Endogenous AhR agonist FICZ accumulates in rainbow trout (Oncorhynchus mykiss) alevins exposed to a mixture of two PAHs, retene and fluoranthene

This is a sel -a chi ed e sion o an o iginal a icle. This e sion may di e om he o iginal in pagina ion and ypog aphic de ails. Au ho (s): Ti le: Yea : Ve sion: Copy igh : Righ s: Righ s u l: Please ci e he o iginal e sion: CC BY 4.0 h ps://c ea i ecommons.o g/licenses/by/4.0/ Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins exposed o a mix u e o wo PAHs, e ene and luo an hene © The Au ho (s) 2022 Published e sion E iksson, And eas N. M.; Rigaud, Cy il; Wincen , Emma; Pakkanen, Hannu; Salonen, Pihla; Vehniäinen, Ee a-Riikka E iksson, A. N. M., Rigaud, C., Wincen , E., Pakkanen, H., Salonen, P., & Vehniäinen, E.-R. (2022). Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins exposed o a mix u e o wo PAHs, e ene and luo an hene. Eco oxicology, 31(9), 1382-1389. h ps://doi.o g/10.1007/s10646-022-02593-9 2022 Eco oxicology h ps://doi.o g/10.1007/s10646-022-02593-9 Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins exposed o a mix u e o wo PAHs, e ene and fluo an hene And eas N. M. E iksson 1●Cy il Rigaud1●Emma Wincen 2●Hannu Pakkanen3●Pihla Salonen1● Ee a-Riikka Vehniäinen1 Accep ed: 23 Sep embe 2022 © The Au ho (s) 2022 Abs ac Mul iple s udies ha e epo ed syne gized oxici y o PAH mix u es in de eloping fish la ae ela i e o he addi i e e ec o he componen s. F om a oxicological pe spec i e, mul iple mechanisms a e known o con ibu e o syne gism, such as al e ed oxicodynamics and kine ics, as well as inc eased oxida i e s ess. An unde s udied con ibu o o syne gism is he accumula ion o endogenous me aboli es, o example: he a yl hyd oca bon ecep o 2 (AhR2) agonis and yp ophan me aboli e 6-Fo mylindolo(3,2-b)ca bazole (FICZ). Fish la ae exposed o FICZ, alongside knock-down o cy och ome p450 (cyp1a), has been epo ed o induced symp oms o oxici y simila o hose obse ed ollowing exposu e o PAHs o he dioxin 2,3,7,8- e achlo odibenzo-p-dioxin. He e, we explo ed i FICZ accumula es in newly ha ched ainbow ou ale ins (Onco hynchus mykiss) exposed o wo PAHs wi h di e en p ope ies: e ene (po en AhR2 agonis ) and fluo an hene (weak AhR2 agonis and Cyp1a inhibi o ), ei he alone o as a bina y mix u e o 3 and 7 days. We ound ha exposu e o he mix u e esul ed in accumula ion o endogenous FICZ, syne gized he blue sac disease index (BSD), and al e ed he body bu den p ofiles o he PAHs, when compa ed o he ale ins exposed o he indi idual componen s. I is hus e y plausible ha accumula ion o endogenously de i ed FICZ con ibu ed o he syne gized BSD index and oxici y in exposed ale ins. Accumula ion o endogenously de i ed FICZ is a no el finding ha ex ends ou gene al unde s anding on PAHs oxici y in de eloping fish la ae, while a he same ime highligh ing why en i onmen al isk assessmen o PAHs should no be based solely esul s om he assessmen o indi idual compounds. Keywo ds Syne gism ●Mix u e ●PAH ●FICZ ●Onco hynchus mykiss ●Blue sac disease In oduc ion Polycyclic a oma ic hyd oca bons (PAHs) a e a di e se and widesp ead g oup o en i onmen al pollu an s o ei he na - u al o an h opogenic o igin (Wicks öm and Tolonen 1987; dos San os e al. 2018) and a e always p esen as complex mix u es (Tisso and Wel e 1978). F om an aqua ic ox- icological pe spec i e, he exac mechanisms o oxici y a e no ully unde s ood, e en a e decades o esea ch employing mul iple species o fish and ypes o PAHs (Hein z e al. 2000; B inkwo h e al. 2003; Wassenbe g and Di Giulio 2004; Van Tiem and Di Giulio 2011; Cla k e al. 2013; Rigaud e al. 2020a). Wha is known is ha di e en PAHs induce oxici y h ough di e en mechanisms and cause exposu e and PAH specific oxici y p ofiles (Billia d e al. 2008; Inca dona e al. 2011; Geie e al. 2018;Rigaud e al. 2020a,b; E iksson e al. 2022a,b). Addi ionally, hea s uc u e and unc ion a e especially sensi i e o he influence o PAH(s) du ing ea ly li e de elopmen o fish (Inca dona e al. 2011,2009; Vehniäinen e al. 2016). The specifici y o ca dio oxici y is hypo hesized o be linked o in e ac ion(s) be ween PAHs, as a pa o c ude oil, and lipop o eins bound o he cellula memb ane (Inca dona 2017). *And eas N. M. E iksson and eas.n.m.e iksson@jyu.fi 1Depa men o Biological and En i onmen al Sciences, Uni e si y o Jy äskylä, Jy äskylä, Finland 2Ins i u e o En i onmen al Medicine, Ka olinska Ins i u e , S ockholm, Sweden 3Depa men o Chemis y, Uni e si y o Jy äskylä, Jy äskylä, Finland 1234567890();,: 1234567890();,: Fu he mo e, mix u e composi ion has been obse ed and epo ed o modula e PAH oxici y ou come, ela i e o he componen s (Geie e al. 2018; E iksson e al. 2022a,b). The bes -known molecula mechanism ela ed o PAH oxici y is ha in ol ing ac i a ion o he a yl-hyd oca bon ecep o 2 (AhR2) (Massa sky e al. 2016; Doe ing e al. 2019). Ac i- a ion o AhR2, by PAHs such as e ene (Sco e al. 2011), benzo[a]py ene (Inca dona e al. 2011; Song e al. 2019), benzo[k]fluo an hene (Van Tiem and Di Giulio 2011), and py ene (Inca dona e al. 2011) induces he exp ession o , among many genes, cy och ome P450 (CYP1), pa icula ly cyp1a, which encodes o an enzyme ha ini ia es phase I me abolism o xenobio ics h ough hyd oxyla ion (Billia d e al. 2008). By con as , some PAHs, such as fluo an hene, can bo h induce he exp ession o cyp1a, and inhibi he unc ion o he ansla ed and unc ional enzyme by blocking i s ac i e si e (Wille e al. 1998), which has p e iously been shown o syne gize he oxici y o o he PAHs (Wills e al. 2009; Van Tiem and Di Giulio 2011). A commonly assessed bioma ke o PAH oxici y in de eloping fish is he so called blue sac disease synd ome (BSD), which encompasses se e al symp oms o PAH induced oxici y: c anio acial de o mi ies, hemo haging, yolk and pe ica dial edema and spinal cu a u es (Billia d e al. 1999,2006; Cola ecchia e al. 2006). Al hough i is no ully known how BSD is induced (Sco e al. 2011; Cla k e al. 2013), knockdown o ah 2 (bu no cyp1a)is known o p e en he o ma ion o BSD- ela ed symp oms in de eloping zeb afish la ae (Danio e io), which implies ha downs eam molecula e en s o AhR2, o he han ac i a ion o Cyp1, a e equi ed o he mani es a ion o PAH oxici y (Van Tiem and Di Giulio 2011; Massa sky e al. 2016). Recen ly, he ac i a ion o cyclooxygenase-2 (cox2), which is linked o AhR2 ac i a ion, by PAH(s) has been epo ed o be in ol ed in he induc ion o de elop- men al oxici y in fish (Doe ing e al. 2019). Some endogenous compounds, such as he yp ophan de i a i e FICZ (6-Fo mylindolo[3,2-b]ca bazole), a e also known o be able o ac i a e AhR2 (Wincen e al. 2009). FICZ is a e y po en AhR agonis , and du ing no mal condi ions, i is main ained a low le els by cons an Cyp1- media ed me abolism (Wincen e al. 2009). Inc eased a e o o ma ion o FICZ has been obse ed ollowing h ee dis inc p ocesses: inc eased enzyma ic ac i i y, inc eased UV-i adia ion, and inc eased le els o oxida i e s ess (Smi no a e al. 2016; Rannug and Rannug 2018). Newly ha ched zeb afish la ae exposed o ex e nally adminis a ed FICZ, in combina ion wi h a Cyp1a-inhibi o (alpha-naph- hofla one) o cyp1a-knockdown, esul ed in educed me abolism o FICZ and inc eased occu ence o BSD- ela ed symp oms, and o he signs o oxici y ha esemble hose caused by exposu e o PAHs (Wincen e al. 2016). I has he e o e been hypo hesized ha he o ma ion and accumula ion o endogenous FICZ could con ibu e o AhR-media ed de elopmen al oxici y in fish la ae (Win- cen e al. 2012; Rannug and Rannug 2018). The e o e, we in es iga ed i exposu e o wo PAHs wi h di e en modes o ac ion, e ene (an AhR2 agonis ) and fluo an hene (a weake AhR2 agonis and Cyp1a inhibi o ) (Ba on e al. 2004), alone o as a bina y mix u e, could o ce he accumula ion o endogenously de i ed FICZ in newly ha ched and de eloping ainbow ou ale ins (Onco hynchus mykiss). By assessing he empo al de el- opmen o he PAH and FICZ specific body bu dens, in ela ion o he BSD index in de eloping ainbow ou , we aimed a unco e ing how po en ial accumula ion o FICZ could con ibu e o de elopmen al oxici y. Ma e ials and me hods Expe imen al se up Newly ha ched 360 deg ee-days and heal hy ainbow ou ale ins ( ee om de elopmen al de o mi ies, edemas, and hemo hages; p o ided by Hanka-Taimen Oy fish a m, Cen al Finland) we e ei he exposed o dime hyl sul oxide as con ol (DMSO; 20 µl L−1;Sigma–Ald ich, S -Louis, MO, USA) CAS-numbe 67-68-5), e ene (nominally 32 µg L−1; MP Biomedicals, Illki ch, F ance) CAS- numbe 483-65-3), fluo an hene (nominally 50 µg L−1; Sigma Ald ich; CAS-numbe 206-44-0) o he bina y mix u e o he wo PAHs (a a o emen ioned nominal concen a ions), and sampled a e 1, 3 and 7 days o exposu e. In es iga ed nominal PAH concen a ions we e selec ed as o p o oke oxici y, bu no inc ease mo ali y a es, as pe p e iously published s udies on e ene oxici y (Hodson e al. 2007; Sco and Hodson, 2008; Vehniäinen e al. 2016) and an unpublished assessmen o fluo an hene oxici y ( ainbow ou ale in exposed o 500 µg L−1 o 11 days, did no inc ease mo ali y). Addi ionally, he concen a ion o DMSO (20 µl L−1) can be conside ed as accep able (<100 µl L−1;OECD2013), and should no con ibu e o sol en -media ed oxici y (Maes e al. 2012). Exposu es we e pe o med in 1.5 li e Py ex glass bowls, filled wi h 1 li e o fil e ed lake wa e ob ained om Konne esi Resea ch s a ion in Cen al Finland. Each ea men was pe o med in iplica es, and each eplica e con ained 15 ale ins. Exposu e wa e empe a u e was main ained a 10.8 ± 0.3 °C, and a 16:8 ligh o da k a io employed. Rela i e oxygen sa u a ion, pH and con- duc i i y we e measu