The total mRNA concentration buffering system in yeast is global rather than gene-specific

1 The total mRNA concentration buffering system in yeast is global rather than gene-specific José García-Martínez1, Daniel A. Medina1&, Pablo Bellvís2, Mai Sun3$, Patrick Cramer3, Sebastián Chávez2,4* and José E. Pérez-Ortín1* 1Instituto de Biotecnología y Biomedicina (BIOTECMED), Facultad de Biológicas, Universitat de València. C/ Dr. Moliner 50. E46100 Burjassot, Spain. 2Instituto de Biomedicina de Sevilla, Universidad de Sevilla-CSIC-Hospital Universitario V. del Rocío, Seville, 41012, Spain. 3Max Planck Institute for Biophysical Chemistry, Department of Molecular Biology, Am Fassber 11, 37077 Göttingen, Germany. 4Dirección de Evaluación y Acreditación, Agencia Andaluza del Conocimiento. Doña Berenguela s/n, planta 3ª C.P. 14006 Córdoba, Spain. *Corresponding authors All correspondence should be sent to: José E. Pérez-Ortín Departamento de Bioquímica y Biología Molecular Facultad de Biológicas. Universitat de València. C/ Dr. Moliner 50. E46100 Burjassot, Spain Phone +34 963543467 Fax +34 963544635 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 2 Current addresses: &Laboratorio de Biotecnología Aplicada, Facultad de Medicina Veterinaria, Universidad San Sebastián, Puerto Montt, 5480000, Chile $Illumina GmbH, Zeppelinstraße 71-73, 81669 München, Germany Short Title: Total mRNA buffering system is not gene-specific Key words: crosstalk, transcription, mRNA decay, yeast, aneuploidy, NMD .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 3 Abstract Gene expression in eukaryotes does not follow a linear process from transcription to translation and mRNA degradation. Instead it follows a circular process in which cytoplasmic mRNA decay crosstalks with nuclear transcription. In many instances this crosstalk contributes to buffer mRNA at a roughly constant concentration. Whether the mRNA buffering concept operates on the total mRNA concentration or at the genespecific level, and if the mechanism to do so is a global or a specific one, remain unknown. Here we assessed changes in mRNA concentrations and their synthesis rates along the transcriptome of aneuploid strains of the yeast Saccharomyces cerevisiae. We also assessed mRNA concentrations and their synthesis rates in non sense-mediated decay (NMD) targets in euploid strains. We found that the altered synthesis rates in the genes from the aneuploid chromosome and the changes in their mRNA stabilities were not counterbalanced. In addition, the stability of NMD targets was not specifically compensated by the changes in synthesis rate. We conclude that there is no genetic compensation of NMD mRNA targets in yeast, and total mRNA buffering uses mostly a global system rather than a gene-specific one. Abbreviations: SR (Synthesis Rate); NMD (Non sense-Mediated Decay); DR (Degradation Rate); [mRNA]t (Total mRNA concentration); PTC (Premature Stop Codon); HL (mRNA Half Life); RBP (RNA-Binding Protein); BF (Buffering Factor); RA (mRNA amount or level); GRO (Genomic Run-On); cDTA (comparative Dynamic Transcriptome Analysis); TRO (Transcription Run-On). .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 4 Introduction Cell homeostasis requires the total concentrations of proteins and RNAs to be remain within a certain range (Pérez-Ortín et al. 2019). In the yeast Saccharomyces cerevisiae, it has been shown that the total mRNA concentration ([mRNA]t) is buffered (PérezOrtín et al. 2013; Sun et al. 2013; Haimovich et al. 2013). Indeed several reports in strains with mutations in proteins related to either mRNA synthesis or decay machineries indicate the primary defect caused by mutation: a drop in global synthesis rates or degradation rates is compensated by a roughly comparable increase in the reciprocal rate (Sun et al. 2013; Haimovich et al. 2013; Timmers and Tora 2018; Begley et al. 2019). In principle, buffering can also apply to specific mRNAs or groups of functionally-related mRNAs. For instance, the existence of [mRNA]t