Expression Analysis of Platinum Sensitive and Resistant Epithelial Ovarian Cancer Patient Samples Reveals New Candidates for Targeted Therapies

Expression Analysis of Platinum Sensitive and Resistant Epithelial Ovarian Cancer Patient Samples Reveals New Candidates for Targeted Therapies 1 K Veskimäe *, 2 , M Scaravilli †,‡,2 , W Niininen †,‡ , H Karvonen †,‡ , S Jaatinen †,‡ , M Nykter †,‡ , T Visakorpi †,‡,§ , J Mäenpää *, ‡ , D Ungureanu †,‡ and S Staff *, † * Department of Obstetrics and Gynecology, Tampere University Hospital, Tampere, Finland; † BioMediTech Institute, University of Tampere, Tampere, Finland.; ‡ Faculty of Medicine and Life Sciences, University of Tampere, Tampere, Finland; § Fimlab Laboratories, Tampere University Hospital, Tampere, Finland Abstract Ovarian cancer has the highest mortality rate of all gynecologic malignancies. Identification of new biomarkers is highly needed due to its late diagnosis and high recurrence rate. The objective of this study was to identify mechanisms of therapy resistance and potential biomarkers by analyzing mRNA and protein expression from samples derived from patients with platinum-sensitive and -resistant ovarian cancer (total cohort n = 53). The data revealed new candidates for targeted therapies, such as GREB1 and ROR2. We showed that the development of platinum resistance correlated with upregulation of ROR2, whereas GREB1 was downregulated. Moreover, we demonstrated that high levels of ROR2 in platinum-resistant samples were associated with upregulation of Wnt5a, STAT3 and NF-kB levels, suggesting that a crosstalk between the non-canonical Wnt5a-ROR2 and STAT3/NF-kB signaling pathways. Upregulation of ROR2, Wnt5a, STAT3 and NF-kB was further detected in a platinum-resistant cell-line model. The results of the present study provided insight into molecular mechanisms associated with platinum resistance that could be further investigated to improve treatment strategies in this clinically challenging gynecological cancer. Translational Oncology (2018) 11, 1160–1170 Introduction Epithelial ovarian cancer (EOC) accounts for the majority of mortality from gynecological cancers, with diagnosis often at a late stage. Currently, the golden standard of treatment is primary debulking surgery (PDS) followed by platinum-based chemotherapy [1]. Although most patients initially respond to chemotherapy, cancer cells will eventually develop resistance leading to relapse [2]. Despite intensive efforts to improve targeted therapy in EOC, the five-year survival rate is still only 30% for advanced disease [3]. Therefore, increased knowledge about mechanisms of platinum resistance in EOC treatment is needed in search for cure. Genetically complex and unstable high-grade serous ovarian cancer subtype (HGSC), accounting for approximately 50–70% of EOC, represents the most aggressive histological subtype [4]. A large-scale integrated genomic data analysis for HGSC identified TP53 mutations in almost 96% of tumors. Recurrent somatic mutations were found in nine other genes including NF1, BRCA1, BRCA2, www.transonc.com Translational Oncology Volume 11 Number 5 October 2018 pp. 1160–1170 1160 Address all correspondence to: Kristina Veskimäe, Tampere University Hospital, Department of Obstetrics and Gynecology, PO Box 2000, 33521 Tampere, Finland. E-mail: [email protected] 1 Funding: This work was supported by Finnish Cancer Society (S02 Syöpäsäätiön käyttörahasto), Pirkanmaan Cancer Society (no specific grant number available), Academy of Finland (grant nr. 284663/275525), Ida Montini Foundation (no specific grant number available), the Doctoral Programme in Biomedicine and Biotechnology in University of Tampere (no specific grant number available) and Paulo Foundation, the Competitive Research Funding of Pirkanmaa Hospital District (no specific grant number available). 2 Equal contribution. Received 8 May 2018; Revised 9 July 2018; Accepted 10 July 2018 © 2018 Published by Elsevier Inc. on behalf of Neoplasia Press, Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 1936-5233/18 https://doi.org/10.1016/j.tranon.2018.07.010 RB1 and CDK12, as well as DNA copy number aberrations and promoter methylation events, indicating biological and molecular heterogeneity that should be considered when developing novel therapeutic strategies [5]. While only 10%–15% of ovarian cancer patients carry BRCA1 or BRCA2 mutations in their germline, ∼50% of ovarian cancers exhibit a defect in the homologous recombination (HR) repair of DNA [6]. PARP-1 enzyme became an attractive target for chemotherapeutics for its crucial function in single-strand breaks (SSBs) DNA repair mechanism through base excision repair (BER) pathway [7]. The concept of synthetic lethality has been used in genetic studies to determine functional interactions and compensation among genes for decades and has also been exploited in the development of PARP (Poly (ADP-ribose) polymerase) inhibitors [8]. The responsiveness to platinum and PARP inhibitors associates with so called BRCAness profile showing independent prognostic value [9,10]. The chemotherapy resistance can arise due to multiple mechanisms, such as drug target alteration, re-activation or amplification of the oncogenic pathway, activation of parallel pathways, increased DNA damage tolerance/repair, and deregulation of growth factor receptors among others [11]. Deregulation of apoptosis and altered phosphorylation (intracellular signaling), as well as metabolic pathways represent the two main biological processes responsible for oncogene-mediated drug resistance in ovarian cancer [12]. In this context, activation of PI3K/AKT cell survival pathway plays a pivotal role with NF-kB and STAT3 as the main mediations of these intracellular events. On the other hand, tumor suppressor genes such as BRCA1, BRCA2, MLH1 and p21 contribute to ovarian cancer drug resistance via alterations in the DNA damage and repair mechanisms, whereas RASSF1, TP53 and TP73 impair the apoptotic machinery for the same outcome [13]. Epithelial-to-mesenchymal transition (EMT) has also been implicated in HGSC invasiveness and chemoresistance, and in vitro studies using ovarian cancer cell lines have shown that more aggressive, mesenchymal-type cells are more resistant to cisplatin treatment [14]. An important signaling cascade involved in EMT is the Wnt signaling, with increasing evidence suggesting that β-catenin-independent pathway via Wnt5a/ROR1/ ROR2 has a critical role in EMT and chemoresistance [15–18]. Consequently, therapies targeting these pathways may offer means to overcome drug resistance. Active and also productive research in the field of cancer therapy has led to an improved understanding of the molecular mechanisms, providing insight into the development of cancer. This new data has led to the development of new treatment options for cancer patients, including targeted therapies and associated biomarker tests that can select which patients are most likely to respond [19]. The aim of this study was to identify candidate genes and their molecular pathways involved in the pathogenesis of ovarian cancer associating with platinum resistance. Overcoming the paucity of obtaining large collection of tumor samples available for molecular profiling, we investigated differences in mRNA and protein expression between ovarian cancer samples derived from two clinically and molecularly distinct patient cohorts namely high PARP/ platinum-sensitive and low PARP/platinum-resistant HGSC cohorts. This comparison aimed at distinction of two cohorts with extremely different clinical behavior. Finally, this analysis led to identification of GREB1 and ROR2 that showed significant differential expression profile between the two groups. Our data suggest new predictive biomarkers for ovarian cancer drug resistance development warranting further investigations. Materials and Methods Study Cohort and Tissue Samples The study was carried out at the University of Tampere and Tampere University Hospital (TAUH), Tampere, Finland. The study protocol was approved by the Ethics Committee of TAUH (identification code ETL-R11137). The microarray study cohort consisted of 12 HGSC patients who participated in a prospective study addressing PARP enzyme activity in fresh ovarian cancer tumor samples [20]. The selection of this patient subcohort was based on PARP values (high PARP/low PARP, cut off 203 pg/ml, which corresponded to the median value of PARP) and platinum sensitivity/resistance (treatment response), with no differences in respect of age and FIGO (International Federation of Gynecology). Platinum sensitivity was defined as no recurrence within 12 months after the completion of first-line platinum-based chemotherapy. Patient characteristics are presented in Table 1. The validation cohort of the microarray data consisted of all the patients (n = 53) that participated in the previous prospective study [20]. The median follow-up time of patients was 31 months. The validation cohort is described in Table 2. For further investigation of ROR2 in EOC, a retrospective subcohort was chosen from the study cohorts described above consisting of a subgroup of patients who had not received NACT (neoadjuvant chemotherapy) and were divided in two