ed a 103.23 ± 3.32%, 7.38 ± 0.09 and 17.53 ± 3.95 mS m−1, espec i ely and h oughou he exposu e du a ion. A sampling, 5 ale ins pe eplica e we e ideo eco ded and pho og aphed while he emain- ing 10 ale ins (pe eplica e) we e pho og aphed and A. N. M. E iksson e al. snap- ozen o la e HPLC-analysis. Symp oms o blue sac disease (BSD) we e assessed based upon he ideo eco dings (pe ica dial edema) combined wi h pho o- g aphs (yolk sac edema and hemo hages) o he 5 indi- idually sampled ale ins in silico. Blue sac disease index BSD index was calcula ed h ough es ablished con en ion o each exposu e eplica e (n=3; Eq. 1) (Cola ecchia e al. 2006; Sco e al. 2011). In o de o compa e he BSD indices epo ed by E iksson e al. (2022a)wi h hose ob ained in his p esen s udy, he same symp oms o oxici y we e assessed and sco ed in he same ashion: hemo hages (HE; sco ed 0 o 1; no p esen o p esen ), pe ica dial (PE; 0 o 1) and yolk sac edemas (YE: 0 o 1). The o al sco e pe eplica e was hen di ided by he o al maximum po en ial sco e pe eplica e: 15 (maximum sco e pe indi idual ale in was 3, and 5 ale ins pe eplica e we e assessed). BSD index ¼PHE þPPE þPYE 15 ð1Þ Es ablishmen o body bu den h ough HPLC analysis and confi ma ion o FICZ P epa a ion o ale ins and HPLC analysis we e pe o med as ins uc ed by Rigaud e al. (2020a) and E iksson e al. (2022a). In sho , he 10 pooled ale ins (pe eplica e) we e homogenized by zi conium pelle s (ci cum e ence o 1 and 2 mm; Nex Ad ance, USA) in 70% ace oni ile (ACN; Fishe Scien ific) using a s anda d model bulle blende (Nex Ad ance). The homogena e was hen cen i uged (Cen i uge 5415 R, Eppendo , Ge many) o 10 min a 14,000 pm and 4 °C. The supe na an was collec ed and he pelle e-suspended in 70% ACN, cen i uged, he supe - na an collec ed and pooled. The e-suspension s ep was pe o med wice. Body bu den o he PAHs and FICZ was es ablished h ough HPLC wi h fluo escence de ec o (Shimadzu UHPLC Nexe a-sys em). De ec ion pa ame e s and limi s o he HPLC measu emen s a e p esen ed in Table 1. Subsequen a ea unde he cu e (AUC) o each espec i e compound was manually adjus ed, backg ound compensa ed (con ol AUC), and he body bu den calcu- la ed based upon s anda d cu es. The p esence o FICZ was confi med using LC-MS/MS (Agilen 1290 ul a-high-p essu e liquid ch oma og aphy sys em coupled o an Agilen 6460 iple quad upole mass spec ome e ). The mobile phase employed in LC-MS/MS analysis was c ea ed om double-dis illed wa e and ace - oni ile (70%), bo h o ified wi h 1.5 mM o mic acid (Fische Scien ific). The a io be ween he componen s o he mobile phase s a ed a 1:1 which om minu e 1 o 9 inc eased o 1:20 be o e e u ning o 1:1 om minu e 10.5 o 11; finally, he pos - ime column s abiliza ion las ed o 2.5 min. Re en ion ime o FICZ was 3.54 min (LC-MS/MS). qPCR p epa a ion and analysis Measu emen o whole-body cyp1a exp ession was pe - o med acco ding o ins uc ions epo ed by Rigaud e al. (2020a), which in u n was modified om Si ula e al. (2018). In sho : he 5 indi idual ale in ca casses we e ea ed using TRI eagen (Molecula Resea ch Cen e) in o de o ex ac RNA. The concen a ion, pu i y (NanoD op 1000, The mo Fishe Scien ific) and in eg i y o he RNA we e assessed using a TapeS a ion and confi med (euka - yo e o al RNA 6000 Nano-ki ; Agilen ) in acco dance wi h he manu ac u e ’s ins uc ions. RNA was DNase ea ed (DNase I, Fe men as) and using iSc ip cDNA Syn hesis Ki (Bio-Rad, USA), 500 ng o RNA was e e se ansc ibed in o cDNA and dilu ed 1:10 in nuclease- ee wa e . Fi e µL o dilu ed cDNA we e hen mixed wi h 1.5 µL o o wa d and e e se p ime s (final concen a ion 300 nM; Table 2), 4.5 µL s e ile H2O and 12.5 µL o iQ SYBR G een Supe - mix (Bio-Rad). The 25 µL qPCR eac ion mix u e was analyzed u ilizing he CFX96 Real-Time PCR cycle (Bio- Rad) acco ding o es ablished p o ocol: 3 min a 95 °C; 40 cycles (10 s a 95 °C, 10 s a 58 °C, 30 s a 72 °C, 10 s a 95 °C) and mel ing cu e inc eased om 55 °C o 95 °C in inc emen s o 0.5 °C. The exp ession o cyp1a was calcu- la ed using Bio-Rad CFX Manage so wa e ( .3.1), employing ndu a and l17 as e e ences genes (Table 2). Da a analysis S a is ical analyses we e pe o med using R .4.0.3 (The R Founda ion o S a is ical Compu ing, 2020)coupledwi h R-s udio .1.3.1093 (RS udio Team 2020). Significan di e ences we e assessed using K uskal–Wallis es com- bined wi h Dunn’spos -hoc es (KW +Dunn) and adjus ed o mul iple compa isons using Bon e oni’s me hod (Benjamini and Hochbe g 1995). Exposu e specific Table 1 PAH and FICZ de ec ion pa ame e s employed o Shimadzu HPLC analyses HPLC and quan ifica ion pa ame e s Re ene Fluo an hene FICZ Exci a ion (nm) 259 288 390 Emission (nm) 370 525 525 Re en ion ime (minu es) 16.7 ± 0.1 13.5 ± 0.2 8.370 ± 0.001 LOD (nM) 4.56 6.21 15.11 LOQ (nM) 13.83 18.83 