Endogenous AhR agonist FICZ accumulates in rainbow trout (Oncorhynchus mykiss) alevins exposed to a mixture of two PAHs, retene and fluoranthene
Full text
This is a sel -a chi ed e sion o an o iginal a icle. This e sion
may di e om he o iginal in pagina ion and ypog aphic de ails.
Au ho (s):
Ti le:
Yea :
Ve sion:
Copy igh :
Righ s:
Righ s u l:
Please ci e he o iginal e sion:
CC BY 4.0
h ps://c ea i ecommons.o g/licenses/by/4.0/
Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss)
ale ins exposed o a mix u e o wo PAHs, e ene and luo an hene
© The Au ho (s) 2022
Published e sion
E iksson, And eas N. M.; Rigaud, Cy il; Wincen , Emma; Pakkanen, Hannu;
Salonen, Pihla; Vehniäinen, Ee a-Riikka
E iksson, A. N. M., Rigaud, C., Wincen , E., Pakkanen, H., Salonen, P., & Vehniäinen, E.-R. (2022).
Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins
exposed o a mix u e o wo PAHs, e ene and luo an hene. Eco oxicology, 31(9), 1382-1389.
h ps://doi.o g/10.1007/s10646-022-02593-9
2022
Eco oxicology
h ps://doi.o g/10.1007/s10646-022-02593-9
Endogenous AhR agonis FICZ accumula es in ainbow ou
(Onco hynchus mykiss) ale ins exposed o a mix u e o wo PAHs,
e ene and fluo an hene
And eas N. M. E iksson 1●Cy il Rigaud1●Emma Wincen 2●Hannu Pakkanen3●Pihla Salonen1●
Ee a-Riikka Vehniäinen1
Accep ed: 23 Sep embe 2022
© The Au ho (s) 2022
Abs ac
Mul iple s udies ha e epo ed syne gized oxici y o PAH mix u es in de eloping fish la ae ela i e o he addi i e e ec o
he componen s. F om a oxicological pe spec i e, mul iple mechanisms a e known o con ibu e o syne gism, such as
al e ed oxicodynamics and kine ics, as well as inc eased oxida i e s ess. An unde s udied con ibu o o syne gism is he
accumula ion o endogenous me aboli es, o example: he a yl hyd oca bon ecep o 2 (AhR2) agonis and yp ophan
me aboli e 6-Fo mylindolo(3,2-b)ca bazole (FICZ). Fish la ae exposed o FICZ, alongside knock-down o cy och ome
p450 (cyp1a), has been epo ed o induced symp oms o oxici y simila o hose obse ed ollowing exposu e o PAHs o
he dioxin 2,3,7,8- e achlo odibenzo-p-dioxin. He e, we explo ed i FICZ accumula es in newly ha ched ainbow ou
ale ins (Onco hynchus mykiss) exposed o wo PAHs wi h di e en p ope ies: e ene (po en AhR2 agonis ) and
fluo an hene (weak AhR2 agonis and Cyp1a inhibi o ), ei he alone o as a bina y mix u e o 3 and 7 days. We ound ha
exposu e o he mix u e esul ed in accumula ion o endogenous FICZ, syne gized he blue sac disease index (BSD), and
al e ed he body bu den p ofiles o he PAHs, when compa ed o he ale ins exposed o he indi idual componen s. I is hus
e y plausible ha accumula ion o endogenously de i ed FICZ con ibu ed o he syne gized BSD index and oxici y in
exposed ale ins. Accumula ion o endogenously de i ed FICZ is a no el finding ha ex ends ou gene al unde s anding on
PAHs oxici y in de eloping fish la ae, while a he same ime highligh ing why en i onmen al isk assessmen o PAHs
should no be based solely esul s om he assessmen o indi idual compounds.
Keywo ds Syne gism ●Mix u e ●PAH ●FICZ ●Onco hynchus mykiss ●Blue sac disease
In oduc ion
Polycyclic a oma ic hyd oca bons (PAHs) a e a di e se and
widesp ead g oup o en i onmen al pollu an s o ei he na -
u al o an h opogenic o igin (Wicks öm and Tolonen 1987;
dos San os e al. 2018) and a e always p esen as complex
mix u es (Tisso and Wel e 1978). F om an aqua ic ox-
icological pe spec i e, he exac mechanisms o oxici y a e
no ully unde s ood, e en a e decades o esea ch
employing mul iple species o fish and ypes o PAHs
(Hein z e al. 2000; B inkwo h e al. 2003; Wassenbe g and
Di Giulio 2004; Van Tiem and Di Giulio 2011; Cla k e al.
2013; Rigaud e al. 2020a). Wha is known is ha di e en
PAHs induce oxici y h ough di e en mechanisms and
cause exposu e and PAH specific oxici y p ofiles (Billia d
e al. 2008; Inca dona e al. 2011; Geie e al. 2018;Rigaud
e al. 2020a,b; E iksson e al. 2022a,b). Addi ionally, hea
s uc u e and unc ion a e especially sensi i e o he influence
o PAH(s) du ing ea ly li e de elopmen o fish (Inca dona
e al. 2011,2009; Vehniäinen e al. 2016). The specifici y o
ca dio oxici y is hypo hesized o be linked o in e ac ion(s)
be ween PAHs, as a pa o c ude oil, and lipop o eins
bound o he cellula memb ane (Inca dona 2017).
*And eas N. M. E iksson
and eas.n.m.e iksson@jyu.fi
1Depa men o Biological and En i onmen al Sciences, Uni e si y
o Jy äskylä, Jy äskylä, Finland
2Ins i u e o En i onmen al Medicine, Ka olinska Ins i u e ,
S ockholm, Sweden
3Depa men o Chemis y, Uni e si y o Jy äskylä,
Jy äskylä, Finland
1234567890();,:
1234567890();,:
Fu he mo e, mix u e composi ion has been obse ed and
epo ed o modula e PAH oxici y ou come, ela i e o he
componen s (Geie e al. 2018; E iksson e al. 2022a,b). The
bes -known molecula mechanism ela ed o PAH oxici y is
ha in ol ing ac i a ion o he a yl-hyd oca bon ecep o 2
(AhR2) (Massa sky e al. 2016; Doe ing e al. 2019). Ac i-
a ion o AhR2, by PAHs such as e ene (Sco e al. 2011),
benzo[a]py ene (Inca dona e al. 2011; Song e al. 2019),
benzo[k]fluo an hene (Van Tiem and Di Giulio 2011), and
py ene (Inca dona e al. 2011) induces he exp ession o ,
among many genes, cy och ome P450 (CYP1), pa icula ly
cyp1a, which encodes o an enzyme ha ini ia es phase I
me abolism o xenobio ics h ough hyd oxyla ion (Billia d
e al. 2008). By con as , some PAHs, such as fluo an hene,
can bo h induce he exp ession o cyp1a, and inhibi he
unc ion o he ansla ed and unc ional enzyme by blocking
i s ac i e si e (Wille e al. 1998), which has p e iously been
shown o syne gize he oxici y o o he PAHs (Wills e al.