categories based on treatment response, i.e. either platinum-sensitive or platinum-resistant (Table 3). The tumor tissue samples were collected at surgery, two samples approximately 0.5 cm were chosen at the operation room from macroscopically visible tumor and were snap-frozen with liquid nitrogen and stored in −70 °C. The findings from the corresponding archival surgical tumor specimens were assessed by experienced pathologists as part of routine diagnostics at the Department of Pathology at TAUH. Table 1. Characteristics of the Study Patients in the Microarray Cohort (n = 12) Characteristic Platinum Sensitive * n (%) Platinum Resistant * n (%) All 6 6 PDS † 52 NACT ‡ 14 PARP § low 0 6 PARP § high 6 0 Age mean (SD) 65 62 median (range) 63 (46–78) 62 (55–79) Grade 3 ¶ 6 (100%) 6 (100%) Stage # FIGO st I 0 0 FIGO st II 0 0 FIGO st III and IV 6 6 Histology serous 6 (100%) 6 (100%) PFS ** (months) 28 3.5 * Sensitivity defined as relapse or event-free intervalN12 months after completion of platinum based 1st line therapy. † PDS - primary debulking surgery. ‡ NACT - neoadjuvant therapy. § PARP - PARP activity in fresh frozen tumor tissue was assessed by an enzymatic chemiluminescense assay in a previous study [20]; the cut-off level for high PARP activity was set to 203 pg/ml corresponding to median value. ¶ Grade –Grade 3 represents high grade tumors. # FIGO - International Federation of Gynecology. ** PFS - progression free survival. Translational Oncology Vol. 11, No. xx, 2018 Expression Analysis in Platinum Resistant Ovarian Cancer Veskimäe et al. 1161 mRNA Microarray Total RNA from ovarian cancer fresh frozen samples was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's protocol. The quality and integrity of the RNA was assessed using Fragment Analyzer parallel capillary electrophoresis (Advanced Analytical Technologies, Ankeny, IA, USA). The RNA was subsequently labeled and hybridized using the Agilent gene expression microarray kit (Agilent Technologies, Santa Clara, CA, USA), according to the manufacturer's instruction. Briefly, the RNA from the clinical samples was labeled with Cy3 fluorochrome and subsequently co-hybridized with Cy5 labeled Xpress Ref TM Human Universal Reference Total RNA (SuperArray Bio-science Corporation) as a control. The hybridization was carried out for 21 hours on Agilent 4X44K human gene expression array slides. The slides were subsequently scanned on an Agilent C scanner and raw data were extracted using the Agilent Feature Extraction software ver. 11.0.1.1 and quantile normalized. A fold-change cutoff of 2 was used to determine differential mRNA expression as well as q-value and signal intensity. qRT-PCR Putatively differentially expressed genes (ROR2, CAST, ATP6V1D, GUCY1A3, TMOD1, MYCN, DLK1, PLEKHG4B, GREB1, B4GALNT4, SLC35F3, PTCH2, TNNC1, BNC1) were selected from the array results based on fold change, q-value, signal intensity and literature data and were validated by quantitative real-time polymerase chain reaction (qRT-PCR). Total RNA from ovarian cancer fresh frozen tumor samples were extracted with TRIzol as described above and were reverse transcribed using random hexamere primers and MultiScribe reverse transcriptase (Thermo Fischer Scientific, Waltham, MA, USA). Quantitative Real Time PCR was performed using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fischer Scientific) on a BioRad CFX96 ™Real-Time PCR Detection System (BioRad Laboratories, Hercules, CA, USA). Each sample was run in duplicate and expression values were normalized against the TATA-binding protein (TBP). The primer sequences for the two validated genes are as follows: Western blotting Frozen tumor pieces were thawed, washed 2X with cold PBS and pestered to lyse in lysis buffer (50 mM Tris–HCl pH 7.5, 10% glycerol, 150 mM NaCl, 1 mM EDTA, 1% Triton-x-100, 50 mM NaF) supplemented with protease and phosphatase inhibitor cocktails (Bimake, Houston, TX, USA). Lysates were mixed with 4X Laemmli loading buffer and subjected to SDS-PAGE gel electrophoresis and Western blotting. The primary antibodies used were as following: pAkt S473 (#4060), pMEK1/2 S217/221 (#9121), NF-κB p65 (#6956), pPI3K p85 Y458/p55 Y199 (#4228), PI3K p85α(#13666), Rac-1 (#4651), pSTAT3 Y705 (#9145), STAT3 (#9139), Wnt5a/b (#2530) (Cell Signaling Technology, Danvers, MA, USA); Akt (#sc-5298), Bcl-2 (#sc-7382), MEK1/2 (#sc-6250), β-tubulin (#sc-166,729) (Santa Cruz, Dallas,TX,USA);ROR16D4(Dr.Riddellab,ref.Balakrishanaetal. 