Full text
Molecular Psychiatry https://doi.org/10.1038/s41380-019-0440-2 ARTICLE Circadian glucocorticoid oscillations preserve a population of adult hippocampal neural stem cells in the aging brain M. Schouten1,2 ●P. Bielefeld1●L. Garcia-Corzo3●E. M. J. Passchier1●S. Gradari4●T. Jungenitz5●M. Pons-Espinal6● E. Gebara7●S. Martín-Suárez8●P. J. Lucassen1●H. E. De Vries2●J. L. Trejo 4●S. W. Schwarzacher5● D. De Pietri Tonelli 6●N. Toni7●H. Mira3●J. M. Encinas 8,9,10 ●C. P. Fitzsimons 1 Received: 4 July 2018 / Revised: 9 April 2019 / Accepted: 29 April 2019 © The Author(s) 2019. This article is published with open access Abstract A decrease in adult hippocampal neurogenesis has been linked to age-related cognitive impairment. However, the mechanisms involved in this age-related reduction remain elusive. Glucocorticoid hormones (GC) are important regulators of neural stem/precursor cells (NSPC) proliferation. GC are released from the adrenal glands in ultradian secretory pulses that generate characteristic circadian oscillations. Here, we investigated the hypothesis that GC oscillations prevent NSPC activation and preserve a quiescent NSPC pool in the aging hippocampus. We found that hippocampal NSPC populations lacking expression of the glucocorticoid receptor (GR) decayed exponentially with age, while GR-positive populations decayed linearly and predominated in the hippocampus from middle age onwards. Importantly, GC oscillations controlled NSPC activation and GR knockdown reactivated NSPC proliferation in aged mice. When modeled in primary hippocampal NSPC cultures, GC oscillations control cell cycle progression and induce specific genome-wide DNA methylation profiles. GC oscillations induced lasting changes in the methylation state of a group of gene promoters associated with cell cycle regulation and the canonical Wnt signaling pathway. Finally, in a mouse model of accelerated aging, we show that disruption of GC oscillations induces lasting changes in dendritic complexity, spine numbers and morphology of newborn granule neurons. Together, these results indicate that GC oscillations preserve a population of GR-expressing NSPC during aging, preventing their activation possibly by epigenetic programming through methylation of specific gene promoters. Our observations suggest a novel mechanism mediated by GC that controls NSPC proliferation and preserves a dormant NSPC pool, possibly contributing to a neuroplasticity reserve in the aging brain. Introduction Aging imposes an increasing disease burden and the neurological consequences of aging, such as cognitive decline, are particularly deleterious to quality of life [1]. These authors contributed equally: M. Schouten, P. Bielefeld *C. P. Fitzsimons c.p.fi[email protected] 1Neuroscience Collaboration, Swammerdam Institute for Life Sciences, Faculty of Sciences, Amsterdam Neuroscience, University of Amsterdam, Amsterdam, The Netherlands 2Department of Molecular Cell Biology and Immunology, VU University Medical Center, Amsterdam Neuroscience, Amsterdam, The Netherlands 3Biomedicine Institute of Valencia (IBV), Consejo Superior de Investigaciones Científicas (CSIC), Valencia, Spain 4Cajal Institute, Consejo Superior de Investigaciones Científicas (CSIC), Madrid, Spain 5Institute of Clinical Neuroanatomy, Neuroscience Center, GoetheUniversity Frankfurt, Frankfurt am Main, Germany 6Neurobiology of miRNA Lab, Neuroscience and Brain Technologies Department, Istituto Italiano di Tecnologia, Genoa, Italy 7Center for Psychiatric Neuroscience, Department of Psychiatry, Lausanne University Hospital (CHUV), Lausanne, Switzerland 8Achucarro Basque Center for Neuroscience, Leioa, Spain 9Ikerbasque, The Basque Foundation for Science, Bilbao, Spain 10 University of the Basque Country (UPV/EHU), Leioa, Spain Supplementary information The online version of this article (https:// doi.org/10.1038/s41380-019-0440-2) contains supplementary material, which is available to authorized users. 1234567890();,: 1234567890();,:
There is substantial heterogeneity in the various changes in brain function associated with aging, suggesting that aging proceeds at different rates due to genetic, environmental, emotional and/or physiopathological factors [2]. Among the latter, alterations in circadian glucocorticoid hormones (GC) rhythms are associated with increased allostatic load and may affect normal aging [3–5]. GC are rhythmically released from the adrenal glands in ultradian near-hourly pulses. These ultradian pulses generate characteristic circadian oscillations in circulating GC levels [6,7]. GC oscillations develop after the third week of life in mice [8] and induce cyclic glucocorticoid receptor (GR)‐mediated transcriptional regulation, or gene pulsing, in vitro [9] and also in vivo in the hippocampus [10]. Alterations in GC oscillations are observed in aged mammals, including mice [11] and humans [6]. GC oscillations have been implicated in the regulation of cortical plasticity [12], anxiety-like behavior [13], and the diurnal rhythm of neural stem/precursor cells (NSPC) proliferation in the dentate gyrus (DG) [14]. NSPC in the sub-GZ (SGZ) of the DG proliferate and generate new neurons in the adult hippocampus across the lifespan of most mammals [15–21]. Several studies have documented an age-associated decline in NSPC proliferation, suggesting an age-dependent exhaustion of the NSPC pool [19,22–29]. As adult NSPC proliferation may belimitedtoafinite number of divisions [27], NSPC quiescence could preserve a NSPC pool that contributes to neuroplasticity reserve and preservation of hippocampusdependent cognitive functions during aging [19,30–33]. However, this hypothesis remains controversial and subject to debate [34–37]. In particular, the underlying molecular mechanisms involved are still unknown and require detailed characterization. NSPC dynamically and selectively respond to GC, which strongly inhibit NSPC proliferation [23,38–40]. In mice, GC acting through the GR have direct effects on NSPC differentiation and functional integration within hippocampal circuits [41]. In old rats, adrenalectomy (ADX) increases NSPC proliferation in the hippocampus, whereas lifelong GC reduction increases AHN and prevents age-related memory disorders [23,39,42]. Interestingly, ADX induces a cellular phenotype in the DG that is very similar to the one induced by GR knockdown, i.e., a significant increase in the number of DCX+cells and immature neurons with an ectopic location and multiple primary dendrites, indicating that the GR is of critical importance in the regulation of newbornneuronmaturation[41]. However, ADX is a surgical strategy that will affect all GC-responsive cell types and remove several other adrenal hormones as well, making the identification of a direct link to cell-type specific effects impossible. The effects of GC on adult hippocampal neurogenesis (AHN) are agedependent, as life-long GC suppression from early life onwards does not enhance AHN [43]. Therefore, the relationship between GC, NSPC proliferation and AHN is complex and remains incompletely characterized. Importantly, in young adult mice, NSPC populations exhibit differences in GR expression and response to GC stimulation [41,44,45]. Here, we show for the first time that GC oscillations are associated with the preservation of GR-expressing NSPC populations in the aging DG, suggesting a novel mechanism that controls the maintenance of NSPC in the aging brain and presenting a possible source of neuroplasticity reserve that could be exploited to sustain hippocampus-dependent cognitive functions throughout life. Results GR+NSPC populations persist into old age and decay with different kinetics in vivo NSPC were classified based on the expression of NestinGFP and GFAP [16,46,47]. Specifically, Nestin-GFP +/GFAP+with characteristic radial glia-like morphology were classified as Type-1 cells. Type-2a cells were Nestin-GFP+/GFAP+, with horizontal morphology and Type-2b cells were Nestin-GFP+/GFAP−, also with horizontal morphology. Type-1, -2a and -2b cells were observed in animals of all ages (Fig. S1C–I). The numbers of proliferative NSPC decreased with age in Nestin-GFP mice [27](Fig.S1A,B).Furthermore, extra-sum-of-squares F-testing for best-fit decay curves showed that the total Nestin-GFP+NSPC population decayed exponentially during aging (Fig. S1J). Importantly Nestin-GFP expression was consistent with native Nestin expression over time and was unaffected by aging in individual Type 1 NSPC [27] (Fig. S2A–C). Interestingly, Type-1, -2a, and -2b cells decayed following different patterns. Type-1 and -2a cells decayed linearly, while Type-2b cells followed exponential decay kinetics (Fig. S1K). The volume of the granule zone (SGZ plus granule cell layer (GCL)) did not change significantly with age (Fig. S1J). These data demonstrate that Type-1 and -2a NSPC persist into old age, while Type-2b cells are depleted earlier following an exponential decay. We next characterized GR expression in Type-1, -2a, and-2bcellsin3-to18-month-oldNestin-GFPmice (Fig. 1a–q, Fig. S1L, Fig. S2D). The relative abundances of GR+and GR−populations of Type-1, -2a, and -2b cells changed with age (Fig. S1L), in agreement with previous M. Schouten et al.
Fig. 1 The preservation of NSPC populations is associated with GR expression and age-related changes in the amplitude of circadian CORT oscillations. aRepresentative example of Nestin-GFP+/GFAP+/GR+NSPC with characteristic vertical process and triangular cell-body in the SGZ of the DG. a’The boxed area in A is magnified and channels split and Z-stacked, showing the expression of individual markers. Arrowhead: cell soma. a” The dashed black line shows a transversal cell section. bHistogram of the transversal section in (a”), showing fluorescent intensity signals for DNA (blue), GFP (green), GFAP (black) and GR (red). Representative examples of c–dType-2a/GR+,e–fType-2b/GR+,g–hType-1/GR− ,i–jType-2a/GR − ,andk–lType-2b/GR−NSPC. In all cases cells with intensity value ≥1500 across the nucleus were considered GR+(Fig. S2D). NSPC in the DG of m3, n6, o10, p14, or q18-month-old mice. The boxed areas are shown magnified in the panels below each image. Arrows: Nestin-GFP+/GR−Type1 NSPC; arrowheads: Nestin-GFP+/GR+Type-1 NSPC. Scale bars represent 40 μm(m–q”); 20 μm(a,c,e,g,i,andk); 15 μm(a’,c’,e’,g’,i’,andk’) and 10 μm(a”,c”,e”,g”,i”,andk”). rBest-fit curves and 95% confidence intervals of Type-1 GR+(solid circles) GR−(open circles); sType-2a GR+ (solid triangles) and GR−(open triangles) or (t) Type-2b GR+(solid diamonds) and GR−(open diamonds) cell numbers. Data points indicated by the different shapes are mean ± SEM (n=5 mice, *p<0.05, **p< 0.01, ***p< 0.001, one-way ANOVA) and NSPC population half-lives (t1/2)are indicated in the figures. GR−populations fitted exponential decay curves (p<0.05, F-test, calculated t1/2 =1.02 (Type-1), 3.0 (Type-2a), and 0.9 months (Type-2b) NSPC, respectively). GR+populations fitted linear decay curves (p<0.05, F-test, calculated t1/2 =28 (Type-1), 36 (Type-2a) and 27 months (Type-2b) NSPC, respectively). Best curve fit comparisons are shown in Figure S2F-K. uTime-windows of blood collection. vAM and PM plasma [CORT] at different ages in mice. Bars are mean ± SEM and red circles individual data points (animals) (n=5 mice, *p<0.05, **p<0.01, ***p< 0.001, vs. 3-month-old, one-way ANOVA). Calculated circadian CORT amplitude (black line) vs. wGR+or xGR−Type-1 (red lines), -2a (green lines) and -2b (blue lines) NSPC numbers at different ages in mice Circadian glucocorticoid oscillations preserve a population of adult hippocampal neural stem cells in. . .
