scieee Open visual document viewer

VP3 is crucial for the stability of Nora virus virions

Sadanandan, Sajna Anand,Ekström, Jens-Ola,Venkateswara Rao, Jonna,Hultmark, Dan,Hofer, Anders

Abstract

Nora virus is an enteric virus that causes persistent, non-pathological infection in Drosophila melanogaster. It replicates in the fly gut and is transmitted via the fecal-oral route. Nora virus has a single-stranded positive-sense RNA genome, which is translated in four open reading frames. Reading frame three encodes the VP3 protein, the structure and function of which we have investigated in this work. We have shown that VP3 is a trimer that has an α-helical secondary structure, with a functionally important coiled-coil domain. In order to identify the role of VP3 in the Nora virus life cycle, we constructed VP3-mutants using the cDNA clone of the virus. Our results show that VP3 does not have a role in the actual assembly of the virus particles, but virions that lack VP3 or harbor VP3 with a disrupted coiled coil domain are incapable of transmission via the fecal-oral route. Removing the region downstream of the putative coiled coil appears to have an effect on the fitness of the virus but does not hamper its replication or transmission. We also found that the VP3 protein and particularly the coiled coil domain are crucial for the stability of Nora virus virions when exposed to heat or proteases. Hence, we propose that VP3 is imperative to Nora virus virions as it confers stability to the viral capsid.

Full text

Vi us Resea ch 223 (2016) 20–27 Con en s lis s a ailable a ScienceDi ec Vi us Resea ch jou nalhomepage: www.else ie .com/loca e/ i us es VP3 is c ucial o he s abili y o No a i us i ions Sajna Anand Sadanandana, Jens-Ola Eks öma,c, Venka eswa a Rao Jonnab, Ande s Ho e b, Dan Hul ma ka,c,∗ aDepa men o Molecula Biology, Umeå Uni e si y, SE-901 87 Umeå, Sweden bDepa men o Medical Biochemis y and Biophysics, Umeå Uni e si y, SE-901 87 Umeå, Sweden cIns i u e o Biomedical Technology, Uni e si y o Tampe e, FI-33520 Tampe e, Finland a i c l e i n o A icle his o y: Recei ed 15 Ma ch 2016 Recei ed in e ised o m 15 June 2016 Accep ed 17 June 2016 A ailable online 18 June 2016 Keywo ds: RNA i uses No a i us Capsid s abili y Vi us biology a b s a c No a i usisanen e ic i us ha causes pe sis en ,non-pa hologicalin ec ion inD osophila melanogas e . I eplica es in he fly gu and is ansmi ed ia he ecal-o al ou e. No a i us has a single-s anded posi i e-senseRNAgenome,whichis ansla edin ou open eading ames.Reading ame h eeencodes he VP3 p o ein, he s uc u e and unc ion o which we ha e in es iga ed in his wo k. We ha e shown ha VP3 is a ime ha has an ␣-helical seconda y s uc u e, wi h a unc ionally impo an coiled-coil domain. In o de o iden i y he ole o VP3 in he No a i us li e cycle, we cons uc ed VP3-mu an s using he cDNA clone o he i us. Ou esul s show ha VP3 does no ha e a ole in he ac ual assembly o he i us pa icles, bu i ions ha lack VP3 o ha bo VP3 wi h a dis up ed coiled coil domain a e incapable o ansmission ia he ecal-o al ou e. Remo ing he egion downs eam o he pu a i e coiled coil appea s o ha e an e ec on he fi ness o he i us bu does no hampe i s eplica ion o ansmission. We also ound ha he VP3 p o ein and pa icula ly he coiled coil domain a e c ucial o he s abili y o No a i us i ions when exposed o hea o p o eases. Hence, we p opose ha VP3 is impe a i e o No a i us i ions as i con e s s abili y o he i al capsid. © 2016 The Au ho s. Published by Else ie B.V. This is an open access a icle unde he CC BY license (h p://c ea i ecommons.o g/licenses/by/4.0/). 1. In oduc ion No a i us is a small RNA i us ha causes pe sis en , non- pa hological in ec ion in D osophila melanogas e (Habayeb e al., 2006). I is an en e ic i us ha is ansmi ed ia he ecal-o al ou e and high i us i e s ha e been obse ed in he eces o in ec ed animals (Habayeb e al., 2009). I possibly defines a new amily o pico na-like i uses. Based on sequence compa isons o he eplica i e enzymes, he No a i us is mos closely ela ed o i uses o he amilies Pico na i idae, which in ec e eb a es, and Ifla i idae, which in ec insec s (Habayeb e al., 2006; Koonin e al., 2008). Ye , he No a i us has a unique size and o gani- za ion o i s genome. Pico na i idae includes impo an human en e o i uses such as he polio i us, while honeybee pa hogens like he de o med wing and sacb ood i uses belong o Ifla i idae. Some membe s o hese amilies a e able o es ablish pe sis en in ec ions in hei hos s, p obably con ibu ing o p oblems such as he pos -polio synd ome in humans and he colony collapse dis- ∗Co esponding au ho a : Depa men o Molecula Biology, Umeå Uni e si y, SE-901 87 Umeå, Sweden. E-mail add ess: [email p o ec ed] (D. Hul ma k). o de in honeybees (P isco e al., 2011; Baj e al., 2015). The No a i us may be a use ul model o s udy he phenomenon o RNA i us pe sis ence. Fo ha pu pose, we ound i impo an o cha ac e ize he i us in mo e de ail. No a i us has a 12333 nucleo ides long (Eks öm e al., 2011) single-s anded RNA genome o posi i e pola i y (Habayeb e al., 2006). Expe imen al wo k and sequence analysis ha e indica ed ha , ou o he ou open eading ames in he No a i us genome, ORF1 encodes an inhibi o o he RNAi de ense mechanism ( an Mie lo e al., 2012), while ORF2 encodes a long polyp o ein wi h he helicase, p o ease and polyme ase egions ha a e closely ela ed o he co esponding p o eins ound in he eplica i e casse es o pico na-like i uses (Habayeb e al., 2006; Koonin e al., 2008). No sequence simila i y was de ec ed be ween ORF4 and o he known i us p oduc s, bu expe imen al e idence has shown ha i encodes a polyp o ein ha is clea ed in o h ee capsid p o eins, VP4A, B and C (Eks öm e al., 2011). Howe e , he ORF3-encoded p o ein, VP3, emains la gely uncha ac e ized. Small amoun s o an ORF3-encoded p o ein, wi h an es ima ed molecula mass o 35kDa, we e de ec ed in he i ions du ing mass spec ome y analysis o he