Dpp and Hedgehog promote the glial response to neuronal apoptosis in the developing Drosophila visual system

RESEARCH ARTICLE Dpp and Hedgehog promote the glial response to neuronal apoptosis in the developing Drosophila visual system Sergio B. VelardeID, Alvaro QuevedoID, Carlos EstellaID, Antonio BaonzaID* Centro de Biologı ´a Molecular Severo Ochoa, Consejo Superior de Investigaciones Cientificas (CSIC)/Universidad Autonoma de Madrid (UAM), Madrid, Spain *[email protected].es Abstract Damage in the nervous system induces a stereotypical response that is mediated by glial cells. Here, we use the eye disc of Drosophila melanogaster as a model to explore the mechanisms involved in promoting glial cell response after neuronal cell death induction. We demonstrate that these cells rapidly respond to neuronal apoptosis by increasing in number and undergoing morphological changes, which will ultimately grant them phagocytic abilities. We found that this glial response is controlled by the activity of Decapentaplegic (Dpp) and Hedgehog (Hh) signalling pathways. These pathways are activated after cell death induction, and their functions are necessary to induce glial cell proliferation and migration to the eye discs. The latter of these 2 processes depend on the function of the c-Jun Nterminal kinase (JNK) pathway, which is activated by Dpp signalling. We also present evidence that a similar mechanism controls glial response upon apoptosis induction in the leg discs, suggesting that our results uncover a mechanism that might be involved in controlling glial cells response to neuronal cell death in different regions of the peripheral nervous system (PNS). Introduction A complex nervous system is comprised of neurons and glial cells whose development and function are mutually interdependent. The intricate interaction between these 2 cell types is essential for the generation and maintenance of a functional nervous system. During development or after neuronal damage, cells within the nervous system undergo changes in order to preserve structural integrity and function. Glial cells actively participate in all aspects of nervous system development, including mechanisms involved in maintaining structural robustness and functional plasticity. In response to neuronal damage, glial cells proliferate, change their morphology, and alter their behaviour [1–4]. This glial cell response is associated with their regenerative function and is found across different species. The signalling pathways underlying glial response and how they are coordinated remain poorly understood. We can have a better understanding of the mechanisms involved in regulating this process by exploring how glial cells respond to the induction of neuronal apoptosis. PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 1 / 39 a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 OPEN ACCESS Citation: Velarde SB, Quevedo A, Estella C, Baonza A (2021) Dpp and Hedgehog promote the glial response to neuronal apoptosis in the developing Drosophila visual system. PLoS Biol 19(8): e3001367. https://doi.org/10.1371/journal. pbio.3001367 Academic Editor: Richard Daneman, UCSD, UNITED STATES Received: April 19, 2021 Accepted: July 16, 2021 Published: August 11, 2021 Peer Review History: PLOS recognizes the benefits of transparency in the peer review process; therefore, we enable the publication of all of the content of peer review and author responses alongside final, published articles. The editorial history of this article is available here: https://doi.org/10.1371/journal.pbio.3001367 Copyright: ©2021 Velarde et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Drosophila melanogaster is an excellent model system to discover evolutionarily conserved gene functions and gene networks. Previously, the eye disc of Drosophila has been used to analyse basic mechanisms regulating the migration of glial cells along their neuronal partners [2,5–11]. The eye disc develops from a group of ectodermal cells with embryonic origin, distinct from the neuroectodermal cells that form the central nervous system (CNS). Thus, unlike its mammalian counterpart, Drosophila eyes are not part of the CNS. Nevertheless, similarly to mammalian systems, they do contain neurons and glial cells. The eye primordia develops progressively, from posterior to anterior, over the course of approximately 2 days. A morphogenetic furrow (MF) sweeps across the disc during this period, leaving in its wake, developing clusters of photoreceptor cells that will become the individual units of the compound eye, known as ommatidia [12]. Therefore, while the region anterior to the furrow is mainly composed of proliferating, undifferentiated cells, the region posterior to the furrow consists predominantly of cells that have exited the cell cycle and have begun to differentiate into photoreceptors [12–14]. Unlike photoreceptors, the progenitors of all subretinal glia are not generated from the eye disc cells. During early embryonic stages, the anlage of the eye disc is established, and a few glial cells are born in the initial segment of the Bolwing nerve, which will later become the optic stalk and serve to connect the developing imaginal disc to the brain [9,10,15]. These new glial cells are the precursors of the eye disc glial cells. During larval stages, these precursor cells proliferate, forming new glial cells that accumulate in the optic stalk. As the eye imaginal disc grows and neurogenesis is initiated behind the MF, glial cells leave the optic stalk and migrate onto the eye disc [9,10,11,15]. The eye discs contain distinct glial cell types [10]. Subperineurial cells, the so-called carpet cells, are 2 large cells that cover the entire differentiated part of the eye disc epithelium. Sitting basally to these 2 cells are the perineurial (PN) glial cells that have a distinct morphology in the optic stalk and in the eye disc [10,16]. These cells define a reserve pool, which can generate glial cells when necessary (for plasticity and development); accordingly, these cells maintain the ability to divide during eye disc development [10]. In addition, carpet cells separate the PN glia from the underlying wrapping glia (WG), a group of cells that derive from the PN glial and enwrap all axons produced by the photoreceptors. The WG cells perform functions that resemble the non-myelinating Schwann cells forming Remak fibers in the mammalian peripheral nervous system (PNS) [7]. Likewise, Schwann cells play a key role in promoting regeneration and provide the high ability of the peripheral nerves to regenerate [17]. Many studies using eye discs as a model system have contributed to uncovering the basic mechanisms and signalling pathways involved in the coupling of neuronal and glial development and have shown that Drosophila glial cells can serve as an experimental model to gain insights into mammalian glial biology [6,7,10,18,19]. However, despite the widespread use of this model, little is known about the response of glial cells upon apoptosis induction of neural tissue and the signalling pathways that might be mediating this function. The unique developmental features of the fly eye disc make this structure an excellent model to analyse the signals emitted by dying neural tissue and the mechanisms involved in regulating glial cell response. Furthermore, considering the similarities between non-myelinating Schwann cells and WG, the eye discs might provide new insights into the signalling pathway network involved in regulating glial cells behaviour in response to apoptosis induction in the PNS. Here, we use the eye disc to explore the mechanisms involved in promoting glial cell response to the induction of neural apoptosis during development. We demonstrate that eye glial cells respond by increasing in number and undergoing morphological changes that confer them phagocytic activity. We found that this glial response is controlled by the activity of the Decapentaplegic (Dpp) and Hedgehog (Hh) signalling pathways. These pathways are activated in glial cells upon apoptosis induction in the retina region, and their function is necessary for PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 2 / 39 Funding: This study was supported by grants from: Fundacio ´n Ramo ´n Areces (to AB); Programa Estatal de Generacio ´n de conocimiento y fortalecimiento cientı ´fico y tecnolo ´gico del sistema de I+D+I (Ministerio de Ciencia, Innovacio ´n y Universidades) grants PGC2018-095144-B-I00 (to CE) and BFU2014-54153-P (to AB); The National Council of Science and Technology from Me ´xico (CONACyT) (to SBV); Fellowship from the Ignacio Larramendi foundation (to SBV); Consejeria de Ciencia. Universidades e innovacion, Comunidad Autonoma de Madrid. “Ayudas para la contratacion de Investigadores Predoctorales” (to AQ). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interest exist. Abbreviations: AEL, after egg laying; CNS, central nervous system; Dpp, Decapentaplegic; EdU, 5Ethynyl-2-deoxyuridine; GMR, glass multiple reporter; GRR, glial regenerative response; hep, hemipterous; Hh, Hedgehog; JNK, c-Jun Nterminal kinase; LC3, light chain 3; MF, morphogenetic furrow; PN, perineurial; PNS, peripheral nervous system; ptc,patched;puc, puckered; RNAi, RNA interference; rpr,reaper; SEM, standard error of the mean; TNF, tumour necrosis factor; WG, wrapping glia. stimulating the proliferation and migration of glial cells to the eye discs. This latter process depends on the function of the c-Jun N-terminal kinase (JNK) pathway, which is activated by Dpp signalling. Remarkably, we present evidence indicating that a similar mechanism controls glial response upon apoptosis induction in the leg discs. As in the eye discs, most leg glial cells are born in the CNS/PNS transition zone during larval stages and migrate into the forming leg [16]. We observed that after apoptosis induction in leg discs, glial cells accumulate in this region. The function of Dpp and JNK, but not Hh signalling, is required for this glial response; hence, our results uncover a mechanism that might be involved in controlling glial cell response to neural cell death in different regions of the PNS. Results Cell death induction in the eye disc epithelium promotes the accumulation of glial cells Different studies have shown that when apoptosis is induced in the retinal region of eye discs, a regenerative response that includes compensatory proliferation is initiated [20]. However, whether this response also involves glial cells activation was unknown. In order to study glial cell response to apoptotic induction in this model system, we have examined the localisation, pattern of proliferation, and number of glial cells in eye discs after inducing apoptosis in the retinal region. To genetically induce targeted cell death in this region of the eye disc epithelium, we used the Gal4/UAS/Gal80 ts system to transiently overexpress the