studies showing heterogeneous GR expression in NSPC populations in young animals [41,44,48]. At 3 months of age, most Type-1 and -2a cells were GR+, whereas the majority of Type-2b cells were GR-at this age. However, from 6 months of age on, GR+cells predominated in all NSPC populations. This predominance of GR+NSPC populations persisted throughout middle and into old age (Fig. S1L). Thus, a marked depletion of GR−NSPC takes place in DG earlier than anticipated from previous studies [44]. Interestingly the decay of GR−NSPC populations fitted best to an exponential decay, while the decay of GR +populations fitted best to a linear model (Fig. 1r–t, Fig. S2F–K). The predominance of GR+NSPC populations correlates with an age-associated increase in the amplitude of circadian GC oscillations in vivo Corticosterone (CORT) concentrations were measured in plasma samples collected at AM (08:00, lights on) and PM (20:00, lights off), representing the nadir and the peak of circadian GC oscillations, respectively (Fig. 1u). CORT AM levels remained stable with age, while PM peak levels were increased in all age groups compared to 3-month-old mice (Fig. 1v), indicating an age-associated increase in the amplitude of circadian GC oscillations that correlated negatively with the numbers of GR−NSPC (Fig. 1w, x and Fig. S3). Disruption of circadian GC oscillations in young mice induces NSPC to enter a reversible non-proliferative cellular state in vivo One-week-long subcutaneous implantation of CORT pellets suppressed GC oscillations and proliferation in the mouse DG (Fig. 2and Fig. S4A), in agreement with previous reports [49]. We observed that low-dose CORT pellets (12.5 mg/kg/day) were able to fix blood [CORT] to PM peak levels, while high-dose pellets (25 mg/kg/day) induced supra-physiological blood [CORT] (Fig. 2i). Ki67+Type-1, -2a, and -2b NSPC populations were detected in 3-monthold mice with oscillating GC levels, but were not observed in mice of the same age implanted with CORT pellets (12.5 and 25 mg/kg/day) (Fig. 2j). Cell proliferation was reinstated in all NSPC populations 2 days after removal (2-day recovery, Fig. 2j) of the CORT implant and was significantly increased in Type-1 cells as compared to vehicle control groups (Fig. 2j). As the implantation of high-dose CORT pellets (25 mg/kg/day) did not result in stronger inhibition of NSPC proliferation as compared to low-dose ones (12.5 mg/kg/day) (Fig. 2j), low-dose pellets (12.5 mg/ kg/day) were used in the rest of the experiments. These data indicate a dynamic proliferative response of Type-1 NSPC to the disruption of GC oscillations. GR reduction in old mice reactivates proliferation of Type-1 NSPC in vivo To characterize the role of the GR on Type-1 cell proliferation in old mice, we used two separate experimental approaches to reduce GR expression. The first approach consisted of a partial genetic inactivation of the GR using a split-Cre system designed for in vivo targeting of Type-1 cells specifically [50] in heterozygous floxed Nr3c1 (GRfl/wt) mice [51], (Fig. S4B and “Experimental Procedures”). Secondly, we used a siRNA-mediated reduction of GR expression with previously described siRNAs [41] injected into the DG as described in ref. [52] (Fig. S4C–L). Cells expressing the full Cre-recombinase were visualized using a lentiviral vector expressing a Cre-reporter construct containing a floxed STOP cassette upstream of the enhanced green fluorescent protein (EGFP) gene [53]. Cre-induced recombination in homozygous floxed Nr3c1 (GRfl/fl) mice completely abolishes GR expression, while GR expression is only partially reduced in GRfl/wt mice [54], allowing for a better comparison with a siRNA-mediated GR knockdown. Using the split-Cre system (Fig. S4B) we targeted proliferative (Ki67+) and nonproliferative (Ki67−) Type-1 NSPC in 12-month-old mice (Fig. 3a–c). We found a fourfold increase in proliferative EGFP+Type-1 NSPC in GRfl/wt mice compared to GRwt/wt controls (Fig. 3d). In control experiments using Nestin-GFP mice, we found that GFP+Type-1 cells readily took up Cy3-labeled siRNAs (Fig. S4I–L) and downregulated GFP expression after injection with siRNAs against GFP (Fig. S4C–H). We subsequently used siRNA injections to reduce GR expression in 20-month-old Nestin-GFP mice. siRNA-mediated GR knockdown resulted in a significant increase in the number of Ki67+Type-1 NSPC, as compared to contralateral control hemispheres injected with negative control non-targeting siRNA (Fig. 3e–h). Type-1 cells present morphological heterogeneity and can be sub-classified into Type-1αcells, that display a long radial process extending into the inner molecular layer, and Type-1βcells, with a short radial process that does not reach the molecular layer (Fig. 3i), which predominate in 8-month-old and older mice [55]. Starting at 10 months of age the vast majority of Type1 cells we found in the DG were GR+(Fig. 1r, s; Fig. 3j). In 14-month-old and older mice Type-1αcells were practically nonexistent, as described before [27,55], resulting in a marked predominance of Type-1βcells (Fig. 3j), which were all GR+. Reduction of GR expression using genetic (Fig. 3a, c) or siRNA-mediated approaches (Fig. 3e, g) in 12 or 20-month-old mice, respectively, had no apparent effect on Type-1βcell morphology. Overall, these results show that GR reduction in middleaged and old mice results in Type-1βNSPC reactivation in vivo. M. Schouten et al.
Circadian glucocorticoid oscillations preserve a population of adult hippocampal neural stem cells in. . .
Primary hippocampal NSPC express the GR and enter a reversible quiescent cellular state after GC treatment in vitro Primary hippocampal NSPC cultures have been previously used to model and examine the direct effects of GC on NSPC [41,56]. In these cultures, as in vivo in 3-month-old Nestin-GFP mice, we found mixed GR+and GR−NSPC populations, with GR+NSPC numerically predominating (Fig. 4a, b). CORT and the specific GR agonist dexamethasone (DEX) reduced the rate of NSPC proliferation as assessed by expression of Ki67 in NSPC cultures, in a dose-dependent manner (Fig. 4c, d). In agreement with their relative affinities for the GR [57], DEX was ~10 times more potent than CORT in its effect on proliferation (IC50 = 5.8 × 10−9M, maximum effect reached at 1 × 10−7M vs. 8.3 × 10−8M, maximum effect reached at 1 × 10−6M, DEX and CORT, respectively). Incubation with both GR agonists resulted in a significant reduction in the number of Ki67+ NSPC, leaving ~20% NSPC unaffected (Fig. 4d, e), in agreement with the relative abundance of GR−populations in our NSPC cultures (Fig. 4a, b). The inhibitory effect of CORT was maximal after 72 h of incubation and was reverted 24 h after CORT washout (Fig. 4e). These results indicate that exposure of NSPC to CORT induces a reversible inhibition of NSPC proliferation compatible with cellular quiescence, supporting our observations in vivo (Figs 1–3). GC oscillations regulate NSPC cell cycle progression in vitro We applied a previously described method to model GC oscillations in vitro [9,58] in which NSPC were treated with pulses (30 min each) of 1 × 10−6M CORT, mimicking the daily CORT peak levels observed in 3-month-old mice (Fig. 1v) or vehicle. To study in more detail the responsiveness of the cell cycle to GC oscillations modeled in NSPC cultures, we applied this pulsatile treatment for intervals of 12 h interspaced with 12 h-long hormone free periods (Fig. S4N, O) for a total of 72 h, a time when the inhibitory effect of CORT on cell proliferation was maximal (Fig. 4e). Cell cycle was analyzed in fixed NSPC using flow cytometry with propidium iodide DNA staining. Oscillatory CORT treatment was compared to continuous stimulation with 1 × 10−6M CORT (Fig. 4f–h, Fig. S4N, O, Fig. S5 and “Experimental Procedures”), as described [9]. Incubation with oscillatory CORT resulted in a significantly smaller percentage of NSPC in the G0/G1 phase of the cell cycle (Fig. 4f), suggesting that CORT oscillations maintain cell cycle entry and progression in NSPC in vitro. Interestingly, the inhibitory effect of continuous CORT incubation on the cell cycle was largely reversed 24 h after CORT washout (recovery, Fig. 4g), in agreement with the transient inhibition of cell proliferation presented in Fig. 4e. Continuous treatment had no significant effects on Hes5 expression, neither after 72 h of treatment nor after 24 h CORT washout (recovery) (Fig. 4i, j). Oscillatory treatment resulted in a transient upregulation of Hes5 72 h after treatment, which disappeared after recovery (Fig. 4i, j), suggesting that the GC treatments did not permanently affect NSPC multipotency, as measured by the expression of Hes5, a marker of multipotent adult NSPC [59]. Overall, these observations in vitro, support the hypothesis that exposure of NSPC to GC oscillations maintain cell cycle entry and proliferation. Next, we modeled the differences in the amplitude of GC oscillations observed in vivo in young vs. old mice (Fig. 1v) by comparing the effects of oscillatory treatment with 1 × 10−6M CORT (young mice) with oscillatory treatment with 2 × 10−6 M CORT (old mice) in vitro. We found that the effects of oscillatory treatment with 2 × 10−6M CORT on the cell cycle in NSPC was indistinguishable from that of oscillatory treatment with 1 × 10−6M CORT (Fig. S5C, D), indicating that GC amplitudes that fully activate the GR result in similar effects on the cell cycle in NSPC. These results suggest that the increased Fig. 2 Disruption of GC oscillations in 3-month-old Nestin-GFP mice induces reversible NSPC quiescence. aRepresentative example of Nestin-GFP (green), GFAP (white) and Ki67 (red) immunoreactivity in the DG of 3-month-old Nestin-GFP mice. The boxed area shows a cluster of Nestin-GFP+/GFAP+/Ki67+NSPC. bMagnification of area boxed in (a). b’Same area further magnified with channels split and Zstacked, showing the expression of individual markers. Arrow: cell soma. b”The dashed white line shows a transversal cell section. c Histogram of the transversal section in (a”), showing fluorescent intensity signals for DNA (blue), GFP (green), GFAP (black), and Ki67 (red). Representative Z-stacked confocal images of NSPC in the DG of mice treated for 7 days with d0, e12.5, f25 mg/kg/day [CORT] pellets or allowed to recover for 2 days after removal of a g 12.5 and h25 mg/kg/day [CORT] pellet. Arrows: Type-1 cells; arrowheads: Type-2a/2b cells. Scale bars represent 20 μm(a,band d, h), 15 μm(b’) and 10 μm(b”). iAM and PM plasma CORT levels after the treatments indicated in the graph legends. Bars are mean ± SEM [CORT] and red circles individual data-points (animals). Statistical comparisons were done using one-way analysis of variance test with Tukey’s post hoc test for multiple comparisons (n=4 mice, ***p<0.001, AM vs. PM in 0 mg/kg/day, ns p>0.05, AM vs. PM in both 12.5 and 25 mg/kg/day and after 2 day recovery; #p<0.001, 25 mg/kg/day AM and PM vs. 0 mg/kg/day AM and PM, respectively; $p<0.05, 25 mg/kg/day AM and PM vs. 12.5 mg/kg/day AM and PM, respectively; §p< 0.001, both AM and PM in 12.5 and 25 mg/kg/day vs. 2-day recovery). jPercentages of Ki67+(full bars and full circles) or Ki67−(dashed bars and open circles) of Type-1 (red), −2a (green) and −2b (blue) NSPC, 7 days postimplantation with 0, 12.5, 25 mg/ kg/day [CORT] pellets and 25 mg/kg/day [CORT] +2-day recovery. Ki67+NSPC were not observed in animals treated with [CORT] 12.5 and 25 mg/kg/day. Bars are mean ± SEM and circles individual data points (animals) (n=4 mice, *p< 0.05, ***p< 0.001, vs. 0 mg/kg/ day, one-way ANOVA or ###p< 0.001, 7-day treatment vs. 7-day treatment +2-day recovery with the same [CORT], one-way ANOVA). Further information in Fig. S4A. ML molecular layer, SGZ subgranular zone, GCL granule cell layer M. Schouten et al.
