scieee Open visual document viewer

Expression of the Alternative Oxidase Influences JNK Signaling and Cell Migration

Andjelković, Ana,Mordas, Amelia,Bruinsma, Lyon,Ketola, Annika,Cannino, Giuseppe,Giordano, Luca,Dhandapani, Praveen K,Szibor, Marten,Dufour, Eric,Jacobs, Howard T

Full text

Exp ession o he Al e na i e Oxidase Influences Jun N-Te minal Kinase Signaling and Cell Mig a ion Ana Andjelko ic´, a,b Amelia Mo das, a,b *Lyon B uinsma, a,b *Annika Ke ola, a,b *Giuseppe Cannino, a,b *Luca Gio dano, a,b * P a een K. Dhandapani, a,b,c Ma en Szibo , a,b,c E ic Du ou , a,b Howa d T. Jacobs a,b,c a Facul y o Medicine and Li e Sciences, Uni e si y o Tampe e, Tampe e, Finland b BioMediTech Ins i u e, Uni e si y o Tampe e, Tampe e, Finland c Ins i u e o Bio echnology, Uni e si y o Helsinki, Helsinki, Finland ABSTRACT Down egula ion o Jun N- e minal kinase (JNK) signaling inhibi s cell mig a ion in di e se model sys ems. In D osophila pupal de elopmen , a enua ed JNK signaling in he ho acic do sal epi helium leads o de ec i e midline closu e, e- sul ing in cle ho ax. He e we epo ha concomi an exp ession o he Ciona in- es inalis al e na i e oxidase (AOX) was able o compensa e o JNK pa hway down- egula ion, subs an ially co ec ing he cle ho ax pheno ype. AOX exp ession also p omo ed wound-healing beha io and single-cell mig a ion in immo alized mouse emb yonic fib oblas s (iMEFs), coun e ac ing he e ec o JNK pa hway inhibi ion. Howe e , AOX was no able o escue de elopmen al pheno ypes esul ing om knockdown o he AP-1 ansc ip ion ac o , he canonical a ge o JNK, no i s a - ge s and had no e ec on AP-1-dependen ansc ip ion. The mig a ion o AOX- exp essing iMEFs in he wound-healing assay was di e en ially s imula ed by an i- mycin A, which edi ec s espi a o y elec on flow h ough AOX, al e ing he balance be ween mi ochond ial ATP and hea p oduc ion. Since o he ea men s a ec ing mi ochond ial ATP did no s imula e wound healing, we p opose inc eased mi o- chond ial hea p oduc ion as he mos likely p ima y mechanism o ac ion o AOX in p omo ing cell mig a ion in hese a ious con ex s. KEYWORDS AP-1, Jun N- e minal kinase, al e na i e oxidase, ansc ip ion, wound healing Cell mig a ion is an essen ial p ocess in animal de elopmen , as well as in issue epai . I has been widely s udied in model sys ems, whe e he ocus has been la gely on mechanosensa ion and mechano ansduc ion (1, 2). The ansc ip ional and cy oskele al egula ion o cell mig a ion ensu es coo dina ion and an abili y o espond o ex insic and in insic cues (2). A he cellula le el, he mos s udied mammalian model is he sc a ch o wound-healing assay, in which a linea sc a ch is made in a confluen monolaye o cells, which hen mig a e o close he gap a a measu able a e (3). In D osophila de elopmen , cell mig a ion has been s udied in emb yogenesis, in he p ocess o do sal closu e (4, 5), and la e on du ing me amo phosis, when many o he same genes a e in ol ed in ho acic closu e (6). This p ocess in ol es cells e e ing om he wing imaginal discs, which sp ead o e he p eexis ing la al epide mis (7). These mig a ing cell shee s e en ually use a he midline o c ea e a closed epi helial laye ha gi es ise o he cu icula s uc u es o he do sal ho ax. In an ea lie s udy (8), we epo ed ha he p ocess o do sal ho acic closu e is dis up ed by he exp ession o a commonly used, inducible d i e o ansgene exp es- sion, GeneSwi ch, in he p esence o he inducing s e oid RU486. GeneSwi ch is a modified e sion o he Saccha omyces ce e isiae ansc ip ion ac o GAL4 inco po a - ing he ligand-binding domain o he p oges e one ecep o so as o place i unde Recei ed 5 Ma ch 2018 Re u ned o modifica ion 11 Ap il 2018 Accep ed 11 Sep embe 2018 Accep ed manusc ip pos ed online 17 Sep embe 2018 Ci a ion Andjelko ic´ A, Mo das A, B uinsma L, Ke ola A, Cannino G, Gio dano L, Dhandapani PK, Szibo M, Du ou E, Jacobs HT. 2018. Exp ession o he al e na i e oxidase influences Jun N- e minal kinase signaling and cell mig a ion. Mol Cell Biol 38:e00110-18. h ps:// doi.o g/10.1128/MCB.00110-18. Copy igh © 2018 Andjelko ic´ e al. This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion 4.0 In e na ional license. Add ess co espondence o Howa d T. Jacobs, howa d. .jacobs@u a.fi. *P esen add ess: Amelia Mo das, Ins i u e o Molecula , Cell and Sys ems Biology, Uni e si y o Glasgow, Glasgow, Sco land, Uni ed Kingdom; Lyon B uinsma, Labo a o y o Sys ems and Syn he ic Biology, Wageningen Uni e si y & Resea ch, Wageningen, The Ne he lands; Annika Ke ola, VTT Technical Resea ch Cen e o Finland L d., Espoo, Finland; Giuseppe Cannino, CNR Ins i u e o Neu oscience and Depa men o Biomedical Sciences, Uni e si y o Pado a, Padua, I aly; Luca Gio dano, Uni e si y o Pi sbu gh School o Medicine, Di ision o Ca diology, Pi sbu gh, Pennsyl ania, USA. E.D. and H.T.J. con ibu ed equally o his a icle. RESEARCH ARTICLE c ossm Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 1Molecula and Cellula Biology on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om s e oid con ol (9, 10). Since p oges e one o i s analogues a e no ound in D osophila, i had been assumed ha GeneSwi ch plus RU486 would be pheno ypically ine in o he wise wild- ype flies, which is indeed he case in adul s. Al hough cle ho ax was he mos d ama ic and equen pheno ype obse ed in GeneSwi ch-exp essing flies ea ed h oughou de elopmen on RU486-con aining medium, o he de elopmen al dysmo phologies we e also obse ed, including wings wi h apop o ic egions, abno - mal o missing b is les, and cle abdomen. In he cou se o hese s udies, we obse ed ha coexp ession o he mi ochon- d ial al e na i e oxidase (AOX) om Ciona in es inalis was able o e e he cle ho ax and o he dysmo phological pheno ypes b ough abou by GeneSwi ch plus RU486 (8). Exp ession o an o he wise ine ansgene, such as g een fluo escen p o ein (GFP), he al e na i e NADH dehyd ogenase Ndi1 om yeas , o e en a ca aly ically inac i e a ian o AOX, was unable o co ec GeneSwi ch-plus-RU486- induced cle ho ax (8). AOX ep esen s an accesso y componen o he mi ochond ial espi a o y chain (RC), which is ound in mic obes, plan s, and some me azoan phyla bu no insec s o e eb a es (11). AOX p o ides a non-p o on-mo i e bypass o complexes III (cIII) and IV (cIV) o he s anda d RC. In a ious con ex s, i is able o elie e me abolically dele e ious s esses a ising om damage, oxic inhibi ion, o o e load o he RC (11, 12). Fu he mo e, when exp essed in human cells, flies, o mice, Ciona AOX can alle ia e he damaging pheno ypes associa ed wi h RC inhibi ion (13–19). Howe e , he link be- ween espi a o y homeos asis and dysmo phologies esul ing om GeneSwi ch plus RU486 is unknown. These findings p omp ed us o es whe he AOX could e e he cle ho ax pheno ype b ough abou by gene ic manipula ions in he signaling ne wo k ha main ains he mig a o y beha io o he cell shee s e e ing om he wing discs. Th ee such classes o mu an s ha e been s udied. Fi s , cle ho ax is mani es ed by specific, ecessi e alleles o he gene encoding he D osophila RXR homologue, ul aspi acle (usp), which ac s as a dime iza ion pa ne o he ecdysone ecep o (20). Second, compound he e ozygo es o ano he essen ial ansc ip ion ac o , he GATA ac o pannie (pn ), also gi e ise o his pheno ype (21). One pn allele used in hese s udies is pn MD237 , a hypomo ph c ea ed by inse ion o GAL4 in o he p omo e egion o one o he wo an agonis ic pn iso o ms. This allele was o iginally isola ed in an enhance - ap sc een and has p o en use ul as a d i e o ansgene exp ession in he specific domain o pn exp ession in he do sal epi he- lium; hus, i is o en e e ed o as pn -GAL4. Thi d, cle ho ax esul s om mu a ions in he Jun N- e minal kinase (JNK) signaling pa hway (4)(Fig. 1A). JNK (22) is a membe o he mi ogen-ac i a ed p o ein (MAP) kinase amily ha ac i a es he AP-1 ansc ip ion ac o by phos- pho yla ing i s c-Jun subuni (23). AP-1 has a ple ho a