proapoptotic gene reaper (rpr) under the control of the eye specific glass multiple reporter (GMR) Gal4 line. GMR-Gal4 is expressed in all cells posterior to the MF, including photoreceptor cells (Fig 1A and 1A”). Given that glial cells do not originate in the eye disc, this driver is not active in glial cells (Fig 1A’). Therefore, cells in the retinal region would nonautonomously induce changes in the behaviour of glial cells. We used the tub-Gal80 ts transgene to modulate the time of apoptotic induction to 72 hours before dissection (see Materials and methods). As expected, we found that in GMR-Gal4 tub-Gal80 ts UAS-rpr, larvae cell death strongly increased behind the MF (S1 Fig). Remarkably, we observed a pronounced increase in the density of glial cells in damaged discs compared to control discs (0.019 ±0.0004, n= 47 versus 0.009 ±0.0003, n= 39 number of glial cells/area μ 2 occupied by glial cells, in damaged discs and control discs, respectively, p<0.0001; Fig 1D and 1G, Table A in S1 Text). In contrast to control discs, where glial cells are always located on the basal layer of the discs (Fig 1C–1C””), injured discs contained glial cells contacting with photoreceptors in the middle layer of the eye disc epithelium (yellow arrowheads in Fig 1D”–1D””), as well as in the apical region (green arrowheads in Fig 1D”–1D””). Interestingly, retinal damage also affects the position of glial cells with respect to the MF. Thus, in control discs, the anterior border of glial migration lies between 0 and 5 cell rows behind the most anterior row of photoreceptors, whereas in damaged discs, the anterior boundary of the glial migration moved ahead (Fig 1, compare 1E–1E’ with 1F–1F’ and 1H). In order to get a better understanding of the sequence of events associated with glial response, we examined glial behaviour at different times after induction of apoptosis in the retinal region. To that end, GMR-Gal4 tub-Gal80 ts UAS-rpr larvae were raised at permissive temperature (17˚C), then shifted to the restrictive temperature (29˚C) during 24 hours to induce UAS-rpr and then shifted back to the permissive temperature to allow time for recovery (see Materials and methods). Discs were analysed at different time points: immediately after rpr induction (T0), after 24 hours at permissive temperature (T1), and after 48 hours of recovery (T2) (Fig 2M). In discs dissected immediately after genetic ablation (T0), we observed a large number of apoptotic cells and cellular debris labelled with anti-Dcp1 (Fig 2C–2D”). Most apoptotic cells were located at the basal region of the discs and predominantly corresponded PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 3 / 39 to interommatidial cells, as they did not express the neuronal marker Elav (Fig 2C–2D”). The density of glial cells in these discs was significantly higher than in control discs (0.01 ±0.00033 number of glial cells/area μ 2 in control discs, n= 28 versus 0.015 ±0.0009 in damaged discs Fig 1. Response of glia to neuronal apoptotic induction in the eye discs. (A–F’) Third instar eye discs stained with anti-Elav (Photoreceptors in red), anti-Repo (glial cells in white), and the nuclear marker DAPI (blue). (A–D) Apical/middle layers of the eye disc epithelium. (A’–D’) Basal layers of the eye discs. (A”–D”, E’–F’) The X– Z projections show cross sections perpendicular to the furrow of the eye discs of panels A–D (A”–D”) and E–F (E’–F’). (C”’–C”” and D”’–D””) Transverse sections parallel to the furrow of discs shown in C (C”’–C””) and D (D”’–D””). (A–A”) Eye disc showing the expression of UAS-GFP (green) under the control of GMR-Gal4. Glial nuclei (anti-Repo in white) are located in the basal layer of the eye disc, and they do not express UAS-GFP. (B–B”) The expression of UAS-GFP (green) under the control of repo-Gal4 is restricted to glial cells. (C–C””) In control discs, subretinal glial cells are always located in the basal layer of the disc. (D–D””) In damaged UASrpr/+ GMR-Gal4,tub-Gal80 ts eye discs glial cells are not only in the basal layer of the disc but also in the middle and apical layers. This is most clearly seen in transverse sections shown in (D”–D””). Arrowheads indicate glial cells located in apical (green arrowheads) and middle (yellow arrowheads) layers of the discs (D”– D””). Note that glial cells in the medial layer directly contact photoreceptors. (E–F’) Projections of confocal images of the basal layers of third instar control (GMR-Gal4 tub-Gal80 ts ) (E) and damaged (UAS-rpr/+ GMR-Gal4,tub-Gal80 ts ) (F) eye showing the relative position of the anterior border of glial migration with respect to the anterior most row of photoreceptors. In damaged discs, the anterior border of glial migration lays 2–4 row in front of the MF (green dashed line). (G) Graph shows the density of glial cells (number of glial cells/area occupied by glial cells in μm 2 ) in control and damaged UAS-rpr/+ GMR-Gal4 tub-Gal80 ts /+ discs. (H) Graph shows the relative position of the anterior border of glial migration with respect to the anterior most row of photoreceptors (0 indicates the position of this row) in control and damaged UAS-rpr/+ GMR-Gal4 tub-Gal80 ts eye disc. Error bars represent SEM. Statistical analysis is shown in Table A in S1 Text. In this and all subsequent figures, anterior is to the left. Blue dotted lines indicate the approximate limit between eye disc and optical stalk (os). The green dashed line indicates the approximate position of the MF. Scale bars, 50 μm. The numerical data used in this figure are included in S1 Data. GMR, glass multiple reporter; MF, morphogenetic furrow; rpr,reaper; SEM, standard error of the mean. https://doi.org/10.1371/journal.pbio.3001367.g001 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 4 / 39 Fig 2. Overview of glial response at different times after apoptotic induction in the eye discs. (A–H”) Third instar eye discs stained with anti-Elav (red) and anti-Repo (blue), the apoptotic marker Dcp-1 (grey), and Phalloidin to visualise Factina (yellow). Control undamaged disc (GMR-Gal4 tub-Gal80 ts ) (A–B”) and UAS-rpr/+; GMR-Gal4 tub-Gal80 ts /+ eye discs analysed at different times after inducing apoptosis (C–H”). (A, C, E, and G) Apical, (A’, C’, E’, and G’) middle, and (A”, C”, E”, and G”) basal layers of the eye disc epithelium. (B–B”, D–D”, F–F”, and H–H”) X–Z projections show a cross section of the eye discs epithelium perpendicular to the furrow of the discs shown in A (B–B”), C (D–D”), E (F–F”), and G (H–H”). (I) Bar charts show the average density of glial cells of discs analysed at different times after apoptotic induction. (J–L) Bar charts show the average density of glial cells and their apical/basal localisation of discs immediately after apoptotic induction T0 (J), discs analysed after 24 hours of recovering T1 (K), and discs examined after 48 hours of recovering T2 (L). In each graph is also shown the total density of glial cells for control (GMR-Gal4 tub-Gal80 ts /+) and UAS-rpr/+; GMR-Gal4 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 5 / 39 n= 11, p=<0.0001; Fig 2C–2D”, 2I, and 2J). This is mainly due to the increased number of glial cells that appear in the middle/apical layers of the disc epithelium (Fig 2J). After 24 hours of recovery at permissive temperature (T1; Fig 2E–2F”), the density of glial cells was still higher in damaged discs than in control discs; however, numbers were similar to those found at T0 (0.015 ±0.0009 number glial cells/area μ 2 at T0 versus 0.014 ±0.00033 number glial cells/area μ 2 at T1; Fig 2I and 2K). We also observed a high number of glial cells in the middle/apical layers of the retinal epithelium (Fig 2E–2F”). After 48 hours of recovery (T2), we did not see apoptotic cells or cellular debris in the epithelium (Fig 2G–2H”). The density of glial cells was similar to the earlier time points, but higher when compared to control discs (0.01 ±0.00033 number glial cells/area μ 2 in control discs versus 0.016 ±0.0013 number glial cells/area μ 2 at T2; Fig 2G–2H”, 2I and 2L). In contrast to the discs analysed at T0 and T1, we did not find glial cells in the middle or apical layers. The adult eyes derived from these discs were only slightly smaller than control eyes, and they occasionally show small scars in the posterior region (Fig 2N and 2O). Altogether, our data suggest that after inducing cell death in the retinal region, a nonautonomous response is activated, which increases the number of glial cells located in the eye disc epithelium. Glial cell proliferation increases in response to apoptotic induction in the retinal cells The increased number of glial cells observed in damaged eye discs may be due to over-migration of these cells from the optic stalk and/or an excess of glial proliferation. To distinguish between these possibilities, we next examined the proliferation pattern of the glial cells in GMR-Gal4 tub-Gal80 ts UAS-rpr eye discs after inducing cell death during 72 hours. We observed that upon cell death induction, the proportion of glial cells in S phase was higher than in age-matched control animals, as assayed by 5-Ethynyl-2-deoxyuridine (EdU) incorporation (S2A–S2B” and S2E Fig). In addition, we observed an overall increase in the number of dividing glia upon damage (S2F Fig). Only glial cells located in the basal layer of the eye disc undergo mitosis, as we do not find cells expressing PH3 outside this level. Next, we analysed the proliferation dynamics of glial cells during recovery time. To this end, we induced cell death in the retina region during a 24-hour period and then determined the number of positive PH3 glial cells at various time points post damage induction. We found that at T0 glial cell proliferation was already elevated compared to control discs. After 24 hours of recovering (T1), glial proliferation was still higher than in undamaged discs, but similar to tub-Gal80 ts /+ eye discs. (M) Schematic diagram of the temperature shifts used in this experiment. (A–B”’) In control discs, subretinal glial cells are always localised in the basal layer of the eye disc. (C–D”) UAS-rpr/+; GMR-Gal4 tub-Gal80 ts eye discs dissected and analysed immediately after ablation (T0). Apoptotic cells are located in the middle and basal layer of the discs, whereas glial cells appear in the middle (yellow arrowhead in D”) as well as apical planes (green arrowhead in D”) (D–D”). (E–F”) UAS-rpr/+; GMR-Gal4 tub-Gal80 ts /+ eye discs analysed after 24 hours of recovering. The new rows of photoreceptors that are specified during the recovery time are not affected. Note that most cellular debris was displaced towards the posterior region of the discs and even inside the optic stalk. The average density of glial cells in these discs is still higher than in control discs (K). We find a high number of glial cells in apical and middle layers of the discs (yellow arrowhead in F”). (G–H”) Damaged eye discs analysed after 48 hours of