45.79 Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins exposed o a. . . changes in he body bu den o mix u e exposed ale ins, compa ed o hose exposed o he componen s, we e assessed using Mann–Whi ney’sU- es . In o de o assess he e ec o he mix u e, ela i e o he addi i e e ec o he componen s on he ob ained BSD indices, backg ound adjus ed combina ion indices we e calcula ed (CI; Eq. 2) (Foucquie and Guedj 2015) andcompa edwi h he esul s epo edbyE ikssone al. (2022a): CI ¼RþFRFðÞ Mð2Þ whe e he a e age, and no malized e ec (agains con ol), exe ed by e ene and fluo an hene alone a e ep esen edbyRandF,while heno malizede ec exe ed by he bina y mix u e is ep esen ed by M. A s onge e ec by he mix u e, ela i e o he componen s, is assumed i he CI is <1. Resul s and discussion The occu ence o blue sac disease ela ed symp oms was dependen on bo h he ype o exposu e and du a ion (Table 3). Exposu e o fluo an hene p oduced a weake index a e 3 days o exposu e compa ed o Day 7. Exposu e o e ene p oduced, on a e age, simila BSD indices on bo h Day 3 and 7. By con as , exposu e o he bina y mix u e p oduced he s onges BSD index, i espec i e o exposu e du a ion. Ye , significance was only obse ed a e 3 days o exposu e (fluo an hene ela i e o mix u e), while nea - o-significance was ob ained be ween con ol and mix u e exposed ale ins on Day7(p=0.0532). Few eplica es pe ea men (n=3) a e plausibly obscu ing some he s a is ical ou come, as he BSD indices epo ed by E iksson e al. (2022a), who u ilized a g ea e numbe o eplica es (n=6), we e accompanied by s a is ical di e ences. Ne e heless, exposu e o he mix u e esul ed in a g ea e han p edic ed BSD index (Table 3; Table 3 A e age (± s anda d de ia ion) blue sac disease (BSD) indices among ale ins exposed o 3 and 7 days o DMSO (con ol) and he PAHs e ene (Re ) and fluo an hene (Flu) o he bina y mix u e S udy Exposu e BSD; Day 3 BSD; Day 7 Backg ound adjus ed; Day 3; Backg ound adjus ed; Day 7 E iksson e al. (2022a) DMSO 0.20 ± 0.08 a0.23 ± 0.11 A00 Flu 0.34 ± 0.17 ab 0.25 ± 0.06 A0.14 0.02 Re 0.25 ± 0.08 a0.29 ± 0.16 AB 0.05 0.06 Mix 0.49 ± 0.09 b0.43 ± 0.10 B0.29 #0.20 # P esen s udy DMSO 0.20 ± 0.12 12 0.24 ± 0.08 0 0 Flu 0.18 ± 0.10 10.33 ± 0.12 −0.02 0.09 Re 0.33 ± 0.18 12 0.33 ± 0.12 0.13 0.09 Mix 0.49 ± 0.10 20.44 ± 0.10 ¤ 0.29 #0.20 # ¤ DMSO –Mix: p=0.0532 (Dunn’spos hoc es ) Significan di e ences, as pe E iksson e al. (2022a), a e deno ed wi h di e en lowe and uppe case le e s o Day 3 and 7, espec i ely (N=6) A nea - o significan di e ence be ween con ol and mix u e, by Day 7, a e deno ed wi h ¤ (P esen s udy) Significan di e ences (KW +Dunn; N=3) we e obse ed among mix u e exposed ale ins compa ed o con ol (DMSO) and fluo an hene by Day 3 (deno ed wi h di e en numbe s) Backg ound adjus ed indices we e u ilized o he assessmen o combina ion indices A BSD-index g ea e han he combined addi i e e ec o he componen s among ale ins exposed o he mix u e, as pe combina ion index BSD esul s, as pe his p esen s udy, a e compa ed wi h he indices epo ed by E iksson e al. (2022a) Table 2 Accession iden ifica ion codes, o wa d and e e se p ime sequences (F = o wa d; R = e e se), subsequen p oduc leng h (base pai s) and o e all e ficiency o cyp1a (%) and he e e ence genes (ndu a and l17) Gene Accession P ime P oduc leng h E ficiency (%) cyp1a NM_001140880.2 F: CAGTCCGCCAGGCTCTTATCAAGC 94 96.9 R: GCCAAGCTCTTGCCGTCGTTGAT ndu a NM_001195159.2 F: ATCGAGCACATCCAGGTAACAAG 99 110.1 R: AATGTGGCAAGGGGAGCTCATGTA l17 NM_001160582.1 F: TTCAGAGCCTCATCTTGCCTGCT 119 114 R: CAACATAGGGATTGGAGAGCTGTACG A. N. M. E iksson e al. i espec i e o exposu e du a ion), as he combina ion index was 0.39 a e 3 days o exposu e and 0.86 by Day 7. Hence, he esul s p esen ed in E iksson e al. (2022a) can he e o e be conside ed as compa able, highligh ing BSD indices as a unc ional p oxy o nominal exposu e concen a ions in a s anda dized exposu e s udy; a leas when conside ing he e ec o his bina y mix u e and combina ion indices. E en hough he ac ual PAH concen a ions in wa e we e no measu ed, we know om p e ious exposu e s u- dies ha he concen a ions o PAH in newly made solu- ions a e e y simila o he nominal concen a ion (Honkanen e al. 2020). Mo eo e , and as p esen ed in Table 3, he same nominal concen a ions caused e y simila BSD indices as in he p esen s udy, ela i e o ou p e ious wo k (E iksson e al. 2022a), whe eby s eng h- ening he compa abili y. Thebodybu deno e enefluc ua ed non-significan ly wi h ime, i espec i e o ea men (Fig. 1a). Hence, no significan di e ence in he body bu den o e ene was obse ed in mix u e exposed ale ins ela i e o hose exposed o e ene alone. By compa ison, exposu e o fluo an henealone esul edinaninc easingbodybu den wi h ime, and a significan ly g ea e body bu den was obse ed by