2016); ROR2 (#565550, BD Biosciences, San Jose, CA, USA). Secondary antibodies: IRDye® 800CW Donkey anti-Mouse IgG, or IRDye® 680RD Donkey anti-Rabbit IgG (LI-COR, Lincoln, NE, USA). Blots were scanned and quantified using Odyssey CLx and Image Studio Table 2. Characteristics of the Study Patients in the Validation Cohort (n = 53) Characteristic Patients in study, n 53 Age at surgery, yrs. (SD) 66 (9.3) BMI, mean (SD) 26.8 (6.2) Median follow-up, months (range) 31 (2–50) Ca 125 level (kU/L) before treatment, median (range) 523 (30–4728) FIGO * Stage, n (%) Stage 1 2 (3,7%) Stage 2 3 (5,6%) Stage 3 34 (64,3%) Stage 4 14 (26,4%) Histology, n (%) Serous 46 (86,8) Endometroid 4 (7,6%) Papillar 2 (3,7%) Mucinous 0 (0%) Carcinosarcoma 0 (0%) Transitional cell 1 (1,9%) Grade † , n (%) Grade 1 and 2 10 (18%) Grade 3 43 (82%) Sensitivity to platinum therapy ‡ , n (%) Sensitive 25 (47,2%) Resistant 15 (28,3%) Partial sensitive 13 (24,5%) Neoadjuvant therapy, n (%) 19 (36%) Recurrence 36 (68%) Death 22 (42%) * FIGO = International Federation of Gynecology. † Grade –Grade 3 represents high grade tumors, Grade 1 and 2 low grade tumors. ‡ Sensitive: Recurrence N12 months after completion of platinum-based 1st line therapy; Resistant: Recurrence ≤6 months after completion of platinum-based 1st line therapy; Partially sensitive: Recurrence 6– 12 months after completion of platinum-based 1st line therapy. Table 3. Characteristics of the study patients in the ROR investigation subcohort (n = 30) Characteristic Patients in study, n 30 Age at surgery, yrs mean (SD) 66 (9.3) Median follow-up, months (range) 31 (2–50) FIGO * Stage, n (%) Stage 1 2 (6,7%) Stage 2 4 (14%) Stage 3 17 (56%) Stage 4 7(23,3%) Histology, n (%) Serous 22(73,3%) Endometroid 2 (6,7%) Papillar 2 (6,7%) Mucinous 2 (6,7%) Carcinosarcoma 1 (3,3%) Transitional cell 1 (3,3%) Grade † , n (%) Grade 1 and 2 8 (26,7%) Grade 3 22 (73,3%) Response to platinum therapy ‡ , n (%) Sensitive 20 (66,7%) Resistant 10 (33,3%) Recurrence 20 (66,7%) Death 9 (30%) * FIGO = International Federation of Gynecology. † Grade –Grade 3 represents high grade tumors, Grade 1 and 2 low grade tumors. ‡ Sensitivity defined as relapse or event-free follow up timeN12 months after completion of platinum based 1st line therapy. GREB1 fw 5’ATGGGAAATTCTTACGCTGGAC GREB1 rev 5’CACTCGGCTACCACCTTCT ROR2 fw 5’GTGCGGTGGCTAAAGAATGAT ROR2 rev 5’ATTCGCAGTCGTGAACCATATT TBP fw 5’GAATATAATCCCAAGCGGTTTG TBP rev 5’ACTTCACATCACAGCTCCCC 1162 Expression Analysis in Platinum Resistant Ovarian Cancer Veskimäe et al. Translational Oncology Vol. 11, No. xx, 2018 software (LI-COR). Protein quantification was normalized to β-tubulin expression level for each sample. Cell Culture A2780 and A2780cis cells were purchased from Merck & Company Inc. (Kenilworth, NJ, USA) and cultured according to manufacturer's recommendations. The A2780 line was maintained in medium containing 1 μM cisplatin (Selleckchem, Munich, Germany). The cisplatinEC50responseofA2780and A2780cis cells was validated by incubating cells with increasing concentration of cisplatin for 3 days and cell viability was determined using CellTiterGlo (CTG) Assay (Promega, USA) according to manufacturer's instructions. qRT-PCR of the Ovarian Cancer Cell Lines RNA was collected from A2780 and A2780cis using TRI Reagent® (Molecular Research Center Inc. Cincinnati, OH, USA) according to the manufacturer's protocol. qRT-PCR was performed as described for the ovarian cancer clinical samples. Each cell line was run in 4 replicates and the expression of ROR2 and GREB1 was normalized against TBP. Statistical Analysis The statistical analysis of mRNA microarray data was implemented in R using packages limma and preprocessCore of Bioconductor project [21–23]. Data was quantile normalized and probe sets were summarized by choosing the probes with the highest average expression [22]. Using limma approach, differential expression was identified between patients who had low PARP value and were platinum resistant, and patients who had high PARP value and were platinum sensitive [23]. P-values were obtained by the empirical Bayes moderated t-test. A fold-change cutoff of 2 was used to determine differential mRNA expression. The results were Table 4. The 50 Most Upregulated mRNAs in High PARP and Platinum Sensitive OC Patient Samples in Comparison to low PARP and Platinum Resistant Samples. Gene name Gene description log2-fold change p-value q-value COLEC11 collectin subfamily member 11 3.68E+ 00 1.29E-02 0.2588936 MYCN MYCN proto-oncogene. bHLH transcription factor 3.61E+ 00 2.74E-04 0.1050305 ESM1 endothelial cell specific molecule 1 3.18E+ 00 1.64E-04 0.1028588 IGF1R insulin like growth factor 1 receptor 3.08E+ 00 5.29E-03 0.211962 TNNC1 troponin C1. slow skeletal and cardiac type 3.04E+ 00 1.25E-05 