Mitochondrial dysfunction generates a growth-restraining signal linked to pyruvate in Drosophila larvae

Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=kfly20 Fly ISSN: 1933-6934 (Print) 1933-6942 (Online) Journal homepage: https://www.tandfonline.com/loi/kfly20 Mitochondrial dysfunction generates a growthrestraining signal linked to pyruvate in Drosophila larvae Jack George, Tea Tuomela, Esko Kemppainen, Antti Nurminen, Samuel Braun, Cagri Yalgin & Howard T. Jacobs To cite this article: Jack George, Tea Tuomela, Esko Kemppainen, Antti Nurminen, Samuel Braun, Cagri Yalgin & Howard T. Jacobs (2019) Mitochondrial dysfunction generates a growth-restraining signal linked to pyruvate in Drosophila larvae, Fly, 13:1-4, 12-28, DOI: 10.1080/19336934.2019.1662266 To link to this article: https://doi.org/10.1080/19336934.2019.1662266 © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. View supplementary material Published online: 17 Sep 2019. Submit your article to this journal Article views: 419 View related articles View Crossmark data RESEARCH PAPER Mitochondrial dysfunction generates a growth-restraining signal linked to pyruvate in Drosophila larvae Jack George a , Tea Tuomela a , Esko Kemppainen a , Antti Nurminen a , Samuel Braun a , Cagri Yalgin a,b , and Howard T. Jacobs a,b a Faculty of Medicine and Health Technology, Tampere University, Tampere, Finland; b Institute of Biotechnology, University of Helsinki, Helsinki, Finland ABSTRACT The Drosophila bang-sensitive mutant tko 25t , manifesting a global deficiency in oxidative phosphorylation due to a mitochondrial protein synthesis defect, exhibits a pronounced delay in larval development. We previously identified a number of metabolic abnormalities in tko 25t larvae, including elevated pyruvate and lactate, and found the larval gut to be a crucial tissue for the regulation of larval growth in the mutant. Here we established that expression of wild-type tko in any of several other tissues of tko 25t also partially alleviates developmental delay. The effects appeared to be additive, whilst knockdown of tko in a variety of specific tissues phenocopied tko 25t , producing developmental delay and bang-sensitivity. These findings imply the existence of a systemic signal regulating growth in response to mitochondrial dysfunction. Drugs and RNAi-targeted on pyruvate metabolism interacted with tko 25t in ways that implicated pyruvate or one of its metabolic derivatives in playing a central role in generating such a signal. RNA-seq revealed that dietary pyruvate-induced changes in transcript representation were mostly non-coherent with those produced by tko 25t or high-sugar, consistent with the idea that growth regulation operates primarily at the translational and/or metabolic level. ARTICLE HISTORY Received 7 May 2019 Revised 26 August 2019 Accepted 28 August 2019 Published online 13 September 2019 KEYWORDS Mitochondria; protein synthesis; lactic acidosis; respiration; translation; larva Introduction Mitochondrial dysfunction is a common underlying cause or manifestation of human disease [1–3]. Whilst mammalian models such as the mouse have provided insights into the underlying processes, the use of Drosophila to understand mitochondrial pathophysiology has been relatively neglected, despite its versatility and the availability of a wide variety of easily applied genetic tools. Deficient mitochondrial protein synthesis is frequently associated with mitochondrial diseases [4], and Drosophila provides a valuable model to study the physiological effects of limitations on mitochondrial translation in the context of animal development. The Drosophila tko gene, encoding mitoribosomal protein S12, a core component of the mitoribosomal decoding centre, has been a particular object of study in this regard. The canonical mutant tko 25t displays a range of phenotypic features that resemble mitochondrial disease in humans, including developmental delay, impaired sound-responsiveness, bangsensitivity (paralytic seizures induced by mechanical shock) and antibiotic sensitivity [5]. Other tko 25t phenotypes are unique to Drosophila,suchasmalecourtship defect [5]. These phenotypic features reflect an underlying deficiency of mitoribosomes [5] and consequent global deficiency of the enzymatic functions of oxidative phosphorylation (OXPHOS) that depend upon mitochondrial translation products, manifesting in both adults [5]andlarvae[6]. All of these phenotypes are reversed by ubiquitous expression of a transgenic copy of the wild-type tko gene, using the UAS/GAL4 system [6]. Since developmental delay occurs during the larval stages [5], this prompts the question as to which of the larval tissues mediates the crucial signalling that regulates growth in response to limitations on mitochondrial protein synthesis, and by what mechanism. In a follow-up study [7], we obtained some relevant cluesastotheunderlyingmechanism(s)wherebythe growth rate of tko 25t larvaeisadjusted,soastotake account of the decreased capacity for processing CONTACT Howard T. Jacobs [email protected] Faculty of Medicine and Health Technology, FI-33014 Tampere University, Tampere FI-33014, Finland Supplemental data for this article can be accessed here. FLY 2019, VOL. 13, NOS. 1–4, 12–28 https://doi.org/10.1080/19336934.2019.1662266 © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License (http://creativecommons.org/licenses/by-ncnd/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited, and is not altered, transformed, or built upon in any way. nutritional resources caused by mitochondrial dysfunction. In particular, we observed that components of the apparatus of cytosolic protein synthesis and secretion were down-regulated in tko 25t larvae, both at the transcript level and via a key regulatory step of cytosolic protein synthesis, the ribosomal protein S6 kinase (S6K). tko 25t larvae were also found to be unaffected by low levels of the cytosolic protein synthesis inhibitor cycloheximide, which retarded the development of wild-type larvae, also implicating the cytoribosome as a crucial target in larval growth regulation. Many other genes that were downregulated in tko 25t at the RNA level encoded secreted proteins of the gut and cuticle, suggesting that growth rate in tko 25t could be adjusted to compensate for stress in the protein secretory system caused by disruption of redox homeostasis. In the same study [7]wedeterminedthatthe strength of the tko 25t phenotype depends upon the culture conditions, specifically the sugar content of the growth medium. When tko 25t flies were cultured on high-sugar medium, their growth was further impaired compared with those grown on low-sugar medium, and many of the observed changes in gene expression were more pronounced. The effect of high sugar was accompanied by increases in the level of pyruvate and lactate in the larvae, whilst supplementation of the medium with pyruvate or lactate exacerbated developmental delay. tko 25t larvae also manifested low levels of ATP and a greatly decreased NADPH/NADP ratio, both of which were enhanced by high-sugar medium [7]. A key result from the previous study was the observation that expression of wild-type tko specifically in portions of the larval gut, a major secretory tissue, partially alleviated the developmental delay of tko 25t [7]. Since the driver used in this experiment did not express at a high level in all regions of the gut, we reasoned that other gut-specific drivers used in combination might provide a more complete rescue of the phenotype. To embark on such a study, we initially implemented what we assumed would be negative controls, directing wild-type tko expression in other regions of the larva with high specificity. However, this produced the unexpected result that partial rescue of developmental delay was conferred by expression in each of the tissues tested (muscle, fat-body, neurons, as well as gut), with some evidence of additive effects. Conversely, tko knockdownineachspecific tissue produced a partial developmental delay, accompanied by bang sensitivity, the canonical adult phenotype of tko 25t . These new findings indicate the existence of a systemic and possibly metabolic signal integrating growth across the entire larva, in response to limitations on mitochondrial translational or OXPHOS capacity. Given the previous findings implicating pyruvate and/or lactate as key regulatory metabolites, we studiedtheeffectsofdrugsandRNAitargetedon pyruvate and its metabolic transactions. The findings are consistent with pyruvate metabolism playing a central role in generating the signal that links growth and mitochondrial function in Drosophila larvae. Materials and methods Drosophila strains and culture Drosophila strains were procured from stock centres, supplied by colleagues or maintained long term in our laboratory. A full list of GAL4 drivers, RNAi lines and other strains used in the study are provided in Tables 1,2and 3, respectively. Markers carried on standard balancers were used to distinguish experimental from control progeny. Except where stated, flies were cultured on standard high-sugar medium (HS), as detailed in [7]. A variant, ‘zero-sugar’medium (ZS), containing standard dietary supplements but no added sugars [7], was used where indicated. Note that HS and ZS media are not isocaloric: in an earlier study [7] the extent of developmental delay in tko 25t flies was shown to depend only on the sugar content of the medium, not its calorific value. Sodium pyruvate, dichloroacetate or UK5099 (Sigma-Aldrich), were added to these media from aqueous stock solutions after the medium had been cooled to below 65°C, giving the final concentrations indicated in the figures. Developmental and bang-sensitivity assays Mean developmental time to eclosion and bangsensitivity were measured as previously [5,7], in temperature-controlled incubators, with temperature verified daily throughout the experiment. In all crosses where developmental time to eclosion was measured, at least 3 (usually 4) replicate vials were studied, and the entire experiment was repeated to validate the findings. FLY 13 RNA analysis Quantitative reverse-transcription PCR (qRTPCR) to confirm the effectiveness of RNAi was conducted as previously [7,37], using RpL32 as an internal standard and verified primer pairs (all shown 5´ to 3´) as follows: for Pdk –GGATTCG GAACAGATGCAAT and CGCGATAGAACTTT GAGCTTG, for Mpc1 –GCCGACACACAAA AGAGTCC and GCTGGACCTTGTAGGCAAAT, for Men –ACTCGATCCTACGACGCTGT and TGAGGAAGGACTCTGCGAAT. RNA sequencing and data analysis were carried out as previously [7], using RNA from Oregon R or tko 25t L3-stage larvae cultured on different media. Note that initial statistical filtering by Cuffdiff (chipster. csc.fi) excludes genes in any pairwise