Day 7 compa ed o Day 1 (Fig. 1b). When co- exposed wi h e ene, he body bu den o fluo an hene diminished significan ly compa ed o ale ins exposed o fluo an hene alone o 7 days. Simila empo al pa e ns o accumula ion we e obse ed among ale ins exposed o he mix u e o e ene and fluo an hene, as epo ed in ou p e ious s udies (E iksson e al. 2022a,b). Hence, he educ ion in he body bu den o fluo an hene, when co- exposed wi h e ene, eflec s a b oade and mo e po en ac i a ion o phase I and II me abolic p ocesses, ei he ansc ip omic (E iksson e al. 2022a)o p o eomic (E iksson e al. 2022b), ha can o se he inhibi o y e ec o fluo an hene upon Cyp1a. Addi ionally, we we e able o iden i y and quan i y he accumula ion o endogenously o med FICZ in ale ins Fig. 1 Boxplo ep esen a ion o he exposu e specific body bu den p ofiles, pe ale in, ollowing exposu e o e ene (a; pmol), fluo - an hene (b; pmol) and endogenously o med FICZ (c; mol). Ale ins we e sampled a e 1, 3 and 7 days o semi-s a ic exposu e o he PAHs alone (da k-g ey-filled boxes) o as a bina y mix u e (whi e-filled boxes). Significan di e ences in body bu den wi hin each ea men , as pe KW +Dunn, a e deno ed wi h uppe - (fluo an hene) and lowe - case le e s (FICZ). Significan di e ences in body bu den be ween la ae exposed o he mix u e and he componen s a e deno ed wi h *. N pe ea men =3 Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins exposed o a. . . exposed o he mix u e, bu no in ale ins exposed o fluo - an hene o e ene alone (Fig. 1c). Howe e , i canno be uled ou ha exposu e o e ene and fluo an hene alone inc eased he a e o o ma ion. Ra he , i can only be s a ed ha accumula ion o de ec able le els did no occu ollowing exposu e o he indi idual PAHs. Endogenously o med and accumula ed FICZ can ei he be de i ed enzyma ically om yp amine o yp ophan, ollowing UV-i adia ion, o oxi- da ion o yp ophan, as obse ed du ing inc eased oxida i e s ess (Smi no a e al. 2016; Rannug and Rannug 2018). UV-i adia ion can be ejec ed as causa i e agen due o he a chi ec u e o he exposu e acili y (no windows), as he oom was illumina ed by yellow flo escen ligh . Tha lea es enzyma ic p ocesses and oxida i e s ess as he mos plau- sible causes; he la e being mo e likely due he known and es ablished ela ionship be ween PAH oxici y and subse- quen ly inc eased oxida i e s ess (Timme-La agy e al. 2007;Songe al.2019), al e ed i on me abolism (Rigaud e al. 2020b;E ikssone al.2022b) and ac i a ion o hea shock p o eins (Räsänen e al. 2012) in PAH exposed fish la ae. The body bu den o FICZ may also inc ease when subsequen me abolism by Cyp1a is inhibi ed (Wincen e al. 2012,2016). In he p esen s udy, he body bu den o FICZ peaked by Day 3 be o e dec easing significan ly by Day 7. The dynamics o he body bu den o FICZ, o e ime, hus sugges s a link be ween ac ual Cyp1a inhibi ion and sub- sequen accumula ion o FICZ in ela ion o de elopmen , and plausibly influenced by he ma u a ion o he li e . Howe e , Cyp1a inhibi ion by exposu e o fluo an hene alone was no su ficien in causing accumula ion o FICZ. The e o e, i can be pos ula ed ha al e a ions o mul iple pa allel molecula p ocesses and e en s a e equi ed o FICZ accumula ion in i o. Accumula ion o PAHs and FICZ was eflec ed in he exp ession o cyp1a ollowing 3 days o exposu e. Exposu e o fluo an hene esul ed in a non-significan ly inc eased exp ession ela i e o con ol, whe eas exposu e o e ene inc eased he exp ession significan ly. By con- as , exposu e o he mix u e esul ed in a significan ly s onge exp ession, ela i e o he o he ea men s and as a consequence, he measu ed exp ession was g ea e han he p edic ed addi i e e ec exe ed by he componen s (Table 4; combina ion index), esul s ha we e expec ed as pe p e ious s udies (Billia d e al. 2008;E ikssone al. 2022a). As he expe imen was designed o de ec and quan i y FICZ, i can only be assumed ha accumula ion o endogenously de i ed FICZ influences he exp ession o cyp1a. The unde lying p ocesses go e ning he ox- icodynamic and kine ic p ocesses a e ye o be de e mined. Combined, hese findings highligh ha he oxici y exe ed by his mix u e o PAHs could no ha e been p e- dic ed om he addi i e e ec o he componen s in de eloping ainbow ou ale ins, no could he obse ed syne gized BSD index in ale ins exposed o he mix u e be explained by he PAHs body bu den alone. As FICZ is known o cause symp oms o BSD in fish (Wincen e al. 2016), i is plausible ha accumula ion o FICZ could con ibu e o he syne gized BSD index among mix u e exposed ale ins. This is a no el mechanism o PAH mix- u e oxici y ha could, a leas , pa ly explain he syne gism obse ed in o ganisms exposed o complex PAH mix u es such as c ude oil (Billia d e al. 2008). Howe e , i is unknown o wha ex en accumula ed FICZ con ibu es o oxici y, no i