Full text
ARTICLE
Recei ed 2 Jun 2015 |Accep ed 16 Feb 2016 |Published 11 Ap 2016
Splicing mis egula ion o SCN5A con ibu es o
ca diac-conduc ion delay and hea a hy hmia in
myo onic dys ophy
Fe nande F eye mu h1,*,w,F e
´de
´ ique Rau2,*, Yosuke Kokunai3, Thomas Linke4, Chan al Sellie 1, Masayuki Nakamo i3,
Yoshihi o Kino5, Ludo ic A andel2, A naud Jolle 2, Ch is elle Thibaul 1, Mu iel Philipps1, Se ge Vicai e1, Be na d Jos 1,
Bja ne Udd6,7,8, John W. Day9, Denis Duboc10, Ka im Wahbi10, Tsuyoshi Ma sumu a11, Ha u oshi Fujimu a11,
Hideki Mochizuki3, F anc¸ois De ycke e12, Takashi Kimu a13, Nobuyuki Nukina14, Shoichi Ishiu a15, Vincen Lac oix16,
Amandine Campan-Fou nie 17, Vincen Na a il18, Emilie Chau a d19, Didie Auboeu 19, Mino u Ho ie20, Keiji Imo o21,
Kuang-Yung Lee22, Mau ice S. Swanson23, Adol o Lopez de Munain24, Shin Inada25, Hideki I oh20, Kazuo Nakazawa25,
Takashi Ashiha a20, E ic Wang23, Thomas Zimme 4, Denis Fu ling2, Masano i P. Takahashi3& Nicolas Cha le -Be gue and1
Myo onic dys ophy (DM) is caused by he exp ession o mu an RNAs con aining expanded
CUG epea s ha seques e muscleblind-like (MBNL) p o eins, leading o al e na i e splicing
changes. Ca diac al e a ions, cha ac e ized by conduc ion delays and a hy hmia, a e he second
mos common cause o dea h in DM. Using RNA sequencing, he e we iden i y no el splicing
al e a ions in DM hea samples, including a swi ch om adul exon 6B owa ds e al exon 6A in
he ca diac sodium channel, SCN5A. We find ha MBNL1 egula es al e na i e splicing o SCN5A
mRNA and ha he splicing a ian o SCN5A p oduced in DM p esen s a educed exci abili y
compa ed wi h he con ol adul iso o m. Impo an ly, ep oducing splicing al e a ion o Scn5a in
mice is su ficien o p omo e hea a hy hmia and ca diac-conduc ion delay, wo p edominan
ea u es o myo onic dys ophy. In conclusion, mis egula ion o he al e na i e splicing o SCN5A
may con ibu e o a subse o he ca diac dys unc ions obse ed in myo onic dys ophy.
DOI: 10.1038/ncomms11067 OPEN
1Depa men o T ansla ional medicine and neu ogene ics, IGBMC, CNRS UMR7104, INSERM U964, Uni e si e
´de S asbou g, Illki ch 67400, F ance. 2So bonne Uni e si e
´s
UPMC Uni Pa is 06, Inse m, CNRS, Cen e de Reche che en Myologie UMRS974/FRE3617, Ins i u de Myologie, GH Pi ie
´-Salpe
ˆ ie
` e, Pa is 75013, F ance. 3Depa men o
Neu ology, Osaka Uni e si y G adua e School o Medicine, Osaka 565-0871, Japan. 4Depa men o Physiology, F ied ich Schille Uni e si y Hospi al, Jena 07743, Ge many.
5Depa men o Bioin o ma ics and Molecula Neu opa hology, Meiji Pha maceu ical Uni e si y, Kiyose 205-8588, Japan. 6Neu omuscula Resea ch Cen e , Tampe e
Uni e si y and Uni e si y Hospi al, Tampe e 33520, Finland. 7Depa men o Medical Gene ics, Folkha
¨lsan Ins i u e o Gene ics, Helsinki Uni e si y, Helsinki 00250, Finland.
8Depa men o Neu ology, Vaasa Cen al Hospi al, Vaasa 65130, Finland. 9Depa men o Neu ology, S an o d Uni e si y, S an o d, Cali o nia 94304, USA. 10 Se ice de
Ca diologie, Uni e si e
´Pa is-Desca es, Ho
ˆpi al Cochin, AP-HP, Pa is 75014, F ance. 11 Depa men o Neu ology, Toneyama Na ional Hospi al, Toyonaka 560-8552, Japan.
12 CNRS UMR7175, Ecole Supe
´ ieu e de Bio echnologies de S asbou g, Illki ch 67400, F ance. 13 Di ision o Neu ology, Hyogo Medical College, Nishinomiya 663-8501, Japan.
14 Labo a o y o S uc u al Neu opa hology, Doshisha Uni e si y G adua e School o B ain Science, Kyo o 610-0394, Japan. 15 G adua e School o A s and Sciences, Uni e si y
o Tokyo, To kyo 15 3 - 8 9 0 2, Japan . 16 Uni e si e
´Lyon 1, CNRS, UMR5558 LBBE, Villeu banne 69622, F ance. 17 Hospices ci ils de Lyon, Labo a oi e de cy oge
´ne
´ ique
cons i u ionelle, B on 69500, F ance. 18 Po
ˆle Rho
ˆne Alpes de Bioin o ma ique, Uni e si e
´Lyon 1, Ba
ˆ imen G ego Mendel, Villeu banne 69100, F ance. 19 Cen e de Reche che
en Cance
´ ologiedeLyon,Lyon69373,F ance.20 Depa men o Ca dio ascula and Respi a o y Medicine, Shiga Medical Uni e si y, O su 520-2192, Japan. 21 Depa men o
In o ma ion Physiology, Na ional Ins i u e o Physiological Sciences, Okazaki 444-8585, Japan. 22 Depa men o Neu ology, Chang Gung Memo ial Hospi al, Keelung 20401,
Taiwan. 23 Depa men o Molecula Gene ics and Mic obiology, Cen e o Neu oGene ics and he Gene ics Ins i u e, Uni e si y o Flo ida, College o Medicine, Gaines ille,
Flo ida 32610, USA. 24 Depa men o Neu ology, Hospi al Uni e si a io DONOSTIA, Neu oscience A ea, Ins i u e Biodonos ia CIBERNED and Uni e si y o Basque Coun y
UPV-EHU, San Sebas ia
´n 20014, Spain. 25 Labo a o y o Biomedical Sciences and In o ma ion Managemen , Na ional Ce eb al and Ca dio ascula Cen e Resea ch Ins i u e,
Osaka 565-8565, Japan. * These au ho s con ibu ed equally o he wo k. wP esen add ess: Massachuse s Gene al Hospi al, MassGene al Ins i u e o Neu odegene a i e
Diseases, Cha les own, Massachuse s 02129, USA. Co espondence and eques s o ma e ials should be add essed o D.F. (email: denis. u ling@upmc. ) o o
M.P.T. (email: [email p o ec ed]d.osaka-u.ac.jp) o o N.C-B. (email: [email p o ec ed] ).