recovering. In these discs, we do not find apoptotic debris (in grey) (H–H”). In the posterior region of the disc, we observed very disorganised photoreceptors, which are located in the basal layer and that likely correspond to the photoreceptors that did not die after overexpressing UAS-rpr (yellow arrow in H”). (N–O) Adult control eye (N) and an eye derived from damaged eye discs (O). (P) Bar charts show the average size of control eyes and adult eyes developed from damaged discs. Statistical analysis is shown in Table B in S1 Text. In this and all subsequent figures, white arrows indicate the approximate position of the MF. Scale bars, 50 μm. The numerical data used in this figure are included in S1 Data. GMR, glass multiple reporter; MF, morphogenetic furrow; rpr, reaper. https://doi.org/10.1371/journal.pbio.3001367.g002 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 6 / 39 that observed at T0. However, at T2 (after 48 hours of recovering), the ratio of glial proliferation was similar to that of control undamaged discs (S3E Fig), suggesting that the signals that promote glial division cease after 48 hours of apoptotic induction. To evaluate the contribution of cell proliferation on the increased number of glial cells observed in damaged discs, we blocked glial proliferation after inducing apoptosis in the retinal region. To this end, we used the QF/QUAS system [21,22] in combination with the Gal4 system. To induce genetic ablation, we expressed QUAS-rpr [23] in the retinal cells under the control of GMR-QF, whereas glial proliferation was simultaneously blocked by expressing a constitutively activated form of the Retinoblastoma Factor (UAS-rbf CA280 ) under the control of repo-Gal4 [24]. GMR-QF>rpr tub-Gal80 ts repo>rbf CA280 larvae were raised at 17˚C and then shifted to the restrictive temperature to block cell division for 24 hours. After this time, we found that glial cell proliferation was strongly reduced in both damaged and undamaged discs (Fig 3F). Accordingly, we detected that the number of glial cells was also sharply reduced in damaged discs (0.0178 ±0.0004 glial cells/area μ 2 in control damaged discs, n= 24 versus 0.0049 ±0.001 glial cells/area μ 2 in GMRQF>rpr repo>rbf CA280 discs, n= 11, p=<0.0001; Fig 3C–3E). However, in these discs, we observed more glial cells than in control undamaged discs in which proliferation was blocked (0.0049 ±0.001 glial cells/area μ 2 in GMRQF>rpr repoGal4>rbf CA280 versus 0.001 ±0.00035 glial cells/area μ 2 in repo>rbf CA280 ,p= 0.02; Fig 3E), suggesting that glial over-migration also contributes to the elevated number of glial cells found after inducing apoptosis. The overexpression of UAS-rbf CA280 for a prolonged period of time (72 hours) totally abolished glial cell proliferation, yet more glial cells were found when compared to undamaged discs in which proliferation was blocked (Fig 3E and 3F). Taken together, our data suggest that after cell death induction in the retinal region, signals were generated that ultimately promote nonautonomously glial proliferation and migration, resulting in an increase in the number of these cells in the eye disc. Morphological changes in glial cells in response to damage The eye imaginal disc harbours 2 main glial subtypes, the PN and WG cells. We have examined their behaviour in response to the induction of neuronal cell death. To this end, we induced genetic ablation in the retina using the QF-QUAS system and visualised glial cells with UAS-GFP and a membrane-tethered form of GFP (UAS-mCD8GFP) under the regulation of Mz97-Gal4 and c527-Gal4 driver strains, which drive expression in wrapping and PN glial cells, respectively. Apoptotic induction in the retinal cells causes a remarkable change in the behaviour and morphology of WG cells. In control discs, WG send long cellular projections that follow the axons through the optic stalk towards the brain. However, in damaged GMR-QF; UAS-GFP Mz97-Gal4; QUAS-rpr discs, we did not observe these processes (S4 Fig, compare S4A–S4A’ with S4B–S4B’). In damaged discs, the density of WG, as well as the proportion of these cells in the eye discs, was strongly reduced compared to control discs (0.004 ±0.00024 number of WG/ area μ 2 in control discs, n= 21 versus 0.0026 ±9.7e-005 in damaged discs, n= 17, p<0.0001; Fig 4A–4F’ and 4Q–4R). Since WG cells never divide, either in control or damaged discs, the reduction in the number of WG upon apoptotic induction is likely due to the stalling of the process of differentiation of WG from PN glia. In contrast to control discs where WG cells were always located in the basal layer of the discs, in damaged discs we observed these glial cells in the middle/apical layers of the disc epithelium (Fig 4D–4F’). Moreover, whereas in control discs the anterior most row of WG coincided with the anterior leading edge of the glial field, in damaged discs, WG were located between 5 and 4 rows of glia cells behind this boundary (S4 Fig, compare A with B and E). PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 7 / 39 Fig 3. Overexpression of rbf CA280 in glial cells reduces the number of glial cells observed after cell death induction. (A) The schematic illustration represents a transverse section of an eye disc where the region marked in red (expression domain of GMR-QF) corresponds to the area of the discs that has been damaged using QUAS-rpr GMR-QF. Glial cells are indicated in light blue. repo-Gal4 drives the expression of UAS-rbf CA280 under the control of UAS specifically in glial cells. (B–D) Third instar eye discs stained with anti-Repo (white) and anti-Elav (blue). Control undamaged GMR-QF; tub-Gal80 ts repo-Gal4 eye disc (B), tub-Gal80 ts /+; repo-Gal4/UAS-rbf CA280 (C) and GMR-QF; tub-Gal80 ts /+; repo-Gal4/UAS-rbf CA280 disc (D). The overexpression of UAS-rbf CA280 under the control of repo-Gal4 reduces the number of glial cells in undamaged (C) and damaged eye discs (D). (E) The graph represents the glial density of discs shown in B–D (Control, repo Gal4 -rbf 24hrs ,GMR QF -rpr,GMR QF -rpr repo Gal4 -rbf 24hrs , and GMR QF -rpr repo Gal4 -rbf 72hrs ). (F) The graph shows the percentage of glial cells in mitosis (PH3 positive). Statistical analysis is shown in Table C in S1 Text. Error bars represent SEM. Scale bars, 50 μm. The numerical data used in this figure are included in S1 Data. GMR, glass multiple reporter; rpr,reaper; SEM, standard error of the mean. https://doi.org/10.1371/journal.pbio.3001367.g003 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 8 / 39 Fig 4. WG and PN cells change their morphology in response to apoptotic induction in the retinal region. (A–L) Third instar eye discs stained with anti-Elav (blue) and anti-Repo (red). (A–F’) Mz97-Gal4 driving expression of UAS-GFP (green A–C and D–F and grey A’–C’ and D’–F’) reveals WG cells in control UAS-GFP Mz97-Gal4; QUAS-rpr (A–C’) and in damaged GMR-QF; UAS-GFP Mz97-Gal4; QUAS-rpr (D–F’) discs. (G–L’) c527-Gal4 drives expression of UAS-GFP (green G–I and J–L and grey in G’–I’, J’–L’) in PN glial cells in control UAS-GFP c527-Gal4; QUAS-rpr (G–I’) and damaged GMR-QF; UAS-GFP c527-Gal4; QUAS-rpr eye discs (J–L’). (A–A’, D–D’, G–G’, and J–J’) Apical/middle layers and (B–B’, E–E’, H–H,’ and K–K’) basal layers of the eye disc epithelium. (C–C’, F–F’, I–I’, and L–L’) Orthogonal section perpendicular to the furrow through confocal stacks of the eye discs shown in A–K’. (A–F’) In control discs, we never find WG cells in the middle or apical layer of the discs (A–C’); however, in damaged discs, most WG cells are located in the apical region (D–F’ yellow arrow in F’). These cells extend large processes towards the damaged region (D–D’ and F–F’). Some of these projections go over photoreceptors (yellow arrow in F’). (G–L’) In damaged eye discs, some PN glial cells were located in the middle layers of the disc epithelium (compared J–L’ with control G–I’), and they send cellular projections towards the damage region (yellow arrows in J’ and L’). (M–P”) Third instar eye discs stained with anti-Elav (magenta), anti-Repo (red), and anti-Dcp-1 (grey). (M–N”) Mz97-Gal4 driving expression of UAS-mCD8-GFP (in green and grey in M’) reveals WG cells in damaged GMR-QF; UAS-mCD8-GFP Mz97-Gal4; QUAS-rpr discs. (O–P”) Damaged GMR-QF; UAS-mCD8-GFP c527-Gal4; QUAS-rpr eye discs showing the membranes of PN glial cells. Both glial cell types (WG and PN) have vesicles containing cellular debris labelled with anti-Dcp1 (yellow arrows in M” in WG and in O” in PN). (Q-S) Graphs showing ratio of WG and PN glial cells (number WG or PN glial cells/number Total glia) (Q), WG and PN glial density (R), and nuclei size (S). Scale bars, 10 μm. Statistical analysis is shown in Table D in S1 Text. The numerical data used in this figure are included in S1 Data. GMR, glass multiple reporter; PN, perineurial; rpr,reaper; WG, wrapping glia. https://doi.org/10.1371/journal.pbio.3001367.g004 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 9 / 39 Fig 7. Dpp expression increases after inducing apoptosis in eye discs. (A–F””) Third instar eye discs stained with anti-Elav (Blue), anti-Repo (white in A–C and D–F), GMR-Gal4 UAS-mCD8-GFP (green in A–C, C”, D–F, and F” and grey in C”’ and F”’), and anti Dpp (red in A–C, C’, C”, D–F, F’, and F” and grey in A’, B’, C””, D’, E’, and F””), in control tub-Gal80 ts GMR-Gal4 UAS-mCD8-GFP (A–C””) and damaged UAS-rpr/+; GMR-Gal4 tub-Gal80 ts /UAS-mCD8-GFP discs (D–F””). (B–B’ and E–E) Cross sections perpendicular to the furrow of the eye discs shown in A (B–B’) and D (E–E’). (A” and D”) Profile plot of the average Dpp intensity across the x-axis of the region highlighted by yellow rectangles shown in panels A’ (A”) and D’ (D”). (B” and E”) Profile plot of the average Dpp intensity of the panels shown in B’ (B”) and E’ (E”). (C–C”” and F-F””) Higher magnification images corresponding to the regions highlighted by white rectangles on the panels B (C–C””) and E (F-F””). (A–B”) In control eye discs, Dpp is expressed in a band of cells just anterior to the MF, and its expression levels decrease abruptly to a homogeneous low level behind the furrow. (D–E”) In damaged discs, some photoreceptors (positive staining for anti-Elav in blue, yellow arrowheads in F’) express higher levels of Dpp than the surrounding cells (yellow arrowheads in F’ and F””). In the basal region of the epithelia, where most of the dead cells are located, we only detect low levels of Dpp expression. (G–N’) Third instar eye discs stained with anti-Elav (blue), anti-Repo (green), and anti-B-galactosidase (red in G–N and grey in G’–N’) to reveal the activity of the dad-lacZ reporter in control (GMR-Gal4 tub-Gal80 ts /+; dad-lacZ/+) (G–I’ and M–M’) and damaged UAS-rpr/+; GMR-Gal4 tub-Gal80 ts /+; dad-lacZ/+ discs (J–L’ and N–N’). (G–G’ and J–J’) Apical layers of the eye disc epithelium. (H–H’ and K–K’) Basal layers of the eye disc epithelium. (I–I’ and L–L’) Y–Z projections