Fig. 3 GR knockdown in 12 and 20-month-old mice recovers Type-1 NSPC proliferation. aRepresentative confocal images of GFP+ radial glial-like Type-1 NSPC (arrowheads) in 12-month-old (top) GRwt/wt and (bottom) GRfl/ wt mice 6 dpi with split-Cre lentiviruses (further details in Fig. S4B). bNumbers of GFP+ cells per hippocampus in GRwt/wt and GRfl/wt animals. Bars are mean ± SEM GFP+cells per hippocampus of individual mice (red circles) (n=4 mice, ns p> 0.05, GRwt/wt vs. GRfl/wt, Student’sttest). cRepresentative confocal Zstacked image and orthogonal projection of GFP+/Ki67+cells with a radial glial-like morphology (arrowheads) in GRfl/wt mice. dRelative numbers of Ki67+(full bars and full circles) or Ki67−(dashed bars and open circles) Type-1 cells 6dpi with lentiviruses in GRwt/wt and GRfl/wt animals. Bars are mean) ± SEM and circles individual mice (n=4 mice, *p< 0.05, GRwt/wt vs. GRfl/wt, one-way ANOVA). eRepresentative confocal Zstacked image and orthogonal projections of Nestin-GFP+/GFAP+/GR+Type-1 NSPC 3 dpi with GR (siGR) or negative control (siNC) siRNAs (further details in Fig. S4C–H). fGR expression in Type-1 cells 3 dpi with siNC (full bar and open circles) or siGR (dashed bar and open circles). Bars are mean ± SEM GR intensity (gray value) and circles individual mice (n=6 mice, ***p< 0.001, siNC vs. siGR, Student’sttest). gTop: Nestin-GFP (green), Ki67 (red) and GFAP (white) immunoreactivity in Type-1 cells 3 dpi with siNC or siGR. Bottom: higher magnifications and orthogonal projections of the areas boxed in the top panels. hRelative numbers of Type-1 Ki67+(full bars and full circles) or Ki67− (dashed bars and open circles) cells 3 dpi of siNC or siGR. Bars are mean ± SD and circles individual mouse hemispheres (n=6 mice, **p< 0.01, siNC vs. siGR, one-way ANOVA). iRepresentative examples of Nestin-GFP+ Type-1αand Type-1βradial glia-like cells found in 3-month-old mice. jBest-fit curves and 95% confidence intervals of Type-1α (squares) and Type-1β(circles) numbers vs. age in mice. Data points are mean ± SEM of five mice (n=5, **p< 0.01, ***p< 0.001, vs. 3-month-old, one-way ANOVA). Type-1αand -1βcells fitted best to exponential or linear decay curves, respectively (p<0.05, F-test, calculated t1/2 =3.4 and 27.8 months, Type-1α and -1β, respectively). Scale bars =15 μm (a,f,h,j). ML molecular layer, SGZ subgranular zone, GCL granule cell layer Circadian glucocorticoid oscillations preserve a population of adult hippocampal neural stem cells in. . .
M. Schouten et al.
GC amplitude associated with aging in mice after 3 months of age would not result in stronger effects on the cell cycle in NSPC. We next questioned whether the total daily CORT exposure (TDC), which differed between oscillatory and continuous treatments (Fig. S5A, B), could partially explain the effect of GC oscillations on the cell cycle in NSPC. To approach this question experimentally we incorporated two new GC treatments to our experimental design: nonoscillatory incubation with 0.25 × 10−6MCORTand circadian-only oscillations (12 h on, 12 h off, no ultradian pulses) with 1 × 10−6M CORT. We found that continuous incubation with 0.25 × 10−6M CORT and oscillatory incubation with 1 × 10−6M, which deliver the same TDC calculated as the area under the curve [60,61], but differ in their oscillatory pattern (Fig. S5B), resulted in different effects on the cell cycle of NSPC in vitro (Fig. S5C). Continuous incubation with 0.25 × 10−6M CORT induced a significant increase in the percentage of cells in the G0/G1 phase, and a concomitant decrease in the percentage of cells in the S phase, compared to oscillatory 1 × 10−6M CORT (Fig. S5D). Similarly, circadian-only oscillations with 1 × 10−6M CORT and oscillatory incubation with 2 × 10−6M CORT, which deliver the same TDC, had significantly different effects on the cell cycle in NSPC (Fig. S5B–D). Interestingly, circadianonly oscillations with 1 × 10−6M CORT had different effects on the cell cycle than oscillatory incubation with 1 × 10−6M CORT (Fig. S5C, D). Of note, oscillatory treatment with 1×10 −6MCORTor2×10 −6M CORT had similar effects on the cell cycle in NSPC, even when their TDCs were significantly different (Fig. S5D). Finally, the effects of vehicle treatment and continuous incubation with 1 × 10−6M CORT were significantly different from all the other treatments and the latter had the most profound effects on the cell cycle in NSPC (Fig. S5C, D). Together, these results indicate that circadian and ultradian oscillation have different effects on the cell cycle in NSPC and that the oscillatory CORT pattern, not the TDC, is responsible for these effects. To further address the relevance of GC oscillations on NSPC proliferation, we compared the effects of oscillatory incubation with 1 × 10−7M and 1 × 10−6M CORT, which represent ~50 and 100% of the maximal effect of CORT on NSPC proliferation (Fig. 4d, f), on the expression of Sgk-1, a serine/threonine kinase involved in the inhibition of NSPC proliferation by GC [56]. As described by Anacker et al. [56], continuous incubation with 1 × 10−6M CORT induced a significant upregulation of Sgk-1 (Fig. S5E), in agreement with its strong effects on the cell cycle (Fig. 4f). In contrast, we found that oscillatory 1 × 10−6M CORT induced a significant downregulation of Sgk-1 in agreement with its weaker effects on the cell cycle (Fig. 4f), while oscillatory 1×10 −7M CORT failed to downregulate Sgk-1 (Fig. S5E). Overall, these results indicate that full GR activation during ultradian GC oscillations delivers a biological signal to NSPCs that is independent of the TDC. Next, we asked whether continuous or oscillating CORT incubations have lasting effects on NSPC responsiveness to CORT. To evaluate this possibility, we exposed NSPC cultures to continuous or oscillating CORT for 72 h, removed CORT from the culture medium for 18 h and then reinitiated CORT treatment (Fig. S4N). This design was based on a population doubling time of 17.8 ± 0.1 h in our NSPC cultures, similar to previous observations in vivo [62], indicating that 18 h after CORT removal NSPC Fig. 4 CORT oscillations induce a reversible inhibition of cell proliferation and conserve the responsiveness of NSPC proliferation to CORT exposure in vitro. aNuclear GR+/Ki67+(arrowhead) and nuclear GR−/Ki67−(arrow) in primary hippocampal NSPC cultures. Nuclei are indicated by the presence of DNA. bRelative abundances of GR+(full bars and full circles) and GR−(dashed bars and open circles) NSPC in vivo in 3-month-old Nestin-GFP mice and in vitro NSPC cultures. Bars are relative mean of individual data-points (circles) (% of total NSPC in vivo or in vitro) ± SEM, (n=5 or 3 biological replicates respectively, p> 0.05, GR+/GR−NSPC in vivo vs. in vitro, one-way ANOVA with Tukey’s post hoc test). cDosedependent reduction in Ki67+cells (green) in NSPC cultures exposed to CORT or vehicle for 72 h. Cell nuclei (DNA) are shown in blue. Scale bars =50 μm(a,c). dCORT (black circles) or dexamethasone (DEX; black triangles) dose–response curves. Data are mean normalized proliferative Ki67+cells (% of vehicle) ± SEM, (n=3 biological replicates, **p< 0.01 on logIC50 of best-fitted curves, F-test). eTime-dependent effect of 1 × 10−6M CORT on NSPC proliferation (Ki67+cells), and the effect of a 24 h washout period, (n=3, *p< 0.05 and **p< 0.01 unpaired two-tailed Student’sttest). Bars are mean of individual data-points (red circles) ± SEM. Effect on cell proliferation of (f) 72 h vehicle, oscillating or continuous 1 × 10−6M CORT; g72 h vehicle, oscillating or continuous 1 × 10−6M CORT followed by a 24 h washout period (recovery) or h72 h vehicle, oscillating or continuous 1 × 10−6M CORT, a 24 h recovery followed by incubation with 1 × 10−6M CORT (pulse). All data are average percentages of total cell populations per cell cycle phase compared with their corresponding vehicle treatment (n=3, *p< 0.05, **p< 0.01 and ***p< 0.001, one-way ANOVA) or continuous vs. oscillating CORT #p< 0.05, ##p< 0.01, and ###p< 0.001 one-way ANOVA). Changes in multipotency marker Hes5 expression induced by oscillating (gray bars) or continuous CORT (black bars) i72 h or j72 h followed by a 24 h washout period (recovery). Data are mean normalized fold change expression (relative to vehicle) of individual data points (red circles) ± SEM (n=4 biological replicates, *p<0.05 relative to vehicle, one-way ANOVA with Tukey’s post hoc test). hHeatmap showing 4767 vehicle normalized differentially methylated gene promoters (72 h of oscillating vs. continuous CORT, MBD2 read density difference ≥3). Bars to the right of the heatmap are, green: hypermethylated; red: hypomethylated; pink: stably hypermethylated; blue: stably hypomethylated gene promoter clusters (oscillating vs. continuous CORT, MBD2 read density difference ≥3). Changes in DKK3, GSK3β, CCND1, and β-catenin expression induced by oscillating (gray bars) or continuous CORT (black bars) l 72 h or m72 h followed by a 24 h washout period (recovery). Data are mean normalized fold change expression (relative to vehicle) of individual data points (red circles) ± SEM (n=4 biological replicates, *p<0.05, **p<0.01, and ***p<0.001 relative to vehicle; #p<0.05, ##p<0.01, and ###p<0.001 relative to oscillating CORT, one-way ANOVA with Tukey’s post hoc test). All in vitro experiments were run in triplicates and were repeated three times (n), unless indicated Circadian glucocorticoid oscillations preserve a population of adult hippocampal neural stem cells in. . .