VP4 capsid p o eins (Eks öm e al., 2011). This sugges ed ha he VP3 p o ein was associa ed wi h he s uc u al p o eins. The fi s 71 nucleo ides o ORF3 o e lap wi h h p://dx.doi.o g/10.1016/j. i us es.2016.06.011 0168-1702/© 2016 The Au ho s. Published by Else ie B.V. This is an open access a icle unde he CC BY license (h p://c ea i ecommons.o g/licenses/by/4.0/). S.A. Sadanandan e al. / Vi us Resea ch 223 (2016) 20–27 21 he C- e minus o ORF2 and he e o e, ansla ion o ORF3 is likely o occu wi h a ame shi mechanism. The esul ing VP3 p o ein is 281–304 amino acids long, depending on he exac posi ion o he ame shi , and he p edic ed molecula mass app oxima ely 31–34 kDa. Based on he sequence, Eks öm e al. (2011) p edic ed an ␣-helical seconda y s uc u e o he N- e minal 200 amino acids o VP3, and ha his pa o he p o ein is likely o o m a coiled-coil domain. Howe e , expe imen al e idence is s ill lack- ing o his model. Thus a , he ole o VP3 in he li e cycle o No a i us has no been in es iga ed. We ha e now used he cDNA clone o No a i us (Eks öm e al., 2011) o s udy he impo ance o VP3 in i ion assembly and s uc- u al s abili y, by gene a ing VP3 mu an s. Du ing he cou se o his s udy, we obse ed ha VP3 was impo an o he ansmission o No a i us ia he ecal-o al ou e. Consequen ly, we hypo hesized ha he p esumed coiled-coil domain in his p o ein was impo an o he s abili y o he i us pa icles. To add ess his hypo hesis, we compa ed he s abili y o wild- ype i ions o ha o VP3 mu an i ions. We ound ha mu an i ions lacking VP3 o ha bo ing a dis up ion in he p edic ed coiled coil domain we e labile unde hea and p o ease ea men s, while he wild ype i ions su i ed hese condi ions. 2. Ma e ials and me hods 2.1. Cloning, exp ession and pu ifica ion o No a i us VP3 No a i us ORF3 was cloned in o he mul iple cloning si e o he pETM-MBP1a exp ession ec o (P yo and Lei ing, 1997) using o wa d (GCTTCCATGGCATTAAAAGAGGAGATTTTTGATCAA) and e e se (GCTTGGTACCTTACATAGAGTCATAAATTACTGATGT- GCT) p ime s. The pETM-MBP1a ec o con ains a hexa-His idine ag ollowed by he mal ose binding p o ein (MBP) and a Tobacco e ch i us (TEV) clea age si e, a e which he ORF3 sequence was inse ed. This cons uc was ans o med in o Rose a (DE3) cells (Fu e al., 2007), which we e hen g own o e nigh in an au o- induc ion LB medium (Edwin e al., 2014) a 20◦C. Since i is agged wi h he mal ose binding p o ein, he exp essed VP3 p o- ein could be isola ed using an amylose esin a fini y ma ix (NEB), acco ding o he ins uc ions p o ided by he manu ac u e . The isola ed p o ein was clea ed om i s MBP ag using he TEV p o- ease and he ea e pu ified by NiNTA aga ose ch oma og aphy (Qiagen) in o de o emo e bo h MBP and TEV p o ease. The now- un agged VP3 p o ein was subjec ed Q-Sepha ose (GE heal hca e) ch oma og aphy in o de o ob ain pu e VP3 (Fig. 1A, lane 2). 2.2. Analysis o VP3 oligome s by GEMMA Pu ified No a i us VP3 p o ein was dissol ed in 20 mM ammo- nium ace a e pH 7.8 o a final concen a ion o 0.05 mg/ml. GEMMA analysis was pe o med as desc ibed in Ro ouga an e al. (2008). 2.3. Analysis o VP3 oligome s by c oss-linking Fo c oss-linking, pu ified VP3 (0.25 mg/ml, final concen a ion) was ea ed wi h dime hyl pimelimida e (Sigma, 0.75 mg/ml, final concen a ion), bo h dissol ed in phospha e bu e ed saline, pH 8.0. The eac ion was incuba ed a oom empe a u e o 30 min, and he ea e s opped by addi ion o T is-HCL bu e , pH 8.0, o a final concen a ion o 20 mM. Bo h na i e and c oss-linked VP3 we e ea ed wi h 2× Laemmli p o ein sample bu e (100 mM T is pH 6.8, 2% SDS, 0.001% b omophenol blue, 20% Glyce ol and 2% ␤-me cap oe hanol) a a 1:1 a io, hea ed a 95◦C o 10 min, and hen un on a 13.6% SDS-polyac ylamide gel (29:1 ac ylamide/bis- ac ylamide) as desc ibed (Laemmli, 1970). Fig. 1. S uc u al Cha ac e iza ion o No a i us VP3 (A) SDS-polyac ylamide gel elec opho esis o VP3 monome and c oss-linked VP3 ime . Ma ke : PageRule p es ained p o ein ladde (The mo Scien ific). (B) Nano-Elec osp ay GEMMA anal- ysis o No a i us VP3 (0.05 mg/ml) a 2 psi capilla y p essu e. (C) Fa -UV Ci cula dich oism analysis o No a i us VP3, p esen ed as an a e age o 5 scans aken a 50 nm/min, showing a spec um ha is ypical o ␣-helical p o eins. 22 S.A. Sadanandan e al. / Vi us Resea ch 223 (2016) 20–27 2.4. Ci cula dich oism CD spec a o No a i us VP3 we e ob ained on a Jasco Spec- opola ime e model J-715 (Jasco Co po a ion). The spec a we e collec ed a 25◦C in a s anda d phospha e bu e ed saline (pH 7.4) using a qua z cu e e o 0.1 cm pa h leng h. Shown spec a ep e- sen he a e age o fi e scans a a speed o 50 nm/min. Only he a UV egion om 190 nm o 260 nm was analyzed. 2.5. Sequence da a and seconda y s uc u e p edic ion Seconda y s uc u es we e p edic ed using he Ne Su P 1.1 se e (Pe e sen e al., 2009) and he Ne Tu nP 1.0 se e (Pe e sen e al., 2010), accessed ia he CBS P edic ion Se e s (h p://www. cbs.d u.dk/se ices). P edic ion o coiled coil was pe o med using he Ma coil se e (Delo enzi and Speed, 2002) accessed ia he Bioin o ma ics Toolki a he Max-Planck Ins i u e o De elopmen- al Biology (h p:// oolki . uebingen.mpg.de/ma coil), he Pai coil2 se e (McDonnell e al., 2006) and he Mul iCoil se e (Wol e al., 1997), bo h accessed a he MIT Compu e Science and A ificial In elligence Labo a o y (h p://g oups.csail.mi .edu/pai coil2.h ml and h p://g oups.csail.mi .edu/cb/mul icoil/cgi-bin/mul icoil.cgi) 2.6. Es ablishing wild ype and mu an No a i us in ec ion in flies The in ec ious cDNA clone o No a i us (Eks öm e al., 2011) was used o cons uc VP3 mu an s using s anda d molecula cloning echniques. Lis o p ime s used o cons uc he di e - en mu an s is gi en in Table S1 o Supplemen a y ma e ials. All expe imen s we e pe o med using RelishE23 (Hedeng en e al., 1999) flies, ea ed a 25◦C on s anda d mashed-po a o fly ood (Yang e al., 2015). The cons uc ed clones we e mic oinjec ed in o decho iona ed syncy ial-s age emb yos (Sp adling, 1986). To induce exp ession he