buffering in a series of yeast mutants showed that the buffering effect varies between individual mRNA species (Sun et al. 2013; Haimovich et al. 2013; Timmers and Tora 2018; Begley et al. 2019; Medina et al. 2014; García-Molinero et al. 2018). Yet despite the indirect effects of mutations, it is still difficult to unequivocally conclude whether genespecific buffering exists or not. In mammalian cells, the attenuation of global transcription leads to the widespread stabilization of mRNAs (Helenius et al., 2011; Slobodin et al., 2020) which, thus, demonstrates the existence of [mRNA]t buffering in higher eukaryotes (Hartenian and Glaunsinger 2019). In these organisms, specific mRNA buffering has also been demonstrated in one particular case called genetic compensation, where destabilization of some defective mRNAs by the non sense-mediated decay (NMD) pathway is partially compensated by a rise in the synthesis rates of sequence-related genes (Ma et al. 2019; El-Brolosy et al. 2019). .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 5 Global or gene-specific buffering is likely driven by distinct molecular mechanisms, and the purpose of each process might be completely different. Total mRNA buffering may have evolved to keep [mRNA]t within the physiological limits that maintain processes in the cytoplasm efficient, e.g., translation (Pérez-Ortín et al. 2019; Lin and Amir 2018), and to also maintain normal physico-chemical cytoplasm behavior and the solubility of cellular proteins, which very much depend on RNA concentration (Tauber et al. 2020; Aarum et al, 2020). However, the purpose of genespecific mRNA buffering is likely an entirely different one. For instance, it could be used to transiently adjust transcriptional response timing. In fact it has been shown that the genes with or without antisense transcription have different average mRNA halflives , and antisense transcription inactivation can lead to an increase in sense synthesis rate and a decrease in half life, which would help to make the mRNA level (or mRNA amount) constant (Brown et al. 2018). In this case, the specific buffering effect is obtained through chromatin signatures, which are established by antisense transcription and affect the initiation and elongation of sense transcription. The influence of transcription elongation on mRNA stability has been recently established (Begley et al. 2019; 2020; Fischer et al., 2020). Hence, the control by antisense transcription, which reduces production and increases stability, but maintains the same final transcript level, can be a regulatory process for specific genes and a useful one when rapidly varying conditions are expected (Brown et al. 2018). [mRNA]t buffering is based on the crosstalk between transcription and mRNA decay machineries (Sun et al. 2013; Haimovich et al. 2013; Das et al. 2017). This crosstalk functions from the nucleus to the cytoplasm (direct) (Dahan and Choder 2013), and from the cytoplasm to the nucleus (reverse) (Sun et al. 2013). As such, it has been suggested that the gene expression process in eukaryotes is circular (Haimovich et al. 2013). Direct crosstalk may occur by either mRNA imprinting (Choder 2011) with .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 6 RNA-binding proteins (RBP) or the co-transcriptional methylation of specific nucleotides (Slobodin et al. 2020). The reverse crosstalk mechanism is less clear, but may be based on the titration of general RBPs in the cytoplasm with mRNA molecules. Titration by mRNAs limits the number of RBP molecules that are imported back to the nucleus and, therefore, senses [mRNA]t (Gilbertson et al. 2018; Schmid and Jensen 2018; Hartenian and Glausinger 2019). However, these studies did not conclusively answer the question as to whether [mRNA]t buffering is the additive consequence of gene-specific regulations of many individual mRNA species, or if it operates as a global mechanism. Here we used the model eukaryote S. cerevisiae to investigate whether widespread gene-specific