2009; Van Tiem and Di Giulio 2011).
A commonly assessed bioma ke o PAH oxici y in
de eloping fish is he so called blue sac disease synd ome
(BSD), which encompasses se e al symp oms o PAH
induced oxici y: c anio acial de o mi ies, hemo haging,
yolk and pe ica dial edema and spinal cu a u es (Billia d
e al. 1999,2006; Cola ecchia e al. 2006). Al hough i is
no ully known how BSD is induced (Sco e al. 2011;
Cla k e al. 2013), knockdown o ah 2 (bu no cyp1a)is
known o p e en he o ma ion o BSD- ela ed symp oms
in de eloping zeb afish la ae (Danio e io), which implies
ha downs eam molecula e en s o AhR2, o he han
ac i a ion o Cyp1, a e equi ed o he mani es a ion o
PAH oxici y (Van Tiem and Di Giulio 2011; Massa sky
e al. 2016). Recen ly, he ac i a ion o cyclooxygenase-2
(cox2), which is linked o AhR2 ac i a ion, by PAH(s) has
been epo ed o be in ol ed in he induc ion o de elop-
men al oxici y in fish (Doe ing e al. 2019).
Some endogenous compounds, such as he yp ophan
de i a i e FICZ (6-Fo mylindolo[3,2-b]ca bazole), a e also
known o be able o ac i a e AhR2 (Wincen e al. 2009).
FICZ is a e y po en AhR agonis , and du ing no mal
condi ions, i is main ained a low le els by cons an Cyp1-
media ed me abolism (Wincen e al. 2009). Inc eased a e
o o ma ion o FICZ has been obse ed ollowing h ee
dis inc p ocesses: inc eased enzyma ic ac i i y, inc eased
UV-i adia ion, and inc eased le els o oxida i e s ess
(Smi no a e al. 2016; Rannug and Rannug 2018). Newly
ha ched zeb afish la ae exposed o ex e nally adminis a ed
FICZ, in combina ion wi h a Cyp1a-inhibi o (alpha-naph-
hofla one) o cyp1a-knockdown, esul ed in educed
me abolism o FICZ and inc eased occu ence o BSD-
ela ed symp oms, and o he signs o oxici y ha esemble
hose caused by exposu e o PAHs (Wincen e al. 2016). I
has he e o e been hypo hesized ha he o ma ion and
accumula ion o endogenous FICZ could con ibu e o
AhR-media ed de elopmen al oxici y in fish la ae (Win-
cen e al. 2012; Rannug and Rannug 2018).
The e o e, we in es iga ed i exposu e o wo PAHs wi h
di e en modes o ac ion, e ene (an AhR2 agonis ) and
fluo an hene (a weake AhR2 agonis and Cyp1a inhibi o )
(Ba on e al. 2004), alone o as a bina y mix u e, could
o ce he accumula ion o endogenously de i ed FICZ in
newly ha ched and de eloping ainbow ou ale ins
(Onco hynchus mykiss). By assessing he empo al de el-
opmen o he PAH and FICZ specific body bu dens, in
ela ion o he BSD index in de eloping ainbow ou , we
aimed a unco e ing how po en ial accumula ion o FICZ
could con ibu e o de elopmen al oxici y.
Ma e ials and me hods
Expe imen al se up
Newly ha ched 360 deg ee-days and heal hy ainbow ou
ale ins ( ee om de elopmen al de o mi ies, edemas, and
hemo hages; p o ided by Hanka-Taimen Oy fish a m,
Cen al Finland) we e ei he exposed o dime hyl sul oxide
as con ol (DMSO; 20 µl L−1;Sigma–Ald ich, S -Louis,
MO, USA) CAS-numbe 67-68-5), e ene (nominally
32 µg L−1; MP Biomedicals, Illki ch, F ance) CAS-
numbe 483-65-3), fluo an hene (nominally 50 µg L−1;
Sigma Ald ich; CAS-numbe 206-44-0) o he bina y
mix u e o he wo PAHs (a a o emen ioned nominal
concen a ions), and sampled a e 1, 3 and 7 days o
exposu e. In es iga ed nominal PAH concen a ions we e
selec ed as o p o oke oxici y, bu no inc ease mo ali y
a es, as pe p e iously published s udies on e ene oxici y
(Hodson e al. 2007; Sco and Hodson, 2008; Vehniäinen
e al. 2016) and an unpublished assessmen o fluo an hene
oxici y ( ainbow ou ale in exposed o 500 µg L−1 o
11 days, did no inc ease mo ali y). Addi ionally, he
concen a ion o DMSO (20 µl L−1) can be conside ed as
accep able (<100 µl L−1;OECD2013), and should no
con ibu e o sol en -media ed oxici y (Maes e al. 2012).
Exposu es we e pe o med in 1.5 li e Py ex glass bowls,
filled wi h 1 li e o fil e ed lake wa e ob ained om
Konne esi Resea ch s a ion in Cen al Finland. Each
ea men was pe o med in iplica es, and each eplica e
con ained 15 ale ins. Exposu e wa e empe a u e was
main ained a 10.8 ± 0.3 °C, and a 16:8 ligh o da k a io
employed. Rela i e oxygen sa u a ion, pH and con-
duc i i y we e measu ed a 103.23 ± 3.32%, 7.38 ± 0.09
and 17.53 ± 3.95 mS m−1, espec i ely and h oughou he
exposu e du a ion. A sampling, 5 ale ins pe eplica e
we e ideo eco ded and pho og aphed while he emain-
ing 10 ale ins (pe eplica e) we e pho og aphed and
A. N. M. E iksson e al.
snap- ozen o la e HPLC-analysis. Symp oms o blue
sac disease (BSD) we e assessed based upon he ideo
eco dings (pe ica dial edema) combined wi h pho o-
g aphs (yolk sac edema and hemo hages) o he 5 indi-
idually sampled ale ins in silico.
