scieee AI-readable full text Open interactive document viewer

Age-dependent association of gut bacteria with coronary atherosclerosis : Tampere sudden death study

Tuomisto, Sari,Huhtala, Heini,Martiskainen, Mika,Goebeler, Sirkka,Lehtimäki, Terho,Karhunen, Pekka J.

Full text

RESEARCH ARTICLE Age-dependent association of gut bacteria with coronary atherosclerosis: Tampere Sudden Death Study Sari TuomistoID 1,2 *, Heini Huhtala 3 , Mika Martiskainen 1,4 , Sirkka Goebeler 4 , Terho Lehtima ¨ki 1,2 , Pekka J. Karhunen 1,2 1Finnish Cardiovascular Research Center Tampere, Faculty of Medicine and Health Technology, Tampere University, Tampere, Finland, 2Fimlab Laboratories Ltd, Pirkanmaa Hospital District, Tampere, Finland, 3Faculty of Social Sciences, Tampere University, Tampere, Finland, 4National Institute for Health and Welfare, Tampere, Finland *[email protected] Abstract Background The gut microbiome is thought to remain stable into old age. Gut bacteria and their translocation may play a role in the development of coronary heart disease (CHD) by modulating cholesterol levels and immune responses, as well as by producing toxic metabolites and bacterial endotoxins. The association of changes in the gut microbiome with the severity of coronary atherosclerosis and the ability of gut bacteria themselves to translocate into coronary plaques has not been studied. Materials and methods As a part of the Tampere Sudden Death Study, we measured age-dependent changes in the relative ratios of major intestinal bacterial communities (Bacteroides species [spp.], the Clostridium leptum group, the Clostridium coccoides group, Bifidobacterium spp., Enterobactericeae,Lactobacillus spp.) and Streptococcus spp. in both feces and coronary plaques of the same male autopsy cases (n = 67, age range 44–95) using real-time quantitative PCR (qPCR). The area of coronary atherosclerotic lesions were measured by computer-assisted morphometry. Fecal bacterial DNA measurements from healthy volunteers served as a control for gut bacterial analyses of autopsy cases. The relative amount of bacterial DNA in a sample was determined with the comparative Cq method. Results The relative ratios of fecal Lactobacillus spp., Bifidobacterium spp., the Clostridium coccoides group, and Bacteroides spp. did not differ between controls and autopsy cases and showed no age-dependence. In contrast, the ratios of the Clostridium leptum group, Enterobactericeae, and Streptococcus spp. increased with age. Elevated relative ratios of fecal Enterobactericeae associated with a larger coronary plaque fibrotic area (p = 0.001), and the Clostridium leptum group with a larger calcification area (p = 0.015). Intestinal bacterial PLOS ONE | https://doi.org/10.1371/journal.pone.0221345 August 22, 2019 1 / 14 a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 OPEN ACCESS Citation: Tuomisto S, Huhtala H, Martiskainen M, Goebeler S, Lehtima¨ki T, Karhunen PJ (2019) Agedependent association of gut bacteria with coronary atherosclerosis: Tampere Sudden Death Study. PLoS ONE 14(8): e0221345. https://doi.org/ 10.1371/journal.pone.0221345 Editor: Brenda A. Wilson, University of Illinois at Urbana-Champaign, UNITED STATES Received: January 28, 2019 Accepted: August 5, 2019 Published: August 22, 2019 Copyright: ©2019 Tuomisto et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the manuscript and Supporting Information file. Funding: This study was financially supported by the Pirkanmaa Regional Fund of the Finnish Cultural Foundation Pirkanmaan Rahasto (FI) to PhD Sari Tuomisto and Juhani Aho; the Foundation for Medical Research to PhD Sari Tuomisto; the Competitive Research Funding of the Pirkanmaa Hospital District to Professor Terho Lehtima¨ki and Professor Pekka J Karhunen, the Academy of DNA could be amplified in 67.6% of the coronary plaques, the most common being