Gliding motility and expression of motility-related genes in spreading and nonspreading colonies of Flavobacterium columnare

This is an electronic reprint of the original article. This reprint may differ from the original in pagination and typographic detail. Author(s): Title: Year: Version: Please cite the original version: All material supplied via JYX is protected by copyright and other intellectual property rights, and duplication or sale of all or part of any of the repository collections is not permitted, except that material may be duplicated by you for your research use or educational purposes in electronic or print form. You must obtain permission for any other use. Electronic or print copies may not be offered, whether for sale or otherwise to anyone who is not an authorised user. Gliding motility and expression of motility-related genes in spreading and nonspreading colonies of Flavobacterium columnare Penttinen, Reetta; Hoikkala, Ville; Sundberg, Lotta-Riina Penttinen, R., Hoikkala, V., & Sundberg, L.-R. (2018). Gliding Motility and Expression of Motility-Related Genes in Spreading and Non-spreading Colonies of Flavobacterium columnare. Frontiers in Microbiology, 9, 525. doi:10.3389/fmicb.2018.00525 2018 1 Gliding motility and expression of motility-related genes in 1 spreading and nonspreading colonies of Flavobacterium 2 columnare 3 Reetta Penttinen*, Ville Hoikkala and Lotta-Riina Sundberg 4 University of Jyvaskyla, Centre of Excellence in Biological Interactions, Department of 5 Biological and Environmental Science and Nanoscience Center, University of Jyvaskyla, 6 Finland. 7 *Corresponding author: 8 Reetta Penttinen 9 University of Jyvaskyla 10 Department of Biological and Environmental Science 11 P.O. Box 35, FI-40014 University of Jyvaskyla, Finland. 12 E-mail: [email protected] 13 Tel. +358408053858 14 15 Running head: Gliding motility in Flavobacterium columnare 16 Key words: colony type, Flavobacterium columnare, gene expression, gliding motility, 17 nutrients, RT-qPCR, T9SS, type IX secretion system 18 19 2 ABSTRACT 20 Gliding motility machinery enables moving on surfaces in many species among 21 Bacteroidetes, resulting in bacterial colonies with spreading appearance. The adhesins 22 required for gliding are secreted through a gliding motility –associated protein secretion 23 system known as the type IX secretion system (T9SS). The fish pathogen Flavobacterium 24 columnare produces spreading (Rhizoid, Rz; Soft, S) and nonspreading (Rough, R) colony 25 types, of which only the spreading Rz type is virulent. In this study, we explored the 26 spreading behaviour of these colony types by microscopic imaging and measured the 27 expression of genes associated with gliding motility and T9SS (gldG, gldH, gldL, sprA, sprB, 28 sprE, sprF, sprT and porV) under high and low resource levels. The spreading colony types 29 responded to low resource level by increased colony size. The nonspreading colony type as 30 well as the cells subjected to high nutrient level expressed only moderate cell movements. 31 Yet, low nutrient level provoked more active gliding motility by individual cells and 32 increased biofilm spreading by cooperative gliding. The gene expression survey 33 demonstrated an increased expression level of sprA and sprF under low nutrient conditions. 34 Surprisingly, the expression of gliding motility genes was not consistently associated with 35 more active spreading behaviour. Our study demonstrates that environmental nutrient level is 36 an important regulator of gliding motility and also the expression of some of the associated 37 genes. Furthermore, our results may help to understand the connections between nutrient 38 concentration, gliding motility and virulence of F. columnare. 39 INTRODUCTION 40 Gliding motility is a process of bacterial movement on surfaces in several bacterial species in 41 the phylum Bacteroidetes (1). Instead of involvement of flagellae or pili, gliding motility is 42 enabled by complex machinery which has been studied more closely in Flavobacterium 43 johnsoniae (for a review of Flavobacterium gliding motility, see (2)), a model system for 44 gliding motility. Number of studies on flavobacterial gliding motility have led to 45 identification of several genes involved in motility, including gldA, gldB, gldD, gldF, gldG, 46 gldH, gldI, gldJ, gldK, gldL, gldM, gldN, sprA, sprB, sprE, sprT (3-15). Furthermore, a 47 subset of these genes, gldK, gldL, gldM, gldN, sprA, sprE and sprT, has been found to 48 compose a protein translocation system, designated as type IX secretion system (T9SS) (1, 49 10). T9SS-related genes are restricted to Bacteroidetes, with no prevalent similarity between 50 3 the previously described secretion systems (1). T9SS has an important role in secretion of 51 gliding motility adhesins, required for surface contact, but also for secretion of virulence 52 factors (10, 16). For example, periodontal pathogen Porphyromonas gingivalis uses T9SS for 53 secretion of its major virulence factors, gingipains and hemagglutinins (10, 16). 