observations regarding the lasting effects on DNA methylation in NSPC in vitro suggest that GC oscillations may preserve certain components of the Wnt signaling pathway within a controlled expression range. Therefore, an exhaustive functional characterization of the regulation of Wnt signaling by GC oscillations and its possible consequences for other cellular processes such as cellular differentiation in NSPC warrants further investigation. The use of accelerated senescence models, such as the SAMP8 mouse strain, provides an experimental alternative to the use of aged wild-type mice [101]. We found that AM and PM CORT levels were significantly elevated in untreated SAMP8 mice, supporting their use as model of circadian rhythm disturbances associated with pathological aging [74]. Disruption of circadian GC oscillations in SAMP8 mice induced by CORT pellet implantation was associated with lasting morphological changes in newborn neurons generated from NSPC at the time of pellet removal, as indicated by retroviral birth-dating. These morphological changes included increased dendritic complexity, spine numbers and relative numbers of immature spines, with seemingly opposite effects in control SAMR1 mice. The reduced complexity of newborn granule neurons we observed in SAMP8 is compatible with a delayed development of newborn neurons observed in the aging hippocampus [102] and with a GR-mediated regulation of newborn neuron development in the adult hippocampus [41]. The differences observed between SAM strains after disruption of GC oscillations may suggest the presence of alterations in endogenous GC levels in SAMP8 mice that affect the structural plasticity of newborn neurons in the adult hippocampus [95]. Recently, the concept of stress-induced stem cells has been introduced. This conceptualization proposes that the effects of stress on stem/progenitor cells in young individuals may predispose to disease later in life, affecting the renewal and regenerative potential of several tissues, thereby contributing to the development of metabolic and mental diseases [103]. In agreement with this idea, alterations in GC oscillations induced by severe physiological or psychological stress during aging may contribute to the effect of GC on NSPC and AHN [79,104–107]. Moreover, recent data indicate that AHN confers resilience to chronic stress by inhibiting the activity of mature granule cells in the ventral DG112. Although the sustained presence of AHN in the aging human brain remains challenged by contrasting observations, most reports indicate a substantial decrease with age, albeit at different rates [17–20,108]. Indeed, an age-associated exhaustion of the NSPC pool may explain some of the interindividual variations in cognitive and emotional states and resilience to stress-associated diseases related to aging [27,109–112]. Importantly, recent observations have provided new and compelling evidence for the presence of AHN in the aged human hippocampus [33], suggesting that our observations could have implications for the understanding of human brain aging. In conclusion, our results indicate that GR expression and GC oscillations contribute to the preservation of distinct quiescent NSPC subpopulations during aging in vivo, providing a suitable mechanism for the aging-associated decline in AHN and highlight that a GC-controlled structural plasticity reserve remains available in the senescent brain. Methods Animal cohorts, CORT measurements, immunohistochemistry, and confocal microscopy All animal procedures were approved by the Commission for Animal Welfare, at University of Amsterdam, Diputación Foral de Bizkaia and CSIC Madrid and were performed following EU regulations. Male 3, 6, 10, 14, and 18-month-old Nestin-GFP transgenic mice [113](n=5per group) were used for experiments. These time points were selected based on startand end-points of previously defined life-phases (mature adult, middle age, and old) in mice [114]. Mice were housed under standard laboratory cage conditions and kept under 12 h light/dark cycles (lights on at 08:00, lights off at 20:00) with ad libitum access to food and water. At weaning, all animals used were randomly allocated to the different experimental groups once their genotype/phenotype was established. At the indicated ages, tail blood was collected in a stress-free manner in ice-cold EDTA-coated tubes (Sarstedt, Ettenleur, The Netherlands) at 20:00 (PM) the night before and at 08:00 (PM) on the morning of perfusion, as described before [115]. Samples were kept on ice and subsequently centrifuged at 13,000 rpm for 15 min, blood plasma was stored at −20 °C. AM and PM plasma CORT levels were measured using a commercial radioimmunoassay kit (MP Biomedicals, Eindhoven, The Netherlands) as described before [115]. Animals were transcardially perfused at the indicated ages at 08:00 ± 0.3 h (Fig. 1u) with 4% paraformaldehyde in phosphate buffered saline (PBS) and brains were extracted, sectioned in 8 series of 40 μm-thick slices, ensuring a 280 nm separation between series used for individual inmunostainings as described before [41], using the following antibodies: polyclonal chicken anti-GFP (Abcam, 1:500), monoclonal mouse anti-GFAP (Chemicon, 1:1000) and polyclonal rabbit anti-GR (H300 Santa Cruz, 1:100) or polyclonal rabbit anti-Ki67 (Abcam, 1: 1000) in combination with goat anti-chicken Alexa488 (Invitrogen, 1:500), goat anti-mouse Alexa647 (Invitrogen, 1:500), and goat anti-rabbit Alexa568 (Invitrogen, 1:500), respectively. Proliferating cell nuclear antigen (PCNA) and M. Schouten et al.
5-mC stainings required antigen retrieval, which was performed by heating brain sections in 0.1 M citrate buffer (pH 6.0) in a standard microwave (Samsung M6235) to a temperature of approximately 95 °C for 15 minutes (5 min at 800 W, 5 min at 400 W and 5 min at 200 W). Antibodies used were monoclonal mouse anti-PCNA (DAKO, 1:400) and monoclonal mouse anti-5-mC (Eurogentec, 1:500) in combination with goat anti-mouse Alexa647 (Invitrogen, 1:500) and if applicable combined with rabbit anti-GFAP (DAKO, 1:500) in combination goat anti-rabbit Alexa568. For the retroviral experiment stainings the following antibodies were used: polyclonal chicken anti-GFP (Abcam, 1:500), monoclonal mouse anti-NeuN (Chemicon, 1:1000) and polyclonal rabbit anti-GFAP (DAKO, 1:500) or polyclonal chicken anti-GFP (Abcam, 1:500), monoclonal mouse anti-NG2 (Millipore, 1:100) and polyclonal rabbit anti-Iba1 (Wako, 1:1000) in combination with goat antichicken Alexa488 (Invitrogen, 1:500), goat anti-mouse Alexa647 (Invitrogen, 1:500), and goat anti-rabbit Alexa568 (Invitrogen, 1:500), respectively. Sections were counterstained for DNA using Hoechst (Invitrogen. 1:20,000) to detect cell nuclei. Confocal microscopy was performed as described before using a Zeiss LSM510 laser scanning microscope [41]. Z-plane optical sectioning ranged from 150–500 nm. Hippocampal NSPC populations were quantified in the SGZ and GCL hereafter referred to as granular zone (GZ) and were either expressed in absolute numbers per mm3GZ or in relative percentages of the total NSPC subpopulation. Staining intensity histograms were obtained from single confocal Z-planes using ImageJ, using the same imaging conditions for young and old animals. Generation of best-fit curves, population half-life calculations, correlations, and statistical analysis Nonlinear (exponential decay) best-fit curves (N(t)=N0e−κt +N0with Nas number of cells in cells/mm3GZ, tas time in months and κas the decay rate constant as a decimal) or linear (first order polynomial) decay curves (N(t)=N0−λt with Nas number of cells in cells/mm3GZ, tas time in months and λas the slope in cells/mm3month−1), including their 95% confidence intervals were plotted on the numbers of (GR+and GR-) Type-1 and Type-2 NSPC using Graphpad Prism 5.0 software. Non-linear (exponential) decay curves were tested for a significantly better fit than linear (first order polynomial) decay curves using an extrasum-of-squares F-test and were considered significantly different if the F-test reached a p< 0.05. Subsequently, depending on the aforementioned extra-sum-of-squares F-test results, half-lives (or t1/2) were calculated for the either exponential (t1/2 =ln(1/2)/κ) or linear (t1/2 =N3/2/λ) curves from GR+and GR−Type-1 and Type-2 NSPC. For CORT concentrations versus NSPC population correlations a Pearson correlation analysis was used and were subsequently tested for significant deviation from a slope of 0 and were considered significantly different if p< 0.05. Graphpad Prism 5 software was used for the generation of best-fit curves and Pearson correlation analysis. Subcutaneous pellet implantation experiments CORT levels were manipulated using slow release biodegradable carrier-binder pellets to various daily concentrations (vehicle, 12.5 mg/kg/day and 25 mg/kg/day, n =4 per experimental group; Innovative Research of America), as described by others [60], albeit with some modifications. Pellets were implanted subcutaneously between the shoulder blades of Nestin-GFP animals under isoflurane anesthesia at 08:00 h on experimental day 1. When indicated, pellets were removed under isoflurane anesthesia at 08:00 h on experimental day8. PM and AM plasma CORT concentrations were determined on day 7/8 or 3 days after pellet removal (recovery group) on day 9/10 (Figure S4A). Immunohistochemical analysis was performed on 4 animals per experimental group, as described in the corresponding section. Stereotactic split-Cre lentiviral injections in 12month-old GR floxed animals Heterozygous transgenic mice with loxp sites flanking NR3C1 (GR) exon2 [51](herenamedGR fl/wt), where purchased from The Jackson Laboratory (strain B6.129S6-Nr3c1tm2.1Ljm/J) and where compared to their wild-type littermates (here named GRwt/wt). Lentiviral-mediated GR knockout experiments were performed on 12-month-old male GRfl/wt or GRwt/wt mice. Animals were genotyped as described before [51], (Figure S4B). To induce recombination, a split-Cre lentiviral approach with the N-terminus of Cre under the expression of the GFAP promoter and the C-terminus of Cre under the Prominin1 promoter was used as previously described [50]. Linker structures on both termini enabled a functional Cre-recombinase and NSPC recombination was detected with a lentivirus expressing a floxed dsRED +STOP codon which upon recombination expresses eGFP [53]forwhichaspecific anti-GFP staining was performed. 1.5 µl of a 1:1:1 ratio of these three lentiviruses were stereotactically delivered into the DG (anterior-posterior: −2.0, medial-lateral: ±1.5, dorsalventral: −2.0). 6 dpi 4 GRfl/wt and GRwt/wt animals were sacrificed. Native RFP and GFP signal was undetectable and we thus stained specifically for GFP to visualize cells with a radial glial-like Type-1 NSPC morphology expressing both Cre termini in combination with Ki67 to Circadian glucocorticoid oscillations preserve a population of adult hippocampal neural stem cells in. . .