la ae we e subsequen ly ea ed on fly ood con aining 0.5 mM CuSO4, un il hey eached he adul s age. 2.7. Vi us pa icle pu ifica ion Vi us pa icles we e pu ified om whole fly ex ac and om he eces o in ec ed flies. To ex ac i us pa icles om in ec ed flies, 10–15 flies we e homogenized wi h a homogenizing pes le in NT- bu e (100 mM NaCl and 10 mM T is-HCl, pH 7.4). To ex ac i us pa icles om eces, eces was collec ed om 10 o 15 flies by keep- ing hem in 15-ml cen i uge ubes o 2–4 h and washing he ube walls wi h NT-bu e . T i on X-100 was added o a final concen a- ion o 0.5% o he whole fly ex ac and 0.01% o he eces. Vi us pu ifica ion was pe o med as desc ibed p e iously by Ande son e al. (1966). B iefly, he i us pa icles we e pelle ed by cen i u- ga ion a 38000 pm o 70 min using he SW41Ti o o (Beckman Coul e ). Pelle ed pa icles we e dissol ed in 1 ml NT-T bu e (NT bu e , 0.01% T i on X-100) and loaded on op o he suc ose g a- dien s. Ra e-zonal sepa a ion was pe o med on a 35–12% (w/ ) linea suc ose g adien in NT-T bu e a 38000 pm, o 90 min in 4◦C. G adien ac ions we e collec ed by punc u ing he bo om o he ubes and collec ing 0.5 ml/ ac ion. Quan i a i e RT-PCR was used o de e mine i us peak ac ions. 2.8. Quan i a i e RT-PCR To al RNA was ex ac ed om he samples using Au um To al RNA Mini Ki (BioRad). Quan i a i e RT-PCR was pe o med as desc ibed p e iously (Habayeb e al., 2009; Eks öm e al., 2011) using o wa d p ime : 5-TTTCACTTTACTGTTGGTCTCC-3, e e se P ime : 5-ATTCCATTTGTGACTGATTTTATTTC-3and Taq- man p obe: 5-FAM-AGAGTTAGTGGACAAGTTAGAGACTGGCAT- TAMRA-3. 2.9. P o ease clea age analysis Wild- ype and mu an i us pa icles pu ified by a e-zonal sepa a ion, we e subjec ed o p o ease clea age. They we e ea ed wi h, ei he 2000 U/ml ypsin (#T8003, Sigma-Ald ich) o 0.05 U/ml panc ea ic p o ease (#P4630, Sigma-Ald ich), o 2 h a 37◦C. Bo h ypsin and p o ease we e dissol ed in phospha e saline bu e , pH 7.4. Following his, he ea ed pa icles we e incuba ed wi h a p o ease inhibi o cock ail (#1697498, Sigma-Ald ich) and RNase A (The mo Scien ific), o 30 min a 37◦C. To al RNA was ex ac ed and i us i e was de e mined by quan i a i e RT-PCR (as desc ibed in Sec ion 2.6). 3. Resul s 3.1. VP3 o ms ime s In o de o cha ac e ize VP3 biochemically, we cloned and exp essed he p o ein in a bac e ial exp ession ec o . The pu ified VP3 p o ein uns like a 29–31 kDa p o ein on an SDS gel (Fig. 1A). This is in ag eemen wi h he molecula mass p edic ed om he sequence, 31–34 kDa, depending on he posi ion o he amino e - minus. I is also consis en wi h he p e iously es ima ed 35 kDa o VP3 om in ac i ions (Eks öm e al., 2011). Nano-Elec osp ay GEMMA de ec s he elec opho e ic mobil- i y o pa icles in ai , which is used o calcula e molecula diame e and consequen ly, he molecula mass o he pa icles. We ha e used his me hod o find he na i e oligome ic na u e o pu i- fied VP3 p o ein. GEMMA shows a s ong peak a 97 kDa (Fig. 1B), which co esponds wi h he ime ic o m o VP3. Mino peaks a e obse ed a 33, 68, and 190 kDa, sugges ing he p esence o minimal amoun s o in e media y monome ic, dime ic and hex- ame ic o ms o he p o ein. As an independen es o he esul s ob ained h ough GEMMA, we c oss-linked VP3 using dime hyl pimelimida e and analyzed he c oss-linked p o ein on an SDS- polyac ylamide gel (Fig. 1A). The c oss-linked p o ein appea s o be a ound 97 kDa, which would co espond o a VP3 ime . Taken oge he , ou esul s show ha No a i us VP3 has a p opensi y o o m ime s. 3.2. VP3 is p edominan ly ˛-helical Seconda y s uc u e p edic ion o VP3 had indica ed ha he N- e minal egion is ␣-helical and ha he egion downs eam o his showed g ea e likelihood o o ming ␤-s ands (Eks öm e al., 2011). Ci cula dich oism was pe o med on pu ified VP3 o expe imen ally alida e he p edic ed seconda y s uc u e. The CD spec um o VP3 (Fig. 1C) shows a posi i e band a 195 nm and wo nega i e bands a 209 nm and 220 nm. Such a spec um is cha ac- e is ic o ␣-helical p o eins (G eenfield, 2006). On calcula ing he pe cen ages o di e en s uc u al elemen s in he p o ein, using he CDNN CD decon olu ion so wa e (Böhm e al., 1992), i was ound o be app oxima ely 77% ␣-helical, 10% ␤- u n, 8% andom coil and he emaining an ipa allel/pa allel shee s. These esul s pa allel he seconda y s uc u e p edic ion o No a i us VP3 pe - o med p e iously by Eks öm e al. (2011) 3.3. A ime ic coiled-coil s uc u e is p edic ed o VP3 homologs in No a-like i uses The simila i y o No a i us o p e iously desc ibed i uses is la gely es ic ed o he eplica i e casse e encoded by ORF2, which shows homology o pico na-like i uses (Habayeb e al., S.A. Sadanandan e al. / Vi us Resea ch 223 (2016) 20–27 23 Fig. 2. Sequence analysis and seconda y s uc u e p edic ion o VP3. (A) P obabili ies o ␣-helix ( ed), ␤-s and (blue) and coiled coil acco ding o Ma coil (solid black) o Pai coil2 (dashed black), and ela i e p obabili ies o coiled coil dime s (pu ple) o ime s (g een) a e shown as sliding a e ages o 13 amino acids. (B) Schema ic ep esen a ion o p edic ed s uc u al elemen s in VP3. The p obabili y o each amino acid o eside in any o he se en possible posi ions, a-g, o a coiled coil is indica ed by di e en shades o ed. P edic ed ␤- u ns a e shown in g ey and helix-b eaking p oline esidues a e black. The p edic ed coiled coil segmen s, CC1-CC3, a e delinea ed by blue lines. (C) Sequence conse a ion be ween h ee D osophila No a i uses, D. melanogas e , D. immig ans and D. subobscu a; 3/3 indica es ull iden i y. The egion ha o e laps wi h ORF2 is shown g ey. The pe cen o esidues ha a e ully conse ed is indica ed o he di e en sub- egions below he g aph. Also shown is he egion ha is conse ed in i uses om he eph i id flies. 