Streptococcus spp. (41.0%), followed by Enterobactericeae (12.1%), Clostridium leptum (2.4%), and Lactobacillus spp. (2.4%). The percentages of Streptococcus spp. DNA decreased, and those of Enterobactericeae increased in coronary plaques along with age. Conclusions DNA of the Clostridium leptum group and pathogenic Enterobactericeae increase in the gut microbiome with age and can be detected in the same individual’s coronary plaques along with pathogenic Streptococcus spp., associating with more severe coronary atherosclerosis. Introduction Coronary heart disease (CHD) is one of the leading causes of death worldwide. Many CHD risk factors, such as smoking, hypertension, poor diet, dyslipidemia, lack of exercise, obesity, adiposity, and diabetes mellitus, are associated with lifestyle and therefore modifiable. It has long been speculated that gut bacteria might have a role in the development of CHD by modulating several signaling pathways in the host, such as lipid metabolism and inflammation [1]. Moreover, the DNA of several bacteria that originate from the gastrointestinal tract—such as Proteobacteria (e.g.Enterobacter spp.), Cryseomonas spp., Veillonella spp., Streptococcus spp., Staphylococcus spp., Propionibacterium spp. [2], and Chlamydia spp. [3]—have been found in coronary plaques. This suggests that the translocation of bacteria or their residuals, such as endotoxins, from the intestine might be considered a possible mechanism for chronic plaque inflammation. Bacterial translocation from the mouth or other parts of the gastrointestinal tract into circulation is common after dental or surgical procedures, endoscopy, manipulation, or local mucosal infections. Physiological processes, such as defecation, can also lead to a transient detection of bacterial material in the circulation [3]. Furthermore, in patients with CHD, the structure and permeability of the intestinal epithelium has been shown to be altered [4], enhancing the possibility of bacteria and/or their residuals translocating from the gut into the epithelium and continue into blood. The main beneficial functions of normal intestinal bacteria populations include protecting the host against invading pathogens (known as colonization resistance), supporting energy metabolism by digesting carbohydrates and proteins that the host cannot digest on its own, modulating the function and structure of the immune system, as well as vitamin (vitamin K and some B-vitamins) biosynthesis and mediating the breakdown of dietary carcinogens [5, 6]. The most dominant taxa normally present in the intestine are Bacteroidetes,Firmicutes, Proteobacteria, and Actinobacteria [7]. Bacteroidetes and Firmicutes phyla are the majority, representing 56% and 29% of the microbiota, respectively, followed by Actinobacteria at 6% and Proteobacteria at 4% [8]. At the species level, a healthy individual’s gut microbiota mainly consists of Bacteroides spp., Bifidobacterium spp., Enterobacter spp., Peptostreptococcus spp., and bacteria belonging to the Clostridium coccoides (cluster XIVa) and Clostridium leptum (cluster IV) groups [9,10]. Fecal Streptococcus spp. have been reported to represent 1%–10% of the total aerobic intestinal flora and, together with Enterobactericeae, comprise the main facultative anaerobes [11]. Lactobacillus spp. has been estimated to present �1% of the total bacterial population in the distal human gut and is estimated to constitute approximately 0.3% of all bacteria in the colon [12]. Gut bacteria and atherosclerosis PLOS ONE | https://doi.org/10.1371/journal.pone.0221345 August 22, 2019 2 / 14 Finland (286284) to Professor Terho Lehtima¨ki; Syda¨ntutkimussa¨a¨tio¨to Professor Terho Lehtima¨ki and Professor Pekka J Karhunen; the Tampereen Tuberkuloosisa¨a¨tio¨to Professor Terho Lehtima¨ki; the Diabetes Research Foundation of Finnish Diabetes Association to Professor Terho Lehtima¨ki; the European Union 7th Framework Program for the AtheroRemo Project [grant number 201668] to Professor Terho Lehtima¨ki and Professor Pekka J. Karhunen. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: We have the following interests: Sari Tuomisto, Terho Lehtima¨ki and Pekka J. Karhunen have been employed by Fimlab Laboratories Ltd. There are no patents, products in development or marketed products to declare. This does not alter our adherence to all the PLOS ONE policies on sharing data and materials. During the first three years of life, the intestinal microbial community becomes stable [13]. After this it is mainly modified by diet, bacterial infections, antibiotics, surgeries, or other major invasions [14,13]. In old age there is a decline in microbiota diversity. According to Pe ´rez Martı ´nez et al. and Rondanelli et al., there is an increase in Proteobacteria, a decrease in Bifidobacteria, and a decrease in the ratio of Firmicutes to Bacteroidetes [15,16]. Age-related perturbation in the gut microbiome is suggested to be an important determinant of age-associated pathological states, such as chronic inflammation [17] and cardiovascular disease [18], possibly due to a decline in immune system function—e.g. immunosenescence [19]. Such a change in the functional profile may be associated with an increase in the proportion of pathogenic bacteria commonly present in low numbers in the adult gut ecosystem. However, it is not known whether changes in the normal gut microbiome composition might associate with the severity of coronary atherosclerosis. The aim of this study was to investigate age-dependent changes in the major populations of the intestinal microbiome and their possible association with atherosclerotic severity and death due to CHD. Furthermore, we studied whether such intestinal derived bacterial DNA can be found in coronary plaques, which could indicate the translocation of gut bacteria via the portal vein into circulation and further into coronary plaques. Six groups, namely Bacteroides spp. (Bacteroidetes), Clostridium spp. (Firmicutes), Streptococcus spp. (Firmicutes), Lactobacillus spp. (Firmicutes), Bifidobacterium spp. (Actinobacteria), and Enterobactericeae (Proteobacteria), were chosen, since they represent the genera of the major phyla [20]. Materials and methods The present study comprises a prospective series of 67 males (mean age 59 years, range 18–95 years, Table 1) subjected to medico-legal autopsy in the Department of Forensic Medicine at the University of Tampere as a part of the Tampere Sudden Death Study. The selection criteria for the cases were: out-of-hospital death, male gender, time elapsed post-mortem less than 6 days, intact middle torso and bowel, no signs of bacterial infections or drug addiction, and no visible wounds or necrosis. Death due to CHD was determined by forensic pathologists according to cause of death selection guidelines by WHO from 1965 as well as the most recent Table 1. Demographic characteristics of the study subjects. CHD cases Non-CHD Deaths Healthy volunteers P-value N 34 33 7 Post mortem time (days, mean) 4 3 0.270 Age mean (range) 68 (44–95) 49 (18–75) 45 (26–57) 0.000 BMI mean (range) 26.8 (20.7–48.0) 28.6 (15.2–42.8) 27.1 (20.8–37.2) 0.409 Cause of death CHD % 100 (100%) 0 (0%) other disease % 0 (0%) 16 (48%) non-natural death 1 0 (0%) 17 (52%) Coronary atherosclerosis fatty streak area (%) 7.4 (0–32.6) 7.4 (0–54.7) - 0.871 fibrotic lesion area (%) 15.8 (0–66.5) 16.6 (0–42.0) - 0.585 calcification area (%) 20.4 (0–26.5) 3.18 (0–78.2) - 0.000 Coronary stenosis (%) 58.1 (0–100) 26.8 (0–80.7) - 0.000 1 suicide, accident, poisoning CHD = coronary heart disease. BMI = body mass index. P-values over the groups were calculated with ANOVA. https://doi.org/10.1371/journal.pone.0221345.t001 Gut bacteria and atherosclerosis