NATURE COMMUNICATIONS | 7:11067 | DOI: 10.1038/ncomms11067 | www.na u e.com/na u ecommunica ions 1
Myo onic dys ophy (DM), he mos common adul -onse
muscula dys ophy, includes wo gene ically dis inc
o ms. DM o ype 1 (DM1) and i s se e e congeni al
o m (CDM1) a e caused by an expansion o CTG epea s in he
30-un ansla ed egion (UTR) o he DMPK gene1–3. In con as ,
DM o ype 2 (DM2) is caused by an expansion o CCTG epea s
wi hin he fi s in on o he CNBP (also known as ZNF9) gene4.
The pa hogenesis o DM in ol es a RNA gain-o - unc ion
mechanism caused by exp ession o mu an RNAs con aining
hund ed o housands o CUG o CCUG epea s ha in e e e
wi h he splicing o o he p e-mRNAs h ough dys unc ion
o wo classes o RNA-binding p o eins. MBNL p o eins
(MBNL1, MBNL2 and MBNL3) a e seques e ed wi hin nuclea
RNA oci o med by expanded CUG and CCUG epea s5,6,
whe eas exp ession and phospho yla ion o CUG-binding
p o ein 1 (CUGBP1, encoded by he CELF1 gene) a e inc eased
in DM1 hea samples7. MBNL and CUGBP1 p o eins egula e
al e na i e splicing, and al e a ions o hei unc ional le els in
myo onic dys ophic issues esul s in e e sion o e al
splicing pa e ns o se e al mRNAs, such as he insulin
ecep o (INSR) ( e . 8), he muscle chlo ide channel (CLCN1)
( e s 9,10), dys ophin (DMD) ( e s 11,12) and key componen s
o he skele al muscle exci a ion–con ac ion coupling
p ocess, including amphiphysin2 (BIN1) ( e . 13), yanodine
ecep o 1 (RYR1) ( e . 14), sa coplasmic/endoplasmic e iculum
Ca2þ-ATPase SERCA1 (ATP2A1) ( e . 14) and he muscle
calcium channel Ca
V
1.1 (CACNA1S) ( e . 15). Mis egula ion o
he al e na i e splicing o he insulin ecep o INSR,CLCN1 and
DMD mRNAs a e associa ed wi h he insulin esis ance8,
myo onia9,10,16 and dys ophic p ocess12, espec i ely, while
al e a ions o he al e na i e splicing o BIN1,RYR1,ATP2A1
and CACNA1S may con ibu e o he skele al muscle weakness
obse ed in DM13–15.
In con as , he molecula mechanisms unde lying he ca diac
de ec s, which a ec 80% o indi iduals wi h DM and ep esen
he second mos common cause o dea h in his disease17,18, a e
ye o be defined. Ca diac in ol emen s in DM a e cha ac e ized
by ca diac-conduc ion delay ha may esul in a al a io-
en icula block, and by a ial o en icula achyca dia17,18.
Elec oca diog aphy (ECG) analyses in DM pa ien s indica e
p olonged conduc ion ime om he sinoa ial node o he
en icles (PR in e al) and elonga ed en icula depola iza ion
(QRS du a ion). In e es ingly, ca diac dys unc ions in DM a e
eminiscen in some aspec o an al e a ion o he ca diac
sodium cu en . The a-subuni o he ca diac ol age-ga ed Na þ
channel, Na
1.5, is encoded by he SCN5A gene and plays a key
ole in he exci abili y o ca diomyocy es and o apid
p opaga ion o he impulse h ough he ca diac-conduc ion
sys em. Mu a ions in SCN5A lead o a a ie y o a hy hmic
diso de s, including long QT3, p og essi e and non-p og essi e
ca diac-conduc ion disease (also known as Le -Lene
`g e disease),
a ial fib illa ion, sick sinus synd ome, B ugada synd ome and
nume ous o e lapping synd omes19–21.
Using ansc ip omic app oaches, we iden ified a ious no el
splicing changes in hea samples o DM1 indi iduals. Analysis o
he RNA mo i s en iched in he icini y o hese mis egula ed
exons indica es ha seques a ion o he MBNL p o eins is
p obably he main cause o splicing mis egula ion in hea o
indi iduals wi h DM. Among hese no el splicing al e a ions,
we ocused on mis egula ion o al e na i e splicing o he
SCN5A p e-mRNA. This splicing al e a ion esul s in exp ession
o a e al iso o m o SCN5A wi h al e ed elec ophysiological
p ope ies. O impo ance, we demons a e ha ep oducing
he splicing al e a ion o Scn5a in mouse is su ficien o cause
hea a hy hmia and ca diac-conduc ion delay wi h ele a ed PR
in e al, which a e key cha ac e is ics o he hea al e a ions
obse ed in DM. These esul s sugges ha al e ed splicing o
SCN5A mRNA may pa icipa e o he elec ical ca diac
abno mali ies obse ed in DM.
Resul s
Iden ifica ion o splicing changes in DM hea samples.To
de e mine no el splicing abno mali ies in DM hea samples, we
fi s used whole-genome mic oa ays (GeneChip Human Exon
1.0 ST a ay) on polyadenyla ed RNA ex ac ed om le en icle
samples o h ee adul DM1 pa ien s compa ed wi h h ee age-
ma ched con ol indi iduals. Bioin o ma ic analyses p edic ed
significan (Fold Change Z2, Suden - es , P alue 0.01)
changes in he splicing o 24 exons be ween con ol and DM1
samples (Supplemen a y Table 1), including a mis egula ion o
he al e na i e splicing o he SCN5A p e-mRNA. To ex end his
analysis, we pe o med pai ed-end RNA sequencing (RNA-seq)
on he same DM1 and con ol hea samples, yielding 1,611
million o mapped 100 bp eads. DESeq and Cu di we e hen
applied o es ima e di e en ial gene exp ession and o e o
unde -exp essed mRNAs we e selec ed by using he Benjamini
and Hochbe g adjus ed P alues ( alse disco e y a e (FDR)
0.1). A o al o 9 and 19 up egula ed genes we e p edic ed
di e en ially exp essed wi h DESeq and Cu di , espec i ely,
bu none we e confi med by quan i a i e eal- ime RT-qPCR
analyses. This low numbe o di e en ially exp essed mRNAs
sugges s ha ca diac pa hology in DM is no associa ed wi h
d as ic modifica ions o gene exp ession le els. In con as ,
DEXSeq ( e . 22), which es s di e en ial exon usage be ween wo
condi ions, p edic ed 134 significan (Log2 Fold Change Z1.2,
FDR 0.1) al e na i e splicing changes be ween con ol and
DM1 hea samples (Supplemen a y Da a 1). Simila ly, MISO
( e . 23) analysis, which compu es he ac ion o mRNA ha
includes a gi en casse e al e na i e exon, p edic ed 259
significan (DPSI Z0.3; Z-sco e Z1.2) al e na i e splicing
changes be ween con ol and DM1 hea samples (Fig. 1a and
Supplemen a y Da a 2), including a obus mis egula ion o he
al e na i e splicing o SCN5A (Fig. 1b). MISO and DEXSeq p e-
dic ions o e lapped, bu wi h some excep ions, such as he
skipping o he consecu i e exons 18, 19 and 20 o CAMK2B
p edic ed by DEXSeq bu no by MISO; o he shi o SCN5A
exon 6B owa ds exon 6A iden ified by MISO bu no by DEXSeq.