o cellula oles, which include he egula ion o cell mig a ion bo h in de elopmen (24) and in pa hology, e.g., umo in asion (25). I is also subjec o many ypes o egula ion (26). JNK is i sel ac i a ed by a a ie y o s esses h ough a classic kinase cascade (27,28). In he con ex o ho acic closu e, he ini ia ing s imulus appea s o be he engage- men o ecep o y osine kinase p (29) (PDGF [pla ele -de i ed g ow h ac o ] and VEGF [ ascula endo helial g ow h ac o ecep o ] ecep o ela ed). Cle ho ax is p oduced by mu an alleles o he JNK kinase (JNKK) hemip e ous (hep)( 30)o o he AP-1 subuni kayak (kay; he D osophila o holog o mammalian c-Fos)( 31). The use o pn -GAL4 o o he d i e s o b ing abou he local down egula ion o JNK a ge s, such as sca ace (se ine p o ease) (32), o o e exp ession o he AP-1 a ge pucke ed (puc;a phospha ase egula o o JNK ia a nega i e eedback loop) (33)o he issue inhibi o o me allop o eases (Timp)( 34) can also p oduce cle ho ax, while down- egula ion o puc can escue cle ho ax caused by mu a ions o hep (30). One key a ge o JNK in do sal closu e (35,36) is he ans o ming g ow h ac o ␤ amily membe decapen aplegic (dpp). In ho acic closu e, dpp p omo es he mig a ion o cells a he imaginal leading edge (7), bu i ac s in a pa allel pa hway a he han Andjelko ic´ e al. Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 2 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om downs eam o JNK (30). One key a ge o dpp in ho acic closu e is pn (37). A dpp homologue in mammals is simila ly in ol ed in pala al closu e (38). We he e o e se ou o es whe he AOX could escue cle ho ax when induced by manipula ions o he JNK pa hway and he associa ed gene ne wo k desc ibed abo e. RESULTS AOX exp ession mi iga es cle ho ax due o down egula ion o JNK signaling. We fi s confi med, using RNA in e e ence (RNAi) and he pn -GAL4 (pn MD237 ) d i e , ha he down egula ion o key componen s o he JNK signaling cascade (Fig. 1A)(22)in he mediodo sal egion du ing D osophila de elopmen esul ed in a pheno ype o cle ho ax. A e e i ying he exp ession pa e n con e ed by pn -GAL4, using he GFP epo e al eady p esen in he pn MD237 s ock (Fig. 1B; see Table S1 in he supplemen al ma e ial), we combined i wi h RNAi inse ions a ge ed agains baske (bsk; encoding JNK), hemip e ous (hep; encoding JNKK), misshapen (msn; JNKKKK), and PDGF- and VEGF- ecep o ela ed (p ; encoding he ecep o y osine kinase a he op o he cascade [Table S2]). These all p oduced a cle ho ax pheno ype o a ious se e i ies (see Fig. 1C o examples), acco ding o he es ed cons uc /inse ion and empe a u e. The wo isola es o he pn -GAL4 d i e ga e indis inguishable mo phological pheno- ypes and we e he e o e used in e changeably in he emainde o he s udy. Unde condi ions p oducing he clea es pheno ypes, bu a oiding subs an ial le hali y (ex- cep in he case o p , whe e i was una oidable), we hen combined hese wi h exp ession cons uc s o AOX o o a con ol ansgene, he GFP gene (Fig. 2 and 3). Fo bsk and hep we es ed mul iple RNAi lines (Table S1), each p oducing cle ho ax when combined wi h he pn -GAL4 d i e . Al hough he se e i y o cle ho ax a ied FIG 1 Cle ho ax p oduced by down egula ion o JNK signaling. (A) Summa y o he main s eps in he JNK signaling cascade in D osophila ho acic de elopmen indica ing D osophila genes by hei s anda d symbols and hei unc ional assignmen s in ed ex . The do ed line o dpp ep esen s i s ac i a ion by AP-1 in emb yonic do sal closu e bu no in pupal ho acic closu e. pn is ac i a ed by dpp o egula e he do sal pheno ype. The s eps indica ed wi h a g een backg ound a e he ones ha we e clea ly influenced by AOX, based on he da a p esen ed la e in he pape . TGF- ␤ , ans o ming g ow h ac o ␤ . (B) Li e-cell imaging o a 13- o 15-h-old emb yo (i), an L3-s age la a (ii), and a pupa (iii) o flies exp essing GFP unde he con ol o he pn -GAL4 d i e (o iginal pn MD237 s ain). (C) Examples o ho acic pheno ypes sco ed as no mal, mild, o se e e, wi h a ows indica ing he end wi hin each class owa d mo e se e e cle ho ax pheno ypes. AOX and Cell Mig a ion Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 3 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om sligh ly be ween expe imen s, exp ession o AOX (Fig. 2A and 3A and B) bu no ha o GFP (Fig. 2B) led o a significan and subs an ial shi owa d a wild- ype pheno ype in he p ogeny o bsk o hep knockdown flies. Two di e en RNAi lines o each gene showed he same e ec (Fig. 3E o G). Any con ibu ion o he alle ia ion o he pheno ype om p omo e dilu ion was excluded by measu ing he amoun o AOX RNA d i en by pn -GAL4 in pupae wi h and wi hou one o he double-s anded RNA (dsRNA) cons uc s o hep, which showed no significan di e ence (Fig. 2D). FIG 2 AOX escues cle ho ax p oduced by down egula ion o JNK signaling. (A, B) E ec s o coex- p essing AOX (A) o GFP (B) on he p opo ion o di e en pheno ypic classes esul ing om knockdown o bsk and hep, using he pn -GAL4 d i e and RNAi lines KK 104569 (bsk) and GD 47507 (hep). Fo de ails o he c osses, see Table S2 in he supplemen al ma e ial. The da a ep esen he means ⫾SEM o nine eplica e ials in each expe imen , wi h nindica ing he o al numbe o flies analyzed in each case. S a is ically significan di e ences be ween he p opo ions o AOX- o GFP-exp essing and -nonexp essing flies o di e en pheno ypic classes a e shown. P alues, as indica ed, we e de e - mined by pai ed, wo- ailed S uden ’s es wi h Bon e oni co ec ion. (C) E ec o coexp essing AOX o GFP on pupal semile hali y caused by knockdown o p (RNAi line KK 105353) using he pn -GAL4 d i e . Fo de ails o he c osses, see Table S2 in he supplemen al ma e ial. The da a ep esen he means ⫾SEM o nine eplica e ials in each expe imen , wi h nindica ing he o al numbe o flies analyzed in each case. S a is ically significan di e ences be ween classes a e indica ed, wi h P alues being de e mined by analysis o a iance wi h he Tukey pos hoc hones ly significan di e ence (HSD) es . No e ha con e sion o pe cen ages o each ial co ec s o di e en ial le hali y and o o he ial-specific anomalies. (D) qRT-PCR analysis o AOX RNA (means ⫾SD; n⫽3) in hemizygous UAS-AOX F6 ansgenic flies ha we e also hemizygous o pn MD237 (pn -GAL4), wi h o wi hou he hep RNAi cons uc o line GD 47509. Values we e no malized agains hose o RpL32 and hen agains he mean alue o flies exp essing AOX only, o gene a e he ela i e alues shown. KD, knockdown. Andjelko ic´ e al. Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 4 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om Fo msn knockdown, e y ew flies eclosed using he a ailable RNAi line, and AOX o GFP exp ession p oduced no significan change in pheno ype, despi e a end owa d he wild ype o AOX (Fig. 3C) and inc eased se e i y in he case o GFP (Fig. 3F). A p knockdown line was pupal semile hal when combined wi h he pn -GAL4 d i e , e en a 18°C. As a esul , he numbe o eclosing p ogeny was insu ficien o enable a s a is ically meaning ul analysis o he ho acic pheno ype acco ding o se e i y, bu he mean p opo ion o p ogeny wi h cle ho ax was abou 80% in his and pa allel p knockdown expe imen s. Coexp ession o AOX, bu no GFP, ga e subs an ial escue o semile hali y (Fig. 2C), wi h 71% (75/105) o he eclosing flies ha ing a no mal ho ax. AOX exp ession can influence mammalian cell mig a ion. The ailu e o ho acic do sal closu e du ing D osophila de elopmen indica es a de ec in cell mig a ion, which AOX exp ession was able o co ec . To es he gene ali y o his finding, we conduc ed cell mig a ion assays in mammalian cells. Mouse emb yonic fib oblas s (MEFs) we e isola ed om AOX hemizygous mice and wild- ype li e ma es and im- mo alized using a s anda d e o i al ansduc ion p ocedu e wi h i uses encoding human papilloma i us 16 (HPV16) oncop o eins E6 and E7 (39). AOX-endowed immo - alized MEFs (iMEFs) showed an inc eased speed o wound closu e in he s anda d FIG 3 Confi ma ion o AOX