mRNA buffering exists. To achieve this, we employed a set of aneuploid strains with either excess of or a defect in a single copy of a chromosome. This allowed us to assess if the presumed increase/decrease in gene transcription of the genes belonging to that particular chromosome would provoke a compensatory effect on their mRNAs stabilities. We also studied NMD targets in wild-type and upf1 mutant euploid strains to check if an increase in the mRNA stabilities of a selected group of mRNAs would provoke a specific compensatory effect on their synthesis rates. We conclude from our results that, at least in this unicellular eukaryote, most genes do not undergo gene-specific mRNA buffering, which seems mostly a global process. Results For our search to find the mechanism behind [mRNA]t buffering, we designed two strategies to test the existence of gene-specific mRNA buffering in the yeast S. cerevisiae. Both are based on the idea that if one of the two buffering parameters, synthesis rates or half lives, of a selected group of non functionally related genes .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 7 changes in relation to the whole genome, it will cause a similar relative change in its mRNA levels unless a gene-specific crosstalk buffers it by acting on the reciprocal parameter. For the synthesis rate change, we employed stable aneuploid strains in which a single chromosome had a different copy number because this would bring about a change in the synthesis rates only in the set of genes contained in that chromosome. To illustrate half life alteration, we analyzed the mRNAs affected by the NMD pathway that destabilized mRNAs with premature stop codons and other specific sequence features (Celik et al. 2017). Transcriptomic study of a set of aneuploid yeast strains In order to investigate the alteration of synthesis rates in a non functionally related group of genes, we took advantage of the fact that some yeast strains have an extra copy of one chromosome (disomic/trisomic) in haploid/diploid backgrounds, or only one copy of a chromosome (monosomic) in diploid strains. In these strains, we expect an increase or decrease in the synthesis rate, respectively, of the genes belonging to the aneuploid chromosome in relation to the rest of the genome. The buffering effect cannot be investigated by simply looking at the mRNA level , as other researchers have previously done (Torres et al 2007; Hose et al. 2015), because of the possible influence of both synthesis rate and half life on the actual mRNA level. The growth phenotype of many single-gene mutant yeast strains is partially suppressed by the over- /underexpression of a set of genes contained in a given chromosome (Hughes et al. 2000). If the average synthesis rate and mRNA amount in the aneuploid chromosome vary in parallel in relation to the other chromosomes (e.g. no change in average half life), then we can reject the gene-specific buffering hypothesis. .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 8 We first employed a series of mutant strains that had been determined as aneuploids by two different genomic methods in two separate laboratories: Genomic Run-on (GRO, Haimovich et al. 2013) and a comparative Dynamic Transcriptome Analysis (cDTA, Sun et al. 2013). All these mutant strains were initially assumed to be euploids. After discovering that some of them had an additional copy of one chromosome or were diploids with a single copy of one chromosome it was necessary, in the original study, to remake them and check that they were euploids (Sun et al. 2013). In the present study, we used the initial aneuploid strains to analyze their mRNA amounts, synthesis rates and half lives. As seen in Figure 1A, all the haploid strains with a disomy displayed an average increase in the synthesis rate of about 1.71-fold (except for mutant edc1) in relation to the whole genome. This was similar to that of the mRNA amount (1.76-fold) for aneuploid chromosomes as regards the whole transcriptome (Table 