These di e ences a e inhe en o hei compu a ion models, since
MISO does no de ec al e a ions o successi e exons and DEXSeq
does no iden i y mu ually exclusi e exons, highligh ing ha
MISO and DEXSeq a e complemen a y bioin o ma ics
app oaches. Nex , we es ed by PCR wi h e e se ansc ip ion
(RT–PCR) o y candida e mRNAs ha ing he highes p obabili y
o mis egula ion in DEXSeq and/o MISO analyses. We alida ed
splicing al e a ions o 32 o hem, including some ha ha e been
iden ified in p e ious s udies (TNNT2, TNNT3,ABLIM1, LDB3,
MBNL1,CAMK2B,MAPT and so on)24–26, and 20 o he s ha
ep esen , o he bes o ou knowledge, no el al e a ions o
al e na i e splicing (ADD3,GOLGA4,CRTC2,ARHGEF10L,
ANK3,DCLK2,EPN2,UNC13B,TECR,ARVCF,SOCS7,CELF1
and so on) in DM1 hea samples (Fig. 1c). O in e es , some o
hese splicing al e a ions may be o pa hological consequence
in DM. Fo example, knockou o he Socs7 gene in mouse esul s
in insulin esis ance27. Whe he he splicing mis egula ion o
SOCS7 in DM con ibu es o insulin esis ance emains o be
es ed. Also, RNA sequencing p edic s an inc eased e en ion o
he penul ima e in on o FCGRT, which encodes he Fc agmen
o he IgG ecep o anspo e a(FCRN) p o ein, in ol ed in
IGG ecycling28. Whe he splicing al e a ion o FCGRT in DM is
esponsible o he dec eased le el o IGG in blood o hese
pa ien s is an a ac i e hypo hesis ha emains o be es ed.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms11067
2NATURE COMMUNICATIONS | 7:11067 | DOI: 10.1038/ncomms11067 | www.na u e.com/na u ecommunica ions
Finally, RNA sequencing p edic s mis egula ion o he al e na i e
splicing o a ca diac-specific exon loca ed in he 50-UTR o
CELF1, which encodes CUGBP1. Whe he his al e na i e
splicing may con ibu e o he inc ease le els o CUGBP1
p o ein obse ed in DM1 hea s emains also o be e alua ed.
Splicing al e ed in DM a e en iched o MBNL-binding si es.
Mu an s RNAs con aining expanded CUG o CCUG epea s
in e e e wi h he unc ional le els o CUGBP1 and MBNL
p o eins. Ea lie s udies de e mined ha MBNL p o eins bind o
YGC RNA mo i s (whe e Y is a py imidine)29–32, while CUGBP1
binds o UGU-en iched sequences33,34. To de e mine whe he
hese RNA mo i s a e indeed p esen in he icini y o exons
mis egula ed in DM, we de e mined all 4-me RNA mo i s
en iched wi hin, ups eam o downs eam o he exons p edic ed
as mis egula ed by MISO in DM1 hea samples, compa ed wi h
2,000 con ol exons (Fig. 2). Mos RNA mo i s significan ly
en iched (binomial es , P alue o1.0 107) con ained YGC
sequences, while none we e ound o con ain UGU sequences.
Fu he mo e, YGC sequences we e en iched ups eam o
exons abno mally included in DM1, while YGC mo i s we e
en iched downs eam o exons ep essed in DM1. These esul s
ma ched he MBNL splicing egula o y map de e mined by CLIP
expe imen s, whe e binding o MBNL ups eam o an exon ends
o inhibi exon inclusion whe eas binding o MBNL downs eam
Exons excluded in DM Exons included in DM
Z sco e
1
–1 –0.5 0
Δ PSI
0.5 1
2
356A
6B
7
SCN5A
SCN5A
CTL
DM1
6A
6B
CTL DM1
SCN5A
– 16
+ 16
ADD3
CTL DM1
– 6
+ 6
MYH11
CTL DM1
- 47
+ 47
NCOR2
CTL DM1
– 6A
+ 6B
TPM2
CTL DM1
– 2
+ 2
TECR
CTL DM1
100
200
100
200
100
200
300
200
200
300
200
100
CTL DM1
– 14
+ 14
ABLIM1
CLTB
– 6
+ 6
CTL DM1
CRTC2
– 13
+ 13
CTL DM1
NUMA1
– 20
+ 20
CTL DM1
EPN2
CTL DM1
– 5
+ 5
– 6
+ 6
ZFYVE21
CTL DM1
100
200
200
300
300
200
200
100
300
200
400
200
100
– 8
+ 8
CTL DM1
COPZ2
GOLGA4
CTL DM1
– 24
+ 24
MXRA7
CTL DM1
– 4
+ 4
ANK3
CTL DM1
– 40
+ 40
UNC13B
CTL DM1
– 38
+ 38
ARVCF
CTL DM1
– 19
+ 19
100
200
200
300
200
100
200
100
200
100
100
200
ARHGEF10L
DCLK2
CAMK2B
SOCS7
CELF1
SUN1
– 18.19.20
– 10
+ 10
– 8
+ 8
– 5
+ 5
– 5
+ 5
– 2
+ 2
+ 18.19.20
+ 19.20
CTL DM1
CTL DM1
CTL DM1
CTL DM1
CTL DM1
CTL DM1
100
400
200
300
100
200
100
200
100
200
100
200
300
200
300
100 100
300
300 500
300
300
300
100
300
400
30
20
10
30
20
10
30
20
10
30
20
10
30
20
10
30
20
10
38662462
RPKM RPKM RPKM RPKM RPKM RPKM
38658666 38654924 38651227
Genomic coo dina e (ch 3), “-” s and
ab
c
Figu e 1 | Iden ifica ion o no el splicing mis egula ions in DM1 hea samples. (a)D-PSI e sus Z-sco e plo o exon casse es mis egula ions p edic ed
by MISO analysis. (b) Exons s uc u e and co e age o RNA-seq eads ac oss SCN5A exons 5–7 show inc eased inclusion o exon 6A and dec eased
inclusion o exon 6B in hea samples o h ee DM1 pa ien s (bo om, blue) e sus h ee con ol samples ( op, ed). (c) Valida ion by
RT–PCR o RNA-seq p edic ions in human hea samples o no mal adul indi iduals (CTL, black) e sus adul DM1 pa ien s (DM1, ed). Molecula size
ma ke s in bps a e epo ed o he le o each RT–PCR gels. bp, base pai .
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms11067 ARTICLE
NATURE COMMUNICATIONS | 7:11067 | DOI: 10.1038/ncomms11067 | www.na u e.com/na u ecommunica ions 3
o an exon gene ally s imula es exon inclusion35,36. In con as ,
we ound no en iched mo i s o o he RNA-binding p o eins,
including CUGBP1, bFOX1, hnRNP H o S au en. These esul s,
as well as p e ious da a36–38, suppo a model in which i a ion
o MBNL p o eins is he main cause o splicing change in DM1
hea , while mis egula ion o o he RNA-binding p o eins may
con ibu e o a subse o splicing al e a ions.