escue o cle ho ax caused by JNK knockdown. E ec s o coexp essing AOX o GFP on he p opo ion o di e en pheno ypic classes esul ing om knockdown o bsk,hep, and msn, using he pn -GAL4 d i e . (A, B) Repea s o expe imen s whose esul s a e shown in Fig. 2A. (C) Resul s o assays wi h RNAi line KK 101517 (msn) wi h coexp ession o AOX. (D, E, G) Repea s o he expe imen s whose esul s a e shown in Fig. 2A, using al e na e RNAi lines, GD 38138 (bsk) and GD 47509 (hep). (F) Resul s o assays wi h RNAi line KK 101517 (msn) wi h coexp ession o GFP. Fo de ails o he c osses, see Table S2 in he supplemen al ma e ial. The da a ep esen he means ⫾SEM o nine eplica e ials in each expe imen , wi h nindica ing he o al numbe o flies analyzed in each case. S a is ically significan di e ences be ween he p opo ions o AOX- o GFP-exp essing and -nonexp essing flies o di e en pheno ypic classes a e shown. P alues, as indica ed, we e de e mined by pai ed, wo- ailed S uden ’s es wi h Bon e oni co ec ion. No e ha con e sion o pe cen ages o each ial co ec s o di e en ial le hali y and o o he ial-specific anomalies. AOX and Cell Mig a ion Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 5 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om sc a ch assay (Fig. 4A), which was main ained in he p esence o a ious d ugs, no ably, pho bol my is a e ace a e (PMA), an indi ec ac i a o o AP-1-dependen ansc ip ion (ac ing ia p o ein kinase C), and he JNK inhibi o SP600125. Howe e , JNK inhibi o V dec eased he a e o wound closu e o AOX-endowed iMEFs o he same le el as wild- ype iMEFs. The sc a ch assay conduc ed on p ima y MEFs (a passage 6) e ealed no di e ence in mig a ion a e be ween AOX-endowed and con ol MEFs (Fig. 4B). All p ima y lines mig a ed much mo e slowly han iMEFs, wi h inhibi o V also p oducing subs an ial cell dea h. The a e o single-cell mig a ion o AOX-endowed iMEFs was also significan ly g ea e han ha o con ol iMEFs (Fig. 4C). AOX exp ession has no sys ema ic e ec on c-Jun phospho yla ion. We nex es ed he same se o JNK modula o s o hei e ec s on c-Jun phospho yla ion a JNK a ge si es (40) Se 63 and Se 73, which has been shown o p omo e wound healing in he sc a ch assay (41). This was done in iMEFs (Fig. 5A), as well as in wo o he cell lines, he HEK293-de i ed AP-1 ansc ip ional epo e line used la e in he s udy (HEK-AP1) (Fig. 5B) and human fib oblas line BJ-5 a (Fig. 5C). Only SP600125 dec eased he amoun o phospho yla ed c-Jun, whe eas JNK inhibi o V ins ead inc eased i , as did PMA. The p esence o AOX did no influence c-Jun phospho yla ion a hese si es in iMEFs (Fig. 5A), al hough i did appea o po en ia e he e ec o inhibi o V in an AOX-exp essing BJ-5 a cell clone (Fig. 5C). AOX does no escue cle ho ax caused by manipula ion o AP-1 exp ession o o he a ge s. We easoned ha di ec ly down egula ing c-Jun o i s dime iza ion pa ne , c-Fos, encoded in D osophila by Jun- ela ed an igen (J a) and kayak (kay), espec i ely, should p oduce e ec s ha la gely o e ide i s egula ion by JNK and he beneficial e ec s o AOX. Acco dingly, coexp ession o AOX had only a sligh e ec on he se e i y o cle ho ax induced by knockdown o kay o J a using he pn -GAL4 FIG 4 E ec s o AOX on mammalian cell mig a ion. (A, B) Ra e o wound closu e in sc a ch assay o cul u ed wild- ype iMEFs (con ol) and AOX hemizygous iMEFs (A) and p ima y MEFs (B) a passage 6, as indica ed, ei he un ea ed (un ), ea ed wi h only 0.2% DMSO, wi h PMA (20 mM), wi h SP600125 (20 ␮ M in 0.2% DMSO), o wi h JNK inhibi o V (inh V; 20 ␮ M), as shown. As e isks abo e he ba s indica e a s a is ically significan di e ence (de e mined by one-way analysis o a iance wi h he Tukey pos hoc HSD es ) om un ea ed cells o he gi en geno ype. As e isks joining he ba s indica e s a is ically significan di e ences be ween he geno ypes o a gi en ea men , based on he same s a is ical analysis. Fo cla i y, o he significan di e ences a e no shown. All da a poin s a e based on h ee biological eplica es, each analyzed in iplica e, excep o DMSO only, which used only wo biological eplica es. Fo he p ima y MEFs in panel B, he means ⫾SD a e o pooled da a om wo cell lines o each geno ype analyzed in iplica e a passage 6. (C) Ra e o mig a ion o single iMEFs o he indica ed geno ypes. As e isks deno e s a is ical significance, as shown (S uden ’s es , unpai ed; n⫽31 o con ol iMEFs; n⫽21 o AOX-endowed iMEFs). Andjelko ic´ e al. Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 6 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om d i e (Fig. 6A and B). Simila ly, AOX was unable o escue he le hali y caused by o e ex- p ession o he AP-1 a ge , puc, which also an agonizes he ac ion o bsk (Fig. 6C). No e, howe e , ha his esul may be i ial, since puc o e exp ession gene a es a se e e emb yonic pheno ype, due o he inhibi ion o do sal closu e. As discussed ea lie , pn is conside ed o ac in ho acic closu e ia a pa hway pa allel o he JNK pa hway. Since he pn -GAL4 line pn MD237 is also a pn hypomo ph, we combined i wi h he pn D1 mu an as a compound he e ozygo e, p oducing, as expec ed, a pheno ype o se e e cle ho ax (Fig. 6D). This was no alle ia ed by AOX, whe he i was supplied using a cons i u i e o a GAL4-dependen ansgene (Fig. 6D). Ou findings a e consis en wi h he in e ence ha AOX ac s on JNK signaling ups eam o AP-1 bu canno compensa e o a deficiency o AP-1 i sel no o a pa allel pa hway also equi ed o ho acic closu e. FIG 5 Phospho yla ion s a us o JNK a ge esidues in c-Jun. Wes e n blo s o whole-cell p o ein ex ac s om con ol and AOX-exp essing iMEFs (A), HEK-AP1 cells (B), and AOX-exp essing o con ol human BJ-5 a fib oblas s (C) un ea ed (un ) o ea ed wi h JNK modula o s, as shown: 0.2% DMSO, 20 ␮ M SP600125 (SP) in 0.2% DMSO, 20 ␮ M JNK inhibi o V (V o inh V), o 8 nM PMA. The molecula weigh s o he majo bands de ec ed by each an ibody, in e ed om size ma ke s un on all gels, we e as expec ed (100 kDa o ␣ -ac inin [ ␣ -ac ], 47 kDa o c-Jun phospho yla ed a esidue Se 73 [pSe 73] o Se 63 [pSe 63]). Sepa a e blo s we e ini ially p obed o pSe 73 o pSe 63, and hen in bo h cases he blo s we e ep obed o ␣ -ac inin as a loading con ol. D ug concen a ions we e based ei he on dose- esponse cu es ob ained using he HEK-AP1 cell ansc ip ional epo e sys em ( o PMA and JNK inhibi o V; see Table S3 in he supplemen al ma e ial) o on ials o de e mine he highes concen a ion a which he e was no e idence o subs an ial cell dea h ( o SP600125). Blo images we e op imized o b igh ness and con as , o a ed, and c opped wi h he addi ion o whi e ames o di ide s o cla i y, bu wi h no o he manipula ions. AOX and Cell Mig a ion Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 7 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om AOX does no influence AP1-dependen ansc ip ion in cul u ed cells. To in es iga e he mechanism by which AOX impac s he ou come o JNK signaling, we es ed whe he i influences ansc ip ion di ec ed by AP-1. Using a well-es ablished luci e ase-based AP-1 epo e sys em (42) and a a ie y o di e en exp ession con- FIG 6 AOX does no escue cle ho ax p oduced by al e ed exp ession o AP-1 o o he a ge s. (A, B) E ec s o coexp essing AOX on he p opo ion o di e en pheno ypic classes esul ing om knockdown o kay (a 25°C) and J a (a 18°C), using he pn -GAL4 d i e and RNAi lines GD 6212 (kay) and KK 107997 (J a) (A) and al e na e RNAi lines GD 19512 (kay) and GD 10835 (J a) (B). Fo de ails o he c osses, see Table S2 in he supplemen al ma e ial. Because he GD 10835 (J a) cons uc is ca ied on ch omosome X, wo pa allel c osses we e equi ed o es he e ec s o AOX exp ession in each sex, and s a is ical analysis was no meaning ul in his case. The da a ep esen he means ⫾SEM o nine eplica e ials in each expe imen , wi h nindica ing he o al numbe o flies analyzed in each case. S a is ically significan di e ences be ween he p opo ions o AOX-exp essing and -nonexp essing flies o di e en pheno ypic classes a e shown. P alues, as indica ed, we e de e mined by pai ed, wo- ailed S uden ’s es wi h Bon e oni co ec ion. No e ha J a knockdown using RNAi line KK 107997 (J a) was le hal a 25°C and ha AOX did no escue his le hali y. (C) E ec o coexp essing AOX o GFP on pupal le hali y caused by o e exp ession o puc unde he con ol o he pn -GAL4 d i e . P ogeny classes a e as indica ed, and all con ained, in addi ion, he UAS-puc o e exp ession cons uc . Fo de ails o he c osses, see Table S2 in he supplemen al ma e ial. The da a ep esen he means ⫾SEM o nine eplica e ials in each expe imen , wi h nindica ing he o al numbe o flies analyzed in each case. No e ha con e sion o pe cen ages o each ial co ec s o di e en ial le hali y and o he ial-specific anomalies. (D) Pheno- ypes o pn MD237 /pn D1 compound he e ozygo es wi h and wi hou he p esence o AOX ansgenes, as indica ed. Nei he he GAL4-d i en UAS-AOX F6 ansgene no homozygosi y o he ub-AOX ansgenes on ch omosomes 2 and X p oduced he escue o he s ong cle ho ax pheno ype. No e ha because p ogeny pheno ypes we e essen ially uni o m o a gi en geno ype, no meaning ul a iances could be calcula ed. Andjelko ic´ e al. Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 8 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om s uc s o AOX, we es ed whe he AOX exp ession in D osophila S2 cells was able o al e AP-1-dependen ansc ip ion unde di e en condi ions o JNK pa hway ac i a- ion. Fi s , we compa ed he ansc ip ional eadou in cells co ans ec ed wi h he epo e plasmids and wi h AOX cloned in o he coppe -inducible exp ession ec o pMT/V5-His B, wi h i s na u al s op codon, wi h ha in cells ans ec ed wi h he emp y ec o . JNK pa hway ac i a ion was achie ed using he pUAST-Hep ac plasmid, included in all ans ec ions in combina ion wi h pAc -Gal4, which p omo es pUAST-Hep ac ansc ip ion by cons i u i e exp ession o Gal4. T ans ec ion e ficiency was con olled by he inclusion o a cons i u i ely exp essed plasmid encoding enilla luci e ase, which can be expe imen ally dis inguished om he fi efly luci e ase o he epo e cons uc . Finally, o measu e backg ound ansc ip ion independen ly o AP-1, he sys em in- cludes a mu a ed e sion o he epo e (which was used as an al e na i e in ans- ec ions), o which AP-1 does no bind. Despi e he complexi y o his sys em, i ga e clea -cu esul s. AOX p oduced no significan change in AP-1-dependen luci e ase exp ession unde bo h basal and JNK-ac i a ed condi ions (Fig. 7A; Table S4). Nex , we es ed epo e cells co ans ec ed wi h a plasmid (pAC/AOX) (43) di ec ing cons i u i e AOX exp ession unde he con ol o a ␤ -ac in p omo e e sus cells co ans ec ed wi h he emp y ec o . Again, AOX exp ession had no e ec on he ansc ip ional eadou (Fig. 7B; Table S4). Using a sys em in which JNK pa hway ac i a ion and AOX induc ion we e b ough abou simul aneously by exp ession o he exogenous ansc ip ion ac o Gal4, bu his ime using a con ol plasmid ha bo ing a ca aly ically inac i e, mu a ed AOX, we again ound no e ec o AOX (Fig. 7C: see also he esul s o a pa allel expe imen in Table S4). AOX also p oduced no significan di e ence in AP-1-dependen ansc ip ion in cells whe e hep had been knocked down (Fig. 7D; Table S4). We conduc ed a simila exe cise in mammalian cells, using an HEK293 cell-de i ed epo e cell line (he e designa ed HEK-AP1), s ably ansduced wi h len i i al con- s uc s exp essing AOX o , as a con ol, he mu a ed, ca aly ically inac i e a ian (mu AOX). Success ul ansduc ion and cell cloning a limi ing dilu ion we e e ified ia he fluo escence con e ed by he co ansduced ma ke GFP, and AOX unc ionali y was e ified by espi ome y (Table S5). Al hough indi idual HEK-AP1 cell-de i ed clones showed a a iable deg ee o AP-1-dependen ansc ip ional ac i i y, AOX-exp essing and con ol cell clones showed a simila suscep ibili y o he e ec s o he JNK an agonis s SP600125 and inhibi o V (Fig. 7E). Su p isingly, SP600125 inc eased a he han dec eased he ansc ip ional eadou , despi e he ac ha i inhibi ed c-Jun phospho yla ion (Fig. 5B), al hough i did modes ly supp ess PMA-ac i a ed ansc ip- ion in he epo e line (Fig. 7E). An imycin A di e en ially s imula es he mig a ion o AOX-exp essing cells. To gain insigh in o he in acellula p ocess(es) unde lying he enhanced mig a o y beha io o AOX-exp essing cells, we es ed he e ec s o suble hal doses o a ious me abolic e ec o s on he ela i e a es o mig a ion o AOX-exp essing e sus con ol iMEFs. In an ini ial expe imen (Fig. 8A), we es ed a ious oxida i e phospho yla ion inhibi o s, an ioxidan s, and p o ease inhibi o s in he wound-healing assay o a di e en ial e ec on AOX-exp essing cells. Fo u he s udy, we selec ed h ee ea - men s ha appea ed o gi e a di e en ial e ec (an imycin A, oligomycin, and mi o- quinone mesyla e [Mi oQ]), oge he wi h wo ha did no ( o enone and ca bonyl cyanide p- ifluo ome hoxyphenylhyd azone [FCCP]), and measu ed wound closu e in ou independen expe imen s. An imycin A had a significan ly di e en e ec on he mig a ion o AOX-exp essing MEFs e sus wild- ype MEFs (Fig. 8B), s imula ing he mig a ion o he o me bu supp essing ha o he la e , whe eas Mi oQ, o enone, oligomycin, and FCCP had no significan e ec s. To unde s and he implica ions o hese findings o he mechanism by which AOX p omo es cell mig a ion, we checked he e ec s o AOX exp ession on espi a ion in he cell lines es ed (Fig. 8C). AOX had no significan e ec on whole-cell espi a ion o on pe meabilized cell espi a ion on cI-, cII-, and cIV-linked subs a es. Howe e , in he p esence o an imycin A, i enabled AOX and Cell Mig a ion Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 9 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om wo- ound PCR-based p ocedu e essen ially as desc ibed p e iously (112), bu using hep-specific p ime s (shown 5= o 3=) TGGAGGCAAAGCTCCAGGC and CGCGAACGAAGCAGCCAAGG o he fi s ound and GAATTAATACGACTCACTATAGGGGAGACATCCGCCACCCACGCACCTTC and GAATTAATACGACTCACTATA GGGGAGATCCCATTGCCCAGGTCGCCCAG o he second ound, ollowed by ansc ip ion using a MEGAsc ip T7 ansc ip ion ki (Li e Technologies). Knockdown a he RNA le el ( o ⬃85%) was e ified in ans ec ed cells (112) by qRT-PCR. Fo combined dsRNA/ epo e plasmid ans ec ions, 1 ⫻ 10 5 cells we e pla ed pe well in 24-well pla es. A e 30 min, cells we e ans ec ed wi h 300 ng o each ele an plasmid and 4 ␮ go hep-specific dsRNA pe well in a o al olume o 100 ␮ l. A u he 4 ␮ go he dsRNA was added 72 h la e , and luci e ase assays we e conduc ed 110 h a e he ini ial ans ec ion. Fo luci e ase assays, 75 ␮ l o suspended cells om each well was ans e ed in iplica e o he wells o a 96-well mic opla e (Lab Sys ems) and analyzed using a Dual-Glo luci e ase assay sys em (P omega), acco ding o he manu ac u e ’s p o ocol. Luminescence was measu ed using a The mo Labsys ems Luminoskan Ascen pla e eade . Luci e ase epo e assays in mammalian cells. Fi efly luci e ase epo e assays we e ca ied ou in HEK-AP1 cells and in AOX/mu AOX-exp essing clones de i ed om hem, as ollows: 30,000 cells we e pla ed in echnical duplica e (2 wells pe sample) in luminome e -compa ible Nunc Mic oWell 96-well pla es wi h lids (The mo Fishe Scien ific). A e 24 h, he medium was eplaced wi h medium con aining ei he 0.2% DMSO, 20 ␮ M SP600125 in 0.2% DMSO, 20 ␮ M JNK inhibi o V, o no added d ug. Cells we e incuba ed o 2ha 37°C. Fo PMA ea men , a second eplacemen medium con ained 8 nM PMA plus 20 ␮ M SP600125 in 0.2% DMSO, 20 ␮ M JNK inhibi o V, o no o he added d ug, as app op ia e, and he cells we e incuba ed o a u he 6 h. Luci e ase assays we e ca ied ou using he Dual-Glo luci e ase assay sys em (P omega), acco ding o he manu ac u e ’s p o ocol, and luminescence was measu ed using a Pe kinElme UV/ isible pla e eade . P o ein analysis by Wes e n blo ing. Ba ches o 300,000 MEFs o HEK-AP1 cells o 250,000 BJ-5 a cells we e pla ed on 6-well pla es (CellS a ; G eine Bio-One). A e 24 h, he medium was eplaced wi h medium con aining ei he 0.2% DMSO, 20 ␮ M SP600125 in 0.2% DMSO, 20 ␮ M JNK inhibi o V, 8 nM PMA, o no added d ug and he pla e was incuba ed o 2 h (o 40 min, in he case o PMA). Cells we e ca e ully insed in ice-cold phospha e-bu e ed saline (PBS) and hen sc aped ee on ice using a Cy One cell sc ape (220 mm long, 11-mm blade) in 75 ␮ l o esuspension bu e con aining 100 mM NaCl, 10 mM T is-HCl, and 1 mM EDTA, pH 7.8, supplemen ed wi h cOmple e, Mini, EDTA- ee p o ease inhibi o and phospha ase inhibi o cock ails (a he manu ac u e ’s ecommended amoun ; Roche) and 1 mM phen- ylme hylsul onyl fluo ide. P o ein concen a ions we e de e mined using he B ad o d assay. A e lysis by he addi ion o an equal olume o SDS sample bu e (Laemmli 2⫻concen a e; Sigma-Ald ich), samples we e hea ed o 5 min a 100°C and b iefly cen i uged o emo e pa icula es, and 20 ␮ g o each ex ac was loaded on o 18-well p ecas Any kD C i e ion TGX S ain-F ee p o ein gels (Bio-Rad), which we e un and blo ed as desc ibed p e iously (43). Blo s we e p ocessed as desc ibed p e iously (15), bu wi h blocking in 5% bo ine se um albumin (BSA) in PBS-Tween o 1honashake and using he p ima y an ibody phospho-c-Jun (Se 73) abbi monoclonal no. 3270 (1:1,000; Cell Signaling Technology) o phospho-c-Jun (Se 63) II abbi polyclonal 9261 (1:1,000; Cell Signaling Technology), wi h ep obing using an i- ␣ -ac inin abbi polyclonal C-20 (1:7,000; sc-7454-R; San a C uz Bio echnology). Seconda y an ibody was pe oxidase-labeled goa an i- abbi IgG (1:10,000; PI-1000; Vec o Labo a o ies). The chemiluminescence o all blo s was documen ed bo h wi h film and by using a Bio-Rad ChemiDoc image . Respi ome y. Whole-cell and pe meabilized cell espi a ion was measu ed essen ially as desc ibed p e iously (118). iMEFs we e seeded 24 h be o e he expe imen and g own in DMEM con aining 4.5 g/li e glucose, 10% e al bo ine se um (The mo Fishe Scien ific), 2 mM Glu aMAX (Gibco), and 100 U/ml penicillin plus 100 ␮ g/ml s ep omycin (Lonza). To ac i a e cell espi a ion, he g ow h medium was eplaced 1 h be o e he assay. Cells we e de ached wi h 0.05% ypsin and coun ed by ypan blue exclusion. Mi ochond ial espi a ion in pe meabilized cells was assayed using an O obo os oxyg aph-2K oxyg aph (O obo os, Innsb uck, Aus ia), wi h 2 ⫻10 6 iMEFs being di ec ly suspended in he oxyg aph chambe con aining 2 ml o espi a ion bu e B (10 mM KH 2 PO 4 , 20 mM HEPES-KOH, 20 mM au ine, 0.5 mM EGTA, 3 mM MgCl 2 , 1 mg/ml essen ially a y acid- ee BSA, 60 mM po assium-lac obiona e, 110 mM manni ol, 0.3 mM di hio h ei ol, pH 7.1). A e measu ing endogenous whole-cell espi a ion, subs a es and inhibi o s we e added in he ollowing o de : (i) digi onin (30 ␮ g), o pe meabilize he cells; (ii) sodium py u a e ( o 5 mM), sodium glu ama e ( o 5 mM), and sodium mala e ( o 2 mM) as a cI-linked subs a e mix, ollowed by ADP ( o 2 mM); (iii) o enone ( o 150 nM) ollowed by succina e ( o 10 mM) as a cII-linked subs a e mix; (i ) an imycin A ( o 30 ng/ml), o e eal AOX-media ed espi a ion; ( ) n-p opyl galla e (nPG; o 200 ␮ M), o e eal any esidual non-AOX-media ed oxygen consump ion o be sub ac ed; ( i) N,N,N=,N=- e ame hyl-p-phenylenediamine (TMPD; o 1 mM) plus sodium L-asco ba e ( o 2 mM) as a cIV-linked subs a e mix; and ( ii) sodium azide ( o 40 mM), o e eal any non-cIV-media ed oxygen consump ion o be sub ac ed. O 2 consump ion (in picomoles · second ⫺1 · millili e ⫺1 ) was no malized o he amoun o o al p o eins ex ac ed om 1 ⫻10 6 cells and assayed by he B ad o d me hod (119). All chemicals we e pu chased om Sigma-Ald ich. SUPPLEMENTAL MATERIAL Supplemen al ma e ial o his a icle may be ound a h ps://doi.o g/10.1128/MCB .00110-18. SUPPLEMENTAL FILE 1, XLS file, 0.1 MB. SUPPLEMENTAL FILE 2, XLS file, 0.1 MB. Andjelko ic´ e al. Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 16 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om SUPPLEMENTAL FILE 3, XLS file, 0.1 MB. SUPPLEMENTAL FILE 4, XLS file, 0.1 MB. SUPPLEMENTAL FILE 5, XLS file, 0.1 MB. ACKNOWLEDGMENTS This wo k was suppo ed by he Eu opean Resea ch Council (ad anced g an 232738 o H.T.J.), he Academy o Finland (Cen e o Excellence g an 272376 and Academy P o esso ship g an 283157 o H.T.J.), he Finnish Cul u al Founda ion (a g an om he Vilho Rossin Fund o A.A.), he Uni e si y o Tampe e, he Tampe e Uni e si y Hospi al Medical Resea ch Fund, and he Sig id Juselius Founda ion. We hank Tea Tuomela, Ou i Ku onen, Me ja Jokela, Sina Saa i, and Samuli Ha - ikainen o echnical assis ance; Ma cos Oli ei a o use ul discussions; Di k Bohmann o he supply o epo e plasmids; Filippo Scialó o p o iding cells and plasmids; T oy Fai h ull o c i ical eading o he manusc ip ; Ma ia Aa onen and Tiina Pessa-Mo ikawa and he Flow Cy ome y Co e Facili y in he Depa men o Biosciences, Uni e si y o Helsinki, o assis ance wi h flow cy ome y; and Ou i Paloheomo and Teemu Ihalainen (Tampe e Imaging Facili y, Uni e si y o Tampe e) and Mika Molin (Ligh Mic oscopy Uni , Ins i u e o Bio echnology, Uni e si y o Helsinki) o help wi h mic oscopy. REFERENCES 1. Pandya P, O gaz JL, Sanz-Mo eno V. 2017. Ac omyosin con ac ili y and collec i e mig a ion: may he o ce be wi h you. Cu Opin Cell Biol 48:87–96. h ps://doi.o g/10.1016/j.ceb.2017.06.006. 2. Hun e MV, Fe nandez-Gonzalez R. 2017. Coo dina ing cell mo emen s in i o: junc ional and cy oskele al dynamics lead he way. Cu Opin Cell Biol 48:54–62. h ps://doi.o g/10.1016/j.ceb.2017.05.005. 3. Ya ow JC, Pe lman ZE, Wes wood NJ, Mi chison TJ. 2004. A high- h oughpu cell mig a ion assay using sc a ch wound healing, a com- pa ison o image-based eadou me hods. BMC Bio ech 4:21. h ps:// doi.o g/10.1186/1472-6750-4-21. 4. Hayes P, Solon J. 2017. D osophila do sal closu e: an o ches a o o ces o zip shu he emb yo. Mech De 144:2–10. h ps://doi.o g/10.1016/j .mod.2016.12.005. 5. Go finkiel N, Schambe g S, Blancha d GB. 2011. In eg a i e app oaches o mo phogenesis: lessons om do sal closu e. Genesis 49:522–533. h ps://doi.o g/10.1002/d g.20704. 6. Kockel L, Homsy JG, Bohmann D. 2001. D osophila AP-1: lessons om an in e eb a e. Oncogene 20:2347–2364. h ps://doi.o g/10.1038/sj .onc.1204300. 7. Ma ín-Blanco E, Pas o -Pa eja JC, Ga cía-Bellido A. 2000. JNK and de- capen aplegic signaling con ol adhesi eness and cy oskele on dynam- ics du ing ho ax closu e in D osophila. P oc Na l Acad SciUSA 97:7888–7893. h ps://doi.o g/10.1073/pnas.97.14.7888. 8. Andjelko ic´ A, Kemppainen KK, Jacobs HT. 2016. Ligand-bound GeneSwi ch causes de elopmen al abe a ions in D osophila ha a e alle ia ed by he al e na i e oxidase. G3 (Be hesda) 6:2839–2846. h ps://doi.o g/10.1534/g3.116.030882. 9. Ab uzzese RV, Godin D, Bu cin M, Meh a V, F ench M, Li Y, O’Malley BW, No ds om JL. 1999. Ligand-dependen egula ion o plasmid-based ansgene exp ession in i o. Hum Gene The 10:1499–1507. h ps:// doi.o g/10.1089/10430349950017833. 10. McGui e SE, Roman G, Da is RL. 2004. Gene exp ession sys ems in D osophila: a syn hesis o ime and space. T ends Gene 20:384–391. h ps://doi.o g/10.1016/j. ig.2004.06.012. 11. Rogo AG, Sukhano a EI, U alskaya LA, Ali e die a DA, Z yagilskaya RA. 2014. Al e na i e oxidase: dis ibu ion, induc ion, p ope ies, s uc u e, egula ion, and unc ions. Biochemis y (Mosc) 79:1615–1634. h ps:// doi.o g/10.1134/S0006297914130112. 12. Saha B, Bo o skii G, Panda SK. 2016. Al e na i e oxidase and plan s ess ole ance. Plan Signal Beha 11:e1256530. h ps://doi.o g/10 .1080/15592324.2016.1256530. 13. Hakkaa GA, Dassa EP, Jacobs HT, Rus in P. 2006. Allo opic exp ession o a mi ochond ial al e na i e oxidase con e s cyanide esis ance o human cell espi a ion. EMBO Rep 7:341–345. h ps://doi.o g/10.1038/ sj.embo .7400601. 14. Dassa EP, Du ou E, Gonçal es S, Paupe V, Hakkaa GA, Jacobs HT, Rus in P. 2009. Exp ession o he al e na i e oxidase complemen s cy och ome c oxidase deficiency in human cells. EMBO Mol Med 1:30–36. h ps://doi.o g/10.1002/emmm.200900001. 