0.0472319 LGSN lengsin. Lens protein with glutamine synthetase domain 3.02E+ 00 1.25E-02 0.2588936 LOC100134423 uncharacterized LOC100134423 2.97E+ 00 2.71E-04 0.1050305 DLK1 delta like non-canonical Notch ligand 1 2.89E+ 00 4.17E-03 0.2013983 CRYGC crystallin gamma C 2.86E+ 00 2.37E-03 0.1822358 A_33_P3286709 NA 2.82E+ 00 9.15E-05 0.0864965 PLEKHG4B pleckstrin homology and RhoGEF domain containing G4B 2.82E+ 00 1.17E-03 0.1525447 TSPAN8 tetraspanin 8 2.78E+ 00 2.99E-02 0.3064189 ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6 2.73E+ 00 1.20E-02 0.2563874 FLJ30901 uncharacterized protein FLJ30901 2.60E+ 00 3.26E-04 0.1050305 PROM1 prominin 1 2.59E+ 00 3.02E-02 0.3079072 COL22A1 collagen type XXII alpha 1 chain 2.58E+ 00 2.64E-03 0.1844765 KIAA1324 KIAA1324 2.58E+ 00 5.48E-04 0.1261184 PTCH2 patched 2 2.57E+ 00 1.93E-05 0.0472319 SLC35F3 solute carrier family 35 member F3 2.54E+ 00 3.87E-05 0.0596903 GABRG3 gamma-aminobutyric acid type A receptor gamma3 subunit 2.51E+ 00 4.50E-05 0.0628517 LOC613266 uncharacterized LOC613266 2.50E+ 00 4.89E-02 0.3485897 LCE1E late cornified envelope 1E 2.49E+ 00 2.28E-04 0.1050305 B4GALNT4 beta-1.4-N-acetyl-galactosaminyltransferase 4 2.49E+ 00 1.24E-05 0.0472319 STC2 stanniocalcin 2 2.48E+ 00 2.86E-04 0.1050305 FOXL2NB FOXL2 neighbor 2.48E+ 00 1.04E-01 0.4447586 AK124496 NA 2.47E+ 00 2.78E-02 0.3020977 CU677518 NA 2.47E+ 00 2.82E-06 0.0275612 NM_130777 NA 2.45E+ 00 1.10E-02 0.2525629 NR_102701 NA 2.43E+ 00 2.11E-03 0.1762016 NSG1 neuronal vesicle trafficking associated 1 2.43E+ 00 1.05E-03 0.1525447 STAR steroidogenic acute regulatory protein 2.41E+ 00 5.08E-03 0.2110634 MCTS2P malignant T-cell amplified sequence 2. pseudogene 2.40E+ 00 5.43E-03 0.2134259 TRABD2A TraB domain containing 2A 2.36E+ 00 4.89E-03 0.2078187 DEPTOR DEP domain containing MTOR interacting protein 2.35E+ 00 4.70E-04 0.125416 CLEC4GP1 C-type lectin domain family 4 member G pseudogene 1 2.35E+ 00 4.56E-03 0.2021535 LINC01405 long intergenic non-protein coding RNA 1405 2.33E+ 00 6.95E-04 0.1391319 COL2A1 collagen type II alpha 1 chain 2.32E+ 00 1.82E-02 0.2816697 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 2.31E+ 00 2.15E-02 0.2871745 PRAME preferentially expressed antigen in melanoma 2.30E+ 00 4.32E-05 0.0628517 LINC02398 long intergenic non-protein coding RNA 2398 2.29E+ 00 1.08E-05 0.0472319 GJB7 gap junction protein beta 7 2.29E+ 00 3.18E-02 0.3122712 PLCXD3 phosphatidylinositol specific phospholipase C X domain containing 3 2.28E+ 00 6.03E-02 0.3707384 ERVI-1 endogenous retrovirus group I member 1 2.27E+ 00 1.28E-02 0.2588936 ZNF556 zinc finger protein 556 2.27E+ 00 1.46E-06 0.0213888 NTS neurotensin 2.26E+ 00 6.56E-02 0.3828556 BU963192 NA 2.25E+ 00 7.17E-05 0.0751488 GMNC geminin coiled-coil domain containing 2.24E+ 00 1.52E-02 0.2689731 A_33_P3274001 NA 2.24E+ 00 9.36E-05 0.0864965 CRYGD crystallin gamma D 2.24E+ 00 2.58E-02 0.2964626 GREB1 growth regulation by estrogen in breast cancer 1 2.22E+ 00 1.22E-03 0.1542519 mRNAs selected for further validation are shown in bold. Translational Oncology Vol. 11, No. xx, 2018 Expression Analysis in Platinum Resistant Ovarian Cancer Veskimäe et al. 1163 interpreted by principal component analysis [24] and hierarchical clustering. qRT-PCR data were analyzed using the Student's t-test and Mann–Whitney U test where appropriate. The Kaplan–Meier regression analyses were used to estimate the survival rates from the date of surgery (primary debulked patients) or from the date of the first dose of neoadjuvant therapy until the date of the event of interest. For progression-free survival (PFS), the event of interest was a recurrence or death, whichever occurred first. Patients alive at the last follow-up without a recurrence were censored at the last follow-up date. Statistical analysis was performed using GraphPad Prism 6 software for Windows (GraphPad Software Inc., La Jolla, CA, USA). A p-value less than 0.05 was considered significant. Oncomine (https://www.oncomine.org/resource/login.html) and Kaplan–Meier plotter (http://kmplot.com/analysis/index.php?p= service&cancer=ovar) databases were searched for gene expression and survival data. Results Microarray Analysis of HGSC Patient Samples In order to identify differentially expressed genes between ovarian cancer samples with platinum-sensitivity with high PARP levels and samples with platinum resistance with low PARP levels (n = 12), gene expression microarray was performed on total RNA isolated from the freshly frozen tumor samples. The analysis of gene expression showed a total of 3001 differentially expressed genes between the two comparison groups when a log fold change cutoff 2 was implemented. In this comparison, 1463 genes were downregulated and 1538 genes were upregulated. 