Blue sac disease index
BSD index was calcula ed h ough es ablished con en ion
o each exposu e eplica e (n=3; Eq. 1) (Cola ecchia
e al. 2006; Sco e al. 2011). In o de o compa e he BSD
indices epo ed by E iksson e al. (2022a)wi h hose
ob ained in his p esen s udy, he same symp oms o
oxici y we e assessed and sco ed in he same ashion:
hemo hages (HE; sco ed 0 o 1; no p esen o p esen ),
pe ica dial (PE; 0 o 1) and yolk sac edemas (YE: 0 o 1).
The o al sco e pe eplica e was hen di ided by he o al
maximum po en ial sco e pe eplica e: 15 (maximum sco e
pe indi idual ale in was 3, and 5 ale ins pe eplica e
we e assessed).
BSD index ¼PHE þPPE þPYE
15 ð1Þ
Es ablishmen o body bu den h ough HPLC
analysis and confi ma ion o FICZ
P epa a ion o ale ins and HPLC analysis we e pe o med
as ins uc ed by Rigaud e al. (2020a) and E iksson e al.
(2022a). In sho , he 10 pooled ale ins (pe eplica e) we e
homogenized by zi conium pelle s (ci cum e ence o 1 and
2 mm; Nex Ad ance, USA) in 70% ace oni ile (ACN;
Fishe Scien ific) using a s anda d model bulle blende
(Nex Ad ance). The homogena e was hen cen i uged
(Cen i uge 5415 R, Eppendo , Ge many) o 10 min a
14,000 pm and 4 °C. The supe na an was collec ed and he
pelle e-suspended in 70% ACN, cen i uged, he supe -
na an collec ed and pooled. The e-suspension s ep was
pe o med wice. Body bu den o he PAHs and FICZ was
es ablished h ough HPLC wi h fluo escence de ec o
(Shimadzu UHPLC Nexe a-sys em). De ec ion pa ame e s
and limi s o he HPLC measu emen s a e p esen ed in
Table 1. Subsequen a ea unde he cu e (AUC) o each
espec i e compound was manually adjus ed, backg ound
compensa ed (con ol AUC), and he body bu den calcu-
la ed based upon s anda d cu es.
The p esence o FICZ was confi med using LC-MS/MS
(Agilen 1290 ul a-high-p essu e liquid ch oma og aphy
sys em coupled o an Agilen 6460 iple quad upole mass
spec ome e ). The mobile phase employed in LC-MS/MS
analysis was c ea ed om double-dis illed wa e and ace -
oni ile (70%), bo h o ified wi h 1.5 mM o mic acid
(Fische Scien ific). The a io be ween he componen s o he
mobile phase s a ed a 1:1 which om minu e 1 o 9
inc eased o 1:20 be o e e u ning o 1:1 om minu e 10.5 o
11; finally, he pos - ime column s abiliza ion las ed o
2.5 min. Re en ion ime o FICZ was 3.54 min (LC-MS/MS).
qPCR p epa a ion and analysis
Measu emen o whole-body cyp1a exp ession was pe -
o med acco ding o ins uc ions epo ed by Rigaud e al.
(2020a), which in u n was modified om Si ula e al.
(2018). In sho : he 5 indi idual ale in ca casses we e
ea ed using TRI eagen (Molecula Resea ch Cen e) in
o de o ex ac RNA. The concen a ion, pu i y (NanoD op
1000, The mo Fishe Scien ific) and in eg i y o he RNA
we e assessed using a TapeS a ion and confi med (euka -
yo e o al RNA 6000 Nano-ki ; Agilen ) in acco dance wi h
he manu ac u e ’s ins uc ions. RNA was DNase ea ed
(DNase I, Fe men as) and using iSc ip cDNA Syn hesis Ki
(Bio-Rad, USA), 500 ng o RNA was e e se ansc ibed
in o cDNA and dilu ed 1:10 in nuclease- ee wa e . Fi e µL
o dilu ed cDNA we e hen mixed wi h 1.5 µL o o wa d
and e e se p ime s (final concen a ion 300 nM; Table 2),
4.5 µL s e ile H2O and 12.5 µL o iQ SYBR G een Supe -
mix (Bio-Rad). The 25 µL qPCR eac ion mix u e was
analyzed u ilizing he CFX96 Real-Time PCR cycle (Bio-
Rad) acco ding o es ablished p o ocol: 3 min a 95 °C;
40 cycles (10 s a 95 °C, 10 s a 58 °C, 30 s a 72 °C, 10 s a
95 °C) and mel ing cu e inc eased om 55 °C o 95 °C in
inc emen s o 0.5 °C. The exp ession o cyp1a was calcu-
la ed using Bio-Rad CFX Manage so wa e ( .3.1),
employing ndu a and l17 as e e ences genes (Table 2).
Da a analysis
S a is ical analyses we e pe o med using R .4.0.3 (The R
Founda ion o S a is ical Compu ing, 2020)coupledwi h
R-s udio .1.3.1093 (RS udio Team 2020). Significan
di e ences we e assessed using K uskal–Wallis es com-
bined wi h Dunn’spos -hoc es (KW +Dunn) and
adjus ed o mul iple compa isons using Bon e oni’s
me hod (Benjamini and Hochbe g 1995). Exposu e specific
Table 1 PAH and FICZ de ec ion pa ame e s employed o Shimadzu
HPLC analyses
HPLC and quan ifica ion
pa ame e s
Re ene Fluo an hene FICZ
Exci a ion (nm) 259 288 390
Emission (nm) 370 525 525
Re en ion ime (minu es) 16.7 ± 0.1 13.5 ± 0.2 8.370 ± 0.001
LOD (nM) 4.56 6.21 15.11
LOQ (nM) 13.83 18.83 45.79
Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins exposed o a. . .
changes in he body bu den o mix u e exposed ale ins,
compa ed o hose exposed o he componen s, we e
assessed using Mann–Whi ney’sU- es .
In o de o assess he e ec o he mix u e, ela i e o
he addi i e e ec o he componen s on he ob ained
BSD indices, backg ound adjus ed combina ion indices
we e calcula ed (CI; Eq. 2) (Foucquie and Guedj 2015)
andcompa edwi h he esul s epo edbyE ikssone al.
(2022a):
CI ¼RþFRFðÞ
Mð2Þ
whe e he a e age, and no malized e ec (agains
con ol), exe ed by e ene and fluo an hene alone a e
ep esen edbyRandF,while heno malizede ec
exe ed by he bina y mix u e is ep esen ed by M. A
s onge e ec by he mix u e, ela i e o he componen s,
is assumed i he CI is <1.
Resul s and discussion
The occu ence o blue sac disease ela ed symp oms was
dependen on bo h he ype o exposu e and du a ion
(Table 3). Exposu e o fluo an hene p oduced a weake index
a e 3 days o exposu e compa ed o Day 7. Exposu e o
e ene p oduced, on a e age, simila BSD indices on bo h Day
3 and 7. By con as , exposu e o he bina y mix u e p oduced
he s onges BSD index, i espec i e o exposu e du a ion.
Ye , significance was only obse ed a e 3 days o exposu e
(fluo an hene ela i e o mix u e), while nea - o-significance
was ob ained be ween con ol and mix u e exposed ale ins on
Day7(p=0.0532). Few eplica es pe ea men (n=3) a e
plausibly obscu ing some he s a is ical ou come, as he BSD
indices epo ed by E iksson e al. (2022a), who u ilized a
g ea e numbe o eplica es (n=6), we e accompanied by
s a is ical di e ences. Ne e heless, exposu e o he mix u e
esul ed in a g ea e han p edic ed BSD index (Table 3;
Table 3 A e age (± s anda d de ia ion) blue sac disease (BSD) indices among ale ins exposed o 3 and 7 days o DMSO (con ol) and he PAHs
e ene (Re ) and fluo an hene (Flu) o he bina y mix u e
S udy Exposu e BSD; Day 3 BSD; Day 7 Backg ound
adjus ed; Day 3;
Backg ound
adjus ed; Day 7
E iksson e al.
(2022a)
DMSO 0.20 ± 0.08 a0.23 ± 0.11 A00
Flu 0.34 ± 0.17 ab 0.25 ± 0.06 A0.14 0.02
Re 0.25 ± 0.08 a0.29 ± 0.16 AB 0.05 0.06
Mix 0.49 ± 0.09 b0.43 ± 0.10 B0.29 #0.20 #
P esen s udy DMSO 0.20 ± 0.12 12 0.24 ± 0.08 0 0
Flu 0.18 ± 0.10 10.33 ± 0.12 −0.02 0.09
Re 0.33 ± 0.18 12 0.33 ± 0.12 0.13 0.09
Mix 0.49 ± 0.10 20.44 ± 0.10 ¤ 0.29 #0.20 #
¤ DMSO –Mix: p=0.0532 (Dunn’spos hoc es )
Significan di e ences, as pe E iksson e al. (2022a), a e deno ed wi h di e en lowe and uppe case le e s o Day 3 and 7, espec i ely (N=6)
A nea - o significan di e ence be ween con ol and mix u e, by Day 7, a e deno ed wi h ¤ (P esen s udy)
Significan di e ences (KW +Dunn; N=3) we e obse ed among mix u e exposed ale ins compa ed o con ol (DMSO) and fluo an hene by
Day 3 (deno ed wi h di e en numbe s)
Backg ound adjus ed indices we e u ilized o he assessmen o combina ion indices
A BSD-index g ea e han he combined addi i e e ec o he componen s among ale ins exposed o he mix u e, as pe combina ion index
BSD esul s, as pe his p esen s udy, a e compa ed wi h he indices epo ed by E iksson e al. (2022a)
Table 2 Accession iden ifica ion codes, o wa d and e e se p ime sequences (F = o wa d; R = e e se), subsequen p oduc leng h (base pai s)
and o e all e ficiency o cyp1a (%) and he e e ence genes (ndu a and l17)
Gene Accession P ime P oduc leng h E ficiency (%)
cyp1a NM_001140880.2 F: CAGTCCGCCAGGCTCTTATCAAGC 94 96.9
R: GCCAAGCTCTTGCCGTCGTTGAT
ndu a NM_001195159.2 F: ATCGAGCACATCCAGGTAACAAG 99 110.1
R: AATGTGGCAAGGGGAGCTCATGTA
l17 NM_001160582.1 F: TTCAGAGCCTCATCTTGCCTGCT 119 114
R: CAACATAGGGATTGGAGAGCTGTACG
A. N. M. E iksson e al.
i espec i e o exposu e du a ion), as he combina ion index
was 0.39 a e 3 days o exposu e and 0.86 by Day 7. Hence,
he esul s p esen ed in E iksson e al. (2022a) can he e o e be
conside ed as compa able, highligh ing BSD indices as a
unc ional p oxy o nominal exposu e concen a ions in a
s anda dized exposu e s udy; a leas when conside ing he
e ec o his bina y mix u e and combina ion indices.
E en hough he ac ual PAH concen a ions in wa e
we e no measu ed, we know om p e ious exposu e s u-
dies ha he concen a ions o PAH in newly made solu-
ions a e e y simila o he nominal concen a ion
(Honkanen e al. 2020). Mo eo e , and as p esen ed in
Table 3, he same nominal concen a ions caused e y
simila BSD indices as in he p esen s udy, ela i e o ou
p e ious wo k (E iksson e al. 2022a), whe eby s eng h-
ening he compa abili y.