2006; Koonin e al., 2008). TBLASTN sea ch in he EST da abase had ea lie iden ified ORF3- and ORF4- ela ed EST sequences om he pa asi oid wasp, Nasonia i ipennis (Oli ei a e al., 2010; Eks öm e al., 2011), showing ha his wasp, o possibly i s hos , ha bo ed a i us ha is ela ed o he D osophila No a i us. Seconda y s uc- u e es ima ion showed ha he VP3 homolog in his Nasonia No a i us also had a pu a i e coiled coil domain in he N- e minal pa o he p o ein (Eks öm e al., 2011). Addi ional No a-like sequences a e now a ailable, allowing a mo e de ailed compa a i e s udy o VP3- ela ed sequences. Th ee no el No a-like i uses ha e ecen ly been desc ibed, wo om he D osophila species D. immig ans and D. subobscu a and one om he mo h Spodop e a exigua (Jakubowska e al., 2014; an Mie lo e al., 2014). Fu he mo e, h ough TBLASTN sea ches in he T ansc ip ome Sho gun Assembly da abase, we could e ie e addi ional No a-like i us sequence assemblies om h ee eph i id flies, wo addi ional mo hs, one an and one pa a- si oid wasp (Table S2), as well as sho e sequence agmen s om se e al o he insec species. These sequences we e defined as No a- like by wo c i e ia: a) hey encode ORF4 capsid p o eins o he unique No a i us ype and b) hei eplica ion casse es a e mo e closely ela ed o he D. melanogas e No a i us ORF2 p o eins han o o he pico na-like homologs. We will he e e e o all No a i us homologs as No a i uses. No iceably, he ela ionship be ween he di e en No a i uses closely mi o s ha o hei insec hos s, sug- ges ing a long his o y o co-e olu ion. ORF1 and ORF3 sequences we e poo ly conse ed be ween he di e en No a i uses, bu an ORF3 homolog could always be iden ified as a sepa a e open ead- ing ame be ween he be e conse ed ORF2 and ORF4- ela ed sequences. Fig. 2 illus a es p edic ed seconda y s uc u e elemen s in he VP3 p o ein o D. melanogas e No a i us. A egion spanning he fi s app oxima ely 200 amino acids displays a high p obabili y o an ␣-helical con o ma ion ( ed cu e in Fig. 2A), wi h a high p ob- abili y o coiled-coil o ma ion be ween esidues 36–200 (black cu e), while he egion downs eam is p edic ed o ha e s e ches o ␤-s ands (blue cu e) in e up ed by ␤- u ns (g ey-shaded in Fig. 2B). This p edic ion o a seconda y s uc u e is ema kably con- se ed among he No a i uses, in pa icula o he dip e an and lepidop e an i uses (Fig. S1). Howe e , he p ima y amino acid sequences a e poo ly conse ed, allowing a consis en alignmen only o he i uses om he h ee D osophila species (Fig. S2). Only when we used an algo i hm ha akes seconda y s uc u es in o conside a ion was i possible o align VP3 sequences om all No a- like i uses (Fig. S3). A bes , we see a modes ex en o sequence conse a ion o amino acids 1–200, while he egion downs eam is e y poo ly conse ed, ba ing a ew amino acid posi ions. A sequence simila i y wi h a consis ency sco e o 5 o abo e was seen only a 19 amino acid posi ions, all o which all wi hin he ␣-helical egion. Hence, seconda y s uc u e p edic ion is conse ed, despi e he modes sequence simila i y, sugges ing a i al unc ion o he ␣-helical s uc u al domain. A close inspec ion o he p edic ed coiled coil egion shows u - he in e es ing ea u es in VP3 o he D. melanogas e No a i us. Unlike he Ma coil p edic ion (solid black line in Fig. 2A), he Pai - coil algo i hm p edic s ha he coiled coil is spli in o h ee sepa a e segmen s, labeled CC1-3 in Fig. 2A, wi h a ela i ely low coiled coil p obabili y o he middle segmen (dashed line in Fig. 2). The epea uni o a coiled coil is se en amino acids, o abou wo u ns o he ␣-helix. Fig. 2B illus a es he colo -coded p obabili y o each amino acid in VP3 o be in any o hese se en posi ions, labeled a-g. Fo he p edic ed coiled coil segmen CC3 his gene a es a eg- ula pa e n whe e each 7-amino acid epea is ep esen ed as a ed diagonal. The phase o his pa e n shi s by one posi ion a he bo de be ween CC2 and CC3, sugges ing a dis up ion o he coiled coil s uc u e a his poin . A second se o diagonals in CC1 and CC2, shi ed by h ee posi ions om he majo diagonals, indica es wo possible o ien a ions o hese segmen s. In he D. immig ans No a i us he e a e p edic ed phase shi s be ween CC1 and CC2, as well as be ween CC2 and CC3 (Fig. S1), sugges ing discon inu- i ies be ween all h ee segmen s. Finally, while no phase shi s a e p edic ed in he co esponding coiled coil egion o he No a i us om D. subobscu a, a helix-b eaking p oline esidue a he bo de be ween CC2 and CC3 (black line in Fig. 2C) indica es ha he egu- la ␣-helical con o ma ion is in e up ed in his place. We conclude ha he mos likely con o ma ion o VP3 in all h ee D osophila i uses include wo o h ee sepa a e coiled coil segmen s. O hese, 24 S.A. Sadanandan e al. / Vi us Resea ch 223 (2016) 20–27 a Mul icoil p edic ion sugges s ha CC1 is mos likely engaged in coiled coil ime s, while he p edic ion o CC2 is mo e unce ain (g een cu es in Fig. 2 and Fig. S1). The p edic ion o a coiled coil ime is consis en wi h ou obse a ion wi h GEMMA ha VP3 has a endency o o m ime s (Fig. 1A). Howe e , CC3 is p edic ed o o m a dime in he D. immig ans and D. subobscu a i uses (pu - ple cu es) and he e is no p edic ion o i s highe o de s uc u e in he D. melanogas e No a i us. A sequence compa ison be ween he h ee D osophila No a i uses (Fig. 2C, Fig. S2) shows ha he CC1 segmen is highly con- se ed; 76% o he posi ions a e iden ical in all h ee species. CC2 is less well conse ed (23% iden ical) and CC3 is e en mo e a iable (12% iden ical) and he la e segmen has long indels a he N- e minus (Fig. S2). Ou side he coiled coil domains, he N- e minal pa is highly conse ed (78%), bu ha egion pa ially o e laps wi h he polyme ase o ORF2 (g ey egion in Fig. 2C and Fig. S2) and i is unce ain how much o ha sequence is included in he ma u e VP3. Finally, he C- e minal 1/3 o VP3, which is domina ed by p edic ed ␤-s ands and u ns, is poo ly conse ed. Only 16% o he esidues a e iden ical in he h ee D osophila i uses, mos o hem in he C- e minal 50 amino acids. The CC1 segmen is also well conse ed in he No a i uses om he eph i id flies, B. la i ons, B. do salis and C. capi a a. A egion o 68 esidues, ex ending 20 esidues ups eam o CC1 and downs eam in o he bo de egion o CC2, is 