accumula ion can occu in si u ollowing en i onmen al con amina ion. Conclusions Accumula ion o endogenously de i ed FICZ is a no el dis- co e y ha will impac how PAH mix u e oxici y is pe - cei ed. Accumula ion o FICZ, which is a known AhR2 agonis ha has been obse ed o induce de elopmen al oxici y in zeb afish la ae, is likely o ha e influenced and agg a a ed de elopmen al oxici y, as pe he s ong BSD indices. The unde lying p ocesses p omo ing accumula ion a e, in his case, unknown. Hypo he ically, accumula ion can be due o 1) dec eased a e o xenobio ic me abolism due o inc eased subs a e compe i ion be ween he PAHs and FICZ o phase I and II me abolic enzymes; 2) inc eased a e o o ma ion; o 3) a combina ion o dec eased a e o phase I and II me abolism alongside inc eased a e o o ma ion. Addi ionally, i is unknown i o ma ion and accumula ion o FICZ is issue specific, e enly dis ibu ed h oughou he de eloping o ganisms o p oduced in specific issue(s) bu dis ibu ed e enly. Mo eo e , i is unknown, al hough plausible, ha exposu e o o he ypes o PAH mix u es (simple and complex), o c ude oil, can esul in he accu- mula ion o FICZ. The same is ue o species and li e s age specifici y, which mus also be assessed. The e o e, mo e esea ch on he na u e o FICZ, in ela ion o de elopmen al Table 4 Whole-body cyp1a exp ession (%) ollowing 3 days o exposu e o DMSO (con ol ea men ), fluo an hene (Flu), e ene (Re ) and he bina y mix u e (Mix) T ea men cyp1a exp ession (%; ela i e con ol) Backg ound adjus ed cyp1a exp ession N DMSO 100 ± 53109 Flu 159 ± 6412 59 9 Re 436 ± 25323 336 7 Mix 2278 ± 148832178 ¤ 7 Significan di e ences a e deno ed by di e en numbe s (KW + Dunn), while a s onge , backg ound adjus ed, cyp1a exp ession among mix u e exposed ale ins is highligh ed by ¤ (as pe combina ion index) A. N. M. E iksson e al. oxici y, oxicodynamics and kine ics a e equi ed o u he he unde s anding o PAH oxici y in fish. Acknowledgemen s We would like o acknowledge he con ibu ion o labo a o y echnicians Me i Kois inen, Emma Pajunen, and he labo a o y pe sonnel a Konne esi esea ch s a ion o echnical suppo . We also like o hank Hanka-Taimen OY fish a m o supplying us wi h ainbow ou ale ins o scien ific pu poses and esea ch. Funding Academy o Finland p ojec numbe : 285296, 294066 and 319284 g an ed o Ee a-Riikka Vehniäinen. Open Access unding p o ided by Uni e si y o Jy äskylä (JYU). Compliance wi h e hical s anda ds Conflic o in e es The au ho s decla e no compe ing in e es s. Publishe ’s no e Sp inge Na u e emains neu al wi h ega d o ju isdic ional claims in published maps and ins i u ional a filia ions. Open Access This a icle is licensed unde a C ea i e Commons A ibu ion 4.0 In e na ional License, which pe mi s use, sha ing, adap a ion, dis ibu ion and ep oduc ion in any medium o o ma , as long as you gi e app op ia e c edi o he o iginal au ho (s) and he sou ce, p o ide a link o he C ea i e Commons license, and indica e i changes we e made. The images o o he hi d pa y ma e ial in his a icle a e included in he a icle’s C ea i e Commons license, unless indica ed o he wise in a c edi line o he ma e ial. I ma e ial is no included in he a icle’s C ea i e Commons license and you in ended use is no pe mi ed by s a u o y egula ion o exceeds he pe mi ed use, you will need o ob ain pe mission di ec ly om he copy igh holde . To iew a copy o his license, isi h p://c ea i ecommons. o g/licenses/by/4.0/. Re e ences Ba on MG, Hein z R, Rice SD (2004) Rela i e po ency o PAHs and he e ocycles as a yl hyd oca bon ecep o agonis s in fish. Ma En i on Res 58:95–100. h ps://doi.o g/10.1016/j.ma en es. 2004.03.001 Benjamini Y, Hochbe g Y (1995) Con olling he alse disco e y a e: a p ac ical and powe ul app oach o mul iple es ing. J R S a Soc Se ies B (Me hodolog) 57:289–300 Billia d SM, Meye JN, Wassenbe g DM, Hodson PV, Di Giulio RT (2008) Nonaddi i e e ec s o PAHs on ea ly e eb a e de el- opmen : mechanisms and implica ions o isk assessmen . Tox- icolog Sci O ficial J Soc Toxicol 105:5–23. h ps://doi.o g/10. 1093/ oxsci/k m303 Billia d SM, Que bach K, Hodson PV (1999) Toxici y o e ene o ea ly li e s ages o wo eshwa e fish species. En i on Toxicol Chem 18:2070–2077. h ps://doi.o g/10.1002/e c.5620180927 Billia d SM, Timme-La agy A, Wassenbe g DM, Cockman C, Di Giulio RT (2006) The ole o he A yl Hyd oca bon ecep o pa hway in media ing syne gis ic de elopmen al oxici y o polycyclic a oma ic hyd oca bons o Zeb afish. Toxicolog Sci 92:526–536 B inkwo h LC, Hodson PV, Tabash S, Lee P (2003) CYP1A induc- ion and blue sac disease in ea ly de elopmen al s ages o ain- bow ou (Onco hynchus Mykiss) exposed o e ene. J Toxicol En i on Heal h, Pa A 66:627–646. h ps://doi.o g/10.1080/ 15287390309353771 Cla k B, Coope E, S aple on H, Di Giulio R (2013) Compound- and mix u e-specific di e ences in esis ance o polycyclic a o- ma ic hyd oca bons and PCB-126 among Fundulus he e o- cli us subpopula ions h oughou he Elizabe h Ri e es ua y (Vi ginia, USA). En i on Sci Technol 47. h ps://doi.o g/10. 