Thebodybu deno e enefluc ua ed non-significan ly
wi h ime, i espec i e o ea men (Fig. 1a). Hence, no
significan di e ence in he body bu den o e ene was
obse ed in mix u e exposed ale ins ela i e o hose
exposed o e ene alone. By compa ison, exposu e o
fluo an henealone esul edinaninc easingbodybu den
wi h ime, and a significan ly g ea e body bu den was
obse ed by Day 7 compa ed o Day 1 (Fig. 1b). When co-
exposed wi h e ene, he body bu den o fluo an hene
diminished significan ly compa ed o ale ins exposed o
fluo an hene alone o 7 days. Simila empo al pa e ns o
accumula ion we e obse ed among ale ins exposed o he
mix u e o e ene and fluo an hene, as epo ed in ou
p e ious s udies (E iksson e al. 2022a,b). Hence, he
educ ion in he body bu den o fluo an hene, when co-
exposed wi h e ene, eflec s a b oade and mo e po en
ac i a ion o phase I and II me abolic p ocesses, ei he
ansc ip omic (E iksson e al. 2022a)o p o eomic
(E iksson e al. 2022b), ha can o se he inhibi o y e ec
o fluo an hene upon Cyp1a.
Addi ionally, we we e able o iden i y and quan i y he
accumula ion o endogenously o med FICZ in ale ins
Fig. 1 Boxplo ep esen a ion o he exposu e specific body bu den
p ofiles, pe ale in, ollowing exposu e o e ene (a; pmol), fluo -
an hene (b; pmol) and endogenously o med FICZ (c; mol). Ale ins
we e sampled a e 1, 3 and 7 days o semi-s a ic exposu e o he PAHs
alone (da k-g ey-filled boxes) o as a bina y mix u e (whi e-filled
boxes). Significan di e ences in body bu den wi hin each ea men ,
as pe KW +Dunn, a e deno ed wi h uppe - (fluo an hene) and lowe -
case le e s (FICZ). Significan di e ences in body bu den be ween
la ae exposed o he mix u e and he componen s a e deno ed wi h *.
N pe ea men =3
Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins exposed o a. . .
exposed o he mix u e, bu no in ale ins exposed o fluo -
an hene o e ene alone (Fig. 1c). Howe e , i canno be uled
ou ha exposu e o e ene and fluo an hene alone inc eased
he a e o o ma ion. Ra he , i can only be s a ed ha
accumula ion o de ec able le els did no occu ollowing
exposu e o he indi idual PAHs. Endogenously o med and
accumula ed FICZ can ei he be de i ed enzyma ically om
yp amine o yp ophan, ollowing UV-i adia ion, o oxi-
da ion o yp ophan, as obse ed du ing inc eased oxida i e
s ess (Smi no a e al. 2016; Rannug and Rannug 2018).
UV-i adia ion can be ejec ed as causa i e agen due o he
a chi ec u e o he exposu e acili y (no windows), as he
oom was illumina ed by yellow flo escen ligh . Tha lea es
enzyma ic p ocesses and oxida i e s ess as he mos plau-
sible causes; he la e being mo e likely due he known and
es ablished ela ionship be ween PAH oxici y and subse-
quen ly inc eased oxida i e s ess (Timme-La agy e al.
2007;Songe al.2019), al e ed i on me abolism (Rigaud
e al. 2020b;E ikssone al.2022b) and ac i a ion o hea
shock p o eins (Räsänen e al. 2012) in PAH exposed fish
la ae. The body bu den o FICZ may also inc ease when
subsequen me abolism by Cyp1a is inhibi ed (Wincen e al.
2012,2016). In he p esen s udy, he body bu den o FICZ
peaked by Day 3 be o e dec easing significan ly by Day 7.
The dynamics o he body bu den o FICZ, o e ime, hus
sugges s a link be ween ac ual Cyp1a inhibi ion and sub-
sequen accumula ion o FICZ in ela ion o de elopmen ,
and plausibly influenced by he ma u a ion o he li e .
Howe e , Cyp1a inhibi ion by exposu e o fluo an hene
alone was no su ficien in causing accumula ion o FICZ.
The e o e, i can be pos ula ed ha al e a ions o mul iple
pa allel molecula p ocesses and e en s a e equi ed o FICZ
accumula ion in i o.
Accumula ion o PAHs and FICZ was eflec ed in he
exp ession o cyp1a ollowing 3 days o exposu e.
Exposu e o fluo an hene esul ed in a non-significan ly
inc eased exp ession ela i e o con ol, whe eas exposu e
o e ene inc eased he exp ession significan ly. By con-
as , exposu e o he mix u e esul ed in a significan ly
s onge exp ession, ela i e o he o he ea men s and as
a consequence, he measu ed exp ession was g ea e han
he p edic ed addi i e e ec exe ed by he componen s
(Table 4; combina ion index), esul s ha we e expec ed
as pe p e ious s udies (Billia d e al. 2008;E ikssone al.
2022a). As he expe imen was designed o de ec and
quan i y FICZ, i can only be assumed ha accumula ion
o endogenously de i ed FICZ influences he exp ession
o cyp1a. The unde lying p ocesses go e ning he ox-
icodynamic and kine ic p ocesses a e ye o be
de e mined.
Combined, hese findings highligh ha he oxici y
exe ed by his mix u e o PAHs could no ha e been p e-
dic ed om he addi i e e ec o he componen s in
de eloping ainbow ou ale ins, no could he obse ed
syne gized BSD index in ale ins exposed o he mix u e be
explained by he PAHs body bu den alone. As FICZ is
known o cause symp oms o BSD in fish (Wincen e al.
2016), i is plausible ha accumula ion o FICZ could
con ibu e o he syne gized BSD index among mix u e
exposed ale ins. This is a no el mechanism o PAH mix-
u e oxici y ha could, a leas , pa ly explain he syne gism
obse ed in o ganisms exposed o complex PAH mix u es
such as c ude oil (Billia d e al. 2008). Howe e , i is
unknown o wha ex en accumula ed FICZ con ibu es o
oxici y, no i accumula ion can occu in si u ollowing
en i onmen al con amina ion.
Conclusions
Accumula ion o endogenously de i ed FICZ is a no el dis-
co e y ha will impac how PAH mix u e oxici y is pe -
cei ed. Accumula ion o FICZ, which is a known AhR2
agonis ha has been obse ed o induce de elopmen al
oxici y in zeb afish la ae, is likely o ha e influenced and
agg a a ed de elopmen al oxici y, as pe he s ong BSD
indices. The unde lying p ocesses p omo ing accumula ion
a e, in his case, unknown. Hypo he ically, accumula ion can
be due o 1) dec eased a e o xenobio ic me abolism due o
inc eased subs a e compe i ion be ween he PAHs and FICZ
o phase I and II me abolic enzymes; 2) inc eased a e o
o ma ion; o 3) a combina ion o dec eased a e o phase I
and II me abolism alongside inc eased a e o o ma ion.