1). The diploid strains with one monosomy showed an average 0.56-fold decrease in both the synthesis rate and mRNA amount for aneuploid chromosomes (Figure 1B-C and Table 1). Thus we concluded that no change occurred in the half lives of the mRNAs of the chromosome with an altered ploidy. The previous strains were all mutants in the genes associated with mRNA decay. Despite the fact that the deleted gene had no direct relation to most of the genes in the altered copy chromosome, an indirect effect of the mutation occurring on the buffering phenomenon could be argued. To address this issue, we carried out another experiment with a series of stable aneuploids with no known mutations requiring compensation. We specifically utilized a series of haploid or diploid strains with an extra chromosome constructed in A. Amon’s laboratory (Hose et al. 2015). Once again, and as seen in Figure 1D, the higher synthesis rate values (1.64 for the disomic chromosome in haploid and 1.39-fold for the trisomic chromosome in diploid strains) were comparable to those .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 9 for the increase in mRNA amount: 1.64and 1.33-fold, respectively (Table 1). This indicated that no specific buffering for mRNAs with an increased synthesis rate existed. From these experiments, we concluded that when the copy number of a group of genes was altered compared to the rest of the genome, the synthesis rates increased or decreased accordingly. This increase or decrease took place to a lesser extent than we expected (see the Discussion). As this change in the average synthesis rate was comparable to that observed in the average mRNA amount in all cases, we concluded that no specific mechanism existed in yeast to detect altered levels of individual mRNAs and to correct them by half life change compensation. Alteration of mRNA stability via NMD: effect of a premature STOP codon We first investigated if the NMD pathway is able to direct the specific crosstalk that buffers the increased decay of the mRNAs containing a premature stop codon (PTC) in the same way as in metazoa (Ma et al. 2019; El-Brolosy et al. 2019). To check whether this behavior was also present in yeast, we engineered a copy of a fusion gene with or without a PTC (Fig. 2A). We measured the stability of both mRNAs and found a significant decrease in the half life of the allele containing the PTC (Fig. 2B, left panel). As an internal control, we measured the stability of the GAL1 gene, which is driven by the same promoter, and found no significant change (Fig 2B, left panel). To further confirm that the diminished stability of the PTC-containing mRNA was due to the action of the NMD system, we repeated the experiments with an upf1∆ mutant, which lacked one of the fundamental NMD machinery factors. As expected, the mRNA stability of the PTC-containing allele significantly increased, and no changes were detected in the internal GAL1 control (Fig 2B, right panel). .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 16 and Degradation Rates (inverse to half lives) of all the genes are measured genomewide. The cDTA data are deposited in ArrayExpress with accession number E-MTAB1525. Specific mRNA half-life calculations In order to determine single-species mRNA half lives, we ran a transcription shut-off assay by collecting samples at 0, 5, 10 and 15 min after glucose addition. This method was the same as that described in (Begley et al. 2019), except that Northern blot hybridization was used instead of RT-PCR. half lives were estimated by calculating the time it takes for half the initial amount of mRNA to be degraded. mRNA extraction and Northern blots were carried out following the protocols detailed in (Morillo-Huesca et al. 2006). . Transcription run-on and RNApol II-chromatin immunoprecipitation assays The transcription run-on (TRO) assays of PHO5-lacZ fusions and GAL1 were performed as in (Gómez-Herreros et al., 2012). PHO5-lacZ signals were normalized against the plasmid copy number as determined by Q-PCR, and by adapting the method described in (Skulj et al. 2008) to yeast cells. The total genomic DNA from plasmidcontaining yeast was obtained and the Q-PCR signal of lacZ (amplicon corresponding to position 3 in Fig. 2A) was compared to the signal of the chromosomic GAL1 gene. QPCR was carried out with SYBR Green Premix Ex Taq (Takara) in a Light Cycler 480 II (Roche). .