15. Fe nandez-Ayala DJ, Sanz Va iainen AS, Kemppainen KK, Babusiak M, Mus alah i E, Cos a R, Tuomela T, Ze iani M, Chung J, O’Dell KMO, Rus in P, Jacobs HT. 2009. Exp ession o he Ciona in es inalis al e na- i e oxidase (AOX) in D osophila complemen s de ec s in mi ochond ial oxida i e phospho yla ion. Cell Me ab 9:449–460. h ps://doi.o g/10 .1016/j.cme .2009.03.004. 16. Kemppainen KK, Rinne J, S i am A, Lakanmaa M, Zeb A, Tuomela T, Popples one A, Singh S, Sanz A, Rus in P, Jacobs HT. 2014. Exp ession o al e na i e oxidase in D osophila amelio a es di e se pheno ypes due o cy och ome oxidase deficiency. Hum Mol Gene 23:2078–2093. h ps://doi.o g/10.1093/hmg/dd 601. 17. El-Khou y R, Du ou E, Rak M, Ramanan soa N, G andchamp N, Csaba Z, Du illié B, Béni P, Gallego J, G essens P, Sa kis C, Jacobs HT, Rus in P. 2013. Al e na i e oxidase exp ession in he mouse enables bypassing cy och ome c oxidase blockade and limi s mi ochond ial ROS o e p o- duc ion. PLoS Gene 9:e1003182. h ps://doi.o g/10.1371/jou nal.pgen .1003182. 18. Szibo M, Dhandapani PK, Du ou E, Holms öm KM, Zhuang Y, Salwig I, Wi ig I, Heidle J, Giza ullina Z, Gainu dino T, Ge man Mouse Clinic Conso ium, Fuchs H, Gailus-Du ne V, de Angelis MH, Nandania J, Velagapudi V, Wie elmann A, Rus in P, Gelle ich FN, Jacobs HT, B aun T. 2017. B oad AOX exp ession in a gene ically ac able mouse model does no dis u b no mal physiology. Dis Model Mech 10:163–171. h ps://doi.o g/10.1242/dmm.027839. 19. El-Khou y R, Kaulio E, Lassila KA, C ow he DC, Jacobs HT, Rus in P. 2016. Exp ession o he al e na i e oxidase mi iga es be a-amyloid p oduc ion and oxici y in model sys ems. F ee Radic Biol Med 96: 57–66. h ps://doi.o g/10.1016/j. ee adbiomed.2016.04.006. 20. Hen ich VC, Szekely AA, Kim SJ, B own NE, An oniewski C, Hayden MA, Lepesan JA, Gilbe LI. 1994. Exp ession and unc ion o he ul as- pi acle (usp) gene du ing de elopmen o D osophila melanogas e . De Biol 165:38–52. h ps://doi.o g/10.1006/dbio.1994.1232. 21. Hei zle P, Haenlin M, Ramain P, Calleja M, Simpson P. 1996. A gene ic analysis o pannie , a gene necessa y o iabili y o do sal issues and b is le posi ioning in D osophila. Gene ics 143:1271–1286. 22. Wes on CR, Da is RJ. 2002. The JNK signal ansduc ion pa hway. Cu Opin Gene De 12:14–21. h ps://doi.o g/10.1016/S0959-437X(01)00 258-1. 23. Ka in M, Gallaghe E. 2005. F om JNK o pay di : Jun kinases, hei biochemis y, physiology and clinical impo ance. IUBMB Li e 57: 283–295. h ps://doi.o g/10.1080/15216540500097111. 24. G ose R. 2003. Epi helial mig a ion: open you eyes o c-Jun. Cu Biol 13:R678–R680. h ps://doi.o g/10.1016/S0960-9822(03)00607-9. AOX and Cell Mig a ion Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 17 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om 25. Ozanne BW, Spence HJ, McGa y LC, Hennigan RF. 2007. T ansc ip ion ac o s con ol in asion: AP-1 he fi s among equals. Oncogene 26: 1–10. h ps://doi.o g/10.1038/sj.onc.1209759. 26. E e l R, Wagne EF. 2003. AP-1: a double-edged swo d in umo igenesis. Na Re Cance 3:859–868. h ps://doi.o g/10.1038/n c1209. 27. Dhillon AS, Hagan S, Ra h O. 2007. MAP kinase signaling pa hways in cance . Oncogene 26:3279–3290. h ps://doi.o g/10.1038/sj.onc .1210421. 28. Ríos-Ba e a LD, Riesgo-Esco a JR. 2013. Regula ing cell mo phogenesis: he D osophila Jun N- e minal kinase pa hway. Genesis 51:147–162. h ps://doi.o g/10.1002/d g.22354. 29. Ishima u S, Ueda R, Hinoha a Y, Oh ani M, Hana usa H. 2004. PVR plays a c i ical ole ia JNK ac i a ion in ho ax closu e du ing D osophila me amo phosis. EMBO J 23:3984–3994. h ps://doi.o g/ 10.1038/sj.emboj.7600417. 30. Agnes F, Suzanne M, Noselli S. 1999. The D osophila JNK pa hway con ols he mo phogenesis o imaginal discs du ing me amo phosis. De elopmen 126:5453–5462. 31. Zei linge J, Bohmann D. 1999. Tho ax closu e in D osophila: in ol e- men o Fos and he JNK pa hway. De elopmen 126:3947–3956. 32. S i as a a A, Dong Q. 2015. Regula ion o a se ine p o ease homolog by he JNK pa hway du ing ho acic de elopmen o D osophila mela- nogas e . FEBS Open Bio 5:117–123. h ps://doi.o g/10.1016/j. ob.2015 .01.008. 33. Pas o -Pa eja JC, G awe F, Ma in-Blanco E, Ga cia-Bellido A. 2004. In asi e cell beha io du ing D osophila imaginal disc e e sion is me- dia ed by he JNK signaling cascade. De Cell 7:387–399. h ps://doi .o g/10.1016/j.de cel.2004.07.022. 34. S i as a a A, Pas o -Pa eja JC, Igaki T, Paglia ini R, Xu T. 2007. Basemen memb ane emodeling is essen ial o D osophila disc e e sion and umo in asion. P oc Na l Acad SciUSA104:2721–2726. h ps://doi .o g/10.1073/pnas.0611666104. 35. Glise B, Noselli S. 1997. Coupling o Jun amino- e minal kinase and Decapen aplegic signaling pa hways in D osophila mo phogenesis. Genes De 11:1738–1747. h ps://doi.o g/10.1101/gad.11.13.1738. 36. Hou XS, Golds ein ES, Pe imon N. 1997. D osophila Jun elays he Jun amino- e minal kinase signal ansduc ion pa hway o he decapen- aplegic signal ansduc ion pa hway in egula ing epi helial cell shee mo emen . Genes De 11:1728–1737. h ps://doi.o g/10.1101/gad.11 .13.1728. 37. Sa o M, Saigo K. 2000. In ol emen o pannie and u-shaped in egu- la ion o decapen aplegic-dependen wingless exp ession in de elop- ing D osophila no um. Mech De 93:127–138. h ps://doi.o g/10.1016/ S0925-4773(00)00282-3. 38. Taya Y, O’Kane S, Fe guson MW. 1999. Pa hogenesis o cle pala e in TGF-be a3 knockou mice. De elopmen 126:3869–3879. 39. Lochmülle H, Johns T, Shoub idge EA. 1999. Exp ession o he E6 and E7 genes o human papilloma i us (HPV16) ex ends he li e span o human myoblas s. Exp Cell Res 248:186–193. h ps://doi.o g/10.1006/ exc .1999.4407. 40. Mo on S, Da is RJ, McLa en A, Cohen P. 2003. A ein es iga ion o he mul isi e phospho yla ion o he ansc ip ion ac o c-Jun. EMBO J 22:3876–3886. h ps://doi.o g/10.1093/emboj/cdg388. 41. Ja elaud D, Labou eau J, Gabison E, Ve ecchia F, Mau iel A. 2003. Dis up ion o basal JNK ac i i y di e en ially a ec s key fib oblas unc ions impo an o wound healing. J Biol Chem 278:24624–24628. h ps://doi.o g/10.1074/jbc.M301942200. 42. Cha e jee N, Bohmann D. 2012. A e sa ile ⌽C31 based epo e sys em o measu ing AP-1 and N 2 signaling in D osophila and in issue cul u e. PLoS One 7:e34063. h ps://doi.o g/10.1371/jou nal .pone.0034063. 43. Andjelko ic´ A, Oli ei a MT, Cannino G, Yalgin C, Dhandapani PK, Du ou E, Rus in P, Szibo M, Jacobs HT. 2015. Dii on cen e mu a ions in Ciona in es inalis al e na i e oxidase abolish enzyma ic ac i i y and p e en escue o cy och ome oxidase deficiency in flies. Sci Rep 5:18295. h ps://doi.o g/10.1038/s ep18295. 44. Hoe nagel MHN, Wiskich JT. 1998. Ac i a ion o he plan al e na i e oxidase by high educ ion le els o he Q-Pool and py u a e. A ch Biochem Biophys 355:262–270. h ps://doi.o g/10.1006/abbi.1998 .0737. 45. Cas o-Gue e o NA, K ab K, Mo eno-Sanchez R. 2004. The al e na i e espi a o y pa hway o Euglena mi ochond ia. J Bioene g Biomemb 36:459–469. h ps://doi.o g/10.1023/B:JOBB.0000047328.82733.e . 46. Umbach AL, Ng VS, Siedow JN. 2006. Regula ion o plan al e na i e oxidase ac i i y: a ale o wo cys eines. Biochim Biophys Ac a 1757: 135–142. h ps://doi.o g/10.1016/j.bbabio.2005.12.005. 47. May B, Young L, Moo e AL. 2017. S uc u al insigh s in o he al e na i e oxidases: a e all oxidases made equal? Biochem Soc T ans 45:731–740. h ps://doi.o g/10.1042/BST20160178. 48. Ha die DG. 2011. AMP-ac i a ed p o ein kinase: an ene gy senso ha egula es all aspec s o cell unc ion. Genes De 25:1895–1908. h ps:// doi.o g/10.1101/gad.17420111. 49. Cunni B, McKenzie AJ, Hein z NH, Howe AK. 2016. AMPK ac i i y egula es a ficking o mi ochond ia o he leading edge du ing cell mig a ion and ma ix in asion. Mol Biol Cell 27:2662–2674. h ps://doi .o g/10.1091/mbc.e16-05-0286. 50. Pelleg ino MW, Na gund AM, Haynes CM. 2013. Signaling he mi o- chond ial un olded p o ein esponse. Biochim Biophys Ac a 1833: 410–416. h ps://doi.o g/10.1016/j.bbamc .2012.02.019. 