PLOS ONE | https://doi.org/10.1371/journal.pone.0221345 August 22, 2019 3 / 14 10 th version of the International Classification of Diseases (ICD-10), and based on autopsy findings, microscopic examinations, and toxicological screening. Of the cases, 34 (51%) died of CHD with or without an old myocardial infarction, and 33 (49%) died of non-CHD-related causes. There were no cases with acute myocardial infarction in this series. As expected, CHD cases were significantly older and suffered from more severe coronary atherosclerosis than non-CHD-related death cases. There were no statistical differences in BMI or post-mortem time. The time interval between death and storage of the body in the mortuary was less than 24 hours in all cases. In the mortuary, the bodies were kept at 4˚C. Low temperatures prevent bacterial growth, with bacterial populations unlikely to alter. Based on hospital records, incident police reports with data on drugs found at the home and possible treatments, as well as physician admission notes, none of the victims suffering sudden out-of-hospital death used antibiotics within two weeks prior to death. Fecal samples of 7 healthy volunteers were collected to serve as healthy controls for comparison with the deceased study subjects. The mean age of the volunteers was significantly younger compared to autopsy cases. Healthy volunteers had not used antibiotics prior to sampling. Ethics statement The study was approved by the Ethics Committee of the Pirkanmaa Hospital District and the National Supervisory Authority for Welfare and Health (VALVIRA). Written consent was obtained from volunteers. Analysis of relative ratios of gut bacteria in fecal samples Fecal samples were taken aseptically from the rectum of autopsy cases, transferred to the laboratory in closed sterile Petri dishes, immediately frozen and stored at -80˚C until further processing. Bacterial DNA from 150 mg (wet weight) was extracted from samples using a commercial DNA extraction kit (Zymo Fecal DNA Kit, Zymo Research Corporation, Irvine, California, USA) according to the instructions provided. The relative quantity of major gut bacteria populations in a sample was determined by qPCR using specific oligonucleotide primers and probes (Table 2) for Bacteroides spp. [21], the Clostridium leptum group [22], the Clostridium coccoides group [22], Bifidobacterium spp. [22], Enterobactericeae [23], Lactobacillus spp. [23], and Streptococcus spp., mainly of the Str. mitis-group (recognition of Str.mitisgroup (Str.mitis Str.oralis,Str.gordonii,Str.sanguinis, Str.pneumonia), Str.salivarius,Str.thermophilus, uncultured streptococci, Lactobacillus lactis) [24], as previously presented [25,24]. The total amount of gut bacteria was measured using universal bacterial primers and probes as earlier described [26]. Amplification primers and probes were synthesized according to sequences published and verified by BLAST on the National Centre for Biotechnology Information server (http://www.ncbi.nlm.nih.gov/) and Ribosomal Database Project (http://rdp.cme.msu.edu/probematch/search.jsp). The specificity and cross-reactivity of the designed primers and probes were tested using bacterial cultures from clinical samples as earlier described [25,23,24]. The results of Streptococcus, mainly of the Str.mitis-group were marked as Streptococcus spp.. The efficiency of the used universal primers and probe calculated from the dilution curve has been ca. 82%-100% (amplification factor 1.87–2.00), for Bacteroides spp. primers and probe 99% (amplification factor 1.99), Bifidobacterium spp. 100% (amplification factor 2.00), C.leptum group 106% (amplification factor 2.06), C.coccoides group 106% (amplification factor 2.06), Streptococcus spp, mainly S.mitis group 97% (amplification factor 1.97), Lactobacillus spp. 99% (amplification factor 1.99), Enterobactericeae 