50 most upregulated and 50 Table 5. The 50 Most Downregulated mRNAs in High PARP and Platinum Sensitive OC Patient Samples in Comparison to Low PARP and Platinum Resistant Samples Gene Name Gene Description Log2-Fold Change p-Value q-Value EFEMP1 EGF containing fibulin extracellular matrix protein 1 −3.85E+ 00 1.50E-03 0.1587368 FAP fibroblast activation protein alpha −3.66E+ 00 9.07E-04 0.1525447 TMOD1 tropomodulin 1 −3.41E+ 00 2.92E-08 0.0008577 BNC1 basonuclin 1 −3.36E+ 00 2.74E-04 0.1050305 ENST00000453673 NA −3.22E+ 00 2.22E-02 0.2877726 ENST00000411475 NA −3.18E+ 00 2.30E-02 0.2898232 SCRG1 stimulator of chondrogenesis 1 −3.18E+ 00 1.64E-03 0.1627023 PTGFR prostaglandin F receptor −3.04E+ 00 1.05E-03 0.1525447 POSTN periostin −3.01E+ 00 1.10E-02 0.2525629 ENST00000390237 NA −2.97E+ 00 1.54E-02 0.2695379 BF175071 NA −2.92E+ 00 5.12E-02 0.3538495 GUCY1A3 guanylate cyclase 1 soluble subunit alpha −2.89E+ 00 5.68E-05 0.0723946 ENST00000390628 NA −2.87E+ 00 4.44E-03 0.2021325 CXCL13 C-X-C motif chemokine ligand 13 −2.87E+ 00 1.02E-02 0.2487313 ACKR4 atypical chemokine receptor 4 −2.86E+ 00 9.73E-05 0.0864965 IGLL5 immunoglobulin lambda like polypeptide 5 −2.86E+ 00 3.46E-02 0.318167 AREG amphiregulin −2.83E+ 00 1.43E-02 0.2670241 A_33_P3251412 NA −2.81E+ 00 1.46E-02 0.2682963 FYB1 FYN binding protein 1 −2.79E+ 00 2.51E-03 0.1843078 CD38 CD38 molecule −2.78E+ 00 1.54E-03 0.1587368 ENST00000468879 NA −2.77E+ 00 4.36E-02 0.3380632 ENST00000390252 NA −2.73E+ 00 1.49E-02 0.2682963 JCHAIN joining chain of multimeric IgA and IgM −2.70E+ 00 6.61E-03 0.2195342 ENST00000390547 NA −2.69E+ 00 5.85E-03 0.2163421 MEDAG mesenteric estrogen dependent adipogenesis −2.69E+ 00 4.49E-02 0.3403785 CNR1 cannabinoid receptor 1 −2.68E+ 00 9.85E-03 0.2471112 PRRX1 paired related homeobox 1 −2.68E+ 00 7.45E-04 0.1427284 NR4A3 nuclear receptor subfamily 4 group A member 3 −2.67E+ 00 2.00E-02 0.2850432 CH25H cholesterol 25-hydroxylase −2.65E+ 00 2.21E-03 0.1762175 AB363267 NA −2.65E+ 00 4.23E-02 0.3347815 ENST00000426099 NA −2.63E+ 00 4.11E-02 0.331398 CCL18 C-C motif chemokine ligand 18 −2.57E+ 00 1.16E-04 0.0898927 THBS2 thrombospondin 2 −2.57E+ 00 3.91E-02 0.327707 ENST00000410078 NA −2.56E+ 00 5.30E-02 0.3580372 BCHE butyrylcholinesterase −2.55E+ 00 1.00E-02 0.2471753 ATP6V1D ATPase H+ transporting V1 subunit D −2.55E+ 00 1.54E-04 0.1028588 ENST00000390323 NA −2.55E+ 00 2.42E-02 0.2937808 CCR2 C-C motif chemokine receptor 2 −2.54E+ 00 9.37E-03 0.24523 ENST00000479981 NA −2.54E+ 00 9.43E-03 0.24523 CAST calpastatin −2.54E+ 00 1.02E-03 0.1525447 ASPN asporin −2.52E+ 00 2.94E-02 0.3049408 HBB hemoglobin subunit beta −2.52E+ 00 2.08E-02 0.2862875 ENST00000390247 NA −2.51E+ 00 2.16E-02 0.2871745 SULF1 sulfatase 1 −2.50E+ 00 1.80E-02 0.2805948 EPYC epiphycan −2.49E+ 00 1.28E-02 0.2588936 FGFBP1 fibroblast growth factor binding protein 1 −2.49E+ 00 1.03E-02 0.2499163 LRRC15 leucine rich repeat containing 15 −2.48E+ 00 4.14E-02 0.3321649 DOCK11 dedicator of cytokinesis 11 −2.45E+ 00 5.13E-04 0.1261184 OOEP oocyte expressed protein −2.45E+ 00 4.23E-03 0.2013983 ROR2 receptor tyrosine kinase like orphan receptor 2 −1.84E+ 00 2.83E-05 0.0506967 mRNAs selected for further validation are shown in bold. 1164 Expression Analysis in Platinum Resistant Ovarian Cancer Veskimäe et al. Translational Oncology Vol. 11, No. xx, 2018 most downregulated genes are summarized in Tables 4 and 5, respectively. The comparison of patient groups according to PARP levels and treatment responses are shown in Figure 1, a-b. GREB1 and ROR2 are Significantly Differentially Expressed in Ovarian Cancer Tumor Samples Based on Platinum Sensitivity and PARP Levels Fourteen differentially expressed mRNAs (namely: ROR2, CAST, ATP6V1D, GUCY1A3, TMOD1, MYCN, DLK1, PLEKHG4B, GREB1, B4GALNT4, SLC35F3, PTCH2, TNNC1, BNC1) from the microarray analysis were selected for validation by qRT-PCR in the cohort of 53 ovarian cancer patients, based on fold change, q-value, signal intensity and previous literature (Table 2). Two genes, namely ROR2 and GREB1, were significantly differentially expressed in high PARP/platinum-sensitive vs. low PARP/platinum-resistant groups (P= .02 and 0.002, respectively) (Figure 2,a-b).ROR2 was downregulated in microarray data in high PARP/platinum-sensitive tumor samples and the same result was obtained by qRT-PCR analysis in the validation cohort (n = 53). A trend towards statistically significant difference between the platinum sensitive and resistant groups regardless of PARP levels