1021/es401604b Cola ecchia M, Hodson P, Pa o J (2006) CYP1A induc ion and Blue Sac disease in ea ly li e s ages o whi e sucke s (Ca os- omus comme soni) exposed o oil sands. J Toxicol En i on Heal h Pa A 69:967–994. h ps://doi.o g/10.1080/ 15287390500362154 Doe ing J, Hecke M, Villeneu e D, Zhang X (2019) Ad e se ou - come pa hway on a yl hyd oca bon ecep o ac i a ion leading o ea ly li e s age mo ali y, ia inc eased COX-2IS 12. h ps://doi. o g/10.1787/bd46b538-en dos San os IF, Fe ei a SLC, Domínguez C, Bayona JM (2018) Ana- ly ical s a egies o de e mining he sou ces and eco oxicological isk o PAHs in i e sedimen . Mic ochem J 137:90–97. h ps:// doi.o g/10.1016/j.mic oc.2017.09.025 E iksson ANM, Rigaud C, K asno A, Wincen E, Vehniäinen E-R (2022a) Exposu e o e ene, fluo an hene, and hei bina y mix- u e causes dis inc ansc ip omic and apical ou comes in ain- bow ou (Onco hynchus mykiss) yolk sac ale ins. Aqua Toxicol 106083. h ps://doi.o g/10.1016/j.aqua ox.2022.106083 E iksson ANM, Rigaud C, Rokka A, Skaugen M, Liha ainen JH, Vehniäinen E-R (2022b) Changes in ca diac p o eome and me abolome ollowing exposu e o he PAHs e ene and fluo an hene and hei mix u e in de eloping ainbow ou ale ins. Sci To al En i on 830:154846. h ps://doi.o g/10.1016/ j.sci o en .2022.154846 Foucquie J, Guedj M (2015) Analysis o d ug combina ions: cu - en me hodological landscape. Pha macol Res Pe spec 3:e00149–e00149. h ps://doi.o g/10.1002/p p2.149 Geie MC, James Minick D, T uong L, Til on S, Pande P, Ande son KA, Teegua dan J, Tanguay RL (2018) Sys ema ic de elop- men al neu o oxici y assessmen o a ep esen a i e PAH Supe und mix u e using zeb afish. Toxicol Appl Pha macol 354:115–125. h ps://doi.o g/10.1016/j. aap.2018.03.029 Hein z RA, Rice SD, We heime AC, B adshaw RF, Th owe FP, Joyce J, Sho J (2000) Delayed e ec s on g ow h and ma ine su i al o pink salmon Onco hynchus go buscha a e exposu e o c ude oil du ing emb yonic de elopmen . Ma ine Ecology- p og ess Se ies. MAR ECOL-PROGR SER 208:205–216. h ps:// doi.o g/10.3354/meps208205 Hodson PV, Qu eshi K, Noble CAJ, Akh a P, B own RS (2007) Inhibi ion o CYP1A enzymes by alpha-naph hofla one causes bo h syne gism and an agonism o e ene oxici y o ainbow ou (Onco hynchus mykiss). Aqua Toxicol 81:275–285. h ps://doi. o g/10.1016/j.aqua ox.2006.12.012 Honkanen JO, Rees CB, Kukkonen JVK, Hodson PV (2020) Tem- pe a u e de e mines he a e a which e ene a ec s ou emb yos, no he concen a ion ha is oxic. Aqua Toxicol 222:105471. h ps://doi.o g/10.1016/j.aqua ox.2020.105471 Inca dona JP (2017) Molecula mechanisms o c ude oil de elop- men al oxici y in fish. A ch En i on Con am Toxicol 73:19–32. h ps://doi.o g/10.1007/s00244-017-0381-1 Inca dona JP, Ca ls MG, Day HL, Sloan CA, Bol on JL, Collie TK, Scholz NL (2009) Ca diac A hy hmia is he p ima y esponse o Emb yonic Pacific He ing (Clupea pallasi) exposed o c ude oil du ing wea he ing. En i on Sci Technol 43:201–207. h ps://doi. o g/10.1021/es802270 Inca dona JP, Linbo TL, Scholz NL (2011) Ca diac oxici y o 5- ing polycyclic a oma ic hyd oca bons is di e en ially dependen on he a yl hyd oca bon ecep o 2 iso o m du ing zeb afish de el- opmen . Toxicol Appl Pha macol 257:242–249. h ps://doi.o g/ 10.1016/j. aap.2011.09.010 Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins exposed o a. . . Maes J, Ve looy L, Buena e OE, de Wi e PAM, Esgue a CV, C aw o d AD (2012) E alua ion o 14 o ganic sol en s and ca ie s o sc eening applica ions in Zeb afish Emb yos and La ae. PLOS ONE 7:e43850 Massa sky A, Bone AJ, Dong W, Hin on DE, P asad GL, Di Giulio RT (2016) AHR2 mo pholino knockdown educes he oxici y o o al pa icula e ma e o zeb afish emb yos. Toxicol Appl Pha macol 309:63–76. h ps://doi.o g/10.1016/j. aap.2016.08. 024 OECD, 2013. Tes No. 236: Fish Emb yo Acu e Toxici y (FET) Tes . h ps://doi.o g/10.1787/9789264203709-en Rannug A, Rannug U (2018) The yp ophan de i a i e 6- o - mylindolo[3,2-b]ca bazole, FICZ, a dynamic media o o endo- genous a yl hyd oca bon ecep o signaling, balances cell g ow h and di e en ia ion. C i Re Toxicol 48:555–574. h ps://doi.o g/ 10.1080/10408444.2018.1493086 Räsänen K, A siola T, Oika i A (2012) Fas genomic bioma ke esponses o e ene and py ene in li e o Ju enile Rainbow T ou , Onco hynchus mykiss. Bull En i on Con am Toxicol 89:733–738. h ps://doi.o g/10.1007/s00128-012-0770-0 Rigaud C, E iksson A, K asno A, Wincen E, Pakkanen H, Leh i- uo i H, Ihalainen J, Vehniäinen E-R (2020a) Re ene, py ene and phenan h ene cause dis inc molecula -le el changes in he ca - diac issue o ainbow