Addi ionally, i is unknown i o ma ion and accumula ion o
FICZ is issue specific, e enly dis ibu ed h oughou he
de eloping o ganisms o p oduced in specific issue(s)
bu dis ibu ed e enly. Mo eo e , i is unknown, al hough
plausible, ha exposu e o o he ypes o PAH mix u es
(simple and complex), o c ude oil, can esul in he accu-
mula ion o FICZ. The same is ue o species and li e s age
specifici y, which mus also be assessed. The e o e, mo e
esea ch on he na u e o FICZ, in ela ion o de elopmen al
Table 4 Whole-body cyp1a exp ession (%) ollowing 3 days o
exposu e o DMSO (con ol ea men ), fluo an hene (Flu), e ene
(Re ) and he bina y mix u e (Mix)
T ea men cyp1a exp ession (%;
ela i e con ol)
Backg ound adjus ed
cyp1a exp ession
N
DMSO 100 ± 53109
Flu 159 ± 6412 59 9
Re 436 ± 25323 336 7
Mix 2278 ± 148832178 ¤ 7
Significan di e ences a e deno ed by di e en numbe s (KW +
Dunn), while a s onge , backg ound adjus ed, cyp1a exp ession
among mix u e exposed ale ins is highligh ed by ¤ (as pe
combina ion index)
A. N. M. E iksson e al.
oxici y, oxicodynamics and kine ics a e equi ed o u he
he unde s anding o PAH oxici y in fish.
Acknowledgemen s We would like o acknowledge he con ibu ion
o labo a o y echnicians Me i Kois inen, Emma Pajunen, and he
labo a o y pe sonnel a Konne esi esea ch s a ion o echnical
suppo . We also like o hank Hanka-Taimen OY fish a m o
supplying us wi h ainbow ou ale ins o scien ific pu poses and
esea ch.
Funding Academy o Finland p ojec numbe : 285296, 294066 and
319284 g an ed o Ee a-Riikka Vehniäinen. Open Access unding
p o ided by Uni e si y o Jy äskylä (JYU).
Compliance wi h e hical s anda ds
Conflic o in e es The au ho s decla e no compe ing in e es s.
Publishe ’s no e Sp inge Na u e emains neu al wi h ega d o
ju isdic ional claims in published maps and ins i u ional a filia ions.
Open Access This a icle is licensed unde a C ea i e Commons
A ibu ion 4.0 In e na ional License, which pe mi s use, sha ing,
adap a ion, dis ibu ion and ep oduc ion in any medium o o ma , as
long as you gi e app op ia e c edi o he o iginal au ho (s) and he
sou ce, p o ide a link o he C ea i e Commons license, and indica e i
changes we e made. The images o o he hi d pa y ma e ial in his
a icle a e included in he a icle’s C ea i e Commons license, unless
indica ed o he wise in a c edi line o he ma e ial. I ma e ial is no
included in he a icle’s C ea i e Commons license and you in ended
use is no pe mi ed by s a u o y egula ion o exceeds he pe mi ed
use, you will need o ob ain pe mission di ec ly om he copy igh
holde . To iew a copy o his license, isi h p://c ea i ecommons.
o g/licenses/by/4.0/.
Re e ences
Ba on MG, Hein z R, Rice SD (2004) Rela i e po ency o PAHs and
he e ocycles as a yl hyd oca bon ecep o agonis s in fish. Ma
En i on Res 58:95–100. h ps://doi.o g/10.1016/j.ma en es.
2004.03.001
Benjamini Y, Hochbe g Y (1995) Con olling he alse disco e y a e:
a p ac ical and powe ul app oach o mul iple es ing. J R S a Soc
Se ies B (Me hodolog) 57:289–300
Billia d SM, Meye JN, Wassenbe g DM, Hodson PV, Di Giulio RT
(2008) Nonaddi i e e ec s o PAHs on ea ly e eb a e de el-
opmen : mechanisms and implica ions o isk assessmen . Tox-
icolog Sci O ficial J Soc Toxicol 105:5–23. h ps://doi.o g/10.
1093/ oxsci/k m303
Billia d SM, Que bach K, Hodson PV (1999) Toxici y o e ene o
ea ly li e s ages o wo eshwa e fish species. En i on Toxicol
Chem 18:2070–2077. h ps://doi.o g/10.1002/e c.5620180927
Billia d SM, Timme-La agy A, Wassenbe g DM, Cockman C, Di
Giulio RT (2006) The ole o he A yl Hyd oca bon ecep o
pa hway in media ing syne gis ic de elopmen al oxici y o
polycyclic a oma ic hyd oca bons o Zeb afish. Toxicolog Sci
92:526–536
B inkwo h LC, Hodson PV, Tabash S, Lee P (2003) CYP1A induc-
ion and blue sac disease in ea ly de elopmen al s ages o ain-
bow ou (Onco hynchus Mykiss) exposed o e ene. J Toxicol
En i on Heal h, Pa A 66:627–646. h ps://doi.o g/10.1080/
15287390309353771
Cla k B, Coope E, S aple on H, Di Giulio R (2013) Compound- and
mix u e-specific di e ences in esis ance o polycyclic a o-
ma ic hyd oca bons and PCB-126 among Fundulus he e o-
cli us subpopula ions h oughou he Elizabe h Ri e es ua y
(Vi ginia, USA). En i on Sci Technol 47. h ps://doi.o g/10.