assess levels of proliferation, as described in the corresponding sections. Stereotactic siRNA injections in Nestin-GFP mice For siRNA-mediated GR knockdown experiments, 20-monthold male Nestin-GFP mice underwent stereotaxic surgery, delivering 1 µl of a 40 µM mixture of 4 previously validated [41] siRNAs (FlexiTube GeneSolution, Qiagen, CAGACTCA GCATGGAGAATTA, AAGCGTGATGGACTTGTATAA, CAGTGGTGCGATAGCAACAAA, AAGGAAGGTCTGA AGAGCCAA) against the mouse GR (Nr3c1, Entrez gene ID: 14815) into the left DG or negative control siRNA (target sequence: AATTCTCCGAACGTGTCACGT; Qiagen) into the contralateral DG (anterior-posterior: −2.0, medial-lateral: ±1.5, dorsal-ventral: −2.0). Seventy-two hours after siRNA infusion, 6 animals were sacrificed by transcardial perfusionfixation, brains were extracted and processed for immunohistochemistry as described in the corresponding section. Similarly, for naked siRNA uptake verification, male Nestin-GFP mice (n=3) underwent the same procedure in which negative control Cy3-labeled siRNA (siNCCy3; Allstars negative control siRNA; Cat. No. SI03650318, Qiagen) was delivered. These animals were sacrificed 24 h after (1 dpi) siRNA infusion as described above. For naked siRNA knockdown validation, male Nestin-GFP mice (n=3) were injected with siNC (Allstars negative control siRNA; Cat. No. SI03650318, Qiagen) and siRNA directed against GFP (positive silencing control GFP-22 siRNA, Cat. No. 0001022064, Qiagen). Naked siRNA knockdown validation animals were sacrificed 3 dpi. After brain slices were obtained, they were stained for DNA using Hoechst and native GFP and Cy3 colocalization or native GFP intensity levels were measured using the Zeiss LSM510 confocal as described in the corresponding section. Retrovirus production RV-GFP was done as described before [116]. HEK293T cells were co-transfected with pCAG-GFP, pCMV-GP, and pCMV-VSV-G (3:2:1) plasmids by calcium-phosphate precipitation. The media containing retrovirus was collected 48 h after transfection. Cell debris was removed from the supernatant by centrifugation at 3200×gfor 10 min and filtration through a 0.22 μmfilter. The retrovirus was concentrated by ultra-centrifugation at 160,000×gfor 2 h (Sorvall WX Ultracentrifuge and SureSpin 630 swinging bucket rotor; Thermo Fisher Scientific, Waltham, MA, USA). The retroviral pellet was resuspended in 200 μl phosphate buffered saline (PBS; Sigma-Aldrich, St. Louis, MO, USA), aliquoted and stored at −80 °C. The titer was at 105colony forming units. CORT pellet implantation and retrovirus-GFP labeling of newborn cells in SAMP8 and SAMR1 mice 4-month-old male senescence-accelerated mouse-prone 8 (SAMP8) and control senescence-accelerated mouseresistant 1 (SAMR1) mice received subcutaneous 12.5 mg/kg/day CORT and control pellets as described above for 7 days. Subsequently pellets were removed and the animals were allowed to recover for 2 days before they underwent stereotaxic injection of 1.5 μl of a retrovirus suspension prepared as described in the previous section. 28 dpi of the retrovirus mice (n=4 per group) were sacrificed by transcardial perfusion-fixation, brains were extracted and processed for immunohistochemistry as described in the corresponding section. Another cohort of SAMR1 and SAMP8 animals was sacrificed either at day 7 after pellet implantation, or at day 9, 2 days after pellet removal without receiving retroviral injections to assess hippocampal Ki67 expression. The GFP signal from RVGFP+/NeuN+/Iba1−/NG2−cells was traced using ImageJ and Sholl analyses were performed as described before [41]. Furthermore, from RV-GFP+/NeuN+/Iba1−/NG2newborn cells the spine density and morphology analyses were performed in using the software package Neuron Studio on secondary/tertiary dendritic segments, as described before [41]. Cell culture, CORT treatments, and CORT measurements Primary hippocampal NSPC cultures were prepared and maintained in culture flasks in DMEM/F-12 medium supplemented with 5% charcoal-stripped fetal bovine serum (FBS, Atlanta Biologicals), N2 supplement, (Invitrogen), bovine pituitary extract (BPE, Invitrogen), recombinanthuman-EGF (20 ng/mL, Sigma) and recombinant-humanFGF (10 ng/mL, Sigma), as described before [41]. NSPC were seeded the day before the start of the treatments. CORT (corticosterone, Sigma-Alrdich) was dissolved in (vehicle) and added freshly to NSPC medium to a final concentration of 1 × 10−6M (except stated otherwise) prior to incubation. CORT oscillations were modeled in vitro as previously described [58]. Briefly, pulsatile treatment consisted of 30-min long incubation with either vehicle or CORT, interspaced with 30 min-long incubations with hormone-free medium, mimicking CORT ultradian pulses. NSPC were exposed to this pulsatile treatment for 12 h, followed by a 12-h long incubation with hormone-free medium, to model circadian oscillations. The continuous CORT condition consisted of 30 min-long cycles of incubation with CORT for 24 h, without interspaced hormonefree periods (Fig. S4N, O). Additional groups consisted of M. Schouten et al.
pulsatile treatment with 2 μM CORT, continuous 0.25 μM CORT, and 1 μM CORT for 12 h followed by 12 h hormone-free periods to mimic circadian rhythmicity (see also Fig. S5A, B). Starting after a 72 h initial treatment, the washout period (recovery) consisted of a 24 h-long incubation with hormone-free medium. When indicated, NSPC were treated during the last 6 h of the washout period with 10−6M CORT or vehicle, to model the effects on further exposure to CORT. Treatment schemes are depicted in Fig. S4N. Efficient washout and stability of CORT during the experiment (Fig. S4O) was analyzed by collecting samples every 30 min during both oscillating and continuous CORT treatment and CORT concentrations were determined using a commercial radioimmunoassay kit (MP Biomedicals, Eindhoven, The Netherlands) as described above. Immunocytochemistry Immunocytochemistry was carried out as described before [41]. Briefly, cells were rinsed three times with PBS and fixed in 4% PFA in PBS for 30 min. The fixative was then removed and cells were rinsed three times for 5 min with PBS. For detection of proliferation, cells were blocked in blocking buffer (1× TBS/1% skimmed milk powder) for 60 min and incubated for 1 h at room temperature and then overnight at 4 °C with polyclonal rabbit anti-Ki67 (Abcam, 1:1000) diluted in 0.25% gelatin/0.5% Triton X-100 (Supermix). The day after, cells were rinsed three times for 5 min in PBS, incubated with donkey anti-rabbit Alexa488 (Invitrogen, 1:1000) for 1 h at room temperature, rinsed three times for 5 min in PBS and mounted in Vectashield Mounting Medium with DAPI (Vector Laboratories). To assess GR immunoreactivity in Ki67-expressing NSPC, blocking buffer was applied for 60 min before cells were incubated for 1 h at room temperature and then overnight at 4 °C with a polyclonal mouse anti-Ki67 (Novocastra, 1:200) and polyclonal rabbit anti-GR (H300 Santa Cruz, 1:200) antibody diluted in Supermix. The day after, cells were rinsed three times for 5 min in PBS, incubated with goat anti-mouse Alexa568 (Invitrogen, 1:1000) and donkey anti-rabbit Alexa488 (Invitrogen, 1:1000) for 1 h at room temperature, rinsed three times for 5 min in PBS and mounted in Vectashield Mounting Medium with DAPI (Vector Laboratories). Images were acquired using a Leica CTR5500 microscope with the Leica MM AF program (MetaMorph, version 1.6.0). Quantitative real time PCR RNA was isolated using TRIzol reagent (Life Technologies) according to the manufacturers’protocol. For mRNA qPCRs, cDNA was synthetized using a superscript II reverse transcriptase (Life Technologies) according to the manufacturers’protocol. Quantitative real time PCR were performed, as described before [41], using SYBR green (Applied Biosystems) and the following primer sequences: α-tubulin (for normalization) forward: CCCTCGCCTTCT AACGCGTTGC, reverse: TGGTCTTGTCACTTGGCATC TGGC; DNMT1 forward: AGGCGCGTCATGGGTGCT AC, reverse: GGCGGCGCTTCATGGCATTC; DNMT3a forward: GCCAAGAAACCCAGAAAGAGC, reverse: GTGACATTGAGGCTCCCACA; DNMT3b forward: GCGTCAGTACCCCATCAGTT, reverse: ATCTTTCCCC ACACGAGGTC; DKK3 forward: CACAATGAGACC AGCACGGA, reverse: GGCTCCTCTTGCCTTCTTCAT; GSK3βforward: CCCTCAAATCAAGGCACATCC, reverse: TTGGGTCCCGCAATTCATCG; CCND1 forward: GCCATGACTCCCCACGATTT, reverse: CTACCA TGGAGGGTGGGTTG; and β-catenin forward: GAACAG GGTGCTATTCCACGA, reverse: TGGAGAGCTCCAGT ACACCC; Hes5 forward: AGCAAAGCCTTCGCCGC, reverse: CCGCTGGAAGTGGTAAAGCA; SGK1 forward: TGGTGTCTTGGGGCTGTCCTGT, reverse: GCCTTCCA GGAGTGTCCTTGC. Flow cytometry analysis of cell cycle using propidium iodide NSPC were trypsinized (Trypzean, Lonza) for 5 min and fixed by slowly adding cold 70% ethanol (−20 °C) and were then left overnight at 4 °C. Subsequently, cells were washed twice with PBS for 5 min and treated for 20 min with RNAse (100 μg/ml; Sigma-Aldrich) and incubated for 20 min at room temperature with a mix containing propidium iodide (5 µg/ml; Sigma-Alrdich), 0.1% sodium citrate and Triton-X100 (0.1%) in PBS. Cells were sorted using a FACSAria™III system (BD) with 488 nm excitation laser. Propidium iodide was detected within the PE/Texas Red channel with a 610/10 bandpass filter. At least 9000 cells were analyzed per sample and only single cells were included in the analysis. The fluorescence intensity of each single cell indicating total DNA content was used to classify cells in the G0/G1 (2N), S (>2N), M (4N) phase or apoptotic cells (<2N). FACS histograms were plot-fitted using the G2/G1 fixed method using Multicycle AV and FCS express (De Novo Software). Global cytosine methylation analysis Global DNA methylation was measured using MBDisolated Genome Sequencing, essentially as described [68]. Briefly, NSPC were trypsinized (Trypzean, Lonza) for 5 min, spun down for 3 min at 300×gand total DNA was extracted using a GenElute™Mammalian Genomic DNA Circadian glucocorticoid oscillations preserve a population of adult hippocampal neural stem cells in. . .