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 17 The RNApol II ChIP experiments were run using anti-Rpb3 antibodies (ab81859; Abcam) as in (Begley et al. 2019). Sequences of the oligonucleotide employed in this work for the detection of PHO5-lacZ and GAL1 by Q-PCR are the following: ATGCTCGTGACTTCTTGGCTC and AAAACGGCGAAACTGGTTTGG (position 1), GCACCGATCGCCCTTCCCAAC and CCAGGCAAAGCGCCATTCGCC (position 2), CGCGGCGACTTCCAGTTCAAC and AGATGGCGATGGCTGGTTTCC (position 3), CGGTCGTTGCAGAACATTATG and GATCTTCCTCACCGCAAACAG (GAL1). Acknowledgements We thank A. Amon and M. Choder for their generous gift of yeast strains, and M. Choder and A. Singh for helpful discussion. This work was funded with grants from the Spanish Ministry of Economy and Competitiveness, the European Union (FEDER) [BFU2016-77728-C3-1-P to S. C.], [BFU2016-77728-C3-3-P to J.E.P-O] and [RED2018-102467-T to J.E.P-O and S.C.], the Regional Valencian Government [AICO2019/088 to J.E.P-O] and the Junta de Andalucía [BIO-271 to S.C.]. Supplementary Information Table S1. List of the yeast strains used in this paper. Table S2. Genomic data from the aneuploid mutant strains used in Figure 1A & C. Table S3. Genomic data from the aneuploid strains used in Figure 1D. Table S4. Genomic data from the upf1 and BY4741 strains used in Figure 3. .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 18 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 19 References Aarum J, Cabrera CP, Jones TA, Rajendran S, Adiutori R, Giovannoni G, Barnes MR, Malaspina A, Sheer D. 2020. Enzymatic degradation of RNA causes widespread protein aggregation in cell and tissue lysates. EMBO Rep 21:e49585. doi:10.15252/embr.201949585. Begley V, Corzo D, Jordán-Pla A, Cuevas-Bermúdez A, de Miguel-Jiménez L, PérezAguado D, Machuca-Ostos M, Navarro F, Chávez MJ, Pérez-Ortín JE, et al. 2019. The mRNA degradation factor Xrn1 regulates transcription elongation in parallel to Ccr4. Nucleic Acids Res 47: 9524-9541. doi:10.1093/nar/gkz660. Begley V, Jordán-Pla A, Peñate X, Garrido-Godino AI, Challal D, Cuevas-Bermúdez A, Mitjavila A, Barucco M, Gutiérrez G. Singh A, et al. 2020. Xrn1 influence on gene transcription results from the combination of general effects on elongating RNA pol II and gene-specific chromatin configuration. bioRxiv doi:10.1101/2020.06.02.129171. Brown T, Howe FS, Murray SC, Wouters M, Lorenz P, Seward E, Rata S, Angel A, Mellor J. 2018. Antisense transcription-dependent chromatin signature modulates sense transcript dynamics. Mol Syst Biol 14: e8007. doi:10.15252/msb.20178007 Celik A, Baker R, He F, Jacobson A. 2017. High-resolution profiling of NMD targets in yeast reveals translational fidelity as a basis for substrate selection. RNA 23: 735748. doi:10.1261/rna.060541.116. Choder M. 2011. mRNA imprinting: additional level in the regulation of gene expression. Cell Logist 1: 37-40. doi:10.4161/cl.1.1.14465. Collart MA, Panasenko OO. 2017. The Ccr4-Not complex: architecture and structural insights. Subcell Biochem 83: 349-379. doi:10.1007/978-3-319-46503-6_13. .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 20 Dahan N, Choder M. 2013. The eukaryotic transcriptional machinery regulates mRNA translation and decay in the cytoplasm. Biochim Biophys Acta 1829: 169-173. doi: 10.1016/j.bbagrm.2012.08.004 Das S, Sarkar D, Das B. 2017. The interplay between transcription and mRNA degradation in Saccharomyces cerevisiae. Microb Cell 4: 212-228. doi: 10.15698/mic2017.07.580 Dujon B. 1996. The yeast genome project: what did we learn? Trends Genet 12: 263270. doi:10.1016/0168-9525(96)10027-5 El-Brolosy MA, Kontarakis Z, Rossi A, Kuenne C, Günther S, Fukuda N, Kikhi K, Boezio G, Takacs CM, Lai SL, et al. 2019. Genetic compensation triggered by mutant mRNA degradation. Nature 568: 193-197. doi:10.1038/s41586-019-1064-z. Fischer J, Song YS, Yosef N, di Iulio J, Churchman LS, Choder M. 2020. The yeast exoribonuclease Xrn1 and associated factors modulate RNA polymerase II processivity in 5' and 3' gene regions. J Biol Chem 295: 11435-11454. doi:10.1074/jbc.RA120.013426. García-Martínez J, Aranda A, Pérez-Ortín JE. 2004. Genomic run-on evaluates transcription rates for all yeast genes and identifies gene regulatory mechanisms. Mol Cell.15:303-313. doi: 10.1016/j.molcel.2004.06.004. García-Molinero V, García-Martínez J, Reja R, Furió-Tarí P, Antúnez O, Vinayachandran V, Conesa A, Pugh BF, Pérez-Ortín JE, Rodríguez-Navarro S. 2018. The SAGA/TREX-2 subunit Sus1 binds widely to transcribed genes and affects mRNA turnover globally. Epigenetics & Chromatin 11: 13. doi:10.1186/s13072-018-0184-2 Gilbertson S, Federspiel JD, Hartenian E, Cristea IM, Glaunsinger B. 2018. Changes in mRNA abundance drive shuttling of RNA binding proteins, linking cytoplasmic RNA degradation to transcription. eLife 7: e37663. doi:10.7554/eLife.37663. .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 21 Gómez-Herreros F, de Miguel-Jiménez L, Morillo-Huesca M, Delgado-Ramos L, Muñoz-Centeno MC, Chávez S. 2012. TFIIS is required for the balanced expression of the genes encoding ribosomal components under transcriptional stress. Nucleic Acids Res 40: 6508-6519. doi:10.1093/nar/gks340 Haimovich G, Medina DA, Causse SZ, Garber M, Millán-Zambrano G, Barkai O, Chávez S, Pérez-Ortín JE, Darzacq X, Choder M. 2013. Gene expression is circular: factors for mRNA degradation also foster mRNA synthesis. Cell 153: 1000-1011. doi:10.1016/j.cell.2013.05.012 Hartenian E, Glaunsinger BA. 2019. Feedback to the central dogma: cytoplasmic mRNA decay and transcription are interdependent processes. Crit Rev Biochem Mol Biol 54: 385-398. doi:10.1080/10409238.1679083. He F, Jacobson A. 2015. Nonsense-mediated mRNA decay: degradation of defective transcripts is only part of the story. Annu Rev Genet 49: 339-366. doi:10.1146/annurev-genet-112414-054639. Helenius K, Yang Y, Tselykh TV, Pessa HK, Frilander MJ, Mäkelä TP. 2011. Requirement of TFIIH kinase subunit Mat1 for RNA Pol II C-terminal domain Ser5 phosphorylation, transcription and mRNA turnover. Nucleic Acids Res 39: 50255035. doi:10.1093/nar/gkr107. Hose J, Yong CM, Sardi M, Wang Z, Newton MA, Gasch AP. 2015. Dosage compensation can buffer copy-number variation in wild yeast. eLife 4: e05462. doi: 10.7554/eLife.05462 Hughes TR, Roberts CJ, Dai H, Jones AR, Meyer MR, Slade D, Burchard J, Dow S, Ward TR, Kidd MJ, et al. 2000. Widespread aneuploidy revealed by DNA microarray expression profiling. Nat Genet 25: 333-337. doi:10.1038/77116. Lin J, Amir A. 2018. Homeostasis of protein and mRNA concentrations in growing cells. Nat Commun 9: 4496. doi:10.1038/s41467-018-06714-z. .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 22 Ma Z, Zhu P, Shi H, Guo L, Zhang Q, Chen Y, Chen S, Zhang Z, Peng J, Chen J. 2019. PTC-bearing mRNA elicits a genetic compensation response via Upf3a and COMPASS components. Nature 568: 259-263. doi:10.1038/s41586-019-1057-y. Medina DA, Jordán-Pla A, Millán-Zambrano G, Chávez S, Choder M, Pérez-Ortín JE. 2014. Cytoplasmic 5'-3' exonuclease Xrn1p is also a genome-wide transcription factor in yeast. Front Genet 5: 1. doi:10.3389/fgene.2014.00001. Morillo-Huesca M, Vanti M, Chávez S. 2006. A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis. FEBS J 273: 756-769. doi: 10.1111/j.1742-4658.2005.05108.x. Pérez-Ortín JE, Alepuz P, Chávez S, Choder M. 2013. Eukaryotic mRNA decay: methodologies, pathways, and links to other stages of gene expression. J Mol Biol 425: 3750-3775. doi:10.1016/j.jmb.2013.02.029. Pérez-Ortín JE, Tordera V, Chávez, S. 2019. Homeostasis in the Central Dogma of molecular biology: the importance of mRNA instability. RNA Biol 16: 1659-1666. doi:10.1080/15476286.2019.1655352 