97% (amplification factor 1.97), Gut bacteria and atherosclerosis PLOS ONE | https://doi.org/10.1371/journal.pone.0221345 August 22, 2019 4 / 14 RNaseP 104% (amplification factor 2.04). In the relative qPCR method, the result is given in relation to the reference. Assays for fecal samples were performed with the AbiPrism 7500 HT Sequence Detection System (Taqman, Applied Biosystems, USA) in a reaction volume of 20 μl in 96-well reaction plates under standard conditions, using specific Taqman allele hybridization according to instructions. The AbiPrism 7900 HT Sequence Detection System (Taqman, Applied Biosystems, USA) was used for coronary artery samples with a reaction volume of 5 μl. All amplifications and detections were carried out as duplicates or quadruplicates (in uncertain cases). The Master Mix was prepared using Taqman Environmental Master Mix for fecal samples, with a final concentration of 1000 nM for each primer, and 250 nM for each fluorescently labeled probe. DNA from fecal samples were diluted to a ratio of 1:100. One microliter of sample DNA was added to PCR reactions for detection. The amplification data were analyzed with SDS 2.2 software (Applied Biosystems), which calculates ΔRn using the equation Rn(+)−Rn(−). Rn(+) is the emission intensity of the reporter Table 2. The primers and probes used. Primer and probe Sequence (5’-3’) Reference Bacteroides spp. Forward TGGTAGTCCACACAGTAAACGATGA [21] Reverse CGTACTCCCCAGGTGGAATACTT Probe GTTTGCCATATACAGTAAGCGGCCAAGCG Bifidobacterium spp. Forward CGGGTGAGTAATGCGTGACC [22] Reverse TGATAGGACGCGACCCCA Probe CTCCTGGAAACGGGTG Clostridium leptum group Forward CCTTCCGTGCCGSAGTTA [22] Reverse GAATTAAACCACATACTCCACTGCTT Probe CACAATAAGTAATCCACC Clostridium coccoides group Forward GACGCCGCGTGAAGGA [22] Reverse AGCCCCAGCCTTTCACATC Probe CGGTACCTGACTAAGAAG Enterobactericeae Forward GCGGTAGCACAGAGAGCTT [23] Reverse GGCAGTTTCCCAGACATTACTCA Probe CCGCCGCTCGTCACC Streptococcus spp., mainly the Str.mitis-group Forward CCAGCAGCCGCGGTAATA [24] Reverse CCTGCGCTCGCTTTACG Probe ACGCTCGGGACCTACG Lactobacillus spp. Forward GCTAGGTGTTGGAGGGTTTCC [23] Reverse CCAGGCGGAATGCTTAATGC Probe TCAGTGCCGCAGCTAA Universal Forward TGGAGCATGTGGTTTAATTCGA [26] Reverse TGCGGGACTTAACCCAACA Probe CACGAGCTGACGACA[A/G]CCATGCA https://doi.org/10.1371/journal.pone.0221345.t002 Gut bacteria and atherosclerosis PLOS ONE | https://doi.org/10.1371/journal.pone.0221345 August 22, 2019 5 / 14 divided by the emission intensity of the quencher at any given time, whereas Rn(−) is the value of Rn(+) prior to PCR amplification. Thus, ΔRn indicates the magnitude of the signal generated. The critical threshold cycle (Cq) is the cycle at which a statistically significant increase in ΔRn is first detected and at which the fluorescence becomes detectable above the background. Cq is inversely proportional to the logarithm of the initial number of template molecules, i.e. the initial amount of sample DNA. The relative amount (N-fold value) of bacterial DNA in the sample was determined with a comparative Cq method (ΔΔCq, ΔCq sample −ΔCq reference sample ), applied with a simplification [25,27,28,29,30]. First, ΔCq differences between specific bacterium and universal bacterium measurements were calculated for each sample, then ΔΔCq for the sample and reference. As a reference value for fecal ΔΔCq calculation for cases of CHD vs. non-CHD deaths, the mean Cq value from the non-CHD autopsy group was used. Similarly, for age-dependent fecal calculations, the mean Cq value from the <50 group was used as a reference. This calculation method yields an n-fold difference in the amounts of specific bacteria between samples and the reference. Computer-assisted morphometric measurement of coronary atherosclerosis Coronary arteries were opened aseptically and stored on closed sterile Petri dishes then fixed onto cardboard