Miniprep Kit (Sigma-Aldrich) following the manufacturer’s protocol. Global levels of DNA methylation were measured using a Methylamp™Global DNA Methylation Quantification Ultra Kit (Epigentek) according to the manufacturer’s protocol. Data were normalized to global DNA methylation levels of vehicle treated NSPC, as indicated. Methylated DNA sample preparation and quality control DNA was isolated from NSPC as described above. DNA concentration was determined on a Fluostar Optima plate reader (BMG Labtech) with the Quant-iTTM Picogreen® dsDNA assay kit (Invitrogen) at 480/520 nm. Concentration was determined using smear analysis on an Agilent 2100 Bioanalyzer (Agilent Technologies) and checked for degradation. Samples (n=3) for each experimental condition were pooled into a single sample for further processing. Methylated DNA fragmentation and MBD2-capture DNA fragmentation was performed on a Covaris S2 Focused ultrasonicator with the following settings: duty cycle 10%, intensity 5, 200 cycles per burst during 190 s to obtain fragments with an average length of 200 bp. The power mode was set to frequency sweeping, temperature 6–8 °C and water level 12. A maximum of 3 μg DNA was dissolved in 130 μl TE and loaded in a microtube with AFA intensifier (Covaris). DNA was then analyzed on the Agilent 2100 Bioanalyzer (Agilent Technologies) and fragment distribution was analyzed on a high sensitivity DNA chip. Methylated DNA was captured using the MethylCap kit (Diagenode). The concentrations of the fragmented and captured DNA was determined on a Fluostar Optima plate reader (BMG Labtech) with the Quant-iTTM Picogreen® dsDNA assay kit (Invitrogen) at 480/520 nm. A second quality control was performed after fragmentation on an Agilent 2100 HS DNA chip. Methylated DNA library preparation, amplification and sequencing A methylated DNA library was prepared, amplified and sequenced using a modified version of the “multiplexed paired end ChIP protocol”(Illumina) [68], using the DNA Sample Prep Master Mix Set 1 (NEB) in combination with the Multiplexing Sample Preparation Oligo Kit (Illumina). The library was prepared from 250 ng of fragmented DNA on an Apollo 324 NGS Library Prep System (IntegenX) with a PrepXDNA Library Kit (Wafergen Biosystems) according to the kit’s protocol. Library amplification was done according to the multiplexed paired end ChIP protocol including the indexes from Multiplexing Sample Preparation Oligo Kit (Illumina). Smaller fragments were removed when necessary using a 2% agarose gel (Low Range Ultra agarose; Biorad) in combination with a 1 kb Plus ladder (Invitrogen). 300 bp +/−50 bp fragments were excised and eluted on a Qiagen Gel Extraction Kit column (Qiagen), then eluted in 23 μl EB and 1 μl from there was run on an Agilent 2100 HS DNA chip. DNA concentration was determined using smear analysis on an Agilent 2100 Bioanalyzer and samples were diluted to 10 nM. DNA fragments were sequenced using the Hi-Seq 2000 Massive Parallel Sequencer system (Illumina) with 2 × 51 +7(index) sequencing cycles. Initial quality assessment was based on data passing the Illumina Chastity filter control. Subsequently, the reads containing adapters and/or Phix control signal were removed. A second quality assessment was based on the remaining reads using the FASTQC quality control tool version 0.10.0. DNA methylation base scaling and mapping FASTQ sequence reads were generated using the Illumina Casava pipeline version 1.8.0. The paired end 51 bp sequence reads were mapped using Bowtie software v0.12.7, as described [117]. The Bowtie parameters were set to 0 mismatches in the seed (first 28 nucleotides). Only unique paired reads were retained and both fragments must be located within 400 bp of each other on the mouse reference genome build NCBI37/mm9. Regions within −2000 and +500 bp from a TSS were considered as gene promoters. Bio-informatics and statistics Dose–response curves were created using Graphpad Prism 5.0 and statistically compared with an F-test. Heatmaps were generated using the UHC option in MultiExperiment Viewer v4.9 (TM4). GO analysis was performed using the Genecodis GO algorithm hypergeometrically testing for significantly overrepresented processes (FDR corrected p< 0.05) as described [118], and functional network predictions were produced using the GeneMANIA algorithm [119]. The H2G2 genome browser (NXT-Dx) was used to explore the mapped MBD2 read density. All other comparisons were statistically tested using an unpaired two-tailed Student’st test, one-way analysis of variance (ANOVA) test with Tukey’s post-test when more than two groups were compared, or two-way ANOVA test with a Bonferroni post-test when more than two groups with two independent variables were compared. The sample sizes were chosen based on previously observed effect sizes and calculated with a sigma of 0.2, alpha of 0.05 to obtain a power of at least 0.8 using the G Power software [120]. No samples or animals were M. Schouten et al.
excluded from our analyses. Statistical analyses were performed using GraphPad Prism 5.0. Acknowledgements The experimental work was financed by grants from the Innovational Research Incentives Scheme VIDI 864.09.016 from the Netherlands organization for Scientific Research (NWO); the International Foundation for Alzheimer’s Research (ISAO), and Alzheimer Nederland to CPF. HM and LG-C were supported by the Spanish Ministry of Economy and Competitiveness, grant SAF201570433-R to HM and Juan de la Cierva Program to LG-C. EG and NT were financed by the Swiss National Science Foundation. PJL was supported by Alzheimer Nederland. SM-S was financed by the Jesus de Gangoiti Foundation. We acknowledge the assistance of Rafael Hortigüela and Tijana Radic during the paper preparation and Ronald Breedijk and Mark Hink at the Leeuwenhoek Centre for Advanced Microscopy, University of Amsterdam for providing technical assistance with the confocal microscope. Author contributions MS, PB, EMJP, LGC, SG, TJ, MPE, EGG, and SM-S performed the experiments and analyzed the data; PJL, HEV, SWS, DDPT, NT, JLT, HM, and JME participated in the result discussion and interpretation and corrected the paper: MS, PB, and CPF conceived the study, designed experiments, analyzed and interpreted the results and wrote the paper. Compliance with ethical standards Conflict of interest The authors declare that they have no conflict of interest. Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons. org/licenses/by/4.0/. References 1. Tucker-Drob EM. Neurocognitive functions and everyday functions change together in old age. Neuropsychology. 2011;25:368–77. 2. Cole JH, Ritchie SJ, Bastin ME, Valdes Hernandez MC, Munoz Maniega S, Royle N, et al. Brain age predicts mortality. Mol Psychiatry. 2018;23:1385–92. 3. Oster H, Challet E, Ott V, Arvat E, de Kloet ER, Dijk DJ, et al. The functional and clinical significance of the 24-hour rhythm of circulating glucocorticoids. Endocr Rev. 2017;38:3–45. 4. Abercrombie HC, Giese-Davis J, Sephton S, Epel ES, Turner-Cobb JM, Spiegel D. Flattened cortisol rhythms in metastatic breast cancer patients. Psychoneuroendocrinology. 2004;29:1082–92. 5. McEwen BS. Interacting mediators of allostasis and allostatic load: towards an understanding of resilience in aging. Metabolism. 2003;52(10 Suppl 2):10–16. 6. Lightman SL, Conway-Campbell BL. The crucial role of pulsatile activity of the HPA axis for continuous dynamic equilibration. Nat Rev Neurosci. 2010;11:710–8. 7. Walker JJ, Spiga F, Waite E, Zhao Z, Kershaw Y, Terry JR, et al. The origin of glucocorticoid hormone oscillations. PLoS Biol. 2012;10:e1001341. 8. Schmidt MV, Enthoven L, van der Mark M, Levine S, de Kloet ER, Oitzl MS. The postnatal development of the hypothalamicpituitary-adrenal axis in the mouse. Int J Dev Neurosci. 2003;21:125–132. 9. Stavreva DA, Coulon A, Baek S, Sung MH, John S, Stixova L, et al. Dynamics of chromatin accessibility and long-range interactions in response to glucocorticoid pulsing. Genome Res. 2015;25:845–57. 10. Conway-Campbell BL, Sarabdjitsingh RA, McKenna MA, Pooley JR, Kershaw YM, Meijer OC, et al. Glucocorticoid ultradian rhythmicity directs cyclical gene pulsing of the clock gene period 1 in rat hippocampus. J Neuroendocrinol. 2010;22:1093–1100. 11. Dalm S, Enthoven L, Meijer OC, van der Mark MH, Karssen AM, de Kloet ER, et al. Age-related changes in hypothalamicpituitary-adrenal axis activity of male C57BL/6J mice. Neuroendocrinology. 2005;81:372–80. 12. Liston C, Cichon JM, Jeanneteau F, Jia Z, Chao MV, Gan WB. Circadian glucocorticoid oscillations promote learningdependent synapse formation and maintenance. Nat Neurosci. 2013;16:698–705. 13. Ikeda Y, Kumagai H, Skach A, Sato M, Yanagisawa M. Modulation of circadian glucocorticoid oscillation via adrenal opioidCXCR7 signaling alters emotional behavior. Cell. 2013;155:1323–36. 14. Gilhooley MJ, Pinnock SB, Herbert J. Rhythmic expression of per1 in the dentate gyrus is suppressed by corticosterone: implications for neurogenesis. Neurosci Lett. 2011;489:177–81. 15. Altman J, Das GD. Autoradiographic and histological evidence of postnatal hippocampal neurogenesis in rats. J Comp Neurol. 1965;124:319–35. 16. Kempermann G, Jessberger S, Steiner B, Kronenberg G. Milestones of neuronal development in the adult hippocampus. Trends Neurosci. 2004;27:447–52. 17. Spalding KL, Bergmann O, Alkass K, Bernard S, Salehpour M, Huttner HB, et al. Dynamics of hippocampal neurogenesis in adult humans. Cell. 2013;153:1219–27. 18. Kempermann G, Gage FH, Aigner L, Song H, Curtis MA, Thuret S et al. Human adult neurogenesis: evidence and remaining questions. Cell Stem Cell. 2018;23:25–30. 19. Boldrini M, Fulmore CA, Tartt AN, Simeon LR, Pavlova I, Poposka V, et al. Human Hippocampal Neurogenesis Persists throughout Aging. Cell Stem Cell. 2018;22:589–99 e585. 20. Eriksson PS, Perfilieva E, Bjork-Eriksson T, Alborn AM, Nordborg C, Peterson DA, et al. Neurogenesis in the adult human hippocampus. Nat Med. 1998;4:1313–7. 21. Knoth R, Singec I, Ditter M, Pantazis G, Capetian P, Meyer RP, et al. Murine features of neurogenesis in the human hippocampus across the lifespan from 0 to 100 years. PLoS ONE. 2010;5: e8809. 22. Kuhn HG, Dickinson-Anson H, Gage FH. Neurogenesis in the dentate gyrus of the adult rat: age-related decrease of neuronal progenitor proliferation. J Neurosci. 1996;16:2027–33. 23. Cameron HA, McKay RD. Restoring production of hippocampal neurons in old age. Nat Neurosci. 1999;2:894–7. 24. Lazic SE. Modeling hippocampal neurogenesis across the lifespan in seven species. Neurobiol Aging. 2012;33:1664–71. Circadian glucocorticoid oscillations preserve a population of adult hippocampal neural stem cells in. . .