1021/es401604b
Cola ecchia M, Hodson P, Pa o J (2006) CYP1A induc ion and
Blue Sac disease in ea ly li e s ages o whi e sucke s (Ca os-
omus comme soni) exposed o oil sands. J Toxicol En i on
Heal h Pa A 69:967–994. h ps://doi.o g/10.1080/
15287390500362154
Doe ing J, Hecke M, Villeneu e D, Zhang X (2019) Ad e se ou -
come pa hway on a yl hyd oca bon ecep o ac i a ion leading o
ea ly li e s age mo ali y, ia inc eased COX-2IS 12. h ps://doi.
o g/10.1787/bd46b538-en
dos San os IF, Fe ei a SLC, Domínguez C, Bayona JM (2018) Ana-
ly ical s a egies o de e mining he sou ces and eco oxicological
isk o PAHs in i e sedimen . Mic ochem J 137:90–97. h ps://
doi.o g/10.1016/j.mic oc.2017.09.025
E iksson ANM, Rigaud C, K asno A, Wincen E, Vehniäinen E-R
(2022a) Exposu e o e ene, fluo an hene, and hei bina y mix-
u e causes dis inc ansc ip omic and apical ou comes in ain-
bow ou (Onco hynchus mykiss) yolk sac ale ins. Aqua Toxicol
106083. h ps://doi.o g/10.1016/j.aqua ox.2022.106083
E iksson ANM, Rigaud C, Rokka A, Skaugen M, Liha ainen JH,
Vehniäinen E-R (2022b) Changes in ca diac p o eome and
me abolome ollowing exposu e o he PAHs e ene and
fluo an hene and hei mix u e in de eloping ainbow ou
ale ins. Sci To al En i on 830:154846. h ps://doi.o g/10.1016/
j.sci o en .2022.154846
Foucquie J, Guedj M (2015) Analysis o d ug combina ions: cu -
en me hodological landscape. Pha macol Res Pe spec
3:e00149–e00149. h ps://doi.o g/10.1002/p p2.149
Geie MC, James Minick D, T uong L, Til on S, Pande P, Ande son
KA, Teegua dan J, Tanguay RL (2018) Sys ema ic de elop-
men al neu o oxici y assessmen o a ep esen a i e PAH
Supe und mix u e using zeb afish. Toxicol Appl Pha macol
354:115–125. h ps://doi.o g/10.1016/j. aap.2018.03.029
Hein z RA, Rice SD, We heime AC, B adshaw RF, Th owe FP,
Joyce J, Sho J (2000) Delayed e ec s on g ow h and ma ine
su i al o pink salmon Onco hynchus go buscha a e exposu e
o c ude oil du ing emb yonic de elopmen . Ma ine Ecology-
p og ess Se ies. MAR ECOL-PROGR SER 208:205–216. h ps://
doi.o g/10.3354/meps208205
Hodson PV, Qu eshi K, Noble CAJ, Akh a P, B own RS (2007)
Inhibi ion o CYP1A enzymes by alpha-naph hofla one causes
bo h syne gism and an agonism o e ene oxici y o ainbow ou
(Onco hynchus mykiss). Aqua Toxicol 81:275–285. h ps://doi.
o g/10.1016/j.aqua ox.2006.12.012
Honkanen JO, Rees CB, Kukkonen JVK, Hodson PV (2020) Tem-
pe a u e de e mines he a e a which e ene a ec s ou emb yos,
no he concen a ion ha is oxic. Aqua Toxicol 222:105471.
h ps://doi.o g/10.1016/j.aqua ox.2020.105471
Inca dona JP (2017) Molecula mechanisms o c ude oil de elop-
men al oxici y in fish. A ch En i on Con am Toxicol 73:19–32.
h ps://doi.o g/10.1007/s00244-017-0381-1
Inca dona JP, Ca ls MG, Day HL, Sloan CA, Bol on JL, Collie TK,
Scholz NL (2009) Ca diac A hy hmia is he p ima y esponse o
Emb yonic Pacific He ing (Clupea pallasi) exposed o c ude oil
du ing wea he ing. En i on Sci Technol 43:201–207. h ps://doi.
o g/10.1021/es802270
Inca dona JP, Linbo TL, Scholz NL (2011) Ca diac oxici y o 5- ing
polycyclic a oma ic hyd oca bons is di e en ially dependen on
he a yl hyd oca bon ecep o 2 iso o m du ing zeb afish de el-
opmen . Toxicol Appl Pha macol 257:242–249. h ps://doi.o g/
10.1016/j. aap.2011.09.010
Endogenous AhR agonis FICZ accumula es in ainbow ou (Onco hynchus mykiss) ale ins exposed o a. . .
Maes J, Ve looy L, Buena e OE, de Wi e PAM, Esgue a CV,
C aw o d AD (2012) E alua ion o 14 o ganic sol en s and
ca ie s o sc eening applica ions in Zeb afish Emb yos and
La ae. PLOS ONE 7:e43850
Massa sky A, Bone AJ, Dong W, Hin on DE, P asad GL, Di Giulio
RT (2016) AHR2 mo pholino knockdown educes he oxici y
o o al pa icula e ma e o zeb afish emb yos. Toxicol Appl
Pha macol 309:63–76. h ps://doi.o g/10.1016/j. aap.2016.08.
024
OECD, 2013. Tes No. 236: Fish Emb yo Acu e Toxici y (FET) Tes .
h ps://doi.o g/10.1787/9789264203709-en
Rannug A, Rannug U (2018) The yp ophan de i a i e 6- o -
mylindolo[3,2-b]ca bazole, FICZ, a dynamic media o o endo-
genous a yl hyd oca bon ecep o signaling, balances cell g ow h
and di e en ia ion. C i Re Toxicol 48:555–574. h ps://doi.o g/
10.1080/10408444.2018.1493086
Räsänen K, A siola T, Oika i A (2012) Fas genomic bioma ke
esponses o e ene and py ene in li e o Ju enile Rainbow
T ou , Onco hynchus mykiss. Bull En i on Con am Toxicol
89:733–738. h ps://doi.o g/10.1007/s00128-012-0770-0
Rigaud C, E iksson A, K asno A, Wincen E, Pakkanen H, Leh i-
uo i H, Ihalainen J, Vehniäinen E-R (2020a) Re ene, py ene and
phenan h ene cause dis inc molecula -le el changes in he ca -
diac issue o ainbow ou (Onco hynchus mykiss) la ae, pa
1–T ansc ip omics. Sci To al En i on 745:141031. h ps://doi.
o g/10.1016/j.sci o en .2020.141031
Rigaud C, E iksson A, Rokka A, Skaugen M, Liha ainen J, Keinänen
M, Leh i uo i H, Vehniäinen E-R (2020b) Re ene, py ene and
phenan h ene cause dis inc molecula -le el changes in he ca diac
issue o ainbow ou (Onco hynchus mykiss) la ae, pa 2 –
P o eomics and me abolomics. Sci To al En i on 746:141161.