with needles for digital computer-assisted morphometric quantification of the plaque (with the program Olympus cell^D, Greece). A transversally cut piece containing the most severe atheroma or plaque of the coronary artery—the predilection site of atherosclerosis— was stained using the Verhoeff-hematoxylin eosin method to visualize the internal and external elastic membranes and allow measurement of coronary stenosis percentage. Analysis of coronary plaque bacterial DNA For DNA extraction, a transversally cut piece from the most severe coronary atheroma of the coronary artery was surgically extracted and stored at -80˚C until DNA extraction with the Qiagen MiniKit (Qiagen, Germany). The relative quantity of bacteria in plaque samples was determined by qPCR with universal bacterial primers and specific oligonucleotide primers and probes for intestinal bacteria, as described above, using universal measurements as a reference for ΔCq calculation. Maxima Probe/ROX qPCR Master Mix (Thermo Scientific, Massachusetts, USA) was used for qPCR assays on coronary plaque samples. DNA from coronary samples was not diluted for PCR. For determination of the total amount of bacterial DNA, a commercially available human housekeeping gene, RNaseP (TaqManCopy Number Reference Assay, Applied Biosystems, Foster City, CA), was used as a reference [30,31,32]. For coronary plaque samples, a ΔCq value of a combined 4 control cases with healthy arteries (fatty streak, fibrotic lesion, and calcified plaque area all 0%), was used as a reference to determine bacterial DNA positivity and relative amounts in samples. The differences in Cq values between candidate bacteria and universal bacteria measurements (ΔCq) were calculated for each sample, after which a comparative Cq (ΔΔCq) for the sample and reference was calculated. Samples were marked as positive for the candidate bacteria, if 2 -ΔΔCq >= 2 [24,33]. Statistics Median values and statistical calculations for the different study groups were calculated using IBM SPSS Statistical Software version 21 (IBM Corp. released 2012. IBM SPSS Statistics for Windows, Version 21.0. Armonk, NY: IBM Corp.). The Kruskal-Wallis median test was used to measure significant differences over the groups in intestinal bacterial samples. If these were Gut bacteria and atherosclerosis PLOS ONE | https://doi.org/10.1371/journal.pone.0221345 August 22, 2019 6 / 14 less than 0.05, post hoc pairwise comparisons with the Mann-Whitney U test were performed. In the case of less than three different study groups, the Mann-Whitney U test was used. A pvalue of less than 0.05 was considered statistically significant. Bonferroni correction to control multiple testing was implemented, the p-value cutoffs defined as 0.05/7 bacterial groups = 0.007. Correlations were calculated with Spearman’s rho. Results Major commensal Gut bacteria in healthy volunteers and autopsy cases Median values of relative amounts of the measured bacterial groups in fecal samples of autopsy cases were similar to those of healthy volunteers (1.1 vs. 1.3, p = 0.793, for Bacteroides spp.; 1.3 vs. 1.4, p = 0.420, for the Clostridium leptum group; 0.8 vs. 1.0, p = 0.822, for the Clostridium coccoides group; 1.1 vs. 0.8, p = 0.694, for Bifidobacterium spp.; 0.9 vs. 0.8, p = 0.852, for Enterobactericeae; 2.6 vs. 1.1, p = 0.486, for Lactobacillus spp.; and 3.3 vs. 2.7, p = 0.408, for Streptococcus spp. mainly of the Str.mitis group (Mann-Whitney U test; data not shown)). Age-dependent changes in relative ratios of major commensal gut bacterial populations Inter-individual and within-individual differences were high in all the measured intestinal bacteria in gut samples. The relative N-fold ratio values of Bacteroides spp., the Clostridium coccoides group, Bifidobacterium spp., and Lactobacillus spp. did not change with advancing age (Fig 1). However, the