25. Leuner B, Kozorovitskiy Y, Gross CG, Gould E. Diminished adult neurogenesis in the marmoset brain precedes old age. Proc Natl Acad Sci USA. 2007;104:17169–73. 26. Ben Abdallah NM, Slomianka L, Lipp HP. Reversible effect of X-irradiation on proliferation, neurogenesis, and cell death in the dentate gyrus of adult mice. Hippocampus. 2007;17:1230–40. 27. Encinas JM, Michurina TV, Peunova N, Park JH, Tordo J, Peterson DA, et al. Division-coupled astrocytic differentiation and age-related depletion of neural stem cells in the adult hippocampus. Cell Stem Cell. 2011;8:566–79. 28. Mathews KJ, Allen KM, Boerrigter D, Ball H, Shannon Weickert C, Double KL. Evidence for reduced neurogenesis in the aging human hippocampus despite stable stem cell markers. Aging Cell. 2017;16:1195–9. 29. Dennis CV, Suh LS, Rodriguez ML, Kril JJ, Sutherland GT. Human adult neurogenesis across the ages: an immunohistochemical study. Neuropathol Appl Neurobiol. 2016;42:621–38. 30. Kippin TE, Martens DJ, van der Kooy D. p21 loss compromises the relative quiescence of forebrain stem cell proliferation leading to exhaustion of their proliferation capacity. Genes Dev. 2005;19:756–67. 31. Furutachi S, Matsumoto A, Nakayama KI, Gotoh Y. p57 controls adult neural stem cell quiescence and modulates the pace of lifelong neurogenesis. EMBO J. 2013;32:970–81. 32. Toda T, Parylak SL, Linker SB, Gage FH The role of adult hippocampal neurogenesis in brain health and disease. Mol Psychiatry. 2018;24:67–87. 33. Moreno-Jimenez EP, Flor-Garcia M, Terreros-Roncal J, Rabano A, Cafini F, Pallas-Bazarra N et al. Adult hippocampal neurogenesis is abundant in neurologically healthy subjects and drops sharply in patients with Alzheimer's disease. Nat Med. 2019;25:554–560. 34. Kempermann G. The pessimist's and optimist's views of adult neurogenesis. Cell. 2011;145:1009–11. 35. Bonaguidi MA, Wheeler MA, Shapiro JS, Stadel RP, Sun GJ, Ming GL, et al. In vivo clonal analysis reveals self-renewing and multipotent adult neural stem cell characteristics. Cell. 2011;145:1142–55. 36. Lugert S, Taylor V. Neural stem cells: disposable, end-state glia? Cell Stem Cell. 2011;8:464–5. 37. Lucassen PJ, Toni N, Kempermann G, Frisen J, Gage FH, Swaab DF. Limits to human neurogenesis-really? Mol Psychiatry 2019. https://doi.org/10.1038/s41380-018-0337-5 [Epub ahead of print]. 38. Cameron HA, Gould E. Adult neurogenesis is regulated by adrenal steroids in the dentate gyrus. Neuroscience. 1994;61:203–9. 39. Montaron MF, Drapeau E, Dupret D, Kitchener P, Aurousseau C, Le Moal M, et al. Lifelong corticosterone level determines age-related decline in neurogenesis and memory. Neurobiol Aging. 2006;27:645–54. 40. Yu S, Patchev AV, Wu Y, Lu J, Holsboer F, Zhang JZ, et al. Depletion of the neural precursor cell pool by glucocorticoids. Ann Neurol. 2010;67:21–30. 41. Fitzsimons CP, van Hooijdonk LW, Schouten M, Zalachoras I, Brinks V, Zheng T, et al. Knockdown of the glucocorticoid receptor alters functional integration of newborn neurons in the adult hippocampus and impairs fear-motivated behavior. Mol Psychiatry. 2013;18:993–1005. 42. Montaron MF, Petry KG, Rodriguez JJ, Marinelli M, Aurousseau C, Rougon G, et al. Adrenalectomy increases neurogenesis but not PSA-NCAM expression in aged dentate gyrus. Eur J Neurosci. 1999;11:1479–85. 43. Brunson KL, Baram TZ, Bender RA. Hippocampal neurogenesis is not enhanced by lifelong reduction of glucocorticoid levels. Hippocampus. 2005;15:491–501. 44. Garcia A, Steiner B, Kronenberg G, Bick-Sander A, Kempermann G. Age-dependent expression of glucocorticoidand mineralocorticoid receptors on neural precursor cell populations in the adult murine hippocampus. Aging Cell. 2004;3:363–71. 45. Jhaveri DJ, O'Keeffe I, Robinson GJ, Zhao QY, Zhang ZH, Nink V, et al. Purification of neural precursor cells reveals the presence of distinct, stimulus-specific subpopulations of quiescent precursors in the adult mouse hippocampus. J Neurosci. 2015;35:8132–44. 46. Steiner B, Klempin F, Wang L, Kott M, Kettenmann H, Kempermann G. Type-2 cells as link between glial and neuronal lineage in adult hippocampal neurogenesis. Glia. 2006;54:805–14. 47. Encinas JM, Vaahtokari A, Enikolopov G. Fluoxetine targets early progenitor cells in the adult brain. Proc Natl Acad Sci USA. 2006;103:8233–8. 48. Shin J, Berg DA, Zhu Y, Shin JY, Song J, Bonaguidi MA, et al. Single-cell RNA-Seq with waterfall reveals molecular cascades underlying adult neurogenesis. Cell Stem Cell. 2015;17:360–72. 49. Murray F, Smith DW, Hutson PH. Chronic low dose corticosterone exposure decreased hippocampal cell proliferation, volume and induced anxiety and depression like behaviours in mice. Eur J Pharmacol. 2008;583:115–27. 50. Beckervordersandforth R, Deshpande A, Schaffner I, Huttner HB, Lepier A, Lie DC, et al. In vivo targeting of adult neural stem cells in the dentate gyrus by a split-cre approach. Stem Cell Rep. 2014;2:153–62. 51. Brewer JA, Khor B, Vogt SK, Muglia LM, Fujiwara H, Haegele KE, et al. T-cell glucocorticoid receptor is required to suppress COX-2-mediated lethal immune activation. Nat Med. 2003;9:1318–22. 52. DiFiglia M, Sena-Esteves M, Chase K, Sapp E, Pfister E, Sass M, et al. Therapeutic silencing of mutant huntingtin with siRNA attenuates striatal and cortical neuropathology and behavioral deficits. Proc Natl Acad Sci USA. 2007;104:17204–9. 53. Zomer A, Maynard C, Verweij FJ, Kamermans A, Schafer R, Beerling E, et al. In vivo imaging reveals extracellular vesiclemediated phenocopying of metastatic behavior. Cell. 2015;161:1046–57. 54. Mittelstadt PR, Monteiro JP, Ashwell JD. Thymocyte responsiveness to endogenous glucocorticoids is required for immunological fitness. J Clin Invest. 2012;122:2384–94. 55. Gebara E, Bonaguidi MA, Beckervordersandforth R, Sultan S, Udry F, Gijs PJ, et al. Heterogeneity of radial glia-like cells in the adult hippocampus. Stem Cells. 2016;34:997–1010. 56. Anacker C, Cattaneo A, Musaelyan K, Zunszain PA, Horowitz M, Molteni R, et al. Role for the kinase SGK1 in stress, depression, and glucocorticoid effects on hippocampal neurogenesis. Proc Natl Acad Sci USA. 2013;110:8708–13. 57. Mulatero P, Panarelli M, Schiavone D, Rossi A, Mengozzi G, Kenyon CJ, et al. Impaired cortisol binding to glucocorticoid receptors in hypertensive patients. Hypertension. 1997;30:1274–8. 58. Stavreva DA, Wiench M, John S, Conway-Campbell BL, McKenna MA, Pooley JR, et al. Ultradian hormone stimulation induces glucocorticoid receptor-mediated pulses of gene transcription. Nat Cell Biol. 2009;11:1093–102. 59. Lugert S, Basak O, Knuckles P, Haussler U, Fabel K, Gotz M, et al. Quiescent and active hippocampal neural stem cells with distinct morphologies respond selectively to physiological and pathological stimuli and aging. Cell Stem Cell. 2010;6:445–56. 60. Sarabdjitsingh RA, Isenia S, Polman A, Mijalkovic J, Lachize S, Datson N, et al. Disrupted corticosterone pulsatile patterns attenuate responsiveness to glucocorticoid signaling in rat brain. Endocrinology. 2010;151:1177–86. 61. Sarabdjitsingh RA, Spiga F, Oitzl MS, Kershaw Y, Meijer OC, Lightman SL, et al. Recovery from disrupted ultradian M. Schouten et al.