54 The exact role of each component in the gliding motility machinery of F. 55 johnsoniae is not yet fully understood. GldB, GldD, GldH, GldI and GldJ are lipoproteins 56 needed for gliding but their exact functions are not known (4, 5, 7-9). GldA, GldF and GldG 57 form an ABC transporter but its role in gliding is still poorly known (3, 6). sprB is a motility 58 adhesin needed for gliding and it is secreted via the T9SS (10). SprB encoding gene is located 59 in operon sprCDBF where it is transcribed together with sprC and sprD, genes coding for 60 proteins that support SprB function, and sprF which is needed for successful secretion of 61 SprB (17). In addition, a recently identified secretion-related gene, porV, is needed for 62 secretion of chitinase and adhesin RemA in F. johnsoniae (14). The mechanisms that control 63 the assembly and activity of gliding motility machinery and T9SS are not known. In P. 64 gingivalis, a two-component regulative system, consisting of PorX and PorY, regulates the 65 expression of a subset of T9SS genes (10). 66 F. columnare is a fish pathogen belonging to phylum Bacteroidetes. F. 67 columnare carries the majority of the orthologous genes (18) involved in Flavobacterium 68 gliding motility and T9SS, which are used for virulence factor secretion and formation of 69 spreading colonies (2, 10). Recently, a transcriptome-wide study in F. columnare strain 70 ATCC 49512 demonstrated that genes associated with gliding motility and spreading are 71 located in actively transcribed operons (19). F. columnare can form different colony 72 morphotypes, spreading colony types Rz (rhizoid) and S (soft) and nonspreading type R 73 (rough) (20, 21). Spreading colony morphology has been suggested to be essential for F. 74 columnare virulence (20, 21), and indeed, only the spreading rhizoid Rz type is virulent in the 75 fish host (20-22). Furthermore, changes in nutrient concentration in agar culture changes 76 spreading of F. columnare colonies, especially in the virulent Rz type (20). Nutrient 77 availability has also a significant impact on virulence in F. columnare as high nutrient level 78 induces higher virulence in the bacteria (23, 24). However, the functionality of gliding 79 motility and T9SS in different F. columnare morphotypes is not known, although gldL, gldM, 80 gldN, and gldH have been suggested as putative virulence-associated factors in F. columnare 81 (25, 26). Here, we explored gliding motility in F. columnare spreading (Rz, S) and 82 nonspreading (R) morphotypes under conditions that were expected to induce (low-nutrient) 83 or reduce (high-nutrient) spreading behaviour. Gliding motility and individual cell 84 4 movements were seen to be more active under low-nutrient conditions. We also performed a 85 RT-qPCR (Reverse Transcription quantitative PCR) assay in order to measure the gene 86 expression of T9SS or gliding motility -associated genes gldG, gldH, gldL, sprA, sprB, sprE, 87 sprF, sprT and porV. Of these genes, gldL, porV, sprA, sprE and sprT are associated with the 88 T9SS. Increased gene expression in response to low nutrient availability was detected in sprA 89 and sprF. However, the spreading and nonspreading colony types had different expression 90 profiles under different resource levels which could be an indication of divergent metabolic 91 programs. 92 93 RESULTS 94 95 Nutrient availability regulates colony spreading in Rz and S morphotypes 96 The morphology of bacterial colonies originating from the same bacterial liquid culture and 97 grown on 0.5xN or 2xN Shieh plates for 2 days was detected (Figure 1). Rz colonies grown 98 on 0.5xN Shieh plate were spreading with increased mean colony size (3.95 cm, S.E. +/- 99 0.42) and production of root-like protrusions typical for Rz morphology (Figures 1 and 2A). 