comparison where the differences fail significance testing, regardless of their magnitude. For further analysis (see Results), arbitrary thresholds were then applied to restrict the analysis to genes showing substantial differences in expression, as measured by either of two parameters: >8 fold change Table 1. GAL4 drivers used in the study. Name a Stock centre ID b or source Alias, if any Chromosome Expression pattern c References d da-GAL4 BL 8641 3 ubiquitous [8] gut-GAL4 KY 113094 NP3084 2 midgut, proventriculus, gastric ceca, salivary glands [7,9], Fig. S1 elav-GAL4 BL 458 c155 X neurons, embryonic neuroblasts and glioblasts [10,11] nrv2-GAL4 BL 6800 2 glial cells, weak expression in some neurons [12–16], Fig. S1 G14 kind gift of John Sparrow G14-Gal4 2 muscle, salivary glands [17–19] Mef2-GAL4 BL 27390 GAL4-Mef2, DMef2-GAL4 3 muscle [20] Kr-GAL4 kind gift of John Sparrow 2 early embryo, larval midgut [21,22], Fig. S1 Lsp2-GAL4 BL 6357 3 Fat body (third larval instar and adult) [23,24], Fig. S1 a as used here. b BL = Bloomington, KY = Kyoto. c consensus or most recent revision from published literature, or based on figures of this paper. d literature citation(s) or figure of this paper. Table 2. RNAi lines used in the study. Symbol of targeted gene Stock centre ID a Library Chromosome (insertion) Reference b tko BL 38251 TRiP 2 [25,26] Mpc1 BL 67817 TRiP 2 [25,27] Pdk BL 28635 TRiP 3 [25,26] Men BL 38256 TRiP 2 [25,26] Men VDRC 330428 shRNA 2 [28] Men VDRC 104016 KK 2 [28,29] Men-b BL 57489 TRiP 2 [25,27] Men-b VDRC 100812 KK 2 [28,29] Ldh VDRC 110190 KK 2 [29] a BL = Bloomington, VDRC = Vienna Drosophila Research Centre. b literature citation(s). Table 3. Other Drosophila strains used in the study. Name a Stock centre ID b Alias, if any Chromosome (insertion, mutation or balancer) Other features c References d tko 25t n/a tko(25t) X Bang-sensitive; coding-region mis-sense mutant [30–32] UAS-tko + (1) n/a 3 transgenic for wild-type copy of tko cDNA; without driver does not alleviate bang sensitivity of tko 25t [6] UAS-tko + (8) n/a 2 transgenic for wild-type copy of tko cDNA; without driver does not alleviate developmental delay of tko 25t [6] FM7 BL 995 X balancer chromosome [33] CyO BL 4959 2 balancer chromosome [34] TM3Sb n/a TM3-Sb 3 balancer chromosome, currently available from stock centre combined with CyO [34] UAS-Stinger BL 65402 UAS-GFP, UASStinger 2 transgenic expressor of nuclear-targeted GFP [35] UAS-mCD8-GFP KY 108068 mCD8-GFP, + many variants 2 transgenic expressor of membrane-targeted GFP [36] a as used here. b BL = Bloomington, KY = Kyoto, n/a not currently available from stock centres. c consensus or most recent revision from published literature, or based on figures of this paper. d literature citation(s) or figure of this paper (Figure 1). 14 J. GEORGE ET AL. or >100 units of FPKM (mass fraction). Raw sequence data have been deposited at ArrayExpress (www.ebi.ac.uk/ArrayExpress/). Metabolite analysis Batchesof20larvaewerehomogenizedin100µlof 6M guanidine hydrochloride on ice. The homogenate was incubated at 95°C for 5 min and centrifuged at 12000g max for 5 min at 4°C. The supernatants were stored at −80°C, and later diluted 1:10 and with PBS (pH 7.4) for analysis. Pyruvate and lactate were measured with commercially available fluorescence-based determination kits (Abcam) according to manufacturer’s instructions. 10 µl of sample was combined with 50 µl of either lactate or pyruvate reaction mix, incubated at room temperature for 30 min after which fluorescence was measured (excitation at 535 nm, emission at 590 nm) using a plate reader. Lactate and pyruvate standards were used to generate standard curves and concentrations were normalized to soluble protein as measured using the Bradford method. Statistics For pairwise comparisons between groups, the twotailed (unpaired) Student’sttest (Microsoft Excel) was applied. For multiple comparisons, we used one-way ANOVA with Tukey post hoc HSD test online (astatsa. com). For comparisons where multiple factors were being assessed, two-way ANOVA (GraphPad Prism or online tool at vassartstats.net/anova2u.html, as indicated) was used, together with Dunnett’sor Tukey’spost hoc multiple comparisons tests as indicated, where interactions were detected, or where more than two levels were compared. Results Wild-type tko expression in diverse tissues alleviates developmental delay in tko 25t Using the line UAS-tko + (8) [6], in which a wild-type tko transgene is expressed under the control of GAL4, we tested the tissue-specificity of developmental delay in the tko 25t background, by combining it with different GAL4 drivers directing distinct tissue patterns of expression. In addition to almost complete rescue using da-GAL4 and the partial rescue with gutGAL4 documented previously, we found that drivers specific for the fat body (Lsp2-GAL4), muscle (G14 and Mef2-GAL4) and CNS (neurons, elav-GAL4) all gave a partial rescue (Figure 1), although this was most pronounced or significant in each case at different characteristic temperatures (Table S1). We confirmed the specificity of patterns of expression of these drivers using GAL4-dependent constructs for GFP (Fig. S1). The alleviation of the phenotype was due to a positive effect of the transgene/driver combination, and not due to a negative effect of the CyO balancer chromosome in the tko 25t background (Fig. S2). Note, however, that this was not trueoftheTM3Sbbalancer(Fig.S2),theuseofwhich was therefore avoided in all experiments described. The partial rescue produced by several drivers appeared to be additive, based on two lines of evidence. First, we attempted to combine pairs of drivers and the UAS-tko + (8) transgene. This experiment was technically challenging for several reasons: the problematic nature of the TM3Sb balancer precluded its use; some transgenic combinations had poor viability, especially as homozygotes, and the drivers did not all perform optimally at the same temperature. However, the combination of the fat-body and muscle drivers Lsp2-GAL4 and G14 appeared to give an additive enhancement at 22°C (Fig. S3), although this should be interpreted cautiously, due to the imperfect experimental design. The second piece of evidence for a combinatorial effect was that a second transgenic line, UAS-tko + (1), which already showed a one-day alleviation of developmental delay compared with tko 25t flies bearing no transgene [6], showed a further alleviation of developmental delay when combined with different GAL4 drivers (Figure 2). These findings suggest the operation of a systemic signal that integrates the degree of mitochondrial dysfunction across tissues, calibrating growth to the ability of the organism to process nutritional resources. RNAi-mediated tko knockdown in diverse tissues phenocopies tko 25t To further test this hypothesis, we used RNAmediated knockdown of tko to profile the tissues in which the resulting mitochondrial translational deficit leads to a tko 25t -like phenotype. Ubiquitous tko knockdown using the da-GAL4 driver and the FLY 15 Bloomington TRiP line 38251 targeted on tko resulted in a phenotype resembling an exaggerated version of tko 25t . At 25°C tko knockdown was lethal, whilst at 22°C, it was lethal to males and semilethal to females, which eclosed with a long delay (5–9 d) and were too weak to permit a meaningful test of their bang-sensitivity. At 18°C females eclosed with a 7 to 8-d delay (Figure 3(a)) and were highly bang-sensitive (Figure 4(a)), whilst the few males that eclosed were even more delayed (Figure 3(a)) and extremely weak. Knockdown using tissue-specific drivers produced a milder version of the same phenotype, whether knockdown was targeted specifically to neurons (using elavGAL4, Figures 3(b), 4(b)) or muscle (Mef2-GAL4 at 18°C, Figures 3(c),4(c)). Even more limited knockdown targeted on the early embryo, and portions of the midgut (Kr-GAL4, Figure 3(d), Fig. S1) also produced a significant, though very modest developmental delay, but without bang-sensitivity (Figure 4(e)). Mef2-GAL4-driven tko knockdown at higher temperatures (22, 25°C) again gave yadnoisolce 20 18 16 14 12 *** ** Lsp2-GAL4 22 °C * a eclosion day 18 16 14 12 10 elav-GAL4 d 22 °C ** ** * control, driver control, driver, transgene tko25t, driver tko25t, driver, transgene yadnoisolce 32 28 24 20 16 ** Mef2-GAL4 18 °C eclosion day 20 18 16 14 12 **** G14 22 °C control, driver OR transgene control, driver, transgene tko25t, driver OR transgene tko25t, driver, transgene c control control, transgene tko25t, driver control, driver control, driver, transgene tko25t, driver, transgene b transgene = UAS-tko+(8) transgene = UAS-tko+(8) transgene = UAS-tko+(8) ** Figure 1. tko 25t developmental delay is partially alleviated by tko + expression directed by different drivers. Time to eclosion (means ± SD, n ≥3 replicate vials for each cross), of flies of the indicated genotypes, using UAS-tko + (8) with the indicated drivers. Controls were FM7 balancer flies with (a, b and d –right-hand panel) driver but no transgene, (c), driver or transgene (these classes could not be distinguished due to the nature of the cross, since the G14 driver is not viable as a homozygote), and (d –left-hand panel) neither transgene nor driver, as dictated by the chromosomal location of the drivers. Because the elav-GAL4 driver is located on the X chromosome, one of the two reciprocal crosses used in (d) generates only informative females and not males. Horizontal lines denoted by asterisks (*, **, ***) indicate significant differences in pairwise comparisons of flies of a given sex and tko genotype, with and without actively driven tko + (Student’sttest, p< 0.05, 0.01, 0.001, respectively. The specificity of each driver was confirmed by parallel crosses in which it was used to direct the synthesis of nuclearor membrane-localized GFP (see Fig. S1). Note that we avoided the use of the TM3 balancer because we established that it conferred a developmental delay in conjunction with tko 25t , whereas the chromosome 2 balancer CyO did not (Fig. S2). The partial rescue of developmental delay was also observed at other temperatures with some drivers (see Table S1) and using the alternate transgene UAS-tko + (1) –see Figure 2. Note that most GAL4 drivers exhibit the classic pattern of temperature dependence [38], i.e. increased activity at higher temperature. However, for the strongest drivers, this may also lead to deleterious effects of over-expression at high temperature, such that a lower temperature produces optimal effects. 