Rambout X, Detiffe C, Bruyr J, Mariavelle E, Cherkaoui M, Brohée S, Demoitié P, Lebrun M, Soin R, Lesage B, et al. 2016. The transcription factor ERG recruits CCR4–NOT to control mRNA decay and mitotic progression. Nat Struct Mol Biol 23: 663-672. doi:10.1038/nsmb.3243. Reese JC. 2013. The control of elongation by the yeast Ccr4-not complex. Biochim Biophys Acta 1829: 127-133. doi:10.1016/j.bbagrm.2012.09.001. Schmid M, Jensen TH. 2018. Controlling nuclear RNA levels. Nat Rev Genet 19: 518529. doi:10.1038/s41576-018-0013-2. Skulj M, Okrslar V, Jalen S, Jevsevar S, Slanc P, Strukelj B, Menart V. 2008. Improved determination of plasmid copy number using quantitative real-time PCR for .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 23 monitoring fermentation processes. Microb Cell Fact 7:6. doi:10.1186/1475-28597-6 Slobodin B, Bahat A, Sehrawat U, Becker-Herman S, Zuckerman B, Weiss AN, Han R, Elkon R, Agami R, Ulitsky I, et al. 2020. Transcription dynamics regulate Poly(A) tails and expression of the RNA degradation machinery to balance mRNA Levels. Mol Cell 78: 434-444.e5. doi:10.1016/j.molcel.2020.03.022. Sun M, Schwalb B, Schulz D, Pirkl N, Etzold S, Larivière L, Maier KC, Seizl M, Tresch A, Cramer P. 2012. Comparative dynamic transcriptome analysis (cDTA) reveals mutual feedback between mRNA synthesis and degradation. Genome Res 22: 1350-1359. doi:10.1101/gr.130161.111. Sun M, Schwalb B, Pirkl N, Maier KC, Schenk A, Failmezger, H, Tresch A, Cramer P. 2013. Global analysis of eukaryotic mRNA degradation reveals Xrn1-dependent buffering of transcript levels. Mol cell 52: 52-62. doi:10.1016/j.molcel.2013.09.010. Tauber D, Tauber G, Parker R. 2020. Mechanisms and Regulation of RNA Condensation in RNP Granule Formation. Trends Biochem Sci 45: 764-778. doi:10.1016/j.tibs.2020.05.002. Timmers HTM, Tora L. 2018. Transcript buffering: A balancing act between mRNA synthesis and mRNA degradation. Mol Cell 72: 10-17. doi:10.1016/j.molcel.2018.08.023. Torres EM, Sokolsky T, Tucker CM, Chan LY, Boselli M, Dunham MJ, Amon A. 2007. Effects of aneuploidy on cellular physiology and cell division in haploid yeast. Science 317: 916–924. doi:10.1126/science.1142210. Torres EM, Springer M, Amon A. 2016. No current evidence for widespread dosage compensation in S. cerevisiae. eLife 5: e10996. doi:10.7554/eLife.10996. .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 24 Figure legends Figure 1.- Transcriptomic analysis of aneuploid strains. We performed GRO or a cDTA analysis of aneuploid strains compared to their wild-type strain (BY4741). Then we compared the fold changes of the synthesis rates (SR), mRNA amounts (RA) and mRNA half-lives (HL) of the genes aligned from the left to right telomeres in each chromosome ordered from chromosome I (left) to chromosome XVI (right) on a log2 scale. The genes from the aneuploid chromosome (marked as a roman numeral) are highlighted in red. A) The results of the cDTA analysis of haploid strains not4, edc1 and xrn1. B) The results of the GRO analysis of the xrn1 diploid strain from (Haimovich et al., 2013) showing the SR, RA and HL data. The calculated HLs from the RA and SR data indicate how chromosome III has no average HL that differs from the other chromosomes. C) The results of the cDTA analysis of diploid strains cbp20 and hpr1. D) The results of the GRO analysis of a set of diploid (left) and haploid (right) strains from A. Amon’s aneuploid collection (Torres et al. 2007). Note that the HL plot is shown only in the xrn1 mutant for simplification. In all cases, the absence of chromosome-specific variation in HL (see Table 1) indicates the absence of a genespecific buffering system. Data used in these figures are available in supplementary tables S2 and S3. Figure 2.- Effect of the premature stop codon (PTC) on mRNA stability and the synthesis rate. A). Scheme of the two plasmidic gene fusions used for these experiments. The GAL1 promoter directs the synthesis of an mRNA that contains the yeast PHO5 and E. coli lacZ open reading frames fused in-frame until the natural lacZ stop (bottom), or containing a PTC between the two ORFs (top). The CYC1 terminator is placed at the end of constructs. The three probes (1-3) used for transcription run-on .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint 25 (TRO) and RNA polymerase II chromatin immunoprecipitation (ChIP) with the antiRbp3 antibody are shown. B) The mRNA half-life (HL) was determined by the transcription shut-off of the GAL1 promoter by changing cells from galactose to glucose-containing media, and a northern blot of the extracted RNAs, which was successively tested with probes PHO5, GAL1 and 18S rRNA. Note that the presence of a PTC (pink bars) provokes a one third reduction in the HL in the fusion transcript, but no decrease in the endogenous GAL1 mRNA in the wild-type cells. Conversely, the PTC-containing fusion transcript was significantly stabilized in an upf1 mutant. The greater stability of the PTC-containing transcript versus the non containing one in upf1∆ could be related to the much shorter translated region of the former. The shown HL values correspond to the average of at least three independent experiments. C) The TRO experiment with the wild-type strain shows no significant difference in elongating RNA pol II (SR) in the fusion genes containing (pink bars) a PTC, or not (blue bars). Values were presented after normalizing to the plasmid copy number measured by Q-PCR. The results were similar using probes 1-3. D) ChIP using anti-Rpb3 shows similar results as the TRO experiment. E) The TRO experiment in the upf1 mutant shows that there is no significant difference in elongating RNA pol II (SR) on fusion genes containing (pink bars), or not (blue bars), a PTC. In fact the SR is slightly lower in the PTC‐containing mRNA, but not statistically significant. The results were similar using probes 1‐3. F) ChIP employing anti‐Rpb3 in the upf1 strain gave similar results to the TRO experiment. Bars represent the average and SD of three independent replicates of the experiment. The statistical significance of the differences between the averages of the indicated samples was estimated using a two-tailed Sudent’s t-test (* means p < 0.01; *** means p < 0.0001). .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint Figure 4 Reverse cross-talk c c c c P DR AAAAAA P AA SR RNA granule .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint Table 1. List and averages of the ratios of the medians for synthesis rates (SR), mRNA amounts (RA) and mRNA half-lives (HL) of the genes from the copy number altered chromosome vs the rest of the genome in a series of aneuploid strains. Ploidy of each mutant (n or 2n) is indicated. Mutant n Duplicated chromosome SR change mRNA change HL change Sun et al. 2013 not4 II 1.729 1.691 0.978 rrp47 IX 1.701 1.845 1.085 edc1 XI 1.321 1.382 1.046 pat1 II 1.778 1.860 1.046 rrp6 XII 1.553 1.670 1.075 pop2 VIII 1.750 1.819 1.040 trf5 IX 1.741 1.770 1.054 xrn1 XI 1.741 1.865 1.071 Mutant 2n Not duplicated chromosome SR change mRNA change HL change Sun et al. 2013 cbp20 III 0.535 0.540 1.010 hpr1 IX 0.531 0.514 0.969 Medina et al. 2014 xrn1 III 0.583 0.602 1.033 Aneuploid n strain Duplicated chromosome SR change mRNA change HL change This work. A. Amon’s collection A6863 I 1.710 1.498 0.876 A13628 VIII 1.578 1.787 1.132 Aneuploid 2n strain Duplicated chromosome SR change mRNA change HL change A18345 I 1.471 1.168 0.794 A18349 XIV 1.517 1.466 0.966 A18346 V 1.254 1.406 1.121 A18347 VIII 1.302 1.296 0.996 AVERAGES SR change mRNA change HL change n+1 strains (mutants) 1.71±0.07 1.76±0.08 1.05±0.03 2n-1 strains (mutants) 0.53±0.003 0.53±0.02 1.01±0.03 n+1 strains (A. Amon) 1.64±0.09 1.64±0.20 1.00±0.18 2n+1 strains (A. Amon) 1.39±0.13 1.33±0.13 0.97±0.13 .CC-BY-NC-ND 4.0 International licensemade available under a (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is The copyright holder for this preprintthis version posted July 6, 2021. ; https://doi.org/10.1101/2021.01.14.426689doi: bioRxiv preprint