Splicing o SCN5A is mis egula ed in DM hea samples. Bo h
mic oa ay and RNA-seq p edic ed mis egula ion o al e na i e
splicing o SCN5A p e-mRNA in DM1 hea samples. Splicing o
SCN5A is de elopmen ally egula ed, such ha exon 6A is
included in e al hea bu apidly eplaced by exon 6B a e
bi h39. Consequen ly, SCN5A exon 6A is named as emb yonic o
e al, while exon 6B is known as adul . Exons 6A and 6B a e
mu ually exclusi e exons encoding pa o he ol age senso ,
segmen s 3 and 4 loca ed in he domain I o he sodium channel
(Fig. 3a,b). These a e key segmen s o he elec ical ac i i y o
he sodium channel, and inclusion o ei he e al exon 6A o
adul exon 6B esul s in channel iso o ms, named, espec i ely,
hNa
1.5e and hNa
1.5, wi h di e en elec ophysiological
p ope ies39–41. We confi med ou mic oa ay and RNA-seq
p edic ions by RT–PCR and ound ha adul SCN5A exon 6B is
pa ly eplaced by i s e al exon 6A in hea samples o indi iduals
wi h DM, including adul DM1 and adul DM2 cases (Fig. 3c).
No e ha o di e en ia e exon 6B om exon 6A ha ha e
he exac same leng h o 92 bp, we ook ad an age o a Bs bI
es ic ion si e p esen only in exon 6A, which hus appea s as a
Bs bI-diges ed double band in Fig. 3c. These esul s a e
consis en wi h he ecen epo o a splicing mis egula ion o
SCN5A in one DM1 hea sample42. Al hough splicing o SCN5A
is mis egula ed in DM1, we obse ed no co ela ion be ween he
pe cen age o SCN5A exon 6A inclusion and he inc eased
du a ion o he PR in e al and only a e y limi ed, i any,
co ela ion be ween mis egula ion o SCN5A exon 6A splicing
and al e a ion o he QRS du a ion in indi iduals wi h DM1
(R2o 0.2 wi h six DM1 samples; Supplemen a y Fig. 1).
Mis egula ion o SCN5A splicing was specific o DM, as we did
no obse e inclusion o exon 6A in hea samples om
indi idual a ec ed wi h Duchenne muscula dys ophy (DMD),
amyo ophic la e al scle osis (ALS) o dila ed ca diomyopa hy
(DCM) (Fig. 3d). Mo eo e , mis egula ion o splicing in DM1
was specific and no global, as we obse ed no splicing changes o
SCN5A al e na i e exon 18, o CACNA1C mu ually exclusi e
exons 8A and 8B, o KCNAB1 al e na i e exons 2 and 11, o o
KCNQ1 al e na i e exons 2 and 5 (Supplemen a y Fig. 2). Finally,
we obse ed no significan al e a ion o he exp ession le el o
SCN5A mRNA by quan i a i e eal- ime RT-qPCR (Fig. 3e).
O e all, hese esul s indica e a specific mis egula ion o
al e na i e splicing o SCN5A esul ing in exp ession o a e al
o m o his channel in adul DM hea . These esul s a e
consis en wi h p e ious s udies whe e al e na i e splicing
changes in DM esume a MBNL-dependen e al splicing
pa e n ha pe sis in adul issues26,37.
Al e na i e splicing o SCN5A is egula ed by MBNL1.To
de e mine he mechanisms unde lying mis egula ion o SCN5A
splicing, we fi s de e mined i s splicing pa e n in cell models o
DM. Since SCN5A is exp essed a low le el in cul u e o imma u e
skele al muscle cells, we in es iga ed i s splicing in p ima y
cul u es o di e en ia ed skele al muscle cells o igina ing om
muscle biopsies o con ol and DM1 indi iduals. RT–PCR
expe imen s de e mined a swi ch o exon 6B owa ds exon 6A
in DM1 muscle cells compa ed wi h con ol, ep oducing he
splicing al e a ion obse ed in ca diac issue (Fig. 4a). O
echnical in e es , he basal le el o exon 6A inclusion was
highe in muscle cell cul u es han in adul hea samples
(compa e Fig. 4a o Fig. 3c), which p obably eflec he imma u e
aspec o cell cul u es. Since mu an RNAs con aining expanded
CUG o CCUG epea s in e e e wi h al e na i e splicing h ough
i a ion o MBNL p o eins, we es ed whe he MBNL1 egula es
SCN5A splicing. Reduc ion o MBNL1 exp ession h ough a
siRNA-media ed app oach in human con ol p ima y muscle
cells mimicked he e ec o CUG epea s and p omo ed a swi ch
om adul exon 6B owa ds e al exon 6A (Fig. 4b). Wes e n
blo ing analysis confi med he success ul deple ion o MBNL1
exp ession (Supplemen a y Fig. 3A). Nex , we assessed al e na i e
splicing o Scn5A in hea samples o Mbnl knockou mice43.
RT–PCR analysis shows ha inclusion o he exon 6A o Scn5a is
inc eased in hea samples o mice wi h no Mbnl1 and educed
le el o Mbnl2 (Mbnl1/,Mbnl2 þ/)(Fig. 4c). The inc eased
inclusion o Scn5a exon 6A in Mbnl knockou mice is
significan (S uden - es , P alue 0.01) bu a he mild,
p obably eflec ing di e ence in egula ion o al e na i e splicing
be ween human and mouse o he compensa o y e ec o esidual
Mbnl2 exp ession43. This hypo hesis is consis en wi h he mild
splicing al e a ion o Scn5A obse ed in he sole Mbnl1 knockou
mice44. O e all, hese esul s sugges ha MBNL p o eins egula e
he al e na i e splicing o SCN5A exons 6A and 6B. To de e mine
whe he his egula ion is di ec o indi ec , we cons uc ed a
minigene con aining exons 6A and 6B o SCN5A bo de ed by
hei in onic egions. Exp ession o his cons uc in mouse
C2C12 myoblas s ep oduced a e al pa e n wi h mainly
inclusion o exon 6A (Fig. 4d). Since inclusion o exon 6B was
ep essed, educ ion o Mbnl1 ac i i y h ough siRNA o
exp ession o expanded CUG epea s had no u he ep essi e
e ec on exon 6B. In con as , exp ession o MBNL1 p omo ed a
swi ch om e al exon 6A owa ds adul exon 6B, while
CCCC (2×10–18)
CUGC (9×10–15)
UGCU (2×10–14)
CUAA (5×10–10)
UUGC (5×10–8)
CCUG (4×10–7)
UGCC (7×10–7)
UGCU (2×10–26)
GCUU (2×10–19)
CUGC (2×10–15)
UUGC (2×10–9)
CGCU (4×10–9)
GCUC (7×10–7)
GAAG (5.1 10–7)
CCGC (2×10–22)
CGCC (8×10–17)
CGCU (9×10–10)
UCGC (4×10–7)
GCGC (7×10–7)
CCCG (8×10–7)
CUGC (2×10–11)
UGCU (3×10–9)
GCUG (6×10–8)
Exons excluded in DM
Exons included in DM
Figu e 2 | MBNL-binding mo i s a e en iched in icini y o exons mis egula ed in DM1. Sequence and binomial es P alues o 4-me RNA mo i s
en iched downs eam, wi hin and ups eam o exons mis egula ed in DM1 hea samples. Sequences en iched in exons excluded in DM a e indica ed in ed,
while sequences en iched in exons included in DM a e indica ed in blue.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms11067
4NATURE COMMUNICATIONS | 7:11067 | DOI: 10.1038/ncomms11067 | www.na u e.com/na u ecommunica ions
exp ession o siRNA-media ed deple ion o CUGBP1 had no
e ec (Fig. 4d). Wes e n blo ing analysis confi med ha siRNA
ans ec ion e ficien ly educed endogenous Mbnl1 o Cugbp1
exp ession (Supplemen a y Fig. 3B and C). Nex , gel-shi assays
de e mined ha ecombinan pu ified GST- agged MBNL1
bound o UGC RNA mo i s loca ed ups eam o exon 6A
(Fig. 4e). O in e es , his UGC sequence is absen om he mouse
genome, which may explain he mild splicing al e a ion o Scn5A
obse ed in mice knockou o Mbnl p o eins. Mu a ion o hese
UGC mo i s abolished MBNL1 binding (Fig. 4 ), as well as he
egula o y e ec o MBNL1 on a mu an SCN5A minigene
(Fig. 4g). O e all, hese esul s es ablish ha MBNL1 egula es
di ec ly al e na i e splicing o SCN5A exons 6A/6B.