38–40% iden ical o he co esponding D. melanogas e sequence (Fig. 2C). Like D. sub- obscu a, he eph i id i uses ha e a phase shi in he p edic ed coiled coil a he CC1-CC2 bo de (Fig. S1). Remaining pa s o he eph i id i uses and he en i e sequences o he lepidop e an and hymenop e an i uses a e poo ly conse ed (Fig. S2) and hey can- no be unambiguously aligned wi h he D osophila i us sequences, bu he p edic ed seconda y s uc u es a e simila . All No a i uses ha e a egion wi h po en ial o o m coiled coil ime s. 3.4. VP3 is c i ical o he ecal-o al ansmission o No a i us In o de o cha ac e ize he unc ion o VP3 and he p edic ed coiled-coil mo i , we cons uc ed h ee mu an s (Fig. 3A) using he cDNA clone o No a i us. In he fi s mu an (NV-VP3), h ee consecu i e s op codons we e in oduced 97 nucleo ides down- s eam o he 5end o ORF3, o 24 nucleo ides downs eam o he o e lap wi h ORF2. The second mu an (NV-VP3CC) is a dele ion mu an , whe ein 54 nucleo ides co esponding o fi e u ns o he ␣-helix, we e dele ed om ORF3, dele ing pa s o CC1 and CC2. In he hi d mu an (NV- uncVP3), h ee consecu i e s op codons we e in oduced downs eam o he posi ed coiled-coil. The gene - a ed clones we e mic oinjec ed in o ui fly emb yos o es ablish i al in ec ion. To al RNA was ex ac ed om injec ed animals and hei o sp ing o quan i a i e RT-PCR analysis, in o de o e alu- a e i us i e s (Fig. 3B, no e he loga i hmic alues). The wild- ype cDNA clone o No a i us (NV-W ) was used as a con ol in all expe imen s. In p e ious expe imen s we injec ed fly emb yos wi h No a i us cDNA clones wi h non- eplica ing No a i us genome sequences. A e he injec ed emb yos g ew in o adul we nei he de ec ed emains o he injec ed cDNA no ansc ibed i al RNA. In con as , we de ec ed i us i e s in all h ee i us mu an s es ed in his wo k, indica ing ha he genomes we e eplica ing. The i us i e is educed in he NV-VP3 and NV-VP3CC mu an s, bu i is nea he wild- ype le el in NV- uncVP3. In addi ion, NV-W and he NV- uncVP3 mu an s a e also de ec ed in he o sp ing o he injec ed animals. Howe e , NV-VP3 and NV-VP3CC mu an s a e no de ec able in he o sp ing, abo e he le el whe e non-specific PCR p oduc s can be ound (dashed line in Fig. 3B). This indica es ha , al hough he NV-VP3 and NV-VP3CC mu an s ha e epli- ca ing RNA genomes, hey a e no ansmi ed o he o sp ing. I is in e es ing o no e ha dis up ion o he coiled coil egion leads o almos he same pheno ype as emo ing he en i e VP3 p o ein. Dele ing he egion downs eam o he coiled coil appea s o ha e a sligh e ec on he fi ness o he i us, bu no i s eplica ion o ansmission, since he NV- uncVP3 mu an is p esen bo h in he injec ed animals and hei o sp ing. This signifies ha he coiled coil egion is he impe a i e domain o VP3 and ha i is essen- ial o he ansmission o No a i us ia he ecal-o al ou e. This opens up se e al possibili ies, one o which is a ole o his egion in he assembly o i us pa icles. We p oceeded o examine whe he hese mu an s we e capa- ble o assembling i ions. To explo e his possibili y, we pu ified i us pa icles om whole fly ex ac and eces, collec ed om flies in ec ed wi h NV-W , NV-VP3, NV-VP3CC o NV- uncVP3. Ra e-zonal sepa a ion was used o pu i y he i us pa icles and quan i a i e RT-PCR was pe o med on o al RNA isola ed om he suc ose-g adien ac ions (Fig. 3C). In his scena io, any sig- nal ob ained o he i us will ha e o igina ed om assembled, in ac i ions. Also, unassembled capsid p o eins will sedimen e y di e en ly as compa ed o assembled i us pa icles. Hence, his me hod would gi e us an indica ion as o whe he i ions ha e been assembled o he di e en mu an s. Assembled i us pa icles we e de ec ed in in ec ed flies o all h ee mu an s, sig- ni ying ha mu a ion o VP3 did no a ec he ac ual assembly o he i ions. Pa icles we e no de ec ed in eces o he NV-VP3 and NV-VP3CC mu an s in con as o NV-W and NV- uncVP3 mu an pa icles, which we e p esen in he eces also. This implied ha , al hough i ions a e assembled o all he mu an s, only he NV- uncVP3 pa icles can be de ec ed in he eces. The ac ha he NV-VP3 and NV-VP3CC pa icles a e no de ec ed in he eces explains why hey a e no ho izon ally ansmi ed o he o sp ing. Taken oge he , hese esul s indica e ha he pu a i e coiled- coil mo i o VP3 is no in ol ed in he eplica ion o he i al genome o in he assembly o he i ions. This domain is ins ead c i ical o he success ul anspo o he assembled pa icles o he eces o o he s abili y o he pa icles du ing o a e ans- po a ion o he eces. 3.5. VP3-coiled coil domain aids ansmission by s abilizing he i us pa icles The e a e se e al p o eases and enzymes wi hin in ec ed cells ha can cause ha m o i ions. Addi ionally, since No a i us epli- ca es in he ui fly midgu (Habayeb e al., 2009), i a els h ough he hos ile en i onmen o he fly gu , wi h a ying pH condi ions, diges i e enzymes and p o eases (Lemai e and Miguel-Aliaga, 2013), be o e i eaches he eces. Upon a i al in he eces, he i ions may once again ace enzymes and p o eases, sec e ed by de eca ed gu mic obes, be o e success ully in ec ing a new hos . We pos ula ed ha he conse ed coiled-coil domain was c ucial o he s abili y o he i ions agains ad e se condi ions wi hin in ec ed cells, ei he while hey unde ook he pe ilous passage h ough he fly gu , o upon de eca ion along wi h he eces. Fi s , we compa ed he s abili y o hea ed mu an pa icles o ha o wild ype pa icles. Fo his pu pose, NV-W and mu an i i- ons we e pu ified om in ec ed flies by a e-zonal sepa a ion and hei con en o i al RNA was quan ified as shown in Fig. 3C. Only in ac assembled i us pa icles will sedimen a ac ions close o he sedimen a ion a e o wild- ype pa icles. Hence, RNA de ec ed by quan i a i e RT-PCR would ha e o igina ed om assembled i i- ons o i ion-like s uc u es. The 2.5 ml and 3.0 ml sedimen a ion ac ions we e pooled and aliquo ed in o wo equal olumes. One ba ch was subjec ed o hea ea men a 55◦C o 5 min, ollowed by RNase A ea men o 30 min a 37◦C. The second ba ch was subjec ed only o RNase A ea men . To al RNA was ex ac ed om bo h se s o pa icles o each mu an and analyzed by quan- i a i e RT-PCR. Any signal ob ained would ha e o igina ed om S.A. Sadanandan e al. / Vi us Resea ch 223 (2016) 20–27 25 0 10000 20000 1.0 1.5 2. 