100 Rz colonies grown on 2xN Shieh plates had smaller mean colony size (0.73 cm, S.E. +/- 101 0.04) and root-like structures, if seen, were only moderate (Figures 1 and 2A). Type S 102 responded to changing nutrient availability comparably to Rz (mean colony size 2.4 cm, S.E. 103 +/- 0.23 in 0.5xN and 0.75 cm, S.E. +/- 0.06 in 2xN). However, when grown at lower nutrient 104 conditions (0.5xN Shieh), root-like structures were observed also in S type. These colonies 105 were, nevertheless, distinguishable from Rz colonies by their non-adherent, opaque and moist 106 colony appearance (Figure 1). R type did not remarkably alter the colony size in response to 107 changing nutrient availability (mean colony size 0.7 cm, S.E. +/- 0.35 in 0.5xN and 0.5 cm, 108 S.E. +/- 0.00 in 2xN) and root-like structures were seen under low nutrient conditions only 109 occasionally (Figure 2A). 110 Growth and biofilm formation in varying nutrient concentrations 111 The viability of Rz, R and S colony types in 0.5xN and 2xN Shieh medium was measured as 112 maximum optical density (OD max ) reached during a 65-hour-cultivation (Figure 2B). All the 113 colony types reached the highest OD max at higher nutrient level (2xN Shieh). The biofilm 114 forming ability was remarkably higher under low nutrient condition (0.5xN Shieh) in the Rz 115 5 type compared to 2xN Shieh as well as R and S types, which were weaker biofilm producers 116 in both nutrient levels (Figure 2B). 117 Imaging of bacterial movements 118 The movements of individual Rz cells grown on 0.5xN and 2xN Shieh agar plates was 119 recorded with a confocal microscope. The movements of Rz cells were comparable with 120 previously described gliding motility of F. johnsoniae: the cells glided over surface 121 straightforwardly, occasionally attaching to the surface with one end of the cell, rotating and 122 changing the moving direction (Supplementary Videos 1-2). The gliding speed was slower 123 than that seen in F. johnsoniae which was used as reference (data not shown). 124 The movements of individual bacteria growing as a part of forming biofilm were recorded 125 between agar layer and microslide chamber bottom. The colony types Rz and S formed a 126 monolayer on the edges of spreading bacterial biofilm where the cells were organized side by 127 side and glided along the adjacent cells (Figure 3; Supplementary Videos 3-4 and 7-8). The 128 cells formed branching rhizoid-like structures, a few cells wide, (here referred to as 129 microrhizoids) which involved both motile and non-motile cells. In both Rz and S types, 130 more active gliding motility was seen under low nutrient concentration (0.5xN). Colony type 131 R expressed only occasional movements regardless of the nutrient level and cellular 132 organization as a spreading biofilm was not observed (Supplementary Videos 5-6). In order 133 to visualize F. columnare colony formation at longer timescale, the growth of Rz colony type 134 on 1x Shieh was recorded during an 8-hour recording (Supplementary Video 9). In the front 135 of the biofilm, the bacteria were characteristically organized in microrhizoids which moved 136 cooperatively towards the spreading direction of the biofilm and seemed also to serve as 137 routes along which other cells were able to glide further and support biofilm expansion. 138 Sequence analysis and expression of gliding motility associated genes 139 Genes putatively involved in gliding motility were sequenced from Rz, R and S types of 140 strain F. columnare B067. No genetic differences were detected between the colony types in 141 the gene sequences of operons gldFG and gldKLMN, genes gldH, sprA, sprC, sprD, sprE, 142 sprF, sprT, porV, porX, porY or in the predicted regulative regions upstream the genes gldH, 143 sprA, sprE, porV or operons gldFG, gldKLMN and sprCDBF. Expression of genes gldG, 144 gldH, gldL, sprA, sprB, sprE, sprF, sprT or porV, which are putatively involved in F. 145 columnare gliding motility, was measured in B067 Rz, R and S colony types that had been 146 6 grown on 0.5x and 2x Shieh agar plates. Of these genes gldL, sprA, sprE, sprT and porV are 147 associated with the T9SS. Gene expression results were normalized with reference genes 148 gapdh and glyA which are stably expressed in the current dataset (M value 0.5834 for both 149 genes with variance coefficient of 0.2114 for gapdh and 0.2007 for glyA). Relative 150 expressions are presented in Figure 4 (for statistics, see Tables 2 and 3). Significant 151 differences between colony types were observed in expression of genes gldG, gldH, gldL and 152 sprE (Table 2, Figure 4, for pairwise comparisons see Table 3). Nutrient level had a 153 significant effect on gldL, sprA, sprB and sprF expression. The pairwise comparisons 154 revