=Arthroderma uncinatum) is a geophilic dermatophyte that can cause infections in humans, with a preference for keratinrich substrates (Zheng et al., 2020). Other Trichophyton spp. have been isolated from cave air (Nováková, 2009; MartinSanchez et al., 2014; Sanchez-Moral et al., 2021). Conversely, in the connection from Sala Nevada to Sala del Jardin (P5) the basidiomycetes are composed of Sistotrema oblongisporum (41.33%) and Malassezia globosa (10.07%). Sistotrema spp. have been previously found in mines, always associated with timbers (Eslyn and Lombard, 1983; Held etal., 2020). The presence of these basidiomycetes in the cave could berelated with a definite nutrient source, and the most common could be the presence of wood and/or branches fragments. Malassezia globosa is a cold-adapted yeast with the ability to survive in extreme conditions (Connell etal., 2014). This species requires lipids for growth and is common in human dandruff and seborrheic dermatitis and may be an indication of human or animal activity (Connell and Staudigel, 2013). Sala del Jardin (P6) is characterized by the strong relative abundance of two yeasts, Candida parapsilosis (Ascomycota, Saccharomycetes) and an unidentified species of the genus Buckleyzyma (Basidiomycota, Cystobasidiomycetes), both covering 100% of the relative abundance. It has been reported that Candida parapsilosis and other yeasts are associated with basidiomycetes (Péter et al., 2017), as we found in Galeria Principal (P2) and Sala Nevada (P7). The genus Buckleyzyma comprises species previously placed in the genera Rhodotorula, Sporobolomyces and Bullera (Wang et al., 2016). Species of Buckleyzyma have been isolated from litter (Mašínová et al., 2017), plant leaves and soils (Li et al., 2020), as well as from floor and walls of a winery (Abdo et al., 2020). In most of these environments, Buckleyzyma was associated with Candida, Solicoccozyma, Malassezia, Meyerozyma, and other yeasts. Species of Buckleyzyma, Candida, Malassezia, and Meyerozyma were found in Castañar Cave and Solicoccozyma in the soil outside the cave. The genus Preussia (Pleosporales, Sporormiaceae), abundant in the vomit area, Galeria Principal (P2), is widespread on different types of animal dung, and soil, decayed wood, and plant debris. Gonzalez-Menendez et al. (2017) reported that 28 out of 29 species of Preussia from the Iberian Peninsula were isolated from dung. Omphalotus olearius (basidiomycetes) and Chrysosporium pseudomerdarium (ascomycetes) only appeared in Galeria Principal (P2). The habitat of Omphalotus olearius is olive trees (Castro etal., 2011) in accordance with the extensive olive grove under which the cavity is located. This basidiomycete species clearly point to an origin outside the cave and their transport inside, as it was found near the cave entrance. Chrysosporium pseudomerdarium was isolated from soils, caves and bat guano (Nagai et al., 1998; Larcher et al., 2003; Saxena et al., 2004). Most species of Chrysosporium are keratinolytic (Bohacz, 2017). A few basidiomycete species appeared exclusively in Sala Blanca (P7): Cystobasidium slooffiae (28.75%), Stereum hirsutum (12.78%) and Skeletocutis nivea (4.29%). Sistotrema oblongisporum is a corticioid fungus, as well as Stereum hirsutum and Skeletocutis nivea. These fungi are wood-rotting species, common in forest on dead branches and logs (Korhonen etal., 2018). Conversely, Cystobasidium slooffiae, previous known as Rhodotorula slooffiae, was found on bats in Australian caves (Holz et al., 2018). Sala Blanca (P7), at the end of the trail, is rarely visited but the environmental data indicated an external direct influence. The occurrence of these basidiomycetes could be associated to the connection of Sala Blanca with the exterior. Another basidiomycete, an unidentified Geminibasidium occurred in Sala de Entrada with relative abundance of 12.85%, but only 0.02% in the exterior soil. The species of this genus have been isolated from forest soils and rhizosphere (Nguyen et al., 2013; Ren et al., 2021). Other fungi (Glomeromycota phylum), only found in the exterior soil, but not in the cave, were the genera Glomus, Claroideoglomus, and unidentified members of the family Glomeraceae, which are arbuscular mycorrhizal fungi (Pagano, 2016). Their obligate association with plants precludes their presence in the cave. With low relative abundances there are a few interesting fungi in different locations along the cavity: Pseudogymnoascus pannorum and Leptobacillium leptobactrum. Pseudogymnoascus pannorum is a psychrophilic, keratinolytic fungus (Garzoli etal., 2019), closely related to Pseudogymnoascus destructans, the causative agent of white-nose syndrome in bats. This is a soil borne fungus occurring worldwide and in caves. The fungus is common in European and North American caves and is adapted to grow between 4 and 15°C (Out etal., 2016; Vanderwolf et al., 2019; Sanchez-Moral et al., 2021). The saprotrophic fungus Leptobacillium leptobactrum was detected in French and German caves (Bastian et al., 2009; Porca et al., 2011; Burow et al., 2019). In Spanish caves, the abundance of Leptobacillium leptobactrum and Leptobacillium symbioticum amounted 100% of the fungi isolated from the air in some halls (Dominguez-Moñino etal., 2021). This abundance was suggested to be related to their entomopathogenic activity. Meyerozyma guilliermondii appeared exclusively in Sala Nevada. This is a cold-adapted ascomycete yeast often recorded in Arctic and Antarctic ecosystems (Sannino et al., 2021). Meyerozyma guilliermondii occurred in bat guano, in some cases with high isolation frequency (Larcher etal., 2003; Dimkić et al., 2020). Martin-Pozas et al. Microfungi in High Radon Cave Frontiers in Microbiology | www.frontiersin.org 8 April 2022 | Volume 13 | Article 869661 Spatial Distribution of Fungal Communities in Castañar Cave in 2020 In the 2020 sampling, the distribution of 12 fungal phyla in the soil outside the cave (Figure 4) is similar to that of forest soils. In fact, Kujawska et al. (2021) reported that in forest soils Ascomycota was the most abundant phylum, followed by Basidiomycota, Mucoromycota and Mortierellomycota. However, this diversity was greatly reduced inside the cave, with only two phyla (Ascomycota and Basidiomycota) in samples P1, P2, P5 and P6, and three phyla (Ascomycota, Basidiomycota and Mortierellomycota) in P4 and P7. This loss of diversity can be attributed, among other factors, to the lack of nutrients inside the cave, as opposite to the forest soil. The loss of diversity inside the cave increased in the inner part of the trail (P5-P6), corresponding to the most stable area with the least energy exchange with the exterior. The uneven distribution of the phyla Ascomycota and Basidiomycota across the cave is remarkable. Most ascomycetes have been found in areas well connected to the entrance: Sala de Entrada (P1) and Galeria Principal (P2) or in areas with a high impact of tourist visits such as Sala Nevada (P4; Figure 1). Therefore, their presence in the cave is an indirect consequence of the entry of organic matter by three ways: cave animals, human visitors, and airborne spores from outside. The second part of the trail comprises a passage between Sala Nevada and Sala del Jardin (P5), Sala del Jardin (P6), and Sala Blanca (P7; Figure 1), where the relative abundances of basidiomycetes increased, especially in P5. The connection from Sala Nevada to Sala del Jardin (P5) is a very narrow passage that in some way separates both trail sides and this kind of isolation could beresponsible of the different niches colonized by ascomycete and basidiomycete species. It is worth mentioning the abundance of Mortierellomycota (30.80%) in Sala Nevada (P4), against Basidiomycota (1.01%), contrarily to those found in other halls where Basidiomycota ranged from 67.75 to 10.72% (Figure 4). Mortierellomycota was only found in Sala Nevada (P4), in addition to Sala Blanca (P7), where reached 2.42%. Most Mortierellomycota are saprobic soil-inhabiting fungi and many Mortierella alpina strains have been isolated from agricultural soils (Wagner et al., 2011). Other species of Mortierella were found in soil samples near the cave. Species of the genus Mortierella are common in soils and occur frequently in cave sediments (Nováková, 2009; Zhang et al., 2014; Man et al., 2018; Nováková et al., 2018). Inside the cave, the fungal diversity was greater in Sala de Entrada (P1), an ecotone area very close to the entrance, where some roots and animals are frequently observed, as well as in P2, P4 and P7, while in the inner areas (P5 and P6) was low (Figure 5). Members of the phyla Basidiomycota and Ascomycota were found in the soil and Sala de Entrada sediment with high relative abundances. Glomeromycota were only found in the soil, as correspond to symbiotic arbuscular mycorrhizal fungi (Pagano, 2016). It was worthy of note the increase of Basidiomycota in all cave halls and galleries with respect to the exterior soil, except for Sala Nevada (P4). It should be noted the high presence of endophytic fungus (Talaromyces, Porodiplodia vitis, Aureobasidium pullulans) and fungal species associated with roots and decaying plant material (Rhexocercosporidium panacis and Tritirachium dependens) in Sala de Entrada (Lu et al., 2014; Vanam et al., 2018; Crous et al., 2019). Therefore, their presence near the entrance was related with roots and the transport of organic matter from outside. Regarding the ascomycetes, a few fungi were noticeable for their relative abundance: Candida parapsilosis, Cephalotrichum microsporum, an unidentified species of the genus Preussia and Neocosmospora solani were found at different locations along the cavity, while the unidentified species of the genera Diaporthe and Purpureocillium, as well as Trichophyton ajelloi only appeared in Sala Nevada (P4) and/or the connection between Sala Nevada and Sala del Jardin (P5). Ecological Traits of Fungi Castañar Cave is a highly radioactive site with peaks above 50 kBq/m3, but also a low-energy cave with oligotrophic conditions (before the vomit spillage) due to the high isolation level from the outdoor environment. These special conditions could affect fungal communities’ development. Fungi are highly radioresistant when subjected to high doses of ionizing radiation under experimental or accidental conditions (Dadachova and Casadevall, 2008). Chernobyl (Dighton etal., 2008) and the Nevada Test Site (Durrell and Shields, 1960) affected by atmospheric and subterranean nuclear detonations are two reference sites where fungal studies have been carried out. Recently, Fukushima Dai-ichi Nuclear Power Plant was added to the list and it was shown that fungi accumulated high amounts of radiocesium (Fuma et al., 2017). In the literature there are a few papers on the microbial diversity in high 222Rn ecosystems (Anitori et al., 2002; Brugger et al., 2005; Weidler et al., 2007). In the cave sediments the genera Preussia, Aspergillus, Acremonium, Mortierella and Penicillium were coincident with those found in Chernobyl as well as the species Pseudogymnoascus pannorum, Neocosmospora solani, Fusarium oxysporum, Penicillium citrinum, and Purpureocillium lilacinum (Zhdanova et al., 1994, 2000; Egorova et al., 2015). However, all these fungi can be considered as cave inhabitants, either in ionized caves or not, which indicates that these species are relatively tolerant to ionizing radiations. A number of fungi have been studied in relation to the presence or activity in radioactive sites. Some of them have been found in Castañar Cave. Li et al. (2015) reported the isolation of the yeasts Meyerozyma (= Candida) guilliermondii and Rhodotorula calyptogenae from a radioactive waste repository. Shuryak et al. (2017) indicated that fungi were particularly resistant to ionizing radiation. These included Candida parapsilosis and Meyerozyma guilliermondii, in addition to a few Aspergillus, Acremonium and Chrysosporium species. The two first yeasts were found in the cave as well as different species of the three last fungal genera. Zhdanova etal. (2000) detected fungal growth on the buildings of Chernobyl and isolated 37 fungi, from which Penicillium citrinum, Pseudogymnoascus pannorum, Neocosmospora solani, and Fusarium oxysporum were also found in the cave. All species, except Pseudogymnoascus pannorum, were isolated in locations severely contaminated. According to the authors, Martin-Pozas et al. Microfungi in High Radon Cave Frontiers in Microbiology | www.frontiersin.org 9 April 2022 | Volume 13 | Article 869661 the annual dose received by these fungi is 105 times the natural background radiation and they noticed that about 80% of the fungi contained melanin. Blachowicz etal. (2019) investigated the survival of 12 fungi isolated from Chernobyl to UV-C and simulated Mars conditions. Interestingly, among the fungi were represented Fusarium oxysporum and different species of Acremonium, Penicillium and Aspergillus. Gessler etal. (2014) reported that Purpureocillium lilacinum strains isolated from Chernobyl areas had a melanin content 2–2.5 times higher than strains from other areas, concluding that radionuclide contamination changed the fungal communities by increasing the amount of melanized fungi, and Egorova et al. (2015) pointed out that this fungus, was used as a bioindicator of the high level of contamination with radionuclides in Chernobyl soils. Traxler et al. (2021) proved that non-melanized fungi, non-adapted to high ionizing radiation, can survive, grow and spread in the Chernobyl Exclusion Zone soil, with a high level of ionizing radiation. The authors inoculated a model basidiomycete Schizophyllum commune into the soil and confirmed that the fungus was present 1 