16 J. GEORGE ET AL. semilethality and severe weakness, which was more severe in males. elav-GAL4-driven knockdown also gave sexand temperature-dependent bangsensitivity: at 25°C flies were extremely weak, whilst developmental delay was seen at all temperatures but was generally significant only in males (Figure 4(b)). Driving tko knockdown with the glial driver nrv2-GAL4 gave no bang sensitivity (Figure 4(d)). Drugs that affect pyruvate metabolism impact larval growth In principle, a systemic signal regulating growth according to mitochondrial function could be endocrine or metabolic in nature. Candidate metabolites for such a role that were previously shown to be markedly abnormal in tko 25t larvae, include pyruvate and lactate, which were approximately threefold elevated, and NADPH and ATP, which were highly depleted [7]. Since ATP and NADPH may be considered too labile to perform an intercellular role, we focused our attention on pyruvate and lactate, which are interconvertible through lactate dehydrogenase, andwhichwerepreviouslyfoundtoexacerbateand phenocopy the developmental delay of tko 25t ,when added to the medium ([7], Figure 5(a)). We investigated the developmental effect of two drugs known to affect pyruvate metabolism, dichloroacetate (DCA), an inhibitor of pyruvate dehydrogenase kinase (Pdk) and UK5099, an inhibitor of the mitochondrial pyruvate carrier, which could be predicted to have a d control, transgene control, driver, transene tko25t , transgene tko25t , driver, transgene b yadnoisolce 16 14 12 10 8 Lsp2-GAL4 25 °C *** yadnoisolce 16 14 12 10 8 ** Mef2-GAL4 25 °C ** eclosion day 16 14 12 10 8 ** ** G14 25 °C eclosion day 18 16 14 12 10 8 * * nrv2-GAL4 25 °C c transgene = UAS-tko+(1) Figure 2. Alleviation of tko 25t developmental delay in a second UAS-tko + line. Time to eclosion at 25°C (means ± SD, n ≥3 replicate vials for each cross), of flies of the indicated genotypes, using various drivers plus the UAS-tko + (1) transgene, shown previously to confer a modest rescue of developmental delay without any driver [6]. Controls were FM7 balancer flies with transgene but without driver, as shown. Horizontal lines denoted by asterisks (*, **, ***) indicated significant differences in pairwise comparisons of flies of a given sex and tko genotype, with and without actively driven tko + (Student’sttest, p< 0.05, 0.01, 0.001, respectively. The specificity of each driver was confirmed by parallel crosses in which it was used to direct the synthesis of nuclearor membranelocalized GFP (see Figure S1). Note that we avoided the use of the TM3 balancer because we established that it conferred a developmental delay in conjunction with tko 25t , whereas the chromosome 2 balancer CyO did not (Fig. S2). FLY 17 opposite effects on mitochondrial pyruvate utilization. We tested different concentrations of pyruvate and DCA for their effects on the development of wild-type and tko 25t females in ZS medium (Figure 5(b)), and performed a more extensive study at single, effective concentrations on different media and both sexes, including heterozygous tko 25t females (Figure 5(a)). Like pyruvate, DCA produced an additional, dosedependent developmental delay in both tko 25t as well as in wild-type flies (Figure 5(a,b, S5)). UK5099 (25 μg/ml) also exacerbated the developmental delay of tko 25t , but had no significant effect on the eclosion timing of wild-type flies (Figure 5(a, S5)). Genetic manipulations that affect pyruvate metabolism impact larval growth and survival Next, we analyzed the effects of knocking down the genes coding for the key proteins of pyruvate metabolism targeted by these drugs. The mitochondrial pyruvate carrier is a heterodimer of the ubiquitous subunit Mpc1 (CG14290) and a differentially expressed second subunit, Mpc2, encoded in Drosophila by a small gene family (CG9396, CG9399 and CG32832, the latter being testis specific). Pdk is encoded by a single-copy gene (Pdk, CG8808). Using the available RNAi lines for Mpc1 and Pdk from the Harvard Medical School TRiP library, we first confirmed that knockdown for each of the two genes using the ubiquitously acting daGAL4 driver gave viableflies,andusedqRTPCRtoverifythatknockdown was effective at the RNA level (Figure 6(a)). We then evaluated the effects of knockdown on wild-type and tko 25t flies gown in standard high-sugar medium, or on medium supplemented with 25 mg/ml pyruvate (Figure 6(b)). Mpc1 or Pdk knockdown produced no effect on eclosion timing in wild-type flies cultured on standard medium. However, when pyruvate was a driver only tko RNAi only tko RNAi + driver yadnoisolce 35 30 25 20 15 da-GAL4 18 °C *** eclosion day 16 14 12 10 8 elav-GAL4 25 °C ** b yadnoisolce 26 24 22 20 18 Mef2-GAL4 18 °C *** c eclosion day 16 14 12 10 8 Kr-GAL4 25 °C ** * d Figure 3. RNAi knockdown of tko by different drivers results in developmental delay. Times to eclosion (means ± SD, n ≥3 replicate vials for each cross) for flies of the indicated sex and genotype, using the various drivers at the temperatures shown. Horizontal lines denoted by asterisks (*, **, ***) indicate significant differences in pairwise comparisons between knockdown and control flies of a given sex, using a given driver (Student’sttest, p < 0.05, 0.01, 0.001, respectively). Note that males were in general more severely affected and in some cases (e.g. da-GAL4) too few males eclosed to permit a statistically meaningful analysis. Note that most GAL4 drivers exhibit the classic pattern of temperature dependence [38], i.e. increased activity at higher temperature. However, for the strongest drivers this may also lead to highly deleterious effects at high temperature, such that, at a lower temperature, results are more informative. 