ou (Onco hynchus mykiss) la ae, pa 1–T ansc ip omics. Sci To al En i on 745:141031. h ps://doi. o g/10.1016/j.sci o en .2020.141031 Rigaud C, E iksson A, Rokka A, Skaugen M, Liha ainen J, Keinänen M, Leh i uo i H, Vehniäinen E-R (2020b) Re ene, py ene and phenan h ene cause dis inc molecula -le el changes in he ca diac issue o ainbow ou (Onco hynchus mykiss) la ae, pa 2 – P o eomics and me abolomics. Sci To al En i on 746:141161. h ps://doi.o g/10.1016/j.sci o en .2020.141161 R Co e Team (2020) R: A language and en i onmen o s a is ical compu ing. R Founda ion o S a is ical Compu ing, Vienna, Aus ia. h ps://www.R-p ojec .o g/ RS udio Team (2020) RS udio: In eg a ed De elopmen o R. RS u- dio, PBC, Bos on, MA. h p://www. s udio.com/ Sco JA, Hodson PV (2008) E idence o mul iple mechanisms o oxici y in la al ainbow ou (Onco hynchus mykiss) co- ea ed wi h e ene and α-naph hofla one. Aqua Toxicol 88:200–206. h ps://doi.o g/10.1016/j.aqua ox.2008.04.007 Sco JA, Inca dona JP, Pelkki K, Shepa dson S, Hodson PV (2011) AhR2-media ed, CYP1A-independen ca dio ascula oxici y in zeb afish (Danio e io) emb yos exposed o e ene. Aqua Toxicol 101:165–174. h ps://doi.o g/10.1016/j.aqua ox.2010. 09.016 Si ula L, Vehniäinen E-R, Vehniäinen E-R, Kukkonen JVK (2018) Toxici y o biomining e fluen s o Daphnia magna: acu e oxici y and ansc ip omic bioma ke s. Chemosphe e 210:304–311. h ps://doi.o g/10.1016/j.chemosphe e.2018.07.030 Smi no a A, Wincen E, Viks öm Be gande L, Alsbe g T, Be gman J, Rannug A, Rannug U (2016) E idence o new ligh -independen pa hways o gene a ion o he endogenous A yl Hyd oca bon ecep o agonis FICZ. Chem Res Toxicol 29:75–86. h ps://doi.o g/ 10.1021/acs.chem es ox.5b00416 Song Y, Nah gang J, Tolle sen KE (2019) T ansc ip omic analysis e eals dose-dependen modes o ac ion o benzo(a)py ene in pola cod (Bo eogadus saida). Sci To al En i on 653:176–189. h ps://doi.o g/10.1016/j.sci o en .2018.10.261 Timme-La agy A, Cockman CJ, Ma son CW, Di Giulio RT (2007) Syne gis ic induc ion o AHR egula ed genes in de elopmen al oxici y om co-exposu e o wo model PAHs in zeb afish. Aqua Toxicol 85:241–250. h ps://doi.o g/10.1016/j.aqua ox. 2007.09.005 Tisso BP, Wel e DH (1978) Composi ion o C ude Oils, In: Tisso BP, Wel e DH (Eds.), Pe oleum o ma ion and occu ence: a new app oach o oil and gas explo a ion. Sp inge Be lin Heidelbe g, Be lin, Heidelbe g, pp. 333–368. h ps://doi.o g/10.1007/978-3- 642-96446-6_19 Van Tiem LA, Di Giulio RT (2011) AHR2 knockdown p e en s PAH-media ed ca diac oxici y and XRE- and ARE-associa ed gene induc ion in zeb afish (Danio e io). Toxicol Appl Pha macol 254:280–287. h ps://doi.o g/10.1016/j. aap.2011. 05.002 Vehniäinen E-R, B eme K, Sco JA, Jun ila S, Laiho A, Gyenesei A, Hodson PV, Oika i AOJ (2016) Re ene causes mul i unc ional ansc ip omic changes in he hea o ainbow ou (Onco - hynchus mykiss) emb yos. En i on Toxicol Pha macol 41:95–102. h ps://doi.o g/10.1016/j.e ap.2015.11.015 Wassenbe g D, Di Giulio R (2004) Syne gis ic emb yo oxici y o polycyclic a oma ic hyd oca bon a yl hyd oca bon ecep o agonis s wi h cy och ome P4501A inhibi o s in Fundulus he - e ocli us. En i on Heal h Pe spec 112:1658–1664. h ps://doi. o g/10.1289/ehp.7168 Wicks öm K, Tolonen K (1987) The his o y o ai bo ne polycyclic a oma ic hyd oca bons (PAH) and pe ylene as eco ded in da ed lake sedimen s. Wa e Ai Soil Pollu 32:155–175. h ps://doi.o g/ 10.1007/BF00227691 Wille KL, Rande a h K, Zhou G-D, Sa e SH (1998) Inhibi ion o CYP1A1-dependen ac i i y by he polynuclea a oma ic hyd o- ca bon (PAH) fluo an hene. Biochem Pha macol 55:831–839. h ps://doi.o g/10.1016/S0006-2952(97)00561-3 Wills LP, Zhu S, Wille KL, Di Giulio RT (2009) E ec o CYP1A inhibi ion on he bio ans o ma ion o benzo[a]py ene in wo popula ions o Fundulus he e ocli us wi h di e en exposu e his o ies. Aqua Toxicol 92:195–201. h ps://doi.o g/10.1016/j.a qua ox.2009.01.009 Wincen E, Amini N, Luecke S, Gla H, Be gman J, C escenzi C, Rannug A, Rannug U (2009) The sugges ed physiologic A yl hyd oca bon ecep o ac i a o and cy och ome P4501 subs a e 6- o mylindolo[3,2-b]ca bazole is p esen in humans. J Biol Chem 284:2690–2696. h ps://doi.o g/10.1074/ jbc.M808321200 Wincen E, Beng sson J, Ba dbo i AM, Alsbe g T, Luecke S, Ran- nug U, Rannug A (2012) Inhibi ion o cy och ome P4501- dependen clea ance o he endogenous agonis FICZ as a mechanism o ac i a ion o he a yl hyd oca bon ecep o . P oc Na l Acad Sci USA 109:4479. h ps://doi.o g/10.1073/pnas. 1118467109 Wincen E, Kubo a A, Timme-La agy A, Jönsson ME, Hahn ME, S egeman JJ (2016) Biological e ec s o 6- o mylindolo[3,2-b] ca bazole (FICZ) in i o a e enhanced by loss o CYP1A unc- ion in an Ah 2-dependen manne . Biochem Pha macol 110–111:117–129. h ps://doi.o g/10.1016/j.bcp.2016.04.012 A. N. M. E iksson e al.