year after inoculation and could cross 1 m distance within 6 months. The test showed that unadapted fungi can thrive in highly contaminated soils where radiation and heavy metals were present. In light of our data, a high number of non-melanized fungi thrived in the cave sediments but melanized fungi were scarce. This can beexplained because cave fungi do not need melanins to protect from UV radiation. The ecological traits, as well the niches of the most abundant fungal species in Castañar Cave (from P2 to P7) are summarized in Supplementary Tables S3 and S4. Regarding the potential danger to human health, a few species were human opportunistic fungal pathogens: Candida parapsilosis, Meyerozyma guilliermondii, Pseudogymnoascus pannorum, Leptobacillium leptobactrum, Malassezia globosa. Almost all the fungi in this cave were saprophytes and endophytes and were isolated from caves and soils. As opposed to that observed in other show caves (DominguezMoñino etal., 2021), Castañar Cave presented a low occurrence of entomopathogenic fungi: Leptobacillium leptobactrum and Purpureocillium, both in areas well connected to the outside. Other different ecological traits were noticed with the identification of psychrophilic (Candida parapsilosis, Malassezia globosa, Pseudogymnoascus pannorum, Meyerozyma guilliermondii, Buckleyzyma, Penicillium sp., Mortierella, Neocosmospora solani, Fusarium oxysporum, Preussia sp.), keratinolytic (Trichophyton ajelloi, Pseudogymnoascus pannorum, Chrysosporium pseudomerdarium, Penicillium spp., Neocosmospora solani, Candida parapsilosis, Penicillium citrinum, Talaromyces), or coprophilous and/or guanoinhabitant taxa (Mortierella alpina, Preussia sp., Penicillium citrinum, Chrysosporium pseudomerdarium, Meyerozyma guilliermondii, Candida parapsilosis, Talaromyces spp., Cephalotrichum microsporum). In general, most fungi retrieved are typical soil-borne fungi and widespread in nature (e.g., Purpureocillium lilacinum, Penicillium decumbens, Neocosmospora solani, Chaetomium globosum, Pochonia chlamydosporia, Cephalotrichum stemonitis, Cephalotrichum microsporum, Penicillium citrinum, Cladosporium cladosporioides, Cladosporium sphaerospermum, Aspergillus ustus, etc.; Domsch et al., 2007). CONCLUSION The mycobiota of Castañar Cave is defined by the input of organic matter from anthropogenic and animal sources (including dung). It is hypothesized that ecologically distinct niches were created in the cave by the input of diverse types of organic matter, under different environmental conditions and mineral substrata. These niches may account for certain fungal species being present or absent along the cave. The zones well connected to the exterior and Sala Nevada with high impact of tourist visits host copiotrophic fungal species while those thriving in the inner zones occurred under relatively oligotrophic conditions. Under these limited conditions, weobserved occasional fungal inhabitants because of the entry of foreign organic matter during visits. The loss of diversity inside the cave increased in the inner part corresponding to the most stable area with the least energy exchange with the exterior. Regarding persistence, the occurrence of Neocosmospora solani in all samplings from 2008 till 2020 is noteworthy since it has been widely reported in relation to cave outbreaks. In addition, this fungus is usually a very abundant soil inhabitant and is able of taking advantage of any disturbance to over develop, as it made during the vomit spillage. An additional attention merits the abundance of Cephalotrichum microsporum along the cave. This and other abundant taxa should becontrolled. Fungi previously reported in highly radioactive environments were also found in Castañar Cave, but the effect of high 222Rn on these fungi is not conclusive taking into account that the diversity is similar to that found in other caves with relatively low 222Rn concentrations. DATA AVAILABILITY STATEMENT The datasets presented in this study can be found in online repositories. The name of the repository and accession number can be found in the article. AUTHOR CONTRIBUTIONS TM-P, AN, and VJ: samplings and microbial analyses. AF-C, SS-M, and SC: environmental analyses. TM-P and CS-J: writing of the manuscript with support from SS-M and AF-C. SS-M and CS-J: research coordination and funding. All authors have contributed to the scientific discussion of the data and agreed to the submitted version of the manuscript. FUNDING This research was supported by the Spanish Ministry of Science and Innovation through project PID2019-110603RB-I00 and