18 J. GEORGE ET AL. added to the medium, Mpc1 knockdown exacerbated the developmental delay produced in wild-type flies, but not that of tko 25t (Figure 6(b), panel i), whilst Pdk knockdown had no effect on eclosion timing of wildtype flies on either medium, but mildly alleviated the developmental delay of tko 25t (Figure 6(b), panel ii) on pyruvate-supplemented medium (see Fig. S6 for summary of the relevant statistical analyses by two-way ANOVA). Knockdown of two other genes of pyruvate metabolism, coding, respectively, for the cytosolic and mitochondrial isoforms of malic enzyme, produced more dramatic results in combination with tko 25t .In our previous study, we observed that knockdown of Men, the gene encoding the cytosolic isoenzyme, produced no significant effects on tko 25t (Figure 4(c)of [7]). In the present study we were able to make use of more potent and specific TRiP lines for Men,aswellas one further dsRNA line from the VDRC collection, all of which gave a strong knockdown of the gene at the RNA level under the control of da-GAL4 (Figure 7(a)), but had no significant effect on the development of otherwise wild-type flies (Figure 7(b)). However, in combination with tko 25t they were all developmentally lethal or semilethal at both 29°C and 25°C (Figure 7(c)). Both of the Men-b knockdown lines produced a developmental delay in wild-type flies, and were again synthetically lethal with tko 25t (Fig. S4), but this result should be interpreted cautiously, since we were not able to demonstrate convincing and consistent knockdown of Men-b at the RNA level by qRTPCR, using several different primer sets. Knockdown of lactate dehydrogenase (Ldh) was lethal to both wild-type and tko 25t larvae, making comparable experiments uninformative. Despite their similar effects on eclosion timing (Figure 5), the addition of pyruvate and DCA to the low-sugar culture medium had opposite effects on the tissue levels of pyruvate and lactate in L3 larvae (Figure 8), although the changes were only significant for pyruvate levels (Tables S3). Pyruvate addition increased both lactate and pyruvate to levels comparable with those seen in high-sugar medium, whilst DCA lowered them, in accord with the expectation a tko RNAi only tko RNAi + driver da-GAL4 100 75 50 25 0 )s(emityrevoceR 18 °C cMef2-GAL4 b 20 15 10 5 0 )s(emityrevoceR 18 °C 400 300 200 100 0 Recovery time (s) 22 °C 18 °C 80 60 40 20 0 Recovery time (s) 18 °C elav-GAL4 dG14 20 15 10 5 0 Recovery time (s) 25 °C enrv2-GAL4 20 15 10 5 0 Recovery time (s) 25 °C Kr-GAL4 25 °C Figure 4. RNAi knockdown of tko by different drivers results in bang-sensitivity. Box-plots of recovery times from mechanical shock (bold black or red lines –medians, respectively, for controls and tko knockdown flies, with filled boxes representing first to third quartiles) of flies of the indicated genotype, sex and culture temperature. Note the different scales required to plot these data. White bars for control flies were in most cases not plottable, since median and both quartiles were at or very close to zero. FLY 19 ways: first, via a post-translational mechanism affecting S6K, second, via changes in transcript representation [7]. In the present study, we found that only a minor fraction of the genes regulated at theRNAlevelbypyruvatewereregulatedinthe same way by high sugar, whilst those responding to tko 25t were mostly altered in the opposite direction. This was unexpected, given the fact that tko 25t responded similarly to pyruvate and high sugar, and suggests that global growth regulation in response to mitochondrial dysfunction and metabolic disturbance occurs mainly at the (post-)translational level. Regulation at the protein level is also suggested by the fact that the list of similarly or oppositely regulated genes at the RNA level includes very few that are connected either to metabolism or to transcription. It remains possible that relevant changes remain buried in the list of transcriptional targets because they change only by rather modest amounts that are below the thresholds set here but are nevertheless critical to the regulation of growth. More plausibly, a global regulator like the cyclin-dependent kinases or AMPK, which would not have to compete with cell-specific transcriptional programs, can respond to a systemic signal in broadly similar ways in all cells. In conclusion, this study provides evidence that mitochondrial dysfunction triggers a systemic response that curtails the rate of growth of Drosophila larvae, and confirms a key role for pyruvate or its metabolic products in eliciting this signal. Acknowledgments We thank Shweta Manjiry, who conducted some preliminary experiments relevant to this paper, Eveliina Teeri and Essi Eräsalo for technical assistance, and Troy Faithfull for help with the manuscript. Disclosure statement No potential conflict of interest was reported by the authors. During the review process of the manuscript, corresponding author HTJ was appointed as Editor-in-Chief of the journal. However, he remaineduninvolved in, and blinded to, the review and editorial process. Funding This work was supported by the Academy of Finland under Grants 283157 and 272376, the Tampere University Hospital Medical Research Fund and the Sigrid Juselius Foundation. The Drosophila work was carried out in the Tampere Drosophila Facility, partially funded by Biocenter Finland. ORCID Jack George http://orcid.org/0000-0002-0053-4171 Tea Tuomela http://orcid.org/0000-0002-1010-0561 Esko Kemppainen http://orcid.org/0000-0002-5491-5391 References [1] Thompson K, Collier JJ, Glasgow RIC, et al. Recent advances in understanding the molecular genetic basis of mitochondrial disease. J Inherit Metab Dis. 2019. [Epub before print]. DOI:10.1002/jimd.12104. [2] Kanungo S, Morton J, Neelakantan M, et al. Mitochondrial disorders. Ann Transl Med. 2018;6:475. [3] Murphy MP, Hartley RC. Mitochondria as a therapeutic target for common pathologies. Nat Rev Drug Discov. 