h ps://doi.o g/10.1016/j.sci o en .2020.141161
R Co e Team (2020) R: A language and en i onmen o s a is ical
compu ing. R Founda ion o S a is ical Compu ing, Vienna,
Aus ia. h ps://www.R-p ojec .o g/
RS udio Team (2020) RS udio: In eg a ed De elopmen o R. RS u-
dio, PBC, Bos on, MA. h p://www. s udio.com/
Sco JA, Hodson PV (2008) E idence o mul iple mechanisms o
oxici y in la al ainbow ou (Onco hynchus mykiss) co- ea ed
wi h e ene and α-naph hofla one. Aqua Toxicol 88:200–206.
h ps://doi.o g/10.1016/j.aqua ox.2008.04.007
Sco JA, Inca dona JP, Pelkki K, Shepa dson S, Hodson PV (2011)
AhR2-media ed, CYP1A-independen ca dio ascula oxici y
in zeb afish (Danio e io) emb yos exposed o e ene. Aqua
Toxicol 101:165–174. h ps://doi.o g/10.1016/j.aqua ox.2010.
09.016
Si ula L, Vehniäinen E-R, Vehniäinen E-R, Kukkonen JVK (2018)
Toxici y o biomining e fluen s o Daphnia magna: acu e oxici y
and ansc ip omic bioma ke s. Chemosphe e 210:304–311.
h ps://doi.o g/10.1016/j.chemosphe e.2018.07.030
Smi no a A, Wincen E, Viks öm Be gande L, Alsbe g T, Be gman J,
Rannug A, Rannug U (2016) E idence o new ligh -independen
pa hways o gene a ion o he endogenous A yl Hyd oca bon
ecep o agonis FICZ. Chem Res Toxicol 29:75–86. h ps://doi.o g/
10.1021/acs.chem es ox.5b00416
Song Y, Nah gang J, Tolle sen KE (2019) T ansc ip omic analysis
e eals dose-dependen modes o ac ion o benzo(a)py ene in
pola cod (Bo eogadus saida). Sci To al En i on 653:176–189.
h ps://doi.o g/10.1016/j.sci o en .2018.10.261
Timme-La agy A, Cockman CJ, Ma son CW, Di Giulio RT (2007)
Syne gis ic induc ion o AHR egula ed genes in de elopmen al
oxici y om co-exposu e o wo model PAHs in zeb afish.
Aqua Toxicol 85:241–250. h ps://doi.o g/10.1016/j.aqua ox.
2007.09.005
Tisso BP, Wel e DH (1978) Composi ion o C ude Oils, In: Tisso
BP, Wel e DH (Eds.), Pe oleum o ma ion and occu ence: a new
app oach o oil and gas explo a ion. Sp inge Be lin Heidelbe g,
Be lin, Heidelbe g, pp. 333–368. h ps://doi.o g/10.1007/978-3-
642-96446-6_19
Van Tiem LA, Di Giulio RT (2011) AHR2 knockdown p e en s
PAH-media ed ca diac oxici y and XRE- and ARE-associa ed
gene induc ion in zeb afish (Danio e io). Toxicol Appl
Pha macol 254:280–287. h ps://doi.o g/10.1016/j. aap.2011.
05.002
Vehniäinen E-R, B eme K, Sco JA, Jun ila S, Laiho A, Gyenesei A,
Hodson PV, Oika i AOJ (2016) Re ene causes mul i unc ional
ansc ip omic changes in he hea o ainbow ou (Onco -
hynchus mykiss) emb yos. En i on Toxicol Pha macol 41:95–102.
h ps://doi.o g/10.1016/j.e ap.2015.11.015
Wassenbe g D, Di Giulio R (2004) Syne gis ic emb yo oxici y o
polycyclic a oma ic hyd oca bon a yl hyd oca bon ecep o
agonis s wi h cy och ome P4501A inhibi o s in Fundulus he -
e ocli us. En i on Heal h Pe spec 112:1658–1664. h ps://doi.
o g/10.1289/ehp.7168
Wicks öm K, Tolonen K (1987) The his o y o ai bo ne polycyclic
a oma ic hyd oca bons (PAH) and pe ylene as eco ded in da ed
lake sedimen s. Wa e Ai Soil Pollu 32:155–175. h ps://doi.o g/
10.1007/BF00227691
Wille KL, Rande a h K, Zhou G-D, Sa e SH (1998) Inhibi ion o
CYP1A1-dependen ac i i y by he polynuclea a oma ic hyd o-
ca bon (PAH) fluo an hene. Biochem Pha macol 55:831–839.
h ps://doi.o g/10.1016/S0006-2952(97)00561-3
Wills LP, Zhu S, Wille KL, Di Giulio RT (2009) E ec o CYP1A
inhibi ion on he bio ans o ma ion o benzo[a]py ene in wo
popula ions o Fundulus he e ocli us wi h di e en exposu e
his o ies. Aqua Toxicol 92:195–201. h ps://doi.o g/10.1016/j.a
qua ox.2009.01.009
Wincen E, Amini N, Luecke S, Gla H, Be gman J, C escenzi C,
Rannug A, Rannug U (2009) The sugges ed physiologic
A yl hyd oca bon ecep o ac i a o and cy och ome
P4501 subs a e 6- o mylindolo[3,2-b]ca bazole is p esen in
humans. J Biol Chem 284:2690–2696. h ps://doi.o g/10.1074/
jbc.M808321200
Wincen E, Beng sson J, Ba dbo i AM, Alsbe g T, Luecke S, Ran-
nug U, Rannug A (2012) Inhibi ion o cy och ome P4501-
dependen clea ance o he endogenous agonis FICZ as a
mechanism o ac i a ion o he a yl hyd oca bon ecep o . P oc
Na l Acad Sci USA 109:4479. h ps://doi.o g/10.1073/pnas.
1118467109
Wincen E, Kubo a A, Timme-La agy A, Jönsson ME, Hahn ME,
S egeman JJ (2016) Biological e ec s o 6- o mylindolo[3,2-b]
ca bazole (FICZ) in i o a e enhanced by loss o CYP1A unc-
ion in an Ah 2-dependen manne . Biochem Pha macol
110–111:117–129. h ps://doi.o g/10.1016/j.bcp.2016.04.012
A. N. M. E iksson e al.