show 2 cross sections perpendicular to the furrow in control (I–I”) and damaged (L–L’) discs. (M–M’ and N–N’) Higher magnification images corresponding to the regions highlighted by white rectangles on the panels I (M–M’) and L (N–N’). Note that the levels of expression of dadlacZ in glial cells of damaged discs (yellow arrowheads in N and N’) are much higher than in control discs (yellow arrowheads in M–M’). (O) Profile plot of the average β-galactosidase intensity across the x-axis of the region highlighted by yellow rectangles shown in panel H’ (control discs, black line) and K’ (damaged discs, red line). Arrow indicates the approximate position of the MF. The levels of expression of dad-lacZ are similar in control and damaged discs in the region anterior to PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 16 / 39 In control discs, hh-lacZ was expressed at low levels in photoreceptors (S15A–S15D”’ Fig). However, in damaged discs, the activity of this reporter was up-regulated in photoreceptor cells (positive for Elav, green arrows in S15H and S15H’ Fig). Hh:GFP is observed in an anterior–posterior gradient and is strongly accumulated in the apical region of the photoreceptors (S16A–S16F” Fig). Upon apoptosis induction, we find high levels of Hh:GFP throughout the eye discs, not only in the region close to the MF (S16G–S16I’ Fig). Hh:GFP accumulates forming large aggregates in the middle and basal layers of the epithelium, in contrast to control discs, where Hh:GFP always is detected at high levels in the apical region (S16 Fig, compare S16G–S16J”’ with control S16A–S16F”). Most of these aggregates are adjacent to photoreceptors and are not positively stained for DAPI (S16 Fig yellow arrowheads in S16I’, and S16J’ and S16J”), indicating that they do not correspond to cells expressing high levels of Hh, but are likely produced by the adjacent photoreceptors. Occasionally, we find pyknotic nuclei, labelled with DAPI, that have high levels of Hh:GFP (S16 Fig yellow arrows in S16J–S16J’), suggesting that Hh:GFP is also detected at high levels in some apoptotic cells. Accordingly, we find some cells with high levels of Hh:GFP that were also positive for Dcp-1 (blue arrowheads in S16K–S16L” Fig). Interestingly, we observed some glial cells engulfing Hh:GFP aggregates (yellow arrowheads in S16M–S16N” Fig). We next examined whether increased levels of hh expression in retinal cells might activate Hh signalling in subretinal glia by analysing the expression of patched (ptc), a known target of this signalling pathway. Consistent with our previous results, we observed that in GMR>rpr eye discs the levels of Ptc were abnormally high in cells posterior to the MF, as well as in subretinal glial cells (green arrow in S15P–S15P’ Fig). These data suggest that after inducing cell death in the retinal region, some apically located photoreceptor neurons and some interommatidial cells up-regulate Dpp and Hh in response to apoptotic signals. These factors, in turn, nonautonomously would activate these 2 signalling pathways in glial cells. Dpp and hh signalling are necessary to promote glial response Our observations indicate that in response to cell death induction, both Dpp and Hh signalling were activated in the retina region, as well as in glial cells, leading us to consider if these signals might be involved in stimulating glial response to damage. To assess this, we first examined whether the depletion of dpp and hh would alter the density and/or proliferation of glial cells observed in damaged discs. To this end, we performed RNA interference (RNAi)-mediated knockdowns of Hh and Dpp levels by expressing RNAi lines under the control of GMR-Gal4 while simultaneously inducing apoptosis using UAS-rpr. None of the UAS-dpp RNAi lines employed in our assay significantly modified the effects on glia numbers observed after apoptotic induction (Fig 8C and 8G,S17 Fig). We obtained similar results when Hh levels were knock down upon induction of cell death using the same experimental setup (Fig 8D and 8G). Next, we tested whether the simultaneous depletion of Dpp and Hh levels affects glial response by co-expressing UAS-dpp RNAi ,UAS-hh RNAi and UAS-rpr under the control of GMR-Gal4. We found that Dpp and Hh simultaneous knockdown impairs the accumulation of glial cells upon cell death induction (0.019 ±0.00045 glial cells/μ 2 in control GMR>rpr discs, n= 39 versus 0.015 ±0.00039 glial cells/μ 2 in GMR>rpr UAS-dpp RNAi33 UAS-hh RNAi discs, n= 18, p<0.0001; Fig 8A, 8B and 8G). Accordingly, we found that compared to control damaged discs, glial cell proliferation was reduced (1.8 ±0.1% mitotic glial cells in control the MF, but in glial cells posterior to the MF, this reporter is expressed at higher levels in glial cells of damaged discs than in control glial cells. Scale bars, 10 μm. Dpp, Decapentaplegic; GMR, glass multiple reporter; MF, morphogenetic furrow; rpr,reaper. https://doi.org/10.1371/journal.pbio.3001367.g007 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 17 / 39 Fig 8. The down-regulation of Dpp and Hh signalling reduce glial response. (A–F and I–N) Projections of confocal images of third instar eye discs stained with anti-Elav (blue) and anti-Repo (white). (A–F) Effects caused by the downregulation of Dpp and Hh signalling in the damaged region. The schematic illustration on the left represents a transverse section of an eye disc where the region marked in red (expression domain of GMR-Gal4) corresponds to the area of the discs that has been damaged at the same time that Dpp and/or Hh signalling were depleted. (A) UAS-rpr/+; GMR-Gal4 tub-Gal80 ts /+ damaged eye disc. (B) Damaged UAS-rpr/+; GMR-Gal4 tub-Gal80 ts / UAS-hh RNAi ;UASPLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 18 / 39 GMR>rpr discs versus 1.23 ±0% mitotic glial cells in GMR>rpr UAS-dpp RNAi33 UAS-hh RNAi discs, p= 0.01; Fig 8H). The down-regulation of dpp and hh function under the control of GMR-Gal4 using the same experimental conditions neither affect the density or the division of glial cells in control conditions (Fig 8G and 8H, Table G in S1 Text). To confirm that this effect was not due to a titration of Gal4 activity caused by introducing an additional transgene, we used damaged eye discs that have 2 UAS reporters as a control (Fig 8G). In this experimental setup, the effects on glial density were similar to those found in control damaged discs with only 1 UAS construct (Fig 8G). We next examined the consequence of inducing apoptosis in the retinal region and simultaneously blocking Dpp and/or Hh pathways in glial cells. Once again, we combined the QF/QUAS and Gal4/UAS system. To block Dpp signalling in glial cells, we overexpressed brinker (brk) or dad, under the control of repo-Gal4.brinker encodes for a sequence-specific transcriptional repressor that negatively regulates Dpp-dependent genes, whereas dad encodes the inhibitory SMAD in the BMP/Dpp pathway and subsequently down-regulates Dpp signalling activity [48]. The overexpression of UAS-brk or UAS-dad in the glial cells of damaged discs was sufficient to prevent the accumulation of glia induced upon damage (0.018 ±0.0004 glial cells/μ 2 in control damaged discs, n= 27 versus 0.0067 ±0.007, glial cells/μ 2 in GMR-QF>rpr repo>brk, n= 20 p<0.0001, and 0.01 ±0.0037 glial cells/μ 2 in GMR-QF>rpr repo>dad,n= 13 p<0.0001; Fig 8O,S17 Fig). Also, glial proliferation decreased in damaged discs expressing UAS-brk or UAS-dad (2.3 ±0.23% mitotic glial cells in GMR-QF>rpr repo-Gal4 versus 0.58 ±0.25% in GMR-QF>rpr repo>brk discs, p<0.0001 and 1.07 ±0.29 in GMR-QF>rpr repo>dad,n= 11 p= 0.009; Fig 8P). The overexpression of these genes under the control of repo-Gal4 without inducing apoptosis also caused a significant reduction in the number of glial cells, as well as in their rate of proliferation (Fig 8O and 8P,S17 Fig, Table G in S1 Text, Table F in S2 Text). These results imply that Dpp signalling pathway is necessary for increasing the number of glial cells in response to damage. We also analysed the effects of blocking Hh signalling in glial cells upon apoptotic induction, by overexpressing UAS-ci RNAi or UAS-ptc, under the control of repo-Gal4. We observed that after inducing cell death, the down-regulation of Hh signalling did not cause any significant change in the number of glial cells compared to control damaged eye discs (Fig 8J, 8O and 8P,S17 Fig, Table G in S1 Text, Table F in S2 Text). In line with our previous observations, we found that upon apoptotic induction, the simultaneous depletion of Hh and Dpp pathways in glial cells by co-expressing UAS-dad and UASci RNAi or UAS-brk and UAS-ptc under the control of repo-Gal4, significantly reduced the number of glial cells, compared with discs in which only Dpp signalling was depleted (0.0067 ±0.007 glial cells/μ 2 in GMR-QF>rpr repo>UAS-brk,n= 20 versus 0.004 ±0.0007 glial cells/μ 2 in GMR-QF>rpr repo>-ptc brk discs, n= 12, p= 0.047; Fig 8N, 8O and 8P, dpp RNA33i . (C) Damaged UAS-rpr/+; GMR-Gal4 tub-Gal80 ts ; UAS-dpp RNAi33 (BDSC33618). (D) UAS-rpr/+; GMR-Gal4 tub-Gal80 ts / UAS-hh RNAi damaged discs. (E) Control undamaged GMR-Gal4 tub-Gal80 ts /+ disc. (F) GMR-Gal4 tubGal80 ts / UAS-hh RNAi ;UAS-dpp RNAi33 eye discs. (G and H) Graphs show glial cell density (G) and percentage of mitotic glia cells of discs shown in A–F. (I–N) Effects of the down-regulation of Dpp and Hh signalling in glial cells in damaged discs. In the schematic illustration on the left is indicated in red the region that has been damaged (GMR-QF;QUASrpr) and in light blue glial cells. (I) GMR-QF; tub-Gal80 ts ;repo-Gal4 QUAS-rpr eye disc. (J) GMR-QF; tub-Gal80 ts /UASptc;repo-Gal4 QUAS-rpr.