2018;17:865–886. [4] Boczonadi V, Horvath R. Mitochondria: impaired mitochondrial translation in human disease. Int J Biochem Cell Biol. 2014;48:77–84. [5] Toivonen JM, O’Dell KM, Petit N, et al. Technical knockout,aDrosophila model of mitochondrial deafness. Genetics. 2001;159:241–254. [6] Toivonen JM, Manjiry S, Touraille S, et al. Gene dosage and selective expression modify phenotype in a Drosophila model of human mitochondrial disease. Mitochondrion. 2003;3:83–96. [7] Kemppainen E, George J, Garipler G, et al. Mitochondrial dysfunction plus high-sugar diet provokes a metabolic crisis that inhibits growth. PLoS One. 2016;11:e0145836. [8]WodarzA,HinzU,EngelbertM,etal.Expressionof crumbs confers apical character on plasma membrane domains of ectodermal epithelia of Drosophila. Cell. 1995;82:67–76. [9] Yin S, Qun Q, Zhou B. Functional studies of Drosophila zinc transporters reveal the mechanism for zinc excretion in Malpighian tubules. BMC Biol. 2017;15:12. [10] Osterwalder T, Yoon KS, White BH, et al. A conditional tissue-specific transgene expression system using inducible GAL4. Proc National Acad Sci USA. 2001;98:12596–12601. [11] Berger C, Renner S, Lüer K, et al. The commonly used marker ELAV is transiently expressed in neuroblasts and glial cells in the Drosophila embryonic CNS. Dev Dyn. 2007;236:3562–3568. 26 J. GEORGE ET AL. [12] Sun B, Xu P, Wang W, et al. In vivo modification of Na + ,K + -ATPase activity in Drosophila. Comp Biochem Physiol B Biochem Mol Biol. 2001;130:521–536. [13] Oland LA, Biebelhausen JP, Tolbert LP. The glial investment of the adult and developing antennal lobe of Drosophila. J Comp Neurol. 2008;509:526–550. [14] Górska-Andrzejak J, Salvaterra PM, Meinertzhagen IA, et al. Cyclical expression of Na + /K + -ATPase in the visual system of Drosophila melanogaster. J Insect Physiol. 2009;55:459–468. [15] Edwards TN, Meinertzhagen IA. The functional organisation of glia in the adult brain of Drosophila and other insects. Prog Neurobiol. 2010;90:471–490. [16] Stork T, Bernardos R, Freeman MR. Analysis of glial cell development and function in Drosophila. Cold Spring Harb Protoc. 2012;2012:1–17. [17] Wang J-W, Beck ES, McCabe BD. A modular toolset for recombination transgenesis and neurogenetic analysis of Drosophila. PLoS One. 2012;7:e42102. [18] Aberle H, Haghighi AP, Fetter RD, et al. wishful thinking encodes a BMP type II receptor that regulates synaptic growth in Drosophila.Neuron.2002;33:545–558. [19] Kemppainen KK, Rinne J, Sriram A, et al. Expression of alternative oxidase in Drosophila ameliorates diverse phenotypes due to cytochrome oxidase deficiency. Hum Mol Genet. 2014;23:2078–2093. [20] Ranganayakulu G, Elliott DA, Harvey RP, et al. Divergent roles for NK-2 class homeobox genes in cardiogenesis in flies and mice. Development. 1998;125:3037–3048. [21] Casso D, Ramírez-Weber FA, Kornberg TB. GFPtagged balancer chromosomes for Drosophila melanogaster. Mech Dev. 1999;88:229–232. [22] Castelli-Gair JE, Greig S, Micklem G, et al. Dissecting the temporal requirements for homeotic gene function. Development. 1994;120:1983–1995. [23] Reiling JH, Hafen E. The hypoxia-induced paralogs Scylla and Charybdis inhibit growth by down-regulating S6K activity upstream of TSC in Drosophila. Genes Dev. 2004;18:2879–2892. [24] Takeuchi T, Suzuki M, Fujikake N, et al. Intercellular chaperone transmission via exosomes contributes to maintenance of protein homeostasis at the organismal level. Proc National Acad Sci USA. 2015;112:E2497– E2506. [25] Perkins LA, Holderbaum L, Tao R, et al. The transgenic RNAi project at harvard medical school: resources and validation. Genetics. 2015;201:843–852. [26] Yan D, Neumüller RA, Buckner M, et al. A regulatory network of Drosophila germline stem cell self-renewal. Dev Cell. 2014;28:459–473. [27] Pletcher RC, Hardman SL, Intagliata SF, et al. A genetic screen using the Drosophila melanogaster TRiP RNAi collection to identify metabolic enzymes required for eye development. G3. 2019:9:2061–2070. [28] Ni JQ, Zhou R, Czech B, et al. A genome-scale shRNA resource for transgenic RNAi in Drosophila. Nat Methods. 2011;8:405–407. [29] Dietzl G, Chen D, Schnorrer F, et al. A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature. 2007;448:151–156. [30] Judd BH, Shen MW, Kaufman TC. The anatomy and function of a segment of the X chromosome of Drosophila melanogaster. Genetics. 