was observed (P= .058) (Figure 2a). The comparisons described above were based on treatment response as a significant clinical feature and issue of interest. In addition, previously determined PARP levels were taken into account to further investigate tumors from the BRCAness profile point of view. The platinum sensitive and high PARP level cohort is considered a group of better prognosis befitting with the BRCAness profile, whereas the platinum resistant and low PARP level a group with poorer prognosis. On the other hand, GREB1 was upregulated in microarray data in high PARP/platinum-sensitive tumor samples, and this result was validated by qRT-PCR (Figure 2b). Furthermore, GREB1 also showed a trend of overexpression in platinum sensitive samples, regardless of PARP level (P= .26). GREB1 Expression Defines Platinum Sensitivity and Correlates with Longer PFS in Ovarian Cancer Furthermore, we investigated whether GREB1 expression affects PFS in ovarian cancer patients (n = 53). High GREB1 expression was significantly associated with longer PFS as shown in Figure 2c(P= .019 in log-rank test). In Kaplan–Meier database search, which included 1465 ovarian cancer patients, a similar result was shown associating high GREB1 expression with better PFS (P= 0,014 in log-rank test), as shown in Figure 2d. In addition to Kaplan–Meier plotter database and Oncomine (website links are reported in statistical analysis section) were searched for the ROR2 and GREB1 genes. No similar results in expression correlation were found, however, no similar study settings were found (HGSC, treatment response comparison). High ROR2 Expression in LowPARP/Platinum Resistant Ovarian Cancer Samples Correlated with Higher Wnt5a, STAT3 and NF-kB levels Previous data have shown no association with ROR2 expression and relapse-free survival [25] in ovarian cancer. However, ROR2 and ROR1 expression is increased in cisplatin resistant A2780 cell line compared to parental cells ([18]), and silencing their ligand Wnt5a in serous adenocarcinoma OVCAR3 cell line had greater effect in inhibiting cell migration and invasion than silencing either ROR alone [25]. Since ROR2 was significantly upregulated in low PARP/ platinum-resistant patient samples in our microarray data, we decided Figure 1. a. Scatterplot showing location of samples of high PARP and platinum sensitive and low PARP and platinum resistant in patients along the first two principal components (PC1 and PC2). Platinum sensitive and high PARP level samples are represented by black and low PARP and platinum resistant samples by purple dots.b. Unsupervised clustering of the clinical samples shows differential expression patterns in patients with high PARP levels and platinum sensitivity compared to patients with low PARP levels and platinum resistant. Translational Oncology Vol. 11, No. xx, 2018 Expression Analysis in Platinum Resistant Ovarian Cancer Veskimäe et al. 1165 to investigate the expression levels of Wnt5a, ROR1 and ROR2 proteins by Western blot in a subcohort of samples described in Table 3. As shown in Figure 3a-b, higher expression levels of Wnt5a, ROR1 and ROR2 proteins were found in low PARP/ platinum-resistant group compared to high PARP/ platinum-sensitive group. Moreover, upregulation of downstream signaling mediators such as pSTAT3 (Y705) and NF-kB was also observed in tumor lysates from low PARP/platinum resistant group. Noteworthy, patient samples with high levels of ROR1 and ROR2 from low PARP/platinum-resistant group showed higher pSTAT3 (Y705) levels (Figure 3a), indicating that STAT3 could mediate signaling downstream ROR1 and ROR2. Database search (Oncomine, Kaplan–Meier plotter; website links are reported in statistical analysis section) revealed no additional information regarding ROR in therapy response and ovarian cancer setting. ROR2 and GREB1 Show Differential Expression in Cisplatin Resistant Ovarian Cancer Cell Line Model The human epithelial ovarian cancer cell line A2780 and its cisplatin resistant model A2780cis were selected to investigate the expression levels of ROR2 and GREB1. We confirmed the chemoresistant phenotype of A2780cis cells compared to A2780 parental cells by CTG assay and found significant increase of EC50 to cisplatin treatment for A2780cis cells (Figure 4a). The expression of Figure 2. a. Expression of ROR2 and GREB1 in platinum sensitive (n = 38) vs resistant (n = 15) samples as well as high PARP level and platinum sensitive (n = 17) vs low PARP level and platinum resistant (n = 14) samples according to qRT-PCR (P= .02 and 0.002 respectively). The graphs show mean ± SEM.b. Kaplan–Meier analysis of progression free survival (PFS) according to median level of GREB 1 concentration (log rank P= .019). Vertical lines represent censored patients.c. Kaplan–Meier analysis of progression free survival (PFS) according to median level of GREB 1 concentration (log-rank P= .014) from Kaplan–Meier plotter database. 