(K) GMR-QF; tub-Gal80 ts ;repo-Gal4 QUAS-rpr/UAS-brk. (L) GMR-QF; tub-Gal80 ts /UAS-ptc; repo-Gal4 QUAS-rpr/UAS-brk. (M) Control undamaged tub-Gal80 ts ; repo-Gal4 disc. (N) tub-Gal80 ts /UAS-ptc;repoGal4 /UAS-brk. (O and P) Graphs show glial cell density (O) and percentage of mitotic glial cells (P) of discs shown in I–N. Scale bars, 50 μm. Statistical analysis is shown in Table G in S1 Text. The numerical data used in this figure are included in S1 Data. GMR, glass multiple reporter; Dpp, Decapentaplegic; Hh, Hedgehog; RNAi, RNA interference; rpr, reaper. https://doi.org/10.1371/journal.pbio.3001367.g008 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 19 / 39 S17 Fig, Table G in S1 Text, Table F in S2 Text). Interestingly, the proliferative ratio of the glial cells in these discs was similar to that found when only Dpp signalling was reduced, suggesting that Dpp plays a more important role in the control of glial proliferation than Hh signalling. We next examined the consequence of overexpressing UAS-dpp and UAS-hh under the control of GMR-Gal4. Excess glial cells were observed after overexpressing dpp, but not when hh was ectopically expressed (0.0099 ±0.00034 glial cells/μ 2 in control discs, n= 47 versus 0.0122 ±0.00045 glial cells/μ 2 in GMR>dpp discs, n= 15, p= 0.0039; S18E Fig, Table G in S2 Text). The ectopic expression of both genes produce a significant increase in glial density with respect to that observed in GMR>dpp discs (0.0122 ±0.00045 glial cells/μ 2 in GMR>dpp discs, n= 15 versus 0.0145 ±0.00079 glial cells/μ 2 in GMR>dpp hh discs n= 14, p= 0.046; S18 Fig, Table G in S2 Text). Glial cells proliferation also increased after the co-overexpression of both genes, but not when they are individually overexpressed (S18 Fig, Table G in S2 Text). To complement this analysis, we examined the effects caused by the ectopic activation of these signalling pathways in glial cells. To this end, we ectopically expressed under the control of repoGal4 a constitutively activated version of the receptor Thickvein (tkv QD ), Interference hedgehog (Ihog) and a mutated form of ci (ci m1-3 � 103 )that increases the activity of this transcription factor [49–52]. ihog encodes for a transmembrane protein that is essential for Hh pathway activation [53]. We confirmed that the overexpression of UAS-ihog was sufficient to up-regulate Hh signalling by observing high Ptc levels in these discs (S19 Fig). The density of glial cells in eye discs overexpressing UAS-ihog or UAS-ci m1-3 � 103 under the control of repo-Gal4 was similar to that of control discs (Fig 9G). Whereas the overexpression of UAS-tkv QD under the control of repo-Gal4 (repo-Gal4 UAS-tkv QD )caused a mild increase in glial density (0.0094 ±0.00037 glial cells/μ 2 in control discs, n= 23 versus 0.012 ±0.0004 glial cells/μ 2 in repo>tkv QD discs n= 18, p= 0.03; Fig 9), although glial cell proliferation was not statistically significantly augmented (1.64 ±0.11% mitotic glial cells in control discs, n= 22 versus 1.52±0.15% in repo>tkv QD discs, n= 16, p= 0.9; Fig 9H). However, the co-overexpression of UAS-tkv QD and UAS-ihog under repo-Gal4 strongly increased both glial cell density as well as proliferation (0.0094 ±0.00037 glial cells/μ 2 and 1.64 ±0.11% mitotic glial cells in control discs versus 0.019 ±0.001 glial cells/μ 2 and 2.54 ±0.2% mitotic glial cells in repo>ihog tkv QD ; Table H in S1 Text). These effects are not reproduced after co-expressing UAS-tkv QD and UAS-ci m1-3 � 103 (Fig 9). Interestingly, the coactivation of both signalling pathways, either by co-expressing UAStkv QD and UAS-ci m1-3 � 103 or UAS-tkv QD and UAS-ihog, promotes the over-migration of glial cells. Thus, whereas in most discs overexpressing either UAS-tkv QD ,UAS-ihog or UAS-ci m13 � 103 , the anterior border of glial migration lies 2 to 4 rows of ommatidia posterior to the MF, a high percentage of discs overexpressing simultaneously both UAS-tkv QD and UAS-ihog or UAS-ci m1-3 � 103 shown glial cells overcoming that border (Fig 9D, 9E and 9I). Glial motility stimulation by Dpp and Hh signalling depends on JNK function The results described so far indicate that JNK signalling facilitates glial motility during normal development, as well as in response to apoptotic induction. Similarly, our observations suggest that Dpp and Hh signalling stimulate both the proliferation and the motility of the subretinal glia. Next, we investigated whether JNK mediates some of these functions promoted by Dpp and Hh signalling. Firstly, we examined the activity of puc2B-lacz in discs overexpressing UAS-dpp and/or UAS-hh in the retinal region under the control of GMR-Gal4. The ectopic expression of UAS-hh did not significantly modify the activity of this reporter (S20B’ Fig), while the overexpression of UAS-dpp increased the percentage of glial cells that express the reporter (17.39 ±1% glial cells express the reporter in control discs, n= 13 versus 25.9 ±1.9 in PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 20 / 39 GMR>dpp discs, n= 9, p= 0.0036; S20C and S20E Fig), as well as the proportion of glial that express the reporter at high levels (5.4 ±0.991% glial cells express the reporter at high levels in control discs, n= 11 versus 11.02 ±1.67 in GMR>dpp discs, n= 9, p= 0.047; S20E Fig). The co-expression of both factors strengthens the latter effect (S20D–S20D” Fig), although the percentage of glial cells expressing puc2B-lacz is comparable to that observed when UAS-dpp was expressed alone (S20E Fig, Table H in S2 Text). Thus, these results suggest that Dpp signalling is sufficient to activate JNK signal on glial cells, although Hh signalling strengthens this effect. Fig 9. Overexpression of ihog and tkv QD in glial cells induces over-migration and proliferation. (A–F) Third instar eye discs stained with anti-PH3 (red) and anti-Repo (green). Basal layers of the eye disc epithelium. (A) Control tub-Gal80 ts repo-Gal4 eye disc. (B)tub-Gal80 ts /UAS-ihog; repo-Gal4/+. (C) tub-Gal80 ts /+; repo-Gal4/UAS-tkv QD . (D) tub-Gal80 ts /UAS-tkv QD /UAS-ci m1-3 ;repo-Gal4/UAStkv QD . (E) tubGal80 ts /UAS-ihog;repo-Gal4/UAS-tkv QD . (F) hepr75;tub-Gal80 ts /UASihog; repo-Gal4/UAS-tkv QD . The overexpression of tkv QD under the control of repo-Gal4 increases the number of glial cells (C). The co-overexpression of UAStkv QD and UAS-ihog under repo-Gal4 increases the density and proliferation of subretinal glial cells and promotes the over-migration of these cells (E). The overmigration phenotype and the increase of glial density caused by the overexpression of UAS-tkv QD and UAS-ihog with repo-Gal4 was suppressed in the hep r75 mutant discs. Nonetheless, the glial cell division was not significantly altered (F and H). (G) The graph represents the glial density of discs shown in A-F. (H) Histogram showing the percentage of glial cells in mitosis (Ph3 positive) of discs indicated in A–F. (I) The graph represents the percentage of discs with glial overmigration shown in A–F. Scale bars, 50 μm. Statistical analysis is shown in Table H in S1 Text. The numerical data used in this figure are included in S1 Data. https://doi.org/10.1371/journal.pbio.3001367.g009 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 21 / 39 To define whether JNK signalling mediates some of the effects induced by these 2 signalling pathways, we examined glial proliferation and density in hep r75 mutant discs after overexpressing UAS-tkv QD and UAS-ihog under the control of repo-Gal4. In this mutant background, there is a drastic reduction in the density of glial cells compared to UAS-tkv QD UAS-ihog repoGal4 discs (0.019 ±0.001 glial cells/μ 2 in repo>tkv QD ihog discs, n= 22 versus 0.012 ±0.0009 in hep R75 repo>tkv QD ihog discs, n= 13, p<0.0001; Fig 9, Table H in S1 Text). However, glial cell proliferation was not significantly altered (2.39 ±0.16% mitotic glial cells in repo>tkv QD ihog discs, n= 11 versus 2.35 ±0.13% in hep R75 repo>tkv QD ihog discs, n= 14, p= 0.9; Fig 9, Table H in S1 Text). We also found that the over-migration phenotype caused by the overexpression of UAS-tkv QD UAS-ihog was totally suppressed in the hep r75 mutant background (91.67% in repo>tkv QD ihog discs, n= 18 versus 0% in hep R75 repo>tkv QD ihog discs, n= 18; compare Fig 9D and 9E with 9F). Therefore, these results are consistent with a model in which the function of JNK is necessary to facilitate the over-migration of glial cells induced when Dpp and Hh signalling are overexpressed. Glial activity in response to damage is mediated by JNK signalling Next, we investigated whether the JNK signalling pathway, which was highly activated in some WG and PN cells in response to damage, influences the behaviour of these cells. We first examined WG morphology and behaviour upon damage induction in different mutant conditions of the JNK signalling pathway. To specifically knock down JNK function in WG cells, we overexpressed UAS-puc or UASbsk DN under the regulation of Mz97-Gal4. In undamaged Mz97-Gal4 UAS-GFP UAS-puc discs the density, proportion (WG/Total glial cells), morphology, and localisation of WG were not altered when compared with control discs (Mz97-Gal4 UAS-GFP). However, in discs ectopically expressing bsk DN under the control of Mz97-Gal4 or in hep r75 mutant discs, we observed a weak, but statistically significant reduction of the density of WG (Fig 10K), although the proportion of these cells was not altered (Fig 10L). The down-regulation of JNK signalling in WG cells, either via the overexpressing UAS-puc or UAS-bsk DN , in damaged discs altered neither the density of these cells nor their location in the apical/middle layers of the discs (Fig 10G– 10I’ and 10K). However, we did detect a reduction in the proportion of WG (WG/total glial cells) in these discs compared to injured control discs (Fig 10L). Moreover, although we observed cellular debris inside these WG cells (S21 Fig), they hardly ever developed cytoplasmic projections as those presented in activated WG in control discs (compare Fig 10E with 10H). This is most clearly seen in a time-lapse image analysis (compare S2 Video with S5 Video). Another feature of activated WG cells was the enlargement of their nuclei. Interestingly, this effect was suppressed when JNK was reduced (49.9±1.28 μ 2 in GMR>rpr Mz97-GFP discs versus 39.5±1.56 in GMR>rpr Mz97>bsk DN discs, p<0.0001; Fig 10M). We also examined whether the reduction of the function of Hh and Dpp signalling affects the ability of WG to engulf cellular debris. We observed that WG overexpressing either UASbrk or UAS-ptc under the regulation of Mz97-Gal4 in damaged discs contain cellular debris, as assayed by staining for anti-cleaved Dcp-1 (S21 Fig). Cell death induction in the leg disc epithelium promotes the accumulation of glial cells To determine whether the signalling network regulating glial response in the eye discs functions in other regions of the PNS, we examined glial cells response upon apoptotic induction in the leg discs. The leg imaginal disc is an epithelial structure that comprises a variety of sense organs arranged in a precise and reproducible pattern. These sensory elements contain glial PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 22 / 39 Fig 10. JNK depletion affects the morphology and behaviour of WG in damaged eye discs. (A–I’) Third instar eye discs stained with anti-Elav (blue A, A’, D, D’, G, and G’ and grey C, C’, F, F’, I, and I’) and anti-Repo (red). (A–I’) Mz97-Gal4 driving expression of UAS-GFP (green A, A’, D, D’, G, and G’ and grey B, B’, E, E’ H, and H’) reveals WG cells in control UAS-GFP Mz97-Gal4; QUAS-rpr (A–C’), damaged eye discs (GMR-QF; UAS-GFP Mz97-Gal4; QUAS-rpr (D–F’), and damaged eye discs with depleted JNK signalling function GMR-QF; UAS-GFP Mz97-Gal4; repo-Gal4 QUAS-rpr/UAS-puc (G–I’). (A’–C’, D’–F’, and G’–I’) PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 23 / 39 cells that are specified in the CNS/PNS transition region during larval development and have to migrate through a nerve into the forming leg (Fig 11A and 11B) [16]. To analyse glial cells response upon apoptotic inductions in the leg disc, we transiently overexpress UAS-rpr under the control of Distal-less (Dll) or hh-Gal4.Dll-Gal4 is expressed in the central part of the leg, in a region corresponding to the distal elements of the appendages, and is not active in glial cells (Fig 11, yellow arrows in 11F). The overexpression of UAS-rpr during 48 hours leads to increased levels of apoptosis throughout the Dll domain (Fig 11G’). The number of glial cells in the leg epithelium after inducing apoptosis strongly increases compared with control discs (102.2 ±4.07 number of glial cells in control discs, n= 60 versus 153.1 ±11.67 in Dll>rpr,n= 15, p<0.0001; Fig 11C and 11G–11G’”, Table J in S1 Text). Interestingly, in contrast to control discs in which glial cells are located close to the nerve branches innervating the leg discs [16] (Fig 11I–11J”), in damaged leg discs, some glial cells leave the nerve and spread over the leg epithelium (Fig 11, compare 11I–11J” with 11K–11L”). In contrast to eye discs, we do not find that glial cells proliferation increases upon apoptosis induction (Fig 11D). Similar results were observed when rpr was expressed under the hh-Gal4 line (Fig 11C and 11D). We next examined the activity of JNK signalling after inducing apoptosis. In third instar control leg discs, the TRE-GFP reporter is expressed in a group of cells in the distal segment of the appendage and at low levels in few glial cells (S22 Fig). Upon cell death induction using Dll-Gal4, the activity of TRE-GFP significantly increases throughout the discs epithelium, as well as in glial cells (yellow arrowheads in S22C–S22D’ Fig). To complement the expression analysis, we examined glial response to cell death induction in a hep r75 mutant background. The total number of glial cells was significantly smaller in hep r75 hh>rpr damaged leg discs than in control hh>rpr damaged leg discs (96.91 +8.8 glial cells in hep r75 hh>rpr leg discs versus 163±18 in hh>rpr,p= 0.0001; S22E–S22I Fig, Table I in S2 Text). We also examined whether the expression of dpp and hh was altered upon apoptosis induction in the leg disc. The overexpression of UAS-rpr under the control of Dll-Gal4 induces the ectopic expression hh throughout the central region of the leg disc, including the anterior compartment (S23 Fig). However, Hh signalling was not activated in glial cells, as assayed by staining for anti-Ptc (S23G–S23L’ Fig). The expression of dpp was also altered upon apoptotic induction, since we observed that in these discs dpp-lacZ is expressed throughout the domain of expression of Dll-Gal4 (S24 Fig compare S24B–S24B’ with control discs S24A–S24A’). Accordingly, the expression of dad-lacZ was also altered in the leg discs epithelium (S24 Fig). Interestingly, dad-lacZ was detected also in glial cells that enter in the leg epithelium (S24 Fig blue arrows in S24H and S24H’). To assess whether Dpp and or Hh signalling might be involved in stimulating glial response in the leg disc, we first examined whether the depletion of dpp and hh affects glial response in leg dics. To do this, we overexpressed UAS-hh RNAi and/or a UAS-dpp RNAi33 during 48 hours under the control of Dll-Gal4 while simultaneously inducing cell death using UAS-rpr. The overexpression of UAS-dpp RNAi33 impairs the accumulation of glial cells in leg discs after cell death induction (146.2 ±5.94 glial cells in Dll>rpr,n= 25 versus 105 ±7.54 glial cells in Cross sections perpendicular to the furrow of eye discs shown in A–I. The apical localisation of WG cells observed in damaged discs is not prevented by the reduction of JNK signalling (compared E’ to H’). However, when the function of JNK signalling is blocked, WG cells do not produce the large processes found in WG in damaged disc (compared E to H). (J) Detailed frames from in vivo time-lapse analysis (S5 Video) of eye discs. When JNK is blocked, WG cells do not form cellular projections, as it occurs in damaged discs. (K–M) Graphs showing WG and PN glial density (K), ratio of WG and PN glial cells (number of wrapping or PN glial cells/total number of glial cells) (L), and nuclei size (M). Scale bars, 10 μm. Statistical analysis is shown in Table I in S1 Text. The numerical data used in this figure are included in S1 Data. GMR, glass multiple reporter; JNK, c-Jun N-terminal kinase; PN, perineurial; puc,puckered;rpr,reaper; WG, wrapping glia. https://doi.org/10.1371/journal.pbio.3001367.g010 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 24 / 39 Fig 11. The induction of cell death in the leg disc causes glial cells accumulation in the leg disc epithelium. (A and B) Schematic illustrations of leg discs, frontal view (A) and lateral view (B). Leg discs are concentrically organised, and they are connected to the VNC through the leg nerve. In third instar larvae, the glial cells in the leg discs (in green) are accumulated along the leg nerve (in red) and along 2 nerves into the telescoping leg. (C) The graph indicates the total number of glial cells in control and leg discs after cell death induction using Dll-Gal4 and hh-Gal4 lines. (H) Histogram showing the percentage of glial cells in mitosis (PH3 positive) in leg discs analysed in C. (E–E”” and G–G””) Projections of confocal image stacks of control Dll-Gal4 tub-Gal80 ts /UAS-mCD8-GFP (E–E”’), and UAS-rpr;Dll-Gal4 tub-Gal80 ts / UAS-mCD8-GFP (G–G””) leg discs after inducing cell death. (F–F” and H–H”) X–Z projections show a cross section of the leg discs epithelium shown in E (F–F”) and G (H–H”). The discs were stained for anti-Repo (white in E, E”’, F, F”, G, G”’, and H) anti-Dcp1 (red in E, F, F”, G, H, and H’ and grey in E’, G’, and H”), anti-Elav (blue in E, F, F”, G, H, and H’ and grey in E” and G”), and Dll>CD8GFP (green in E, F, F’, G, and H). Dll-Gal4 is not expressed in glial cells, since these cells do not express GFP under the control Dll-Gal4 (yellow arrows in F). The overexpression of UAS-rpr under the control of Dll-Gal4 tubGal80 ts induces cell death throughout the leg discs epithelium, including some of the neurons forming part of the sense organs contained in this structure (yellow arrows in H’ and H”). (I–I” and K–K”) Projections of confocal image stacks of control Dll-Gal4 tub-Gal80 ts (I–I”) and UAS-rpr; Dll-Gal4 tub-Gal80 ts (K–K”) leg discs after inducing cell death. (J–J” and L–L”) Cross section of the leg discs shown in I (J–J”) and K (L–L”). The leg PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 25 / 39 Generation of puc cis-regulatory modules reporters We selected 2 different regions of the regulatory region of the gene puckered (puc-1 and puc-2; see S7 Fig) on the basis of the published open chromatin profile of eye discs during tumour development [32]. The selected region were amplified using KOD enzyme (Novagen, Gibbstown, New Jersey, USA) by PCR using the following primers: PUC1: Forward: CAGTAAGCTTGCCGTCAACTTTTATCTGCCAACG Reverse: CAGTAGATCTCGGGCTAATTGGACTGGGGTTCAA PUC2: Forward: CAGTAAGCTTGGGGTGGCAATGACTCACAATAGG Reverse: CAGTAGATCTCTGCAAAGATACATGCGGATCGG The PCR products were cloned into the attB-hs44-nuc-lacZ vector using the HindIII and BglII restriction endonucleases (NEB, Ipswich, Massachusetts, USA). The 2 sequences (puc1 and puc2) were further subdivided into smaller overlapping fragments. The puc1 region of 2782 bp was divided into 3 fragments: puc1A (978 bp), puc1B (938 bp), and puc1C (839 bp), while the puc2 region of 1,636 bp was subdivided into 2 fragments: puc2A (897 bp) and puc2B (578 bp). To this end, PCR were performed using the aforementioned attB-hs44puc1-nuc-lacZ and attB-hs44-puc2nuc-lacZ constructs as template. We added targets for the restriction enzymes BglII and HindIII to all the fragments generated and then cloned into the attB-hs44-nuc-lacZ vector using these restriction sites. Quantitative analysis Images were processed using ImageJ software (NUH, Bethesda, USA). We calculated glial density as the ratio between the number of glial cells, detected by the expression of Repo and the size of the region occupied by glial cells behind the MF in μm 2 , without including the optical nerve (Repo positive cells/size of the area in μm 2 ). In Fig 1B’, for instance, this region would correspond to the region expressing GFP (green), without including the region of the optical stalk (marked with a blue dotted line). Eye discs were measured using ImageJ. Glial cell division was calculated as the ratio between the number of PH3-positive glial cells and the size of the region posterior to the MF in μm 2 (PH3-positive glial cells/size of the area in μm 2 ) or as the percentage of PH3-positive glial cells (PH3-positive glial cells /Total glial cells �100). The percentage of glial cells incorporating EdU was calculated dividing the number of glial cells incorporating EdU by the total number of glial cells. We calculated the density of WG cells, dividing the number of glial cells expressing UAS-GFP under the control of Mz97-Gal4 by the area of the region occupied by glial cells in μm 2 . The proportion of WG cells in each eye discs analysed was calculated as the ratio between the number of glial cells expressing UAS-GFP under the control of Mz97-Gal4 and the total number of glial cells (Mz97-Gal4 UAS-GFP glial cells/Repo positive cells glial). Nuclei size was automatically calculated using the ImageJ software (NUH). We adjusted threshold intensity to visualise the nuclei of WG cells expressing UAS-GFP under control of Mz97-Gal4. Then, we automatically calculated the area size of each nucleus using the Area option in Set Measurements. We exclude the areas corresponding to the fusion of 2 or more glial cells. The percentage of glial cells expressing the reporter puc2B was calculated dividing the number of glial cells that expressed puc2B-lacZ at detectable levels by the total number of glial cells in each eye. PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 32 / 39 To calculate the number of glial cells that expressed puc2B-lacz at high levels in each eye disc analysed, we used ImageJ to automatically calculate the intensity of expression of puc2BlacZ in all glial cells of the discs. Then we defined the percentage of cells that express the reporter at high levels; we established a threshold where the maximum value corresponds to the maximum value for that specific sample, and the minimum value corresponds to a value 10% less than the maximum value. In this sense, we have an internal control for each sample to compare between different images. To calculate the motility of glia cells, we selected several points of the glial front at the start of the movie and the distance to the closest perpendicular point at the end of the movie was measured. If the end point is closer to the MF than the start point, then the distance covered is considered positive. If opposite, the distance is considered negative (pvalue = 0.0172, n= at least 3 independent movies). Images were adjusted for display using ImageJ (Fiji, NUH, Bethesda, USA). Profile plots were made using “plot profile” in