1972;71:139–156. [31] Royden CS, Pirrotta V, Jan LY. The tko locus, site of a behavioral mutation in Drosophila melanogaster, codes for a protein homologous to prokaryotic ribosomal protein S12. Cell. 1987;51:165–173. [32] Shah ZH, O’Dell KMC, Miller SCM, et al. Metazoan nuclear genes for mitoribosomal protein S12. Gene. 1997;204:55–62. [33] Merriam JR. FM7: a ‘new’first chromosome balancer. Drosophila Inf Serv. 1969;44:101. [34] Lindsley DL, Zimm GG. The genome of Drosophila melanogaster. NY: Academic Press; 1992. [35] Barolo S, Carver LA, Posakony JW. GFP and beta-galactosidase transformation vectors for promoter/enhancer analysis in Drosophila. BioTechniques. 2000;29:726–732. [36] Lee T, Luo L. Mosaic analysis with a repressible neurotechnique cell marker for studies of gene function in neuronal morphogenesis. Neuron. 1999;22:451–461. [37] Fernandez-Ayala DJ, Sanz A, Vartiainen S, et al. Expression of the Ciona intestinalis alternative oxidase (AOX) in Drosophila complements defects in mitochondrial oxidative phosphorylation. Cell Metab. 2009;9:449–460. [38] Brand AH, Perrimon N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993;118:401–415. [39] Finsterer J, Zarrouk-Mahjoub S. Biomarkers for detecting mitochondrial disorders. J Clin Med. 2018;7:16. [40] Muha V, Müller HA. Functions and mechanisms of fibroblast growth factor (FGF) signalling in Drosophila melanogaster. Int J Mol Sci. 2013;14:5920–5937. [41] Nässel DR, Liu Y, Luo J. Insulin/IGF signaling and its regulation in Drosophila. Gen Comp Endocrinol. 2015;221:255–266. [42] Grönke S, Clarke DF, Broughton S, et al. Molecular evolution and functional characterization of Drosophila insulin-like peptides. PLoS Genet. 2010;6:e1000857. [43] Gilbert LI. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster. Mol Cell Endocrinol. 2004;215:1–10. [44] Niwa R, Niwa YS. Enzymes for ecdysteroid biosynthesis: their biological functions in insects and beyond. Biosci Biotechnol Biochem. 2014;78:1283–1292. [45] Yamanaka N, Rewitz KF, O’Connor MB. Ecdysone control of developmental transitions: lessons from Drosophila research. Annu Rev Entomol. 2012;58:497–516. [46] Zhang YQ, Roote J, Brogna S, et al. stress sensitive Bencodes an adenine nucleotide translocase in Drosophila melanogaster. Genetics. 1999;153:891–903. [47] Fergestad T, Bostwick B. Ganetzky B metabolic disruption in Drosophila bang-sensitive seizure mutants. Genetics. 2006;173:1357–1364. FLY 27 [48] Chen S, Oliveira MT, Sanz A, et al. A cytoplasmic suppressor of a nuclear mutation affecting mitochondrial functions in Drosophila. Genetics. 2012; 192:483–493. [49] Vartiainen S, Chen S, George J, et al. Phenotypic rescue of a Drosophila model of mitochondrial ANT1 disease. Dis Models Mech. 2014;7:635–648. [50] Jacobs HT, Fernández-Ayala DJ, Manjiry S, et al. Mitochondrial disease in flies. Biochim Biophys Acta. 2004;1659:190–196. [51] Schell JC, Wisidagama DR, Bensard C, et al. Control of intestinal stem cell function and proliferation by mitochondrial pyruvate metabolism. Nat Cell Biol. 2017;19:1027–1036. [52] Tennessen JM, Baker KD, Lam G, et al. The Drosophila estrogen-related receptor directs a metabolic switch that supports developmental growth. Cell Metab. 2011;13:139–148. [53] Whitehouse S, Cooper RH, Randle PJ. Mechanism of activation of pyruvate dehydrogenase by dichloroacetate and other halogenated carboxylic acids. Biochem J. 1974;141:761–774. [54] Gong F, Peng X, Sang Y, et al. Dichloroacetate induces protective autophagy in LoVo cells: involvement of cathepsin D/thioredoxin-like protein 1 and Akt-mTOR-mediated signaling. Cell Death Dis. 2013;4:e913. [55] Woo SH, Seo SK, Park Y, et al. Dichloroacetate potentiates tamoxifen-induced cell death in breast cancer cells via downregulation of the epidermal growth factor receptor. Oncotarget. 2016;7:59809–59819. [56] Yang Y, Sun Y, Chen J, et al. AKT-independent activation of p38 MAP kinase promotes vascular calcification. Redox Biol. 2018;16:97–103. [57] Carpenter L, Halestrap AP. The kinetics, substrate and inhibitor specificity of the lactate transporter of Ehrlich-Lettre tumour cells studied with the intracellular pH indicator BCECF. Biochem J. 1994;304:751–760. [58] De Preter G, Neveu MA, Danhier P, et al. Inhibition of the pentose phosphate pathway by dichloroacetate unravels a missing link between aerobic glycolysis and cancer cell proliferation. Oncotarget. 2015;7:2910–2920. [59] Halestrap AP. The mitochondrial pyruvate carrier: kinetics and specificity for substrates and inhibitors. Biochem J. 1975;148:85–96. [60] Wiemer EA, Michels PA, Opperdoes FR. The inhibition of pyruvate transport across the plasma membrane of the bloodstream form of Trypanosoma brucei and its metabolic implications. Biochem J. 1995;312:479–484. [61] Halestrap AP, Price NT. The proton-linked monocarboxylate transporter (MCT) family: structure, function and regulation. Biochem J. 1999;343:281–299. [62] Yang J, Ruchti E, Petit JM, et al. Lactate promotes plasticity gene expression by potentiating NMDA signaling in neurons. Proc National Acad Sci USA. 2014;111:12228–12233. [63] Baufeld A, Vanselow J. Lactate promotes specific differentiation in bovine granulosa cells depending on lactate uptake thus mimicking an early post-LH stage. Reprod Biol Endocrinol. 2018;16:15. [64] Wu CY, Satapati S, Gui W, et al. A novel inhibitor of pyruvate dehydrogenase kinase stimulates myocardial carbohydrate oxidation in diet-induced obesity. J Biol Chem. 2018;293:9604–9613. [65] Hildyard JC, Ammälä C, Dukes ID, et al. Identification and characterisation of a new class of highly specific and potent inhibitors of the mitochondrial pyruvate carrier. Biochim Biophys Acta. 2005;1707:221–230. 28 J. GEORGE ET AL.