relative ratios of the Clostridium leptum group (p = 0.003, KruskalWallis), Enterobactericeae family (p = 0.056), and Streptococcus spp. (n.s.) increased with age: relative ratios of the Clostridium leptum group were highest in the oldest age group (>70 years, n = 19), whereas ratios of Enterobactericeae were already significantly (p = 0.011) increased in the middle-aged group (50–69 years; n = 34) in comparison to those aged under 50 years (n = 14). Relative N-fold ratios of Streptococcus spp. increased with age from 1.1 to 7.4 in middle age and to 7.7 in the oldest age group, but these differences were not statistically significant. Fig 1. Age-dependent changes in gut bacterial populations in autopsy fecal samples. Age-dependent changes in relative amounts (i.e. n-fold differences) of the measured bacteria (Bacteroides spp., Clostridium (C.) leptum group, C.coccoides group, Enterobactericeae,Bifidobacterium spp., Lactobacillus spp., Streptococcus spp.). Individual values are presented as boxes, median values as horizontal lines. As a reference value for fecal ΔΔCq calculation, the mean Cq value from the <50 age group was used. Comparisons were calculated first over the groups with the Kruskall-Wallis test and then pairwise with the non-parametric Mann-Whitney U test. https://doi.org/10.1371/journal.pone.0221345.g001 Gut bacteria and atherosclerosis PLOS ONE | https://doi.org/10.1371/journal.pone.0221345 August 22, 2019 7 / 14 Major commensal gut bacteria in CHD and non-CHD cases When comparing amounts of intestinal bacteria in cases of CHD-related death against nonCHD-related deaths, three times more (n-fold 3.4 vs 0.9, p = 0.043) bacteria of the Clostridium leptum group were found in victims of out-of-hospital sudden cardiac death. While a decrease in the amount of Bifidobacterium spp. (n-fold 1.2 vs 0.6) was also observed, this and other differences were not statistically significant. The association of changes in gut bacteria with coronary atherosclerosis Association of the differences in relative ratios of the measured intestinal bacterial genomes in the gut with the extent and severity of coronary atherosclerosis were then analyzed using values below or above the median fatty streak areas as well as fibrotic plaque and calcified plaque areas (Table 3). Increased ratios of fecal Enterobactericeae were associated with a larger coronary plaque fibrotic area (20.96 vs 0.85; p = 0.001) and increased ratios of the Clostridium leptum group with a larger calcification area (3.50 vs. 0.89; p = 0.015). Increased ratios of Streptococcus spp. in the gut (4.72 vs. 0.59; p = 0.061) also tended to associate with coronary calcification areas. Table 3. The association of gut bacteria with atherosclerotic lesions. Gut bacteria Atherosclerosis Lesion Type Atherosclerosis Area (N-fold differences) <Median >Median P-value Bacteroides spp. Fat % 1.20 0.89 0.168 Fibrosis % 1.21 1.44 0.896 Calcification % 1.69 2.12 0.177 C.leptum group Fat % 1.74 1.00 0.783 Fibrosis % 0.97 1.96 0.265 Calcification % 0.89 3.50 0.015 C.coccoides group Fat % 0.51 0.48 0.635 Fibrosis % 0.72 1.22 0.537 Calcification % 0.85 0.64 0.605 Bifidobacterium spp. Fat % 1.23 0.98 0.778 Fibrosis % 1.47 0.49 0.344 Calcification % 0.76 0.63 0.582 Enterobactericeae Fat % 0.62 1.00 0.869 Fibrosis % 0.85 20.96 0.001 Calcification % 0.97 0.62 0.557 Lactobacillus spp. Fat % 0.74 0.93 0.347 Fibrosis % 1.14 0.79 0.812 Calcification % 0.96 1.74 0.145 Streptococcus spp. Fat % 2.44 2.14 0.537 Fibrosis % 2.22 2.02 0.865 Calcification % 0.59 4.72 0.061 Association of the relative amounts (n-fold differences) of measured intestinal bacteria in fecal samples with extent of atherosclerotic lesions (% of coronary surface area) in left ascending coronary artery (LAD) coronary plaques. The fatty streak area and areas of fibrotic and calcified lesions were dichotomized into