51. McLaughlin-D ubin ME, Münge K. 2009. The human papilloma i us E7 oncop o ein. Vi ology 384:335–344. h ps://doi.o g/10.1016/j. i ol.2008 .10.006. 52. Mazu ek S, Zwe schke W, Jansen-Du P, Eigenb od E. 2001. E ec s o he human papilloma i us HPV-16 E7 oncop o ein on glycolysis and glu aminolysis: ole o py u a e kinase ype M2 and he glycoly ic- enzyme complex. Biochem J 356:247–256. 53. Yizhak K, Le Dé édec SE, Rogko i VM, Baenke F, de Boe VC, F ezza C, Schulze A, an de Wa e B, Ruppin E. 2014. A compu a ional s udy o he Wa bu g e ec iden ifies me abolic a ge s inhibi ing cance mi- g a ion. Mol Sys Biol 10:744. h ps://doi.o g/10.15252/msb.20134993. 54. Gaude E, Schmid C, Gammage PA, Dugou d A, Blacke T, Chew SP, Saez-Rod iguez J, O’Neill JS, Szabadkai G, Minczuk M, F ezza C. 2018. NADH shu ling couples cy osolic educ i e ca boxyla ion o glu amine wi h glycolysis in cells wi h mi ochond ial dys unc ion. Mol Cell 69: 581–593. h ps://doi.o g/10.1016/j.molcel.2018.01.034. 55. Vousden KH, Ryan KM. 2009. p53 and me abolism. Na Re Cance 9:691–700. h ps://doi.o g/10.1038/n c2715. 56. Ma oba S, Kang JG, Pa ino WD, W agg A, Boehm M, Ga ilo a O, Hu ley PJ, Bunz F, Hwang PM. 2006. p53 egula es mi ochond ial espi a ion. Science 312:1650–1653. h ps://doi.o g/10.1126/science.1126863. 57. Schwa zenbe g-Ba -Yoseph F, A moni M, Ka nieli E. 2004. The umo supp esso p53 down- egula es glucose anspo e s GLUT1 and GLUT4 gene exp ession. Cance Res 64:2627–2633. h ps://doi.o g/10 .1158/0008-5472.CAN-03-0846. 58. Sche ne M, We ness BA, Huib eg se JM, Le ine AJ, Howley PM. 1990. The E6 oncop o ein encoded by human papilloma i us ypes 16 and 18 p omo es he deg ada ion o p53. Cell 63:1129–1136. h ps://doi.o g/ 10.1016/0092-8674(90)90409-8. 59. Sch eibe M, Kolbus A, Piu F, Szabowski A, Möhle-S einlein U, Tian J, Ka in M, Angel P, Wagne EF. 1999. Con ol o cell cycle p og ession by c-Jun is p53 dependen . Genes De 13:607–619. h ps://doi.o g/10 .1101/gad.13.5.607. 60. Sche e SJ, Maie SM, Sei e M, Hanselmann RG, Zang KD, Mulle - He melink HK, Angel P, Wel e C, Scha l M. 2000. p53 and c-Jun unc ionally syne gize in he egula ion o he DNA epai gene hMSH2 in esponse o UV. J Biol Chem 275:37469–37473. h ps://doi.o g/10 .1074/jbc.M006990200. 61. Saha MN, Jiang H, Yang Y, Zhu X, Wang X, Schimme AD, Qiu L, Chang H. 2012. Ta ge ing p53 ia JNK pa hway: a no el ole o RITA o apop o ic signaling in mul iple myeloma. PLoS One 7:e30215. h ps:// doi.o g/10.1371/jou nal.pone.0030215. 62. Tu SP, Chi AL, Ai W, Takaishi S, Dubeyko skaya Z, Quan e M, Fox JG, Wang TC. 2009. p53 inhibi ion o AP1-dependen TFF2 exp ession induces apop osis and inhibi s cell mig a ion in gas ic cance cells. Am J Physiol 297:G385–G396. h ps://doi.o g/10.1152/ajpgi.90620.2008. 63. Guo Y, Meng X, Ma J, Zheng Y, Wang Q, Wang Y, Shang H. 2014. Human papilloma i us 16 E6 con ibu es HIF-1 ␣ induced Wa bu g e ec by a enua ing he VHL-HIF-1 ␣ in e ac ion. In J Mol Sci 15:7974–7986. h ps://doi.o g/10.3390/ijms15057974. 64. Spangle JM, Münge K. 2010. The human papilloma i us ype 16 E6 oncop o ein ac i a es mTORC1 signaling and inc eases p o ein syn he- sis. J Vi ol 84:9398–9407. h ps://doi.o g/10.1128/JVI.00974-10. 65. Jochum W, Passegué E, Wagne EF. 2001. AP-1 in mouse de elopmen and umo igenesis. Oncogene 20:2401–2412. h ps://doi.o g/10.1038/ sj.onc.1204389. 66. Angel P, Ka in M. 1991. The ole o Jun, Fos and he AP-1 complex in cell-p oli e a ion and ans o ma ion. Biochim Biophys Ac a 1072: 129–157. Andjelko ic´ e al. Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 18 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om 67. Vesely PW, S abe PB, Hoefle G, Kenne L. 2009. T ansla ional egula- ion mechanisms o AP-1 p o eins. Mu a Res 682:7–12. h ps://doi.o g/ 10.1016/j.m e .2009.01.001. 68. Shee in A, Thompson KS, Goyns MH. 2002. Al e ed composi ion o he AP-1 ansc ip ion ac o in immo alized compa ed o no mal p oli - e a ing cells. Cance Le 177:83–87. h ps://doi.o g/10.1016/S0304 -3835(01)00751-0. 69. Ka in M, Liu Z-G, Zandi E. 1997. AP-1 unc ion and egula ion. Cu Opin Cell Biol 9:240–246. h ps://doi.o g/10.1016/S0955-0674(97)80068-3. 70. Li CH, Cheng YW, Liao PL, Yang YT, Kang JJ. 2010. Chlo amphenicol causes mi ochond ial s ess, dec eases ATP biosyn hesis, induces ma- ix me allop o einase-13 exp ession, and solid- umo cell in asion. Toxicol Sci 116:140–150. h ps://doi.o g/10.1093/ oxsci/k q085. 71. Ca boni S, Hi e A, Szynd alewiez C, Gailla d P, Go eland JP, Vi e PA. 2004. AS601245 (1,3-benzo hiazol-2-yl (2-{[2-(3-py idinyl) e hyl] amino}-4 py imidinyl) ace oni ile): a c-Jun NH 2 - e minal p o ein kinase inhibi o wi h neu op o ec i e p ope ies. J Pha macol Exp The 310: 25–32. h ps://doi.o g/10.1124/jpe .103.064246. 72. Bain J, McLauchlan H, Ellio M, Cohen P. 2003. The specifici ies o p o ein kinase inhibi o s: an upda e. Biochem J 371:199–204. h ps:// doi.o g/10.1042/bj20021535. 73. Tanemu a S, Momose H, Shimizu N, Ki agawa D, Seo J, Yamasaki T, Nakagawa K, Kajiho H, Penninge Ka ada T, Nishina H. 2009. Blockage by SP600125 o Fc␧ ecep o -induced deg anula ion and cy okine gene exp ession in mas cells is media ed h ough inhibi ion o phospha i- dylinosi ol 3-kinase signaling pa hway. J Biochem 145:345–354. h ps:// doi.o g/10.1093/jb/m n172. 74. Gup a S, Ba e T, Whi ma sh AJ, Ca anagh J, Sluss HK, Dé ija d B, Da is RJ. 1996. Selec i e in e ac ion o JNK p o ein kinase iso o ms wi h ansc ip ion ac o s. EMBO J 15:2760–2770. h ps://doi.o g/10.1002/j .1460-2075.1996. b00636.x. 75. Aba e C, Pa el L, Rausche FJ, Cu an T. 1990. Redox egula ion o Fos and Jun DNA-binding ac i i y in i o. Science 249:1157–1161. h ps:// doi.o g/10.1126/science.2118682. 76. Jind a M, Gazio a I, Uhli o a M, Okabe M, Hi omi Y, Hi ose S. 2004. Coac i a o MBF1 p ese es he edox-dependen AP-1 ac i i y du ing oxida i e s ess in D osophila. EMBO J 23:3538–3547. h ps://doi.o g/ 10.1038/sj.emboj.7600356. 77. Sanz A, Fe nández-Ayala DJ, S e ana os RK, Jacobs HT. 2010. Mi ochon- d ial ROS p oduc ion co ela es wi h, bu does no di ec ly egula e li espan in D osophila. Aging (Albany NY) 2:200–223. h ps://doi.o g/ 10.18632/aging.100137. 78. Poulios E, T ougakos IP, Gonos ES. 2006. Compa a i e e ec s o hypoxia on no mal and immo alized human diploid fib oblas s. An icance Res 26:2165–2168. 79. Ma ínez-Reyes I, Diebold LP, Kong H, Schiebe M, Huang H, Hensley CT, Meh a MM, Wang T, San os JH, Woychik R, Du ou E, Spelb ink JN, Weinbe g SE, Zhao Y, DeBe a dinis R, Chandel NS. 2016. TCA cycle and mi ochond ial memb ane po en ial a e necessa y o di e se biological unc ions. Mol Cell 61:199–209. h ps://doi.o g/10.1016/j.molcel.2015 .12.002. 80. Ve schoo ML, Wilson LA, Singh G. 2010. Mechanisms associa ed wi h mi ochond ial-gene a ed eac i e oxygen species in cance . Can J Physiol Pha macol 88:204–219. h ps://doi.o g/10.1139/Y09-135. 81. Voelkl J, Alesu an I, P imessnig U, Fege M, Mia S, Jungmann A, Cas o T, Vie eck R, S öckig F, Bo s O, Gawaz M, Sch ickel JW, Me zle B, Ka us HA, Mülle OJ, Pieske B, Heinzel FR, Lang F. 2016. AMP-ac i a ed p o ein kinase ␣ 1-sensi i e ac i a ion o AP-1 in ca diomyocy es. J Mol Cell Ca diol 97:36–43. h ps://doi.o g/10.1016/j.yjmcc.2016.04.009. 82. Jhun BS, Lee JY, Oh YT, Lee JH, Choe W, Baik HH, Kim SS, Yoon KS, Ha J, Kang I. 2006. Inhibi ion o AMP-ac i a ed p o ein kinase supp esses IL-2 exp ession h ough down- egula ion o NF-AT and AP-1 ac i a ion in Ju ka T cells. Biochem Biophys Res Commun 351:986–992. h ps:// doi.o g/10.1016/j.bb c.2006.10.138. 83. Paupe V, P uden J. 2018. New insigh s in o he ole o mi ochond ial calcium homeos asis in cell mig a ion. Biochem Biophys Res Commun 500:75–86. h ps://doi.o g/10.1016/j.bb c.2017.05.039. 84. Hayes JD, Dinko a-Kos o a AT. 2014. The N 2 egula o y ne wo k p o ides an in e ace be ween edox and in e media y me abolism. T ends Biochem Sci 39:199–218. h ps://doi.o g/10.1016/j. ibs.2014.02 .002. 