0 2.5 3.0 3.5 4.0 4.5 Vi us i e, a bi a y uni s Suc ose g adien ac ions, ml 0 10000 20000 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 Suc ose g adien ac ions, ml ORF 1 ORF 2 ORF 3 ORF 4 No a i us genome Helicase P o ease Polyme ase Capsid p o eins ORF 3 S op NV- VP3 ORF 3 P edic ed coiled coil ORF 3 ORF 3 Dele ion S op P edic ed coiled coil P edic ed coiled coil NV-VP3 CC NV- uncVP3 NV-w ...CGCCGTTT AATGAAGA......GTTTAGAA ...GAATTTAC NV-W NV- VP3 NV-VP 3 CC NV- uncVP3 A 0 2 4 6 8 10 Log i us i e, a bi a y uni s Injec ed animals O sp ing nd B C Whole lies Feces Vi us i e, a bi a y uni s NV-ΔVP3 NV-W NV- uncVP3 NV-VP3ΔCC Fig. 3. VP3 is equi ed o he ansmission o No a i us ia he ecal-o al ou e. (A) Schema ic ep esen a ion o No a i us VP3 mu an s gene a ed. (B) No a i us was quan ified by quan i a i e RT-PCR on o al RNA om RelishE23 flies and hei o sp ing, in ec ed wi h ei he unmodified No a i us (NV-W ) o any one o he VP3 mu an s (NV-VP3, NV-VP3CC and NV- uncVP3). The do ed line ep esen s he poin below which PCR a i ac s appea , a e 35 cycles o amplifica ion. Such signals a e also obse ed in nega i e con ols wi hou any empla e RNA. (C) Vi us pa icles we e pu ified om whole RelishE23 flies o om eces o such flies, in ec ed wi h ei he NV-W o any one o he VP3 mu an s, by a e-zonal sepa a ion on a suc ose g adien . Quan i a i e RT-PCR was pe o med on o al RNA ex ac ed om each collec ed ac ion o he suc ose g adien . Fo (B) and (C), he esul s shown a e an a e age o a leas 3 independen expe imen s and e o ba s indica e s anda d de ia ion. Be ween 5–30 flies we e used o each expe imen , and he same numbe o flies we e used o he con ol and he mu an being es ed in ha pa icula expe imen . in ac i us pa icles, as ee RNA eleased due o capsid disin e- g a ion would be deg aded du ing RNase A ea men . This would hence gi e us an es ima e o he pa icles ha su i ed hea ea - men wi hou deg ada ion. As shown in Fig. 4A, he NV-W and NV- uncVP3 pa icles esis hea ea men and can be de ec ed a i e s close o he unhea ed con ols. On he o he hand, he NV-VP3 and NV-VP3CC pa icles a e almos en i ely decima ed (a leas 1000- old dec ease) and can ba ely be de ec ed a e hea ea men . This clea ly shows ha he abili y o No a i us pa icles o wi hs and hea ea men is dependen on he coiled-coil mo i bu no he C- e minal hi d o he VP3 p o ein. We nex p oceeded in a simila way o examine whe he VP3 was impo an o he s abili y o he i ions when ea ed wi h p o eases. The combined 2.5 ml and 3.0 ml ac ions o a e-zonally pu ified NV-W and mu an i us pa icles we e di ided in o h ee equal olumes. The fi s se was ea ed wi h ypsin and he second se was ea ed wi h panc ea ic p o ease, bo h ollowed by ea - men wi h p o ease inhibi o cock ail and RNase A. The hi d se used as con ol was ea ed only wi h p o ease inhibi o and RNase A. Quan i a i e RT-PCR was pe o med on o al RNA om he pa - icles. Like in he hea - ea men expe imen , he NV-W pa icles su i ed bo h ypsin and p o ease ea men wi hou any signi - ican loss o i ions (Fig. 4B). The NV- uncVP3 i ions appea o be only pa ially esis an o ypsin and p o ease ea men as a en- old loss o i ions was obse ed. On he o he hand, NV-VP3 and NV-VP3CC mu an pa icles we e almos comple ely disin- eg a ed as e y li le i al RNA was de ec ed om hese pa icles. This clea ly signifies he impo ance o VP3 in he s abili y o he capsid s uc u e unde p o ease ea men . Based on he esul s om he hea - ea men expe imen and he p o ease clea age analysis, i is appa en ha VP3 is c i ical o he s abili y o No a i us i ions. Specifically, he coiled-coil mo i appea s o be a unc- ionally impo an domain in ol ed in con e ing s abili y o he capsid s uc u e. The egion downs eam o he coiled-coil also 26 S.A. Sadanandan e al. / Vi us Resea ch 223 (2016) 20–27 0 1 2 3 4 5 Log i us i e, a bi a y uni s RNase ea men Hea ➔ RNase ea men Log i us i e, a bi a y uni s 0 1 2 3 4 5 P o ease inhibi o ➔ RNase ea men P o ease ➔ P o ease inhibi o ➔ RNase ea men T ypsin ➔ P o ease inhibi o ➔ RNase ea men A B NV-ΔVP3 NV-W NV- uncVP3 NV-VP3ΔCC NV-ΔVP3 NV-W NV- uncVP3 NV-VP3ΔCC Fig. 4. VP3 is c ucial o he s abili y o No a i us Vi ions. (A) Pu ified i us pa icles we e hea - ea ed a 55◦C o 5 min, ollowed by RNase A ea men . Con ol samples we e ea ed only wi h RNase. qRT-PCR was pe o med on RNA om bo h hea - ea ed and unhea ed pa icles o es ima e i us i e . This g aph shows he loss o NV-VP3 and NV-VP3CC i ions upon hea - ea men . (B) Pu ified i us pa icles we e 1) ea ed wi h ypsin, ollowed by ea men wi h a p o ease inhibi o cock ail and RNase, 2) ea ed wi h p o ease, ollowed by ea men wi h a p o ease inhibi o cock ail and RNase, 3) ea ed wi h only he p o ease inhibi o cock ail and RNase. Quan i a i e RT-PCR was pe o med on RNA om all pa icles o calcula e i us i e . This g aph shows he se e e disin eg a ion o NV-VP3 and NV-VP3CC i ions and a pa ial loss o NV- uncVP3 i ions upon ea men wi h ypsin and p o ease. Fo (A) and (B), he esul s shown a e an a e age o 3 expe imen s, whe ein he e o ba s indica e s anda d de ia ion. Be ween 10–20 flies we e used o each expe imen , bu he same numbe o flies we e used o he con ol and he mu an being es ed in ha pa icula expe imen . The do ed line ep esen s he poin below which all alues a e conside ed o be PCR a i ac s since hese a e ob ained om quan i a i e RT-PCR signals ha appea a e 35 cycles o amplifica ion. Such signals a e also obse ed in nega i e con ols wi hou any empla e RNA. seems o ha e a mode a e e ec on he s abili y o capsid p o eins, bu i is appa en ly no c ucial. 