glucocorticoid rhythmicity reveals a dissociation between hormonal and behavioural stress responsiveness. J Neuroendocrinol. 2010;22:862–71. 62. Ponti G, Obernier K, Guinto C, Jose L, Bonfanti L, AlvarezBuylla A. Cell cycle and lineage progression of neural progenitors in the ventricular-subventricular zones of adult mice. Proc Natl Acad Sci USA. 2013;110:E1045–1054. 63. Ma DK, Jang MH, Guo JU, Kitabatake Y, Chang ML, PowAnpongkul N, et al. Neuronal activity-induced Gadd45b promotes epigenetic DNA demethylation and adult neurogenesis. Science. 2009;323:1074–7. 64. Wu H, Coskun V, Tao J, Xie W, Ge W, Yoshikawa K, et al. Dnmt3a-dependent nonpromoter DNA methylation facilitates transcription of neurogenic genes. Science. 2010;329:444–8. 65. Davis EG, Humphreys KL, McEwen LM, Sacchet MD, Camacho MC, MacIsaac JL, et al. Accelerated DNA methylation age in adolescent girls: associations with elevated diurnal cortisol and reduced hippocampal volume. Transl Psychiatry. 2017;7: e1223. 66. Goll MG, Bestor TH. Eukaryotic cytosine methyltransferases. Annu Rev Biochem. 2005;74:481–514. 67. Bose R, Moors M, Tofighi R, Cascante A, Hermanson O, Ceccatelli S. Glucocorticoids induce long-lasting effects in neural stem cells resulting in senescence-related alterations. Cell Death Dis. 2010;1:e92. 68. Serre D, Lee BH, Ting AH. MBD-isolated Genome Sequencing provides a high-throughput and comprehensive survey of DNA methylation in the human genome. Nucleic Acids Res. 2010;38:391–9. 69. Ohta A, Akiguchi I, Seriu N, Ohnishi K, Yagi H, Higuchi K, et al. Deterioration in learning and memory of inferential tasks for evaluation of transitivity and symmetry in aged SAMP8 mice. Hippocampus. 2002;12:803–10. 70. Soriano-Canton R, Perez-Villalba A, Morante-Redolat JM, Marques-Torrejon MA, Pallas M, Perez-Sanchez F, et al. Regulation of the p19(Arf)/p53 pathway by histone acetylation underlies neural stem cell behavior in senescence-prone SAMP8 mice. Aging Cell. 2015;14:453–62. 71. Diaz-Moreno M, Hortiguela R, Goncalves A, Garcia-Carpio I, Manich G, Garcia-Bermudez E, et al. Abeta increases neural stem cell activity in senescence-accelerated SAMP8 mice. Neurobiol Aging. 2013;34:2623–38. 72. Gang B, Yue C, Han N, Xue H, Li B, Sun L, et al. Limited hippocampal neurogenesis in SAMP8 mouse model of Alzheimer's disease. Brain Res. 2011;1389:183–93. 73. Yanai S, Endo S. Early onset of behavioral alterations in senescence-accelerated mouse prone 8 (SAMP8). Behav Brain Res. 2016;308:187–95. 74. Pang KC, Miller JP, Fortress A, McAuley JD. Age-related disruptions of circadian rhythm and memory in the senescenceaccelerated mouse (SAMP8). Age. 2006;28:283–96. 75. Yagi H, Katoh S, Akiguchi I, Takeda T. Age-related deterioration of ability of acquisition in memory and learning in senescence accelerated mouse: SAM-P/8 as an animal model of disturbances in recent memory. Brain Res. 1988;474:86–93. 76. van Praag H, Schinder AF, Christie BR, Toni N, Palmer TD, Gage FH. Functional neurogenesis in the adult hippocampus. Nature. 2002;415:1030–4. 77. Klempin F, Kronenberg G, Cheung G, Kettenmann H, Kempermann G. Properties of doublecortin-(DCX)-expressing cells in the piriform cortex compared to the neurogenic dentate gyrus of adult mice. PLoS ONE. 2011;6:e25760. 78. Brandt MD, Maass A, Kempermann G, Storch A. Physical exercise increases Notch activity, proliferation and cell cycle exit of type-3 progenitor cells in adult hippocampal neurogenesis. Eur J Neurosci. 2010;32:1256–64. 79. Fitzsimons CP, Herbert J, Schouten M, Meijer OC, Lucassen PJ, Lightman S. Circadian and ultradian glucocorticoid rhythmicity: Implications for the effects of glucocorticoids on neural stem cells and adult hippocampal neurogenesis. Front Neuroendocrinol. 2016;41:44–58. 80. Schoenfeld TJ, Gould EStress. stress hormones, and adult neurogenesis. Exp Neurol. 2012;233:12–21. 81. Meaney MJ, Aitken DH, Sharma S, Viau V. Basal ACTH, corticosterone and corticosterone-binding globulin levels over the diurnal cycle, and age-related changes in hippocampal type I and type II corticosteroid receptor binding capacity in young and aged, handled and nonhandled rats. Neuroendocrinology. 1992;55:204–13. 82. Oomen CA, Mayer JL, de Kloet ER, Joels M, Lucassen PJ. Brief treatment with the glucocorticoid receptor antagonist mifepristone normalizes the reduction in neurogenesis after chronic stress. Eur J Neurosci. 2007;26:3395–401. 83. Kim JB, Ju JY, Kim JH, Kim TY, Yang BH, Lee YS, et al. Dexamethasone inhibits proliferation of adult hippocampal neurogenesis in vivo and in vitro. Brain Res. 2004;1027:1–10. 84. Rousseau G, Baxter JD, Funder JW, Edelman IS, Tomkins GM. Glucocorticoid and mineralocorticoid receptors for aldosterone. J Steroid Biochem. 1972;3:219–27. 85. Reul JM, de Kloet ER. Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. Endocrinology. 1985;117:2505–11. 86. Montaron MF, Piazza PV, Aurousseau C, Urani A, Le Moal M, Abrous DN. Implication of corticosteroid receptors in the regulation of hippocampal structural plasticity. Eur J Neurosci. 2003;18:3105–11. 87. Reul JM, van den Bosch FR, de Kloet ER. Differential response of type I and type II corticosteroid receptors to changes in plasma steroid level and circadian rhythmicity. Neuroendocrinology. 1987;45:407–12. 88. Vázquez DML, Levine S. Hypothalamic-pituitary-adrenal axis in postnatal life. In: Steckler TK,NH, Reul, JMHM, editors. Handbook of Stress and the Brain. Part 2: Stress: Integrative and Clinical Aspects, vol. 15. Elsevier, Amsterdam, The Netherlands; 2005, p. 3–21. 89. Nicola Z, Fabel K, Kempermann G. Development of the adult neurogenic niche in the hippocampus of mice. Front Neuroanat. 2015;9:53. 90. Fitzsimons CP, Ahmed S, Wittevrongel CF, Schouten TG, Dijkmans TF, Scheenen WJ, et al. The microtubule-associated protein doublecortin-like regulates the transport of the glucocorticoid receptor in neuronal progenitor cells. Mol Endocrinol. 2008;22:248–62. 91. De Miguel Z, Haditsch U, Palmer TD, Azpiroz A, Sapolsky RM. Adult-generated neurons born during chronic social stress are uniquely adapted to respond to subsequent chronic social stress. Mol Psychiatry. 2018. https://doi.org/10.1038/s41380-017-00131[Epub ahead of print]. 92. Qian X, Droste SK, Gutierrez-Mecinas M, Collins A, Kersante F, Reul JM, et al. A rapid release of corticosteroid-binding globulin from the liver restrains the glucocorticoid hormone response to acute stress. Endocrinology. 2011;152:3738–48. 93. Hattiangady B, Shetty AK. Aging does not alter the number or phenotype of putative stem/progenitor cells in the neurogenic region of the hippocampus. Neurobiol Aging. 2008;29:129–47. 94. Teilmann AC, Jacobsen KR, Kalliokoski O, Hansen AK, Hau J, Abelson KS. The effect of automated blood sampling on corticosterone levels, body weight and daily food intake in permanently catheterized male BALB/c mice. In Vivo. 2012;26: 577–82. 95. Leuner B, Gould E. Structural plasticity and hippocampal function. Annu Rev Psychol. 2010;61:C111–113. 111-40 Circadian glucocorticoid oscillations preserve a population of adult hippocampal neural stem cells in. . .
96. Babu H, Cheung G, Kettenmann H, Palmer TD, Kempermann G. Enriched monolayer precursor cell cultures from micro-dissected adult mouse dentate gyrus yield functional granule cell-like neurons. PLoS ONE. 2007;2:e388. 97. Walker TL, Kempermann G One mouse, two cultures: isolation and culture of adult neural stem cells from the two neurogenic zones of individual mice. J Vis Exp. 2014;84:e51225. 98. Crudo A, Suderman M, Moisiadis VG, Petropoulos S, Kostaki A, Hallett M, et al. Glucocorticoid programming of the fetal male hippocampal epigenome. Endocrinology. 2013;154:1168–80. 99. Lie DC, Colamarino SA, Song HJ, Desire L, Mira H, Consiglio A, et al. Wnt signalling regulates adult hippocampal neurogenesis. Nature. 2005;437:1370–5. 100. Seib DR, Corsini NS, Ellwanger K, Plaas C, Mateos A, Pitzer C, et al. Loss of Dickkopf-1 restores neurogenesis in old age and counteracts cognitive decline. Cell Stem Cell. 2013;12:204–14. 101. Wang Q, Liu Y, Zou X, Wang Q, An M, Guan X, et al. The hippocampal proteomic analysis of senescence-accelerated mouse: implications of Uchl3 and mitofilin in cognitive disorder and mitochondria dysfunction in SAMP8. Neurochem Res. 2008;33:1776–82. 102. Trinchero MF, Buttner KA, Sulkes Cuevas JN, Temprana SG, Fontanet PA, Monzon-Salinas MC, et al. High Plasticity of New Granule Cells in the Aging Hippocampus. Cell Rep. 2017;21:1129–39. 103. Bornstein SR, Steenblock C, Chrousos GP, Schally AV, Beuschlein F, Kline G et al. Stress-inducible-stem cells: a new view on endocrine, metabolic and mental disease? Mol Psychiatry. 2019;24:2–9. 104. Sapolsky RM. Why stress is bad for your brain. Science. 1996;273:749–50. 105. Sapolsky RM. Glucocorticoids, stress, and their adverse neurological effects: relevance to aging. Exp Gerontol. 1999;34:721–32. 106. Lupien SJ, de Leon M, de Santi S, Convit A, Tarshish C, Nair NP, et al. Cortisol levels during human aging predict hippocampal atrophy and memory deficits. Nat Neurosci. 1998;1:69–73. 107. McEwen BS, Nasca C, Gray JD. Stress effects on neuronal structure: hippocampus, amygdala, and prefrontal cortex. Neuropsychopharmacology. 2016;41:3–23. 108. Sorrells SF, Paredes MF, Cebrian-Silla A, Sandoval K, Qi D, Kelley KW, et al. Human hippocampal neurogenesis drops sharply in children to undetectable levels in adults. Nature. 2018;555:377–81. 109. Schloesser RJ, Lehmann M, Martinowich K, Manji HK, Herkenham M. Environmental enrichment requires adult neurogenesis to facilitate the recovery from psychosocial stress. Mol Psychiatry. 2010;15:1152–63. 110. Freund J, Brandmaier AM, Lewejohann L, Kirste I, Kritzler M, Kruger A, et al. Emergence of individuality in genetically identical mice. Science. 2013;340:756–9. 111. Lemaire V, Aurousseau C, Le Moal M, Abrous DN. Behavioural trait of reactivity to novelty is related to hippocampal neurogenesis. Eur J Neurosci. 1999;11:4006–14. 112. Anacker C, Luna VM, Stevens GS, Millette A, Shores R, Jimenez JC, et al. Hippocampal neurogenesis confers stress resilience by inhibiting the ventral dentate gyrus. Nature. 2018;559:98–102. 113. Mignone JL, Kukekov V, Chiang AS, Steindler D, Enikolopov G. Neural stem and progenitor cells in nestin-GFP transgenic mice. J Comp Neurol. 2004;469:311–24. 114. Flurkey K, Currer JM, Harrison DE The Mouse in Aging Research. The Jackson laboratory handbook on genetically standardized mice, 6th edition, vol. 6th edition. The Jackson Laboratory Press, Bar Harbor, USA; 2007. 115. Fluttert M, Dalm S, Oitzl MS. A refined method for sequential blood sampling by tail incision in rats. Lab Anim. 2000;34:372–8. 116. Beining M, Jungenitz T, Radic T, Deller T, Cuntz H, Jedlicka P, et al. Adult-born dentate granule cells show a critical period of dendritic reorganization and are distinct from developmentally born cells. Brain Struct Funct. 2017;222:1427–46. 117. Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10:R25. 118. Schouten M, Fratantoni SA, Hubens CJ, Piersma SR, Pham TV, Bielefeld P, et al. MicroRNA-124 and −137 cooperativity controls caspase-3 activity through BCL2L13 in hippocampal neural stem cells. Sci Rep. 2015;5:12448. 119. Zuberi K, Franz M, Rodriguez H, Montojo J, Lopes CT, Bader GD, et al. GeneMANIA prediction server 2013 update. Nucleic Acids Res. 2013;41(Web Server issue):W115–122. 120. Faul F, Erdfelder E, Lang AG, Buchner A. G*Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav Res Methods. 2007;39:175–91. M. Schouten et al.