1166 Expression Analysis in Platinum Resistant Ovarian Cancer Veskimäe et al. Translational Oncology Vol. 11, No. xx, 2018 both ROR2 and GREB1 mRNA level was investigated in A2780 and A2780cis cells (Figure 4b and c). We observed ROR2 mRNA upregulation in platinum resistant cell line A2780cis compared to platinum sensitive A2780 cells (P= .0046), as previously shown ([18]), whereas GREB1 mRNA level was downregulated in A2780cis compared to A2780 parental cells (P= .0012). Furthermore, A2780cis cells have increased protein expression levels of ROR2 and Wnt5a compared with the parental A2780 cells as shown by Western blotting of cytoplasmic cell lysates (Figure 4d). In addition, we detected higher nuclear expression levels for STAT3 and NF-kB in chemoresistant A2780cis compared to parental A2780 cells (Figure 4d). Thus, our microarray data from patient samples are validated in chemoresistant ovarian cancer cell line and investigations are ongoing to decipher the molecular mechanisms employed by ROR2 and GREB1 for their differential expression associated with cisplatin resistance. Discussion Due to its poor prognosis, identification of new therapeutic approaches is highly needed in ovarian cancer. Although approximately 50% of HGSC tumors with HR defects may benefit from PARP inhibitors, beyond this, identification of other commonly deregulated pathways could provide opportunities for better therapeutic interventions. As such, our goal was to examine gene and protein expression in a HGSC tumor sample cohort defined by response to platinum therapy and the level of PARP expression. Patients were carefully stratified based on their PARP levels and platinum responsiveness as previously indicated [20] and monitored NF-kB p65 Wnt5a/b -tubulin ROR2 WB ROR1 WB pAKT pMEK1/2 MEK1/2 AKT pSTAT3 (Y705) STAT3 Bcl-2 Rac1 pPI3K PI3K low PARP/platinum resistant high PARP/platinum sensitive Wnt5a NFB ROR2 STAT3 0.0 0.2 0.4 0.6 0.8 1.0 1.2 low PARP/platinum resistant high PARP/platinum sensitive Relative expression 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 a b Figure 3. Wnt5a/ROR2 expression is increased in lysates from platinum resistant tumors. A. Western blot analysis of lysates from platinum resistant vs. platinum sensitive patient samples with the indicated primary antibodies. B. Quantification of protein expression for Wnt5a, ROR2, STAT3 and NF-kB based on β-tubulin levels. Horizontal lines represent the average and errors bars are SEM (standard error of mean). After normalization, samples were quantified based on the highest expression level of all samples. Translational Oncology Vol. 11, No. xx, 2018 Expression Analysis in Platinum Resistant Ovarian Cancer Veskimäe et al. 1167 for relatively long time, up to 50 months to ensure a comprehensive analysis of their disease progression. Two functionally unrelated genes, GREB1 and ROR2 were identified in our analysis as significantly differentially expressed between high PARP/platinum-sensitive and low PARP/ platinum-resistant groups. While initially sequenced from brain tissue, human GREB1 is highly expressed in normal and neoplastic ovarian tissue and in several other hormone-responsive tissues such as breast, uterine and prostate [26–29].GREB1, along with CCND1 and MYC, are common transcription targets for E2 (17β-estradiol)-mediated proliferative responses, via ESR1 (estrogen receptor one) engagement [28]. Figure 4. a. Cisplatin sensitivity testing of A2780 and A2780cis cell lines. Cells were incubated as five replicates for 3 days with increased concentrations of cisplatin as indicated and cell-viability was measured by CTG assay. EC50 was calculated using Graph Prism software and shown as approximate values.b. ROR2 mRNA expression in platinum sensitive and resistant cell lines A2780/A2780cis (P= .0046). The graphs show mean ± SEM.c. GREB1 mRNA expression in platinum sensitive and resistant cell lines A2780/A2780cis (P= .0012. The graphs show mean ± SEM.d. Protein expression levels for ROR2, Wnt5a, NF-kB and STAT3 in the cytoplasmic and nuclear cell lysates of A2780 and A2780cis cell lines. Protein quantification was done using Oddyssey Licor software and normalized against the loading control. 1168 Expression Analysis in Platinum Resistant Ovarian Cancer Veskimäe et al. Translational Oncology Vol. 11, No. xx, 2018