4. Discussion Ou esul s show ha No a i us VP3 is a p ima ily ␣-helical p o ein ha o ms ime s in i s na i e con o ma ion. The ␣-helical egion is p edic ed o o m a coiled-coil domain, spli in o h ee pa s, and compa isons wi h sequences om o he No a i uses ha e shown ha his a angemen is well conse ed. To he bes o ou knowledge, no known s uc u al p o eins o he pico na- like i uses ha e been p edic ed o shown o ha e his mo i . The appea ance o VP3, along wi h VP4 p o eins in i us pa icles (Eks öm e al., 2011) sugges ed ha i should be associa ed wi h he capsid p o eins. I was shown ha he s uc u al p o eins o No a i us a e dis inc ly di e en om ha o known pico na-like i uses (Eks öm e al., 2011), bu he ole o VP3 o i s associa ion wi h he capsid has no been s udied be o e. In Pico na i idae, each capsid p o ein, VP1, VP2, VP3 and VP4 (un ela ed o he No a i us p o eins wi h simila names), has a ole in he di e en s ages o capsid assembly, ma u a ion and s a- bili y (A nold e al., 1987; Hellen and Wimme , 1992a; Hellen and Wimme , 1992b; Cu y e al., 1997; Lin e al., 2009; Jiang e al., 2014). Hence, mu a ions in any o hese p o eins can ad e sely a ec one o mo e s ages o he i us li e cycle. Fo example, mu a- ions in he Polio i us VP2 p o ein can dis up he comple ion o mo phogenesis and he e en ual o ma ion o ma u e i al pa i- cles (Comp on e al., 1990). Fu he , single amino acid subs i u ions in he Foo and Mou h disease i us VP1 p o ein can ende he i us acid-s able, while amino acid subs i u ions in he VP3 p o- ein ende he i us acid-labile (Ca idi e al., 2015). Simila e ec s ha e been obse ed in o he i us amilies such as he Calici i idae and Toga i idae also. In he No walk i us, he VP2 p o ein asso- cia ed wi h he shell domain o he i al capsid (Vongpunsawad e al., 2013) is known o be c ucial o he exp ession and s abili y o he capsid p o eins (Be olo i-Cia le e al., 2003). An Alpha i us nucleocapsid p o ein con ains a p edic ed ␣-helical coiled coil domain ha is essen ial o he assembly o he nucleocapsid co e (Pe e a e al., 2001). Simila ly, he coiled coil domain o adeno i us p o ein pIX is s a ed o ha e an impo an ole in sel -associa ion and ime o ma ion o pIX molecules (Rosa-Cala a a e al., 2001). The co ec s uc u al associa ion o pIX is c i ical o he icosahe- d al capsid s uc u e o adeno i uses ( an Oos um and Bu ne , 1985; Fu cini i e al., 1989; S ewa e al., 1993). Thus, he ole o ce ain capsid-associa ed p o eins in he assembly, s abili y and ma u a ion o i ions ha e been p o en in se e al i uses. Ou wo k on No a i us VP3 has e ealed ha his capsid-associa ed p o ein is indispensable o he s abili y o he i ion s uc u e. Dis up ing he coiled-coil domain o No a i us VP3 has se ious implica ions on he s abili y o he i ions, such ha i a ec s he ho izon al ansmission o he i us. This u he ein o ces ou p emise ha No a i us VP3 is absolu ely essen ial o he s uc u al s abili y o he capsid p o eins. To unde s and he molecula mechanisms in ol ed in capsid s abili y is impo an no only o gain knowledge o an elemen a y aspec o No a i us biology, bu also o cha ac e ize he hos - pa hogen ela ionship be ween a small RNA i us and i s hos . This ela ionship be ween No a i us and he ui fly also happens o be an excellen model o s udy no el pa hways in ol ed in immune esponses agains small RNA i uses. Unde s anding he biology o i uses also helps us unde s and be e he di e en echniques hey use o modi y cellula beha io and o supp ess an i- i al esponses. I would indeed be e y in e es ing o u he dissec he mechanism behind how VP3 p o ides s abili y o he No a i us i ions. Conflic o in e es s The au ho s decla e ha he e is no conflic o in e es s. S.A. Sadanandan e al. / Vi us Resea ch 223 (2016) 20–27 27 Acknowledgemen s The pu ifica ion o VP3 was planned and pe o med by he Umeå P o ein Expe ise Pla o m. We hank Jö gen Åden (Depa men o Chemis y, Umeå Uni e si y) o helping us pe o m Ci cula Dich oism on VP3. This esea ch was suppo ed by g an s om he Swedish Resea ch Council, he Academy o Finland and he Sig id Juselius Founda ion. Appendix A. Supplemen a y da a Supplemen a y da a associa ed wi h his a icle can be ound, in he online e sion, a h p://dx.doi.o g/10.1016/j. i us es.2016.06. 011. Re e ences Ande son, N.G., Ha is, W.W., Ba be , A.A., Rankin J ., C.T., Candle , E.L., 1966. Sepa a ion o subcellula componen s and i uses by combined a e- and isopycnic-zonal cen i uga ion. J. Na l. Cance Ins . Monog . 21, 253–283. A nold, E., Luo, M., V iend, G., Rossmann, M.G., Palmenbe g, A.C., Pa ks, G., Nicklin, M.J.H., Wimme , E., 1987. Implica ions o he pico na i us capsid s uc u e o polyp o ein p ocessing. P oc. Na l. Acad. Sci. 84, 21–25. Baj, A., Colombo, M., Headley, J.L., McFa lane, J.R., Lie ho , M.A., Toniolo, A., 2015. Pos -poliomyeli is synd ome as a possible i al disease. In . J. In ec . Dis. 35, 107–116. Böhm, G., Muh , R., Jaenicke, R., 1992. Quan i a i e analysis o p o ein a UV ci cula dich oism spec a by neu al ne wo ks. P o ein Eng. 5, 191–195. Be olo i-Cia le , A., C aw o d, S.E., Hu son, A.M., Es es, M.K., 2003. The 3’ end o No walk i us mRNA con ains de e minan s ha egula e he exp ession and s abili y o he i al capsid p o ein VP1: a no el unc ion o he VP2 p o ein. J. Vi ol. 77, 11603–11615. Ca idi, F., Vázquez-Cal o, A., Sob ino, F., Ma ín-Acebes, M.A., 2015. The pH s abili y o oo -and-mou h disease i us pa icles is modula ed by esidues loca ed a he pen ame ic in e ace and in he N e minus o VP1. J. Vi ol. 89, 5633–5642. Comp on, S.R., Nelsen, B., Ki kegaa d, K., 1990. Tempe a u e-sensi i e polio i us mu an ails o clea e VP0 and accumula es p o i ions. J. Vi ol. 64, 4067–4075. Cu y, S., F y, E., Blakemo e, W., Abu-Gazaleh, R., Jackson, T., King, A., Lea, S., Newman, J., S ua , D., 1997. Dissec ing he oles o VP0 clea age and RNA packaging in pico na i us capsid s abiliza ion: he s uc u e o emp y capsids o oo -and-mou h disease i us. J. Vi ol. 17, 9743–9752. Delo enzi, M., Speed, T., 2002. An HMM model o coiled-coil domains and a compa ison wi h PSSM-based p edic ions. Bioin o ma ics 18, 617–625. Edwin, A., G unds öm, C., Wai, S.N., Öhman, A., S ie , G., Saue -E iksson, A.E., 2014. Domain isola ion, exp ession, pu ifica ion and p o eoly ic ac i i y o he me allop o ease P V om Vib io chole ae. P o ein Exp . Pu i . 