Fiji, based on the average intensity of the image across the xaxis of the region indicated in the figures. Discs were stained and imaged alongside sibling controls, ensuring identical conditions for each group. In vitro culture Imaginal discs were cultured as described [74]. Statistical analysis For statistical tests applied to each experiment, nand p-values, please see tables in S1 and S2 Text. p-Values shown on the graphs are indicated with the following asterisk codes: �p<0.5; �� p<0.01; ��� p<0.001; ���� p<0.0001. The error bars indicate the standard error of the mean (SEM). Microscopy Images were captured using a Confocal LSM510 Vertical Zeiss (Oberkochen, Germany) and processed with ImageJ or Adobe Photoshop CS4 (San Jose, California, USA). Supporting information S1 Fig. UAS-rpr expression under the control of GMR-Gal4 induces apoptosis in the eye imaginal disc. GMR, glass multiple reporter. (TIF) S2 Fig. Glia proliferation after inducing cell death in the retinal region discs. (TIF) S3 Fig. Pattern of proliferation of glial cells at different times after inducing apoptosis. (TIF) S4 Fig. WG cells generate new projections in direction to the damage area. WG, wrapping glia. (TIF) S5 Fig. Apoptotic induction in retinal cells promotes phagocytic activity in glial cells. (TIF) S6 Fig. JNK pathway is ectopically activated in glial cells in response to damage in the retina. JNK, c-Jun N-terminal kinase. (TIF) PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 33 / 39 S7 Fig. JNK signalling is activated in response to damage. JNK, c-Jun N-terminal kinase. (TIF) S8 Fig. puc reporter. puc,puckered. (TIF) S9 Fig. The co-overexpression of UAS-bsk DN and UAS-rpr under the control of GMR-Gal4 induces apoptosis in the eye imaginal disc. GMR, glass multiple reporter. (TIF) S10 Fig. eiger is not required during the development of glial cells in the eye disc. (TIF) S11 Fig. Glial motility is affected in hep r75 mutant discs. (TIF) S12 Fig. The overexpression of eiger in the retina region is not sufficient for activating JNK signalling in glial cells. JNK, c-Jun N-terminal kinase. (TIF) S13 Fig. Overexpression of hep CA does not increase the number of glial cells in the eye discs. (TIF) S14 Fig. Expression of dpp-LacZ and pMad increase in damaged discs. (TIF) S15 Fig. Expression of Hh and ptc in damaged discs. Hh, Hedgehog; ptc, patched. (TIF) S16 Fig. Hh localises in the apical area of the eye discs. Hh, Hedgehog. (TIF) S17 Fig. The down-regulation of Dpp and Hh signalling reduces glial cells response. Dpp, Decapentaplegic; Hh, Hedgehog. (TIF) S18 Fig. The overexpression of dpp and hh induces over migration and proliferation of glial cells. Dpp, Decapentaplegic; Hh, Hedgehog. (TIF) S19 Fig. Ptc is expressed at high levels in discs overexpressing ihog.ptc, patched. (TIF) S20 Fig. Overexpression of dpp in the retina region induces activation of JNK signalling in glial cells. Dpp, Decapentaplegic; JNK, c-Jun N-terminal kinase. (TIF) S21 Fig. The down-regulation of JNK signalling does not impair the ability of glial cells to engulf cellular debris. JNK, c-Jun N-terminal kinase. (TIF) S22 Fig. JNK signalling is mediating the glial response triggers after cell death induction in the leg discs. JNK, c-Jun N-terminal kinase. (TIF) PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 34 / 39 S23 Fig. Hh signalling is not activated in glial cells in the leg discs in response to apoptotic induction. Hh, Hedgehog. (TIF) S24 Fig. Dpp signalling is activated after cell death induction in the leg discs, and its function is necessary for inducing glial response. Dpp, Decapentaplegic. (TIF) S25 Fig. The down-regulation of Dpp signalling reduces glial migration in the leg discs. Dpp, Decapentaplegic. (TIF) S26 Fig. The up-regulation of Dpp and Hh signalling increases glial migration in the leg. Dpp, Decapentaplegic; Hh, Hedgehog. (TIF) S1 Text. Statistical analysis tables of main figures. (PDF) S2 Text. Statistical analysis tables of Supporting information figures. (PDF) S3 Text. Figure legends of Supporting information figures. (DOCX) S1 Data. Raw numerical values of main figures. (XLSX) S2 Data. Raw numerical values of Supporting information figures. (XLSX) S1 Video. Confocal time-lapse imaging of damaged GMR-QF; UAS-GFP Mz97-Gal4; QUAS-rpr eye disc. GMR, glass multiple reporter. (AVI) S2 Video. Confocal time-lapse imaging of control UAS-GFP Mz97-Gal4 eye discs. (AVI) S3 Video. Time-lapse imaging showing the motility of glial cells in control eye discs. Glial cells are labelled with UAS-GFP using repo-Gal4. (AVI) S4 Video. Time-lapse imaging showing the motility of glial cells in hep r75 ;repo-Gal4 UAS-GFP mutant eye discs. (AVI) S5 Video. Confocal time-lapse imaging of damaged GMR-QF/UAS-bsk DN ; UAS-GFP Mz97-Gal4; QUAS-rpr eye disc. Mz97-Gal4 drives UAS-bsk DN and UAS-GFP expressions to reveal WG cells. GMR, glass multiple reporter; WG, wrapping glia. (AVI) Acknowledgments We thank Jose Felix de Celis and Luis Alberto Baena for providing reagents and useful discussion and Claire Hills for helping to improve the manuscript. We are very grateful to Gines Morata, Isabel Guerrero, Hermann Steller, Sergio Casas, Matthew C. Gibson, the Bloomington PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 35 / 39 Stock Center, and the Developmental Studies Hybridoma Bank for providing fly strains and antibodies. Author Contributions Conceptualization: Antonio Baonza. Data curation: Antonio Baonza. Formal analysis: Sergio B. Velarde, Alvaro Quevedo, Antonio Baonza. Funding acquisition: Antonio Baonza. Investigation: Sergio B. Velarde, Alvaro Quevedo, Carlos Estella, Antonio Baonza. Methodology: Sergio B. Velarde, Alvaro Quevedo. Supervision: Antonio Baonza. Writing – original draft: Antonio Baonza. Writing – review & editing: Sergio B. Velarde. References 1. Kato K, Losada-Perez M, Hidalgo A. Gene network underlying the glial regenerative response to central nervous system injury. Dev Dyn. 2018; 247:85–93. https://doi.org/10.1002/dvdy.24565 PMID: 28791751 2. Klambt C. Modes and regulation of glial migration in vertebrates and invertebrates. Nat Rev Neurosci. 2009; 10:769–79. https://doi.org/10.1038/nrn2720 PMID: 19773781 3. Brosius Lutz A, Barres BA. Contrasting the glial response to axon injury in the central and peripheral nervous systems. Dev Cell. 2014; 28:7–17. https://doi.org/10.1016/j.devcel.2013.12.002 PMID: 24434136 4. Li F, Sami A, Noristani HN, Slattery K, et al. Glial Metabolic Rewiring Promotes Axon Regeneration and Functional Recovery in the Central Nervous System. Cell Metab. 2020; 32(5):767–85. https://doi.org/ 10.1016/j.cmet.2020.08.015 PMID: 32941799 5. Rangarajan R, Gong Q, Gaul U. Migration and function of glia in the developing Drosophila eye. Development. 1999; 126:3285–92. PMID: 10393108 6. Franzdottir SR, Engelen D, Yuva-Aydemir Y, Schmidt I, Aho A, Klambt C. Switch in FGF signalling initiates glial differentiation in the Drosophila eye. Nature. 2009; 460:758–61. https://doi.org/10.1038/ nature08167 PMID: 19597479 7. Yildirim K, Petri J, Kottmeier R, Klambt C. Drosophila glia: Few cell types and many conserved functions. Glia. 2019; 67:5–26. https://doi.org/10.1002/glia.23459 PMID: 30443934 8. Yuva-Aydemir Y, Klambt C. Long-range signaling systems controlling glial migration in the Drosophila eye. Dev Neurobiol. 2011; 71:1310–6. https://doi.org/10.1002/dneu.20893 PMID: 21538921 9. Chotard C, Salecker I. Glial cell development and function in the Drosophila visual system. Neuron Glia Biol. 2007; 3:17–25. https://doi.org/10.1017/S1740925X07000592 PMID: 18333286 10. Silies M, Yuva Y, Engelen D, Aho A, Stork T, Klambt C. Glial cell migration in the eye disc. J Neurosci. 2007; 27:13130–9. https://doi.org/10.1523/JNEUROSCI.3583-07.2007 PMID: 18045907 11. Silies M, Yuva-Aydemir Y, Franzdottir SR, Klambt C. The eye imaginal disc as a model to study the coordination of neuronal and glial development. Fly (Austin). 2010; 4:71–9. https://doi.org/10.4161/fly.4. 1.11312 PMID: 20160502 12. Wolff T, Ready DF. Pattern formation in the Drosophila retina. In: Bate M, Martinez-Arias A, editors. The development of Drosophila melanogaster. Cold Spring Harbor, New York; Cold Spring Harbor Laboratory Press: 1993. 13. Baker NE, Yu SY. The EGF receptor defines domains of cell cycle progression and survival to regulate cell number in the developing Drosophila eye. Cell. 2001; 104:699–708. https://doi.org/10.1016/s00928674(01)00266-5 PMID: 11257224 14. Baonza A, Freeman M. Control of cell proliferation in the Drosophila eye by Notch signaling. Dev Cell. 2005; 8:529–39. https://doi.org/10.1016/j.devcel.2005.01.019 PMID: 15809035 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 36 / 39 15. Choi KW, Benzer S. Migration of glia along photoreceptor axons in the developing Drosophila eye. Neuron. 1994; 12:423–31. https://doi.org/10.1016/0896-6273(94)90282-8 PMID: 8110466 16. Sasse S, Klambt C. Repulsive Epithelial Cues Direct Glial Migration along the Nerve. Dev Cell. 2016; 39:696–707. https://doi.org/10.1016/j.devcel.2016.11.016 PMID: 27997826 17. Jessen KR, Mirsky R. The repair Schwann cell and its function in regenerating nerves. J Physiol. 2016; 594:3521–31. https://doi.org/10.1113/JP270874 PMID: 26864683 18. Sasse S, Neuert H, Klambt C. Differentiation of Drosophila glial cells. Wiley Interdiscip Rev Dev Biol. 2015; 4:623–36. https://doi.org/10.1002/wdev.198 PMID: 26178654 19. Fernandes VM, Chen Z, Rossi AM, Zipfel J, Desplan C. Glia relay differentiation cues to coordinate neuronal development in Drosophila. Science. 2017; 357:886–91. https://doi.org/10.1126/science.aan3174 PMID: 28860380 20. Fan Y, Bergmann A. Distinct mechanisms of apoptosis-induced compensatory proliferation in proliferating and differentiating tissues in the Drosophila eye. Dev Cell. 2008; 14:399–410. https://doi.org/10. 1016/j.devcel.2008.01.003 PMID: 18331718 21. Potter CJ, Tasic B, Russler EV, Liang L, Luo L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 2010; 141:536–48. https://doi.org/10.1016/j.cell. 2010.02.025 PMID: 20434990 22. Potter CJ, Luo L. Using the Q system in Drosophila melanogaster. Nat Protoc. 2011; 6:1105–20. https:// doi.org/10.1038/nprot.2011.347 PMID: 21738124 23. Pe ´rez-Garijo A, Fuchs Y, Steller H. Apoptotic cells can induce non-autonomous apoptosis through the TNF pathway. Elife. 2013; 24:2, e01004. https://doi.org/10.7554/eLife.01004 PMID: 24066226 24. Du W, Vidal M, Xie JE, Dyson N. RBF, a novel RB-related gene that regulates E2F activity and interacts with cyclin E in Drosophila. Genes Dev. 1996; 10:1206–18. https://doi.org/10.1101/gad.10.10.1206 PMID: 8675008 25. Sanjuan MA, Dillon CP, et al. Toll-like receptor signalling in macrophages links the autophagy pathway to phagocytosis. Nature. 2007; 450:1253–7. https://doi.org/10.1038/nature06421 PMID: 18097414 26. Kato K, Awasaki T, Ito K. Neuronal programmed cell death induces glial cell division in the adult Drosophila brain. Development. 2009; 136:51–9. https://doi.org/10.1242/dev.023366 PMID: 19019992 27. Kato K, Forero MG, Fenton JC, Hidalgo A. The glial regenerative response to central nervous system injury is enabled by pros-notch and pros-NFkappaB feedback. PLoS Biol. 2011; 9:e1001133. https:// doi.org/10.1371/journal.pbio.1001133 PMID: 21912512 28. Lu TY, MacDonald JM, Neukomm LJ, Sheehan AE, Bradshaw R, Logan MA, et al. Axon degeneration induces glial responses through Draper-TRAF4-JNK signalling. Nat Commun. 2017; 8:14355. https:// doi.org/10.1038/ncomms14355 PMID: 28165006 29. Tavares L, Correia A, Santos MA, Relvas JB, Pereira PS. dMyc is required in retinal progenitors to prevent JNK-mediated retinal glial activation. PLoS Genet. 2017; 13:e1006647. https://doi.org/10.1371/ journal.pgen.1006647 PMID: 28267791 30. Chatterjee N, Bohmann D. A versatile PhiC31 based reporter system for measuring AP-1 and Nrf2 signaling in Drosophila and in tissue culture. PLoS ONE. 2012; 7:e34063. https://doi.org/10.1371/journal. pone.0034063 PMID: 22509270 31. Martin-Blanco E, Gampel A, Ring J, Virdee K, Kirov N, Tolkovsky AM, et al. puckered encodes a phosphatase that mediates a feedback loop regulating JNK activity during dorsal closure in Drosophila. Genes Dev. 1998; 12:557–70. https://doi.org/10.1101/gad.12.4.557 PMID: 9472024 32. Davie K, Jacobs J, Atkins M, Potier D, Christiaens V, Halder G, et al. Discovery of transcription factors and regulatory regions driving in vivo tumor development by ATAC-seq and FAIRE-seq open chromatin profiling. PLoS Genet. 2015; 11(2):e1004994. https://doi.org/10.1371/journal.pgen.1004994 PMID: 25679813 33. Sluss HK, Han Z, Barrett T, Goberdhan DC, Wilson C, Davis RJ, et al. A JNK signal transduction pathway that mediates morphogenesis and an immune response in Drosophila. Genes Dev. 1996; 10:2745–58. https://doi.org/10.1101/gad.10.21.2745 PMID: 8946915 34. Weston CR, Davis RJ. The JNK signal transduction pathway. Curr Opin Cell Biol. 2007; 19:142–9. https://doi.org/10.1016/j.ceb.2007.02.001 PMID: 17303404 35. Ma X, Huang J, Yang L, Yang Y, Li W, Xue L. NOPO modulates Egr-induced JNK-independent cell death in Drosophila. Cell Res. 2012; 22:425–31. https://doi.org/10.1038/cr.2011.135 PMID: 21844890 36. Wang X, Huang X, Wu C, Xue L. Pontin/Tip49 negatively regulates JNK-mediated cell death in Drosophila. Cell Death Discov. 2018; 4:8. https://doi.org/10.1038/s41420-018-0074-1 PMID: 30062057 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 37 / 39 37. Siegrist SE, Haque NS, Chen CH, Hay BA, Hariharan IK. Inactivation of both Foxo and reaper promotes long-term adult neurogenesis in Drosophila. Curr Biol. 2010; 20:643–8. https://doi.org/10.1016/j.cub. 2010.01.060 PMID: 20346676 38. Heberlein U, Singh CM, Luk AY, Donohoe TJ. Growth and differentiation in the Drosophila eye coordinated by hedgehog. Nature. 1995; 373:709–11. https://doi.org/10.1038/373709a0 PMID: 7854455 39. Heberlein U, Wolff T, Rubin GM. The TGFbeta homolog dpp and the segment polarity gene hedgehog are required for propagation of a morphogenetic wave in the Drosophila retina. Cell. 1993; 75:913–26. https://doi.org/10.1016/0092-8674(93)90535-x PMID: 8252627 40. Curtiss J, Mlodzik M. Morphogenetic furrow initiation and progression during eye development in Drosophila: the roles of decapentaplegic, hedgehog and eyes absent. Development. 2000; 127:1325–36. PMID: 10683184 41. Greenwood S, Struhl G. Progression of the morphogenetic furrow in the Drosophila eye: the roles of Hedgehog, Decapentaplegic and the Raf pathway. Development. 1999; 126:5795–808. PMID: 10572054 42. Wiersdorff V, Lecuit T, Cohen SM, Mlodzik M. Mad acts downstream of Dpp receptors, revealing a differential requirement for dpp signaling in initiation and propagation of morphogenesis in the Drosophila eye. Development. 1996; 122:2153–62. PMID: 8681796 43. Hummel T, Attix S, Gunning D, Zipursky SL. Temporal control of glial cell migration in the Drosophila eye requires gilgamesh, hedgehog, and eye specification genes. Neuron. 2002; 33:193–203. https:// doi.org/10.1016/s0896-6273(01)00581-5 PMID: 11804568 44. Rangarajan R, Courvoisier H, Gaul U. Dpp and Hedgehog mediate neuron-glia interactions in Drosophila eye development by promoting the proliferation and motility of subretinal glia. Mech Dev. 2001; 108:93–103. https://doi.org/10.1016/s0925-4773(01)00501-9 PMID: 11578864 45. Akiyama T, Gibson MC. Decapentaplegic and growth control in the developing Drosophila wing. Nature. 2015; 19;375–378 https://doi.org/10.1038/nature15730 PMID: 26550824 46. Affolter M, Marty T, Vigano MA, Jazwinska A. Nuclear interpretation of Dpp signaling in Drosophila. EMBO J. 2001; 20:3298–305. https://doi.org/10.1093/emboj/20.13.3298 PMID: 11432817 47. Kai T, Spradling A. An empty Drosophila stem cell niche reactivates the proliferation of ectopic cells. Proc Natl Acad Sci U S A. 2003; 15:4633–8. https://doi.org/10.1073/pnas.0830856100 PMID: 12676994 48. Tsuneizumi K, Nakayama T, Kamoshida Y, Kornberg TB, Christian JL, Tabata T. Daughters against dpp modulates dpp organizing activity in Drosophila wing development. Nature. 1997; 389:627–31. https://doi.org/10.1038/39362 PMID: 9335506 49. Chen Y, Goodman RH, Smolik SM. Cubitus interruptus requires Drosophila CREB-binding protein to activate wingless expression in the Drosophila embryo. Mol Cell Biol. 2000; 20:1616–25. https://doi.org/ 10.1128/MCB.20.5.1616-1625.2000 PMID: 10669739 50. Das P, Maduzia LL, Wang H, Finelli AL, Cho SH, Smith MM, et al. The Drosophila gene Medea demonstrates the requirement for different classes of Smads in dpp signaling. Development. 1998; 125:1519– 28. PMID: 9502733 51. Nellen D, Affolter M, Basler K. Receptor serine/threonine kinases implicated in the control of Drosophila body pattern by decapentaplegic. Cell. 1994; 78:225–37. https://doi.org/10.1016/0092-8674(94)902933PMID: 8044837 52. Pignoni F, Zipursky SL. Induction of Drosophila eye development by decapentaplegic. Development. 1997; 124:271–8. PMID: 9053304 53. Camp D, Currie K, Labbe A, van Meyel DJ, Charron F. Ihog and Boi are essential for Hedgehog signaling in Drosophila. Neural Dev. 2010; 5:28. https://doi.org/10.1186/1749-8104-5-28 PMID: 21044292 54. Rodrigues F, Schmidt I, Klambt C. Comparing peripheral glial cell differentiation in Drosophila and vertebrates. Cell Mol Life Sci. 2011; 68:55–69. https://doi.org/10.1007/s00018-010-0512-6 PMID: 20820850 55. Hidalgo A, Logan A. Go and stop signals for glial regeneration. Curr Opin Neurobiol. 2017; 47:182–7. https://doi.org/10.1016/j.conb.2017.10.011 PMID: 29126016 56. Arthur-Farraj PJ, Latouche M, Wilton DK, Quintes S, Chabrol E, Banerjee A, et al. c-Jun reprograms Schwann cells of injured nerves to generate a repair cell essential for regeneration. Neuron. 2012; 75:633–47. https://doi.org/10.1016/j.neuron.2012.06.021 PMID: 22920255 57. Xu XM, Guenard V, Kleitman N, Aebischer P, Bunge MB. A combination of BDNF and NT-3 promotes supraspinal axonal regeneration into Schwann cell grafts in adult rat thoracic spinal cord. Exp Neurol. 1995a; 134:261–72. 58. Xu XM, Guenard V, Kleitman N, Bunge MB. Axonal regeneration into Schwann cell-seeded guidance channels grafted into transected adult rat spinal cord. J Comp Neurol. 1995b; 351:145–60. PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 38 / 39 59. Jessen KR, Mirsky R, Lloyd AC. Schwann Cells: Development and Role in Nerve Repair. Cold Spring Harb Perspect Biol. 2015; 7:a020487. https://doi.org/10.1101/cshperspect.a020487 PMID: 25957303 60. Ovrebo JI, Edgar BA. Polyploidy in tissue homeostasis and regeneration. Development. 2018; 145: dev156034. https://doi.org/10.1242/dev.156034 PMID: 30021843 61. Xiong X, Wang X, Ewanek R, Bhat P, Diantonio A, Collins CA. Protein turnover of the Wallenda/DLK kinase regulates a retrograde response to axonal injury. J Cell Biol. 2010; 191:211–23. https://doi.org/ 10.1083/jcb.201006039 PMID: 20921142 62. Brace EJ, DiAntonio A. Models of axon regeneration in Drosophila. Exp Neurol. 2017; 287:310–7. https://doi.org/10.1016/j.expneurol.2016.03.014 PMID: 26996133 63. Song Y, Ori-McKenney KM, Zheng Y, Han C, Jan LY, Jan YN. Regeneration of Drosophila sensory neuron axons and dendrites is regulated by the Akt pathway involving Pten and microRNA bantam. Genes Dev. 2012; 26:1612–25. https://doi.org/10.1101/gad.193243.112 PMID: 22759636 64. Macdonald JM, Doherty J, Hackett R, Freeman MR. The c-Jun kinase signaling cascade promotes glial engulfment activity through activation of draper and phagocytic function. Cell Death Differ. 2013; 20:1140–8. https://doi.org/10.1038/cdd.2013.30 PMID: 23618811 65. Jiang H, Grenley MO, Bravo MJ, Blumhagen RZ, Edgar BA. EGR/RAS/MAPK signalling mediates adult midgut epithelial homeostasis and regeneration in Drosophila. Cell Stem Cell. 2011; 8:84–95. https:// doi.org/10.1016/j.stem.2010.11.026 PMID: 21167805 66. Haley B, Hendrix D, Trang V, Levine M. A simplified miRNA-based gene silencing method for Drosophila melanogaster. Dev Biol. 2008; 321:482–90. https://doi.org/10.1016/j.ydbio.2008.06.015 PMID: 18598689 67. Adachi-Yamada T, Fujimura-Kamada K, Nishida Y, Matsumoto K. Distortion of proximodistal information causes JNK-dependent apoptosis in Drosophila wing. Nature. 1999; 400:166–9. https://doi.org/10. 1038/22112 PMID: 10408443 68. Nellen D, Burke R, Struhl G, Basler K. Direct and long-range action of a DPP morphogen gradient. Cell. 1996; 85:357–68. https://doi.org/10.1016/s0092-8674(00)81114-9 PMID: 8616891 69. Jazwinska A, Kirov N, Wieschaus E, Roth S, Rushlow C. The Drosophila gene brinker reveals a novel mechanism of Dpp target gene regulation. Cell. 1999; 96:563–73. https://doi.org/10.1016/s0092-8674 (00)80660-1 PMID: 10052458 70. Torroja C, Gorfinkiel N, Guerrero I. Patched controls the Hedgehog gradient by endocytosis in a dynamin-dependent manner, but this internalization does not play a major role in signal transduction. Development. 2004; 131:2395–408. https://doi.org/10.1242/dev.01102 PMID: 15102702 71. Johnson RL, Grenier JK, Scott MP. Patched over-expression alters wing disc size and pattern: transcriptional and post-transcriptional effects on hedgehogtargets. Development. 1995; 121:4161–70. PMID: 8575316 72. Xin S, Weng L, Xu J, Du W. The role of RBF in developmentally regulated cell proliferation in the eye disc and in Cyclin D/Cdk4 induced cellular growth. Development. 2002; 129:1345–56. PMID: 11880344 73. Freeman M. Reiterative use of the EGF Receptor triggers differentiation of cell types in the Drosophila eye. Cell. 1996; 87:651–60. https://doi.org/10.1016/s0092-8674(00)81385-9 PMID: 8929534 74. Aldaz S, Escudero LM, Freeman M. Live imaging of Drosophila imaginal disc development. Proc Natl Acad Sci U S A. 2010; 107:14217–22. https://doi.org/10.1073/pnas.1008623107 PMID: 20660765 PLOS BIOLOGY Signalling network regulating glial response to neural apoptosis in Drosophila PLOS Biology | https://doi.org/10.1371/journal.pbio.3001367 August 11, 2021 39 / 39