below-median (n = 33) and above-median (n = 33) groups (the median value was 3.03 for fat, 13.45 for fibrosis, and 3.93 for calcification). N-fold values for bacteria were calculated using the average Cq value in the <median group as a reference. P-values have been calculated with the non-parametric Mann-Whitney U test. LAD = Left ascending coronary artery. https://doi.org/10.1371/journal.pone.0221345.t003 Gut bacteria and atherosclerosis PLOS ONE | https://doi.org/10.1371/journal.pone.0221345 August 22, 2019 8 / 14 When statistical relationships between intestinal bacteria and different factors in CHD and non-CHD groups were analyzed, a correlation was found between age and the Clostridium leptum group (0.416, p = 0.001, Spearman’s rho). Furthermore, the Clostridium leptum group correlated with LAD stenosis (0.260, p-value = 0.035) and LAD calcification (0.351, p-value = 0.005). Enterobactericeae correlated with LAD fibrosis area percentage (0.442, p-value = 0.008), whereas Bifidobacterium spp. correlated negatively with LAD fibrosis area percentage (-0.411, p-value = 0.042). Bacterial DNA in coronary plaques Bacterial DNA was found in 68% of coronary samples, while 33% of coronaries did not contain any amplifiable bacterial DNA and were thus considered bacterial-DNA-negative (Fig 2A). DNA of the Streptococcus spp. (mainly of the S.mitis group) was the most common finding (41.02%), followed by Enterobactericeae (12.07%), the Clostridium leptum group (2.41%), and Lactobacillus spp. (2.41%). Based on the amount of bacterial DNA detected by universal primers, 9.65% of the coronary plaque samples carried DNA of bacteria not covered by the specific primers. When the analysis was restricted to CHD cases, the amount of Streptococcus spp.– positivity increased and the amount of bacterial-negativity decreased, but the results were not statistically significant (Fig 2B). The number of bacteria-positive findings was found to increase with age, whereas bacterianegative findings did not show any age-dependence (Fig 2C). The most important finding was the percentage of Streptococcus spp. DNA decreased and Enterobactericeae increased in coronary plaques with age, but these trends did not reach statistical significance, most probably due to the small number (n = 37) of cases. The bacteria-positive group tended to suffer from more severe coronary artery disease, but differences were not statistically significant, possibly partly due to the small size (n = 37) of the study population. The bacteria-positive group had more severe percentages of coronary stenosis (43.5% vs. 32.3%. respectively, p = 0.212) compared to the bacteria-negative group. Correspondingly, the bacteria-positive group tended to have a larger fatty streak area (5.3% vs. 0.0%, p = 0.166), fibrosis plaque area (17.5% vs. 15.9%, p = 0.934), and calcification area (4.2% vs 3.8%, p = 0.704). Discussion In this autopsy study, we utilized qPCR to measure age-dependent differences in the composition of major commensal gut microbiota and their association with coronary atherosclerosis Fig 2. Gut bacterial translocation and bacterial DNA positivity in coronary plaques (n = 37). 2A. Bacterial DNA detected in coronary artery samples (total n = 37) using specific primers and probes for Bacteroides spp., Clostridium (C.) leptum group, Clostridium coccoides group, Bifidobacterium spp., Enterobactericeae,Lactobacillus spp., and Streptococcus spp. in all samples. The total amount of gut bacteria was measured using universal bacterial primers and probe described in Tuomisto et al., 2014 [25]. 2B. Bacterial DNA detected in coronary artery samples of CHD samples. 2C. Age-dependent translocation of gut bacteria into plaques. https://doi.org/10.1371/journal.pone.0221345.g002 Gut bacteria and atherosclerosis PLOS ONE | https://doi.org/10.1371/journal.pone.0221345 August 22, 2019 9 / 14