SCN5A splicing o ms p esen di e en elec ical p ope ies.
SCN5A encodes Na
1.5, he main ca diac ol age-ga ed sodium
channel, and loss-o - unc ion mu a ions in SCN5A lead o a
a ie y o a hy hmic diso de s, which sha e some common
pa hological ea u es wi h DM. Fu he mo e, exons 6A and 6B
di e a se en amino acid posi ions, esul ing in channel a ian s
wi h di e en elec ophysiological p ope ies39–41. To in es iga e
he consequences o he swi ch om SCN5A exon 6B owa ds
exon 6A obse ed in DM, we fi s examined in Xenopus oocy es
he sodium cu en s gene a ed by ei he hNa
1.5e, he splice
a ian o SCN5A con aining he e al exon 6A, o hNa
1.5,
encoded by SCN5A con aining he adul con ol exon 6B
(Fig. 5a and Supplemen a y Table 2). Injec ion o RNA
encoding hNa 1.5e, which is he splicing iso o m o SCN5A
ound in DM, indica ed a significan educ ion o he sodium
cu en ampli ude o 45%, compa ed wi h hNa
1.5, he no mal
adul SCN5A exon 6B o m (Fig. 5b,c). Since, he ex en o
splicing mis egula ion a ies among DM indi iduals, which
ypically exp ess a mix o SCN5A splicing o ms con aining ei he
exon 6A o exon 6B (c . Fig. 3c), we analysed sodium cu en s
gene a ed by a mix o bo h SCN5A iso o ms (Fig. 5a). Injec ing
Xenopus oocy es wi h an equimola mix o RNA encoding each
channel, namely 50% o hNa
1.5e (SCN5A con aining e al exon
6A) and 50% o hNa
1.5 (SCN5A exp essing adul exon 6B),
esul ed in a educ ion o 30% o he cu en ampli ude compa ed
wi h he con ol hNa
1.5 (Fig. 5b,c). Nex , wo-elec ode ol age
clamp eco ding expe imen s e ealed ha he s eady-s a e
ac i a ion o he e al hNa
1.5e was shi ed by 7 mV owa ds
depola ized po en ial compa ed wi h he con ol adul hNa
1.5
o m (Fig. 5d and Supplemen a y Table 2). This shi is consis en
wi h he shi obse ed p e iously in ans ec ed mammalian
cells39–41, hus alida ing ou app oach in Xenopus oocy es. To
be e ep oduce he si ua ion obse ed in DM, we injec ed in
Xenopus oocy es an equimola mix o DM (hNa
1.5e, e al exon
6A) and con ol (hNa
1.5, adul exon 6B) RNA iso o ms o
SCN5A. Impo an ly, his mix o splicing o ms also p esen ed a
significan shi o s eady-s a e ac i a ion owa ds depola ized
po en ials by 3.8 mV, compa ed wi h he con ol hNa
1.5 o m
(Fig. 5d, Supplemen a y Table 2). Co espondingly, a simila shi
Adul
Fe al
5 76A 6B
COOH
NH2
IIIIIIIV
Adul CTL Adul DM1 Adul DM2
Adul ALS Congeni al DM1
Adul DM1
Adul DM2
Congeni al DM1
Fe al CTL
Exon 6B
Exon 6A
0
Fe al CTL
Adul CTL
ALS
DCM
DMD
20
40
60
80
100
0.5
1
CTL DM1
0
100
200
300
bp
Bs BI
12345 6 12345 6 12345 6 12345 6
% Exon 6A
inclusion
SCN5A mRNA
exp ession
ab
c
de
Figu e 3 | Splicing o SCN5A exon 6A is al e ed in DM hea samples. (a) Schema ic ep esen a ion o mu ually exclusi e exons 6A and 6B o SCN5A.
SCN5A mRNA includes exon 6A ( ed) in e al hea , while SCN5A mRNA exp esses exon 6B (blue) in adul hea . (b) Schema ic ep esen a ion o SCN5A
opology exp essing exon 6A ( ed). Exons 6A o 6B encodes pa o segmen 3, connec ing loop be ween S3 and S4 and mos pa o he ol age-sensi i e
segmen 4 o domain 1 o he sodium channel SCN5A. (c). Rep esen a i e Bs BI-diges ed RT–PCR analysis o endogenous SCN5A mRNA om human hea
samples o no mal adul (CTL), adul ALS, non-DM e uses (20, 24 and 35 weeks), congeni al DM1 e uses (CDM1 o 22, 25 and 28 weeks), adul s DM1
and DM2 indi iduals. Molecula size ma ke is indica ed in bp. (d) G aphical ep esen a ion o RT–PCR analysis depic ing he pe cen age o SCN5A mRNA
including exon 6A in le en icula hea samples om e al and adul con ol, ALS, DCM, DMD, CDM1 and adul DM1 and DM2 indi iduals. (e) G aphical
ep esen a ion o quan i a i e eal- ime RT-qPCR depic ing he mRNA exp ession o SCN5A ela i e o RPLP0 in con ol no mal adul s (n¼5) e sus adul
DM1 (n¼5) hea samples. Ba s indica e s.e.m. bp, base pai s.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms11067 ARTICLE
NATURE COMMUNICATIONS | 7:11067 | DOI: 10.1038/ncomms11067 | www.na u e.com/na u ecommunica ions 5
was obse ed o he ime cons an o inac i a ion (Fig. 5e).
Consis en wi h p e ious elec ophysiological s udies39–41,no
significan di e ences we e obse ed be ween hNa
1.5 and
hNa
1.5e ega ding s eady-s a e inac i a ion and eco e y om
inac i a ion (Fig. 5 ,g). O e all, ou esul s a e consis en wi h
p e ious s udies39–41, and demons a e ha hNa
1.5e, he splicing
o m o SCN5A exp essed in DM and con aining he e al exon
6A, p esen s a educed exci abili y compa ed wi h hNa
1.5, which
is he adul con ol SCN5A iso o m con aining exon 6B.
Al e a ion o SCN5A splicing leads o hea conduc ion de ec s.
Mis egula ion o he al e na i e splicing o SCN5A in DM is one
al e a ion iden ified among many o he s, hus ques ioning he
CMV
6A 6B
5
CTL DM1 siCTL siMBNL1
% Exon 6B
0
20
40
60
***
% Exon 6B
0
20
40
60
6B
***
UUUGCUAUGCUGUGCUAUGCCUUGCAG
MBNL1
F ee
Bound
SCN5A minigene WT
UUU_CUAU_CUGU_CUAU_CCUU_CAG
MBNL1
F ee
Bound
SCN5A minigene MUT
XXX
% Exon 6B
0
20
40
60
6B
CMV
6A 6B
5
% Exon 6A
**
0
10
20
30
6B
6A
6B
6A
% Exon 6B
0
20
40
60
***
6B
6A
CTL
#6A
6A
100
200
300
bp
100
bp
200
100
200
300
bp
100
200
bp
Con ol
Con ol
CUG 960x
CUG 960x
MBNL1
MBNL1
CUGBP1
siMbnl1
siMbnl1
siCel 1
100
200
bp
Mbnl1–/–
Mbnl2+/–
PolyA
PolyA
abc
de
g
Figu e 4 | MBNL1 egula es al e na i e splicing o SCN5A.(a) Uppe panel, RT–PCR analysis o endogenous SCN5A mRNA om di e en ia ed p ima y
muscle cell cul u es de i ed om biopsies o con ol o DM1 indi iduals. (lowe ) Quan ifica ion o he pe cen age o SCN5A mRNA including exon 6B.
(b, uppe ) RT–PCR analysis o endogenous SCN5A mRNA om human di e en ia ed cul u es o con ol p ima y muscle cells ans ec ed wi h a sc ambled
siRNA (siCTL) o a siRNA a ge ing MBNL1 mRNA (siMBNL1). (lowe ) Pe cen age o SCN5A mRNA including exon 6B. (c, uppe ) RT–PCR analysis o
endogenous Scn5a mRNA in hea samples o wild- ype and compound Mbnl1/,Mbnl2þ/double knockou mice. (lowe ) Pe cen age o Scn5a mRNA
including exon 6A. (d, uppe ) RT–PCR analysis o exogenous SCN5A mRNA om di e en ia ed C2C12 muscle cells co- ans ec ed wi h a SCN5A minigene
con aining exons 6A and 6B bo de ed by hei in ons and wi h ei he a plasmid exp essing 960 CTG epea s, MBNL1, CUGBP1 o wi h a siRNA di ec ed
agains Mbnl1 (siMbnl1)o Cel 1 (encoding Cugbp1; siCel 1). # Indica es usage o a c yp ic splice si e inhe en o he minigene. (lowe ) Pe cen age o SCN5A
mRNA including exon 6B. (e, uppe ) Schema ic ep esen a ion o SCN5A minigene, including he UGC- ich sequence used o binding assays. (lowe ) Gel-
shi assays we e pe o med using 5–1,000 nM o pu ified bac e ial ecombinan GST-MBNL1D101 and a uni o mly 32P-CTP labelled RNA. ( , uppe )
Schema ic ep esen a ion o mu an SCN5A minigene, including he mu an sequence, used o binding assays. (lowe ) Gel-shi assay pe o med as in
e.(g, uppe ) RT–PCR analysis o exogenous SCN5A mRNA om di e en ia ed C2C12 muscle cells co- ans ec ed wi h mu an SCN5A minigene and wi h a
plasmid exp essing 960 CTG epea s o MBNL1 o wi h a siRNA di ec ed agains Mbnl1 (siMbnl1). (lowe ) Pe cen age o SCN5A mRNA including exon 6B.
All ans ec ion and gel-shi expe imen s we e epea ed h ee o fi e imes. Molecula size ma ke s a e indica ed in bp. Ba s indica e s.e.m. S uden es , **
indica es Po0.01, *** indica es Po0.001. bp, base pai s.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms11067
6NATURE COMMUNICATIONS | 7:11067 | DOI: 10.1038/ncomms11067 | www.na u e.com/na u ecommunica ions
con ibu ion o SCN5A mis egula ion o he ca diac symp oms
obse ed in DM. To es he physiological impo ance o SCN5A
splicing mis egula ion, we a ificially o ced he swi ch om adul
exon 6B owa ds e al exon 6A in o wild- ype adul mouse hea
using an exon-skipping s a egy (Fig. 6a). To insu e e ficien
ansduc ion o he ca diac muscle and con inuous exp ession
o nuclea an isense oligonucleo ides, we enginee ed and
p oduced adeno-associa ed i us (AAV2/9) exp essing op imized
U7-snRNA used o Scn5a an isense sequences (U7-ASScn5a).
Splicing analysis e ealed ha combina ion o wo U7-AS
cons uc s, spanning in on 6/exon 6B junc ion and exon
6B o Scn5A, p omo ed a swi ch om inclusion o adul exon
6B owa ds inclusion o he e al exon 6A (Supplemen a y
Fig. 4A). Thus, AAV2/9 exp essing bo h U7-AS cons uc s
2 ms
1 μA
0
1
2
3
4
***
***
Inac i a ion ime cons an (ms)
Vol age (mV)
–40 –30 –20 –10 0 10
0
2
4
6
8
10
12
14
S eady-s a e ac i a ion
Vol age (mV)
–60 –50 –40 –30 –20 –10 0 10 20
0.0
0.2
0.4
0.6
0.8
1.0
hNa 1.5
hNa 1.5e
50% hNa 1.5 +
50% hNa 1.5e
Vol a
g
e (mV)
0.0
0.2
0.4
0.6
0.8
1.0
–130 –110 –90 –70 –50 –30
S eady-s a e inac i a ion
0.0
0.2
0.4
0.6
0.8
1.0
F ac ional eco e y
–60 –40 –20 0 20
Vol age (mV)
–4
–3
–1
–2
0
–5
hNa 1.5
hNa 1.5e
50% hNa 1.5 +
50% hNa 1.5e
hNa 1.5
hNa 1.5e
50% hNa 1.5 +
50% hNa 1.5e
hNa 1.5
hNa 1.5e
50% hNa 1.5
50% hNa 1.5e
40 60
Reco e y in e al Δ (ms)
0 20406080100
50% hNa 1.5 + 50% hNa 1.5e
hNa 1.5e (SCN5A exon 6A)hNa 1.5 (SCN5A exon 6B)
Peak cu en (μA)
Cu en (μA)
hNa 1.5
hNa 1.5e
50% hNa 1.5 +
50% hNa 1.5e
hNa 1.5
hNa 1.5e
50% hNa 1.5 +
50% hNa 1.5e
g
a
bc
de
Figu e 5 | Elec ophysiological p ope ies o hNa
1.5 and hNa
1.5e channels. (a) Rep esen a i e Naþcu en s gene a ed in Xenopus oocy es by hNa
1.5
(encoded by SCN5A con aining he adul exon 6B), hNa
1.5e (encoded by SCN5A including he e al exon 6A), and simul aneously exp essed Na
1.5 and
Na
1.5e channels a a 1:1 a io. (b) Peak cu en ampli udes a he es po en ial o 10 mV in Xenopus oocy es injec ed wi h equimola amoun o cRNA
encoding hNa
1.5, hNa
1.5e o 1:1 combina ion o Na
1.5 and Na
1.5e channels. (c) Cu en – ol age ela ionships. (d) S eady-s a e ac i a ion cu es.
(e) Inac i a ion ime cons an s h (ms) a di e en es pulses. ( ) S eady-s a e inac i a ion cu es. (g) F ac ional eco e y cu es. Da a we e ob ained
om 11 di e en ba ches o oocy es. To illus a e s eady-s a e ac i a ion, s eady-s a e inac i a ion and eco e y om inac i a ion, we used 3–5
ep esen a i e measu emen s. Fo o al numbe o measu emen s (n¼25–27) and o s a is ical da a e alua ion (Vm, s) see he Supplemen a y Table 2.
Ba s indica e s.e.m. S uden es , *** indica es Po0.001.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms11067 ARTICLE
NATURE COMMUNICATIONS | 7:11067 | DOI: 10.1038/ncomms11067 | www.na u e.com/na u ecommunica ions 7
(AAV-U7-ASScn5a) we e injec ed sys emically in o newbo n
wild- ype mice and ca diac unc ions we e in es iga ed 4 and 6
mon hs pos injec ion. Con ol animals injec ed ei he wi h saline
o emp y AAV2/9 p esen ed no splicing al e a ions o Scn5a and
no mal ca diac unc ions. In con as , mice injec ed wi h AAV-
U7-ASScn5a p esen ed a dec eased inclusion o adul exon 6B wi h
a concomi an 30–40% inc ease o he inclusion o exon 6A, hus
ep oducing he si ua ion obse ed in DM (Fig. 6b). Quan i a i e
RT–PCR demons a ed no changes in he exp ession o Scn5a
mRNA o o i s associa ed subuni Scn1b be ween con ol-
and AAV-U7-ASScn5a-injec ed mice (Fig. 6c). Impo an ly,
AAV-U7-ASScn5a-injec ed mice ep oduce some o he key
Adul Fe al
5 76A 6B 5 76A
Fo ced inclusion o
exon 6A in adul
% Exon 6A
CTL U7-ASScn5a
0
20
40
60 ***
c
mRNA
Scn1b Gja1Scn5a
CTL
U7-ASScn5a
0
0.5
1
2
1.5
Con ol U7-ASScn5a
Col3a1
mRNA
0
0.5
1
2
1.5
T
g
b1Cola1a
CTL
U7-ASScn5a
*
**
QT
0
10
20
30
50
40
PR
0
10
20
30
50
40 ***
ms
CTL U7-ASScn5a
mn
150
75
0
225
0.5 1 1.5 20
0.5 1 1.5 20
RR RR
150
75
0
225
CTL
U7-ASScn5a
6B
6A
P
QRS
P
QRS 25 ms
CTL
U7-ASScn5a
P
QRS
P
QRS
CTL
U7-ASScn5a
g
0
5
10
20
15
QRS
0.058
100
200
300
bp
Scn5A an isense
sequences
a
b
de
hi
Figu e 6 | Al e a ion o Scn5a splicing causes hea conduc ion de ec s and a hy hmias. (a) Schema ic ep esen a ion o mu ually exclusi e exons 6A
and 6B o Scn5a and o an isense sequences d i en by op imized U7-snRNAs (U7-ASScn5a) o o ce e al exon 6A inclusion in adul wild- ype mouse hea .
(b, uppe ) RT–PCR analysis o he al e na i e splicing o endogenous Scn5a mRNA om hea samples o mice injec ed wi h AAV2/9 exp essing
U7-ASScn5a compa ed wi h con ol injec ed mice. Molecula size ma ke is indica ed in bp. (lowe ) Pe cen age o Scn5a mRNA including exon 6A. (c) Real-
ime RT-qPCR quan ifica ion o he exp ession o Scn5a, Scn1b and GJja1 (connexin 43) mRNAs in hea samples o mice exp essing U7-ASScn5a (n¼6)
compa ed wi h con ol injec ed mice (n¼6). (d) Rep esen a i e ECG aces show p olonga ion o he PR in e al in U7-ASScn5a-injec ed mice compa ed
wi h con ol mice. (e) ECG measu es o PR in e al, QRS and QT in e als in 4-mon h-old mice injec ed wi h AAV2/9 exp essing U7-ASScn5a (n¼25)
compa ed wi h age-ma ched con ol mice (n¼17). ( ) Rep esen a i e ECG aces e eal a ial fib illa ion in U7-ASScn5a-injec ed mice compa ed wi h
con ol mice. (g) Va ia ion o he RR in e al indica es e idences o hea a hy hmias in U7-ASScn5a-injec ed mice (n¼25) compa ed wi h con ol mice
(n¼17). (h) Rep esen a i e image o six analysed hea samples showing mild fib osis e ealed by Red Si ius his ology s aining in AAV-U7-ASScn5a-injec ed
mice. Scale ba , 100 mm. (i) Real- ime RT-qPCR quan ifica ion o he exp ession o Cola1a, Col3a1 and Tg b mRNAs in hea o con ol (n¼6) o AAV-U7-
ASScn5a-injec ed mice (n¼6). Ba s indica e s.e.m. S uden es , * indica es Po0.5, ** indica es Po0.01, *** indica es Po0.001. bp, base pai .
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms11067
8NATURE COMMUNICATIONS | 7:11067 | DOI: 10.1038/ncomms11067 | www.na u e.com/na u ecommunica ions
pa hological ea u es o DM, including conduc ion de ec s and
hea a hy hmias. Indeed, ECG pe o med 4 mon hs pos
injec ion e ealed a significan p olonga ion o he PR in e als
(S uden - es , P alue 0.001) in AAV-U7-ASScn5a-injec ed
mice compa ed wi h con ol injec ed mice (Fig. 6d,e). In con as ,
QT in e al was no significan ly al e ed, and we iden ified only a
end owa ds inc eased QRS du a ion (S uden - es , P alue o
0.058 wi h 8 AAV-U7-ASScn5a-injec ed mice on 25 p esen ing a
QRS highe han 19 ms e sus 16.5 ms in con ol mice) (Fig. 6e
and Supplemen a y Fig. 4B). Simila ly, analysis o hea unc ions
in 6-mon h-old animals showed ha AAV-U7-ASScn5a-injec ed
mice p esen a consis en inc ease o he PR in e al compa ed
wi h con ol injec ed mice (40.5 ms e sus 34.8 ms espec i ely;
S uden - es , P alue 0.05), wi hou significan changes o
he QRS and QT in e als (Supplemen a y Fig. 4B). O in e es , a
simila elonga ion o he PR in e al was obse ed in Scn5aþ/
mice, which a e hemizygo e o Scn5a exp ession and ep esen
an es ablished model o ca diac-conduc ion disease45–47.
Fu he mo e, ECG analyses also e ealed ha 44% o
AAV-U7-ASScn5a-injec ed mice de elop significan (S uden
- es , Po0,001) hea a hy hmia a 4 mon hs pos injec ion
wi h an a e age o fi e a hy hmic e en s, defined as a ia ion o
he RR in e al, pe minu e whe eas con ol injec ed animals
showed no al e a ions (Fig. 6 ,g). We did no de ec
en icula fib illa ions o second and hi d-deg ee hea
blocks in any injec ed animals. In con as , we obse ed
sup a en icula p ema u e con ac ions and a ial fib illa ion in
AAV-U7-ASScn5a-injec ed mice (Fig. 6 ), and fi e o hese
injec ed mice died suddenly be ween 4 and 6 mon hs pos
injec ions (none o he con ol mice died). These elec ical
al e a ions we e specific and no caused by global ca diac
emodelling since we obse ed nei he sys olic no dias olic
al e a ions by dopple echoca diog aphy (Supplemen a y Table 3)
and no change in hea /body weigh a io (4.4±0,1 mg g1
in con ol, n¼9, e sus 4,7±0,2 mg g1in AAV-U7-ASScn5a-
injec ed animals, n¼14). As u he con ol, H&E-s aining
e ealed no mal hea s uc u es wi h no e iden
ca diomyopa hy o dila ion a 6 mon hs pos AAV injec ions
(Supplemen a y Fig. 4C). Simila ly, quan i a i e RT–PCR
expe imen s show no al e a ion in he exp ession le els o
Nppa,Nppb (encoding Anp and Bnp, espec i ely) and
Myh7 mRNAs (Supplemen a y Fig. 4D), sugges ing no o e
ca diac emodelling in an isense AAV-U7-ASScn5a-injec ed mice.
Mo eo e , Si ius Red s aining confi med no mal hea s uc u es
bu also e ealed some mild fib osis (Fig. 6h), which was
confi med by inc eased exp ession o collagen Cola1a and Tg b1
mRNAs (Fig. 6i). In e es ingly, mild fib osis is also obse ed in
DM ca diac samples17,18, as well as in indi iduals and mice
models wi h loss-o - unc ion mu a ions o he SCN5A
gene20,21,46,47. O e all, hea a hy hmias and p olonged PR
in e al in AAV-U7-ASScn5a-injec ed animals demons a e ha
inclusion o he e al exon 6A o Scn5a is inapp op ia e o adul
mouse hea physiology. Howe e , while we ound a clea
elonga ion o he PR in e al, we did no de ec a significan
al e a ion o he QRS du a ion as only a hi d o AAV-U7-
ASScn5a-injec ed mice p esen inc eased QRS du a ion (419 ms).
In e es ingly, simila findings ha e been desc ibed in Scn5aþ/
mice, which all show elonga ion o he PR in e al, while only a
subse o Scn5aþ/animals p esen a p olonga ion o he QRS
in e al45. Hence, elonga ion o he PR in e al is no
sys ema ically associa ed wi h inc eased du a ion o he QRS in
mouse model o Scn5a dys unc ion. Thus, o s eng hen ou da a,
we ma hema ically es ed whe he human ca diac pa ame e s
would be al e ed by he elec ophysiological di e ences caused by
he swi ch om adul exon 6B owa ds e al exon 6A o SCN5A.
Simula ion based on a modified O’Ha a-Rudy model48,49
p edic ed a change o he QRS du a ion om 72 ms wi h
con ol adul hNa
1.5 o 88 ms wi h e al hNa
1.5e, hence a 22%
inc ease (Fig. 7a and Supplemen a y Fig. 5). Fu he mo e, we also
es ed ex en o a io- en icula change50. Ma hema ical
simula ion p edic ed a change o he a ium-His in e al om
81 ms wi h con ol hNa
1.5 o 143 ms wi h e al hNa
1.5e
(Fig. 7b). O e all, hese esul s suppo ou mouse esul s and
p o ide addi ional e idences ha mis egula ion o SCN5A
al e na i e splicing causes ca diac-conduc ion abno mali ies,
which is a key pa hological ea u e o DM (Fig. 7c).
Discussion
Ca diac de ec s a ec 80% o indi iduals wi h DM and ep esen
he second mos common cause o dea h in his disease17,18.
Howe e , he molecula mechanisms esponsible o
ca diac-conduc ion delay and en icula achyca dia in DM a e
unclea . Using RNA sequencing we iden ified a ious no el
splicing mis egula ion e en s in DM1 hea samples. Among
hese changes, he splicing swi ch om adul exon 6B o e al
exon 6A in SCN5A mRNA is o pa icula in e es . P e ious
s udies39–41 as well as ou s indica e ha hNa
1.5e, he splicing
a ian o SCN5A ound in DM and ha con ains he e al exon
6A, possesses a educed exci abili y compa ed wi h he no mal
adul splicing o m o SCN5A con aining he exon 6B.
Consequen ly, he swi ch om he hNa
1.5 o he hNa
1.5e
channel in DM may cause a slowe ups oke eloci y o he
ca diac ac ion po en ial, leading o conduc ion slowing.
Impo an ly, his hypo hesis is suppo ed by ma hema ical
simula ion as well by animal model, since imposing a swi ch
om inclusion o he con ol adul exon 6B owa ds using he
e al exon 6A o Scn5A in adul mouse hea led o
ca diac-conduc ion delay and hea a hy hmias, wo key
ea u es o DM. Mo eo e , clinical e idence also suppo s an
al e a ion o he sodium cu en in DM. Indeed, he
elec ophysiological ea u es39–41 o he e al iso o m o SCN5A
exp essed in DM a e simila o he elec ophysiological
cha ac e is ics obse ed wi h loss-o - unc ion mu a ions o
SCN5A causing ca diac-conduc ion disease51–53. Also, he e a e
some simila i ies o ECG eco ding, including p olonga ion o he
PR in e al and o he QRS du a ion, be ween indi iduals wi h
DM and indi iduals a ec ed by ca diac-conduc ion disease
caused by loss-o - unc ion mu a ions in SCN5A42,54. Finally, he
induc ion o abno mal ECG pa e n in DM pa ien s ea ed wi h
ajmaline55,56, a class Ia an ia hy hmic agen ac ing on he ca diac
sodium channel and he abno mal sodium cu en obse ed in a
mouse model o DM57, a e also e oca i e o a dys unc ion o he
sodium channel in DM. O e all, ou esul s sugges ha
mis egula ion o he splicing o SCN5A pa icipa es in a subse
o elec ical ca diac al e a ions obse ed in DM, namely he
ca diac-conduc ion delay and he hea a hy hmias. Howe e , i
is likely ha o he al e na i e splicing al e a ions and/o
mechanisms58–61 a e pa icipa ing o he ull pa e n o ca diac
al e a ions in DM since knockou o Mbnl1 and Mbnl2 in mice
leads o only mild al e a ion o Scn5A splicing, while hese mice
show se e e conduc ion disease and ca diac dila a ion43,44.
In conclusion, his wo k may also ha e some clinical
impo ance such as conside ing wi h cau ion he ea men s o
DM pa ien s wi h pha maceu ical agen s ha educe he ac i i y
o he ca diac sodium channel, including mexile ine, flecainide
and o he an ia hy hmic d ugs o class I. In ha aspec , his
s udy may p o ide a molecula explana ion o he ad e se ca diac
eac ion o some pa ien s wi h myo onic dys ophic o ea men
wi h d ugs educing ac i i y o SCN5A ( e s 62,63). In ol emen
o he ca diac sodium channel in DM migh also highligh he
impo ance o conside ing polymo phism in he SCN5A gene, as
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms11067 ARTICLE
NATURE COMMUNICATIONS | 7:11067 | DOI: 10.1038/ncomms11067 | www.na u e.com/na u ecommunica ions 9