85. Ame i K, Ha is AL. 2008. Ac i a ing ansc ip ion ac o 4. In J Biochem Cell Biol 40:14–21. h ps://doi.o g/10.1016/j.biocel.2007.01.020. 86. Rössle OG, Thiel G. 2017. Specifici y o s ess- esponsi e ansc ip ion ac o s N 2, ATF4, and AP-1. J Cell Biochem 118:127–140. h ps://doi .o g/10.1002/jcb.25619. 87. Doughe y CJ, Kubasiak LA, F azie DP, Li H, Xiong WC, Bishop ic NH, Webs e KA. 2004. Mi ochond ial signals ini ia e he ac i a ion o c-Jun N- e minal kinase (JNK) by hypoxia- eoxygena ion. FASEB J 18: 1060–1070. h ps://doi.o g/10.1096/ j.04-1505com. 88. Xu J, Qin X, Cai X, Yang L, Xing Y, Li J, Zhang L, Tang Y, Liu J, Zhang X, Gao F. 2015. Mi ochond ial JNK ac i a ion igge s au ophagy and apop osis and agg a a es myoca dial inju y ollowing ischemia/ epe usion. Biochim Biophys Ac a 1852:262–270. h ps://doi.o g/10 .1016/j.bbadis.2014.05.012. 89. Ro enbe g H, Wu SL. 1998. Quan i a i e assay by flow cy ome y o he mi ochond ial memb ane po en ial in in ac cells. Biochim Biophys Ac a 1404:393–404. h ps://doi.o g/10.1016/S0167-4889(98)00088-3. 90. Hey le PG. 1979. Uncouple s o oxida i e phospho yla ion. Me hods Enzymol 55:462–472. h ps://doi.o g/10.1016/0076-6879(79)55060-5. 91. Ba ien os A, Mo aes CT. 1999. Ti a ing he e ec s o mi ochond ial complex I impai men in he cell physiology. J Biol Chem 274: 16188–16197. h ps://doi.o g/10.1074/jbc.274.23.16188. 92. Liu Y, Schube DR. 2009. The specifici y o neu op o ec ion by an iox- idan s. J Biomed Sci 16:98. h ps://doi.o g/10.1186/1423-0127-16-98. 93. Yuyun X, Jinjun Q, Min ang X, Jing Q, Juan X, Rui M, Li Z, Jing G. 2012. E ec s o low concen a ions o o enone upon mi oho mesis in SH- SY5Y cells. Dose Response 11:270–280. h ps://doi.o g/10.2203/dose - esponse.12-005.Gao. 94. Rushwo h GF, Megson IL. 2014. Exis ing and po en ial he apeu ic uses o N-ace ylcys eine: he need o con e sion o in acellula glu a hi- one o an ioxidan benefi s. Pha macol The 141:150–159. h ps://doi .o g/10.1016/j.pha m he a.2013.09.006. 95. Kelso GF, Po eous CM, Coul e CV, Hughes G, Po eous WK, Ledge - wood EC, Smi h RA, Mu phy MP. 2001. Selec i e a ge ing o a edox- ac i e ubiquinone o mi ochond ia wi hin cells: an ioxidan and an i- apop o ic p ope ies. J Biol Chem 276:4588–4596. h ps://doi.o g/10 .1074/jbc.M009093200. 96. Bo e is A, Chance B. 1973. The mi ochond ial gene a ion o hyd ogen pe oxide. Gene al p ope ies and e ec o hype ba ic oxygen. Biochem J 134:707–716. 97. B ennan JP, Sou hwo h R, Medina RA, Da idson SM, Duchen MR, Sha ock MJ. 2006. Mi ochond ial uncoupling, wi h low concen a- ion FCCP, induces ROS-dependen ca diop o ec ion independen o KATP channel ac i a ion. Ca dio asc Res 72:313–321. h ps://doi .o g/10.1016/j.ca dio es.2006.07.019. 98. Aon MA, Co assa S, O’Rou ke B. 2010. Redox-op imized ROS balance: a uni ying hypo hesis. Biochim Biophys Ac a 1797:865–877. h ps://doi .o g/10.1016/j.bbabio.2010.02.016. 99. Seglen PO, G inde BS, Solheim AE. 1979. Inhibi ion o he lysosomal pa hway o p o ein deg ada ion in isola ed a hepa ocy es by ammo- nia, me hylamine, chlo oquine and leupep in. Eu J Biochem 95: 215–225. h ps://doi.o g/10.1111/j.1432-1033.1979. b12956.x. 100. Mu ay EJ, G isan i MS, Ben ley GV, Mu ay SS. 1997. E64d, a memb ane-pe meable cys eine p o ease inhibi o , a enua es he e - ec s o pa a hy oid ho mone on os eoblas s in i o. Me abolism 46: 1090–1094. h ps://doi.o g/10.1016/S0026-0495(97)90284-5. 101. Slee EA, Zhu H, Chow SC, MacFa lane M, Nicholson DW, Cohen GM. 1996. Benzyloxyca bonyl-Val-Ala-Asp (OMe) fluo ome hylke one (Z- VAD.FMK) inhibi s apop osis by blocking he p ocessing o CPP32. Biochem J 315:21–24. h ps://doi.o g/10.1042/bj3150021. 102. Ch é ien D, Béni P, Ha HH, Keipe S, El-Khou y R, Chang YT, Jas och M, Jacobs HT, Rus in P, Rak M. 2018. Mi ochond ia a e physiologically main ained a close o 50 °C. PLoS Biol 16:e2003992. h ps://doi.o g/ 10.1371/jou nal.pbio.2003992. 103. Pa kinson WC. 1983. Mo ili y o mouse fib oblas s in issue cul u e. Biophys J 42:17–23. h ps://doi.o g/10.1016/S0006-3495(83)84364-1. 104. Zimme le CT, F ieden C. 1986. E ec o empe a u e on he mechanism o ac in polyme iza ion. Biochemis y 25:6432–6438. h ps://doi.o g/10 .1021/bi00369a014. 105. Gao F, Hu X, Xie X, Liu X, Wang J. 2015. Hea shock p o ein 90 s imula es a mesenchymal s em cell mig a ion ia PI3K/Ak and ERK1/2 pa hways. J Cell Biochem Biophys 71:481–489. h ps://doi.o g/ 10.1007/s12013-014-0228-6. 106. Bo oughs LK, An onyak MA, Johnson JL, Ce ione R. 2011. A unique ole o hea shock p o ein 70 and i s binding pa ne issue ansglu ami- nase in cance cell mig a ion. J Biol Chem 286:37094–37107. h ps:// doi.o g/10.1074/jbc.M111.242438. AOX and Cell Mig a ion Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 19 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om 107. Lang BJ, Nguyen L, Nguyen HC, Vieusseux JL, Chai RCC, Ch is ophi C, Fifis T, Kouspou MM, P ice JT. 2012. Hea s ess induces epi helial plas ici y and cell mig a ion independen o hea shock ac o 1. Cell S ess Chape ones 17:765–778. h ps://doi.o g/10.1007/s12192-012 -0349-z. 108. O’Callaghan-Sunol C, She man MY. 2006. Hea shock ansc ip ion ac o (HSF1) plays a c i ical ole in cell mig a ion ia main aining MAP kinase signaling. Cell Cycle 5:1431–1437. h ps://doi.o g/10.4161/cc.5 .13.2915. 109. Ema a S, Ame S, Ali A, Abouleila Y, Oga A, Masujima T. 2017. Single-cell me abolomics, p 323–344. In Sussulini A (ed), Me abolomics: om undamen als o clinical applica ions. Sp inge , Cham, Swi ze land. 110. Me key AB, Wong CK, Hoshizaki DK, Gibbs AG. 2011. Ene ge ics o me amo phosis in D osophila melanogas e . J Insec Physiol 57: 1437–1445. h ps://doi.o g/10.1016/j.jinsphys.2011.07.013. 111. an Ho ssen R, Janssen E, Pe e s W, an de Pasch L, Linde MM, an Dommelen MM, Linssen PC, Hagen TL, F ansen JA, Wie inga B. 2009. Modula ion o cell mo ili y by spa ial eposi ioning o enzyma ic ATP/ ADP exchange capaci y. J Biol Chem 284:1620–1627. h ps://doi.o g/ 10.1074/jbc.M806974200. 112. Fukuoh A, Cannino G, Ge a ds M, Buckley S, Kazanciouglu S, Scialo F, Liha ainen E, Ribei o A, Du ou E, Jacobs HT. 2014. Sc een o mi o- chond ial DNA copy numbe main enance genes e eals essen ial ole o ATP syn hase. Mol Sys Biol 10:734. h ps://doi.o g/10.15252/msb .20145117. 113. Abbondanzo SJ, Gadi I, S ewa CL. 1993. De i a ion o emb yonic s em cell lines. Me hods Enzymol 225:803–823. h ps://doi.o g/10.1016/0076 -6879(93)25052-4. 114. Cannino G, El-Khou y R, Pi inen M, Hu z B, Rus in P, Jacobs HT, Du ou E. 2012. Glucose modula es espi a o y complex I ac i i y in esponse o acu e mi ochond ial dys unc ion. J Biol Chem 287: 38729–38740. h ps://doi.o g/10.1074/jbc.M112.386060. 115. Reed BH, McMillan SC, Chaudha y R. 2009. The p epa a ion o D osoph- ila emb yos o li e-imaging using he hanging d op p o ocol. J Vis Exp 25:1206. h ps://doi.o g/10.3791/1206. 116. Piccinini F, Kiss A, Ho a h P. 2016. CellT acke (no only) o dum- mies. Bioin o ma ics 32:955–957. h ps://doi.o g/10.1093/bioin o ma ics/b 686. 117. Jõe s P, Lewis SC, Fukuoh A, Pa hiala M, Ellilä S, Hol IJ, Jacobs HT. 2013. Mi ochond ial ansc ip ion e mina o amily membe s mTTF and mTe 5 ha e opposing oles in coo dina ion o m DNA syn hesis. PLoS Gene 9:e1003800. h ps://doi.o g/10.1371/jou nal.pgen.1003800. 118. Kuzne so AV, Veksle V, Gelle ich FN, Saks V, Ma g ei e R, Kunz WS. 2008. Analysis o mi ochond ial unc ion in si u in pe meabilized mus- cle fibe s, issues and cells. Na P o oc 3:965–976. h ps://doi.o g/10 .1038/np o .2008.61. 119. B ad o d MM. 1976. A apid and sensi i e me hod o he quan i a- ion o mic og am quan i ies o p o ein u ilizing he p inciple o p o ein-dye binding. Anal Biochem 72:248–254. h ps://doi.o g/10 .1016/0003-2697(76)90527-3. Andjelko ic´ e al. Molecula and Cellula Biology Decembe 2018 Volume 38 Issue 24 e00110-18 mcb.asm.o g 20 on Janua y 3, 2019 by gues h p://mcb.asm.o g/Downloaded om