96, 39–47. Eks öm, J.O., Habayeb, M.S., S i as a a, V., Kieselbach, T., Wingsle, G., Hul ma k, D., 2011. D osophila No a i us capsid p o eins di e om hose o o he pico na-like i uses. Vi us Res. 160, 51–58. Fu, W., Lin, J., Cen, P., 2007. 5-Aminole ulina e p oduc ion wi h ecombinan Esche ichia coli using a a e codon op imize hos s ain. Appl. Mic obiol. Bio echnol. 75, 777–782. Fu cini i, P.S., an Oos um, J., Bu ne , R.M., 1989. Adeno i us polypep ide IX e ealed as capsid cemen by di e ence images om elec on mic oscopy and c ys allog aphy. EMBO J. 8, 3563–3570. G eenfield, N.J., 2006. Using ci cula dich oism spec a o es ima e p o ein seconda y s uc u e. Na . P o oc. 1, 2876–2890. Habayeb, M.S., Ekeng en, S.K., Hul ma k, D., 2006. No a i us, a pe sis en i us in D osophila, defines a new pico na-like i us amily. J. Gen. Vi ol. 87, 3045–3051. Habayeb, M.S., Can e a, R., Casano a, G., Eks öm, J.O., Alb igh , S., Hul ma k, D., 2009. The D osophila No a i us is an en e ic i us, ansmi ed ia eces. J. In e eb . Pa hol. 101, 29–33. Hedeng en, M., Åsling, B., Dushay, M.S., Ando, I., Ekeng en, S., Wihlbo g, M., Hul ma k, D., 1999. Relish, a cen al ac o in he con ol o humo al bu no cellula immuni y in D osophila. Mol. Cell 4, 827–837. Hellen, C.U.T., Wimme , E., 1992a. Ma u a ion o polio i us capsid p o eins. Vi ology 187, 391–397. Hellen, C.U.T., Wimme , E., 1992b. The ole o p o eoly ic p ocessing in he mo phogenesis o i us pa icles. Expe ien ia 48, 201–215. Jakubowska, A.K., D’Angiolo, M., González-Ma ínez, R.M., Millán-Lei a, A., Ca ballo, A., Mu illo, R., Caballe o, P., He e o, S., 2014. Simul aneous occu ence o co e in ec ions wi h small RNA i uses in he lepidop e an Spodop e a exigua. J. In e eb . Pa hol. 121, 56–63. Jiang, P., Liu, Y., Ma, H.C., Paul, A.V., Wimme , E., 2014. Pico na i us mo phogenesis. Mic obiol. Mol. Biol. Re . 78, 418–437. Koonin, E.V., Wol , Y.I., Nagasaki, K., Dolja, V.V., 2008. The Big Bang o pico na-like i us e olu ion an eda es he adia ion o euka yo ic supe g oups. Na . Re . Mic obiol. 6, 925–939. Laemmli, U.K., 1970. Clea age o s uc u al p o eins du ing he assembly o he head o he bac e iophage T4. Na u e 227, 680–685. Lemai e, B., Miguel-Aliaga, I., 2013. The diges i e ac o D osophila melanogas e . Annu. Re . Gene . 47, 377–404. Lin, J.Y., Chen, T.C., Weng, K.F., Chang, S.C., Chen, L.L., Shih, S.R., 2009. Vi al and hos p o eins in ol ed in pico na i us li e cycle. J. Biomed. Sci. 16, 103. McDonnell, A.V., Jiang, T., Kea ing, A.E., Be ge , B., 2006. Pai coil2: imp o ed p edic ion o coiled coils om sequence. Bioin o ma ics 22, 356–358. Oli ei a, D.C.S.G., Hun e , W.B., Ng, J., Desja dins, C.A., Dang, P.M., We en, J.H., 2010. Da a mining cDNAs e eals h ee new single s anded RNA i uses in Nasonia (Hymenop e a: P e omalidae). Insec Mol. Biol. 19 (Suppl. 1), 99–107. Pe e a, R., Owen, K.E., Tellinghuisen, T.L., Go balenya, A.E., Kuhn, R.J., 2001. Alpha i us nucleocapsid p o ein con ains a pu a i e coiled coil ␣-helix impo an o co e assembly. J. Vi ol. 75, 1–10. Pe e sen, B., No dahl Pe e sen, T., Ande sen, P., Nielsen, M., Lundegaa d, C., 2009. A gene ic me hod o assignmen o eliabili y sco es applied o sol en accessibili y p edic ions. BMC S uc . Biol. 9, 51. Pe e sen, B., Lundegaa d, C., No dahl Pe e sen, T., 2010. Ne Tu nP − neu al ne wo k p edic ion o be a- u ns by use o e olu iona y in o ma ion and p edic ed p o ein sequence ea u es. PLoS One 5, e15079. P isco, G.D., Zhang, X., Pennacchio, F., Cap io, E., Li, J., E ans, J.D., DeG andi-Ho man, G., Hamil on, M., Chen, Y.P., 2011. Dynamics o pe sis en and acu e de o med wing i us in ec ions in honey bees, Apis melli e a. Vi uses 3, 2425–2441. P yo , K.D., Lei ing, B., 1997. High-le el exp ession o soluble p o ein in Esche ichia coli using a His6- ag and mal ose-binding-p o ein double-a fini y usion sys em. P o ein Exp . Pu i . 10, 309–319. Ro ouga an, R., C ona, M., Vodnala, M., Sjöbe g, B.M., Ho e , A., 2008. Oligome iza ion s a us di ec s o e all ac i i y egula ion o he Esche ichia coli class Ia ibonucleo ide educ ase. J. Biol. Chem. 283, 35310–35318. Rosa-Cala a a, M., G a e, L., Pu ion-Du illeul, F., Cha on, B., Kedinge , C., 2001. Func ional analysis o adeno i us p o ein IX iden ifies domains in ol ed in capsid s abili y, ansc ip ional ac i i y, and nuclea eo ganiza ion. J. Vi ol. 75, 7131–7141. Sp adling, A.C., 1986. P elemen -media ed ans o ma ion. In: Robe s, D.B. (Ed.), D osophila: A P ac ical App oach. IRL P ess, Ox o d, pp. 175–197. S ewa , P.L., Fulle , S.D., Bu ne , R.M., 1993. Di e ence imaging o adeno i us: b idging he esolu ion gap be ween X- ay c ys allog aphy and elec on mic oscopy. EMBO J. 12, 2589–2599. an Mie lo, J.T., B onkho s , A.W., O e heul, G.J., Sadanandan, S.A., Eks öm, J.-O., Hees e mans, M., Hul ma k, D., An oniewski, C., an Rij, R.P., 2012. Con e gen e olu ion o a gonau e-2 slice an agonism in wo dis inc insec RNA i uses. PLoS Pa hog. 8, e1002872. an Mie lo, J.T., O e heul, G.J., Obadia, B., an Clee , K.W.R., Webs e , C.L., Saleh, M.-C., Obba d, D.J., an Rij, R.P., 2014. No el D osophila i uses encode hos -specific supp esso s o RNAi. PLoS Pa hog. 10, e1004256. an Oos um, J., Bu ne , R.M., 1985. Molecula composi ion o he adeno i us ype 2 i ion. J. Vi ol. 56, 439–448. Vongpunsawad, S., Venka a am P asad, B.V., Es es, M.K., 2013. No walk i us mino capsid p o ein VP2 associa es wi hin he VP1 shell domain. J. Vi ol. 87, 4818–4825. Wol , E., Kim, P.S., Be ge , B., 1997. Mul iCoil: a p og am o p edic ing wo- and h ee-s anded coiled coils. P o ein Sci. 6, 1179–1189. Yang, H., K onhamn, J., Eks öm, J.O., Ko ku , G.G., Hul ma k, D., 2015. JAK/STAT signaling in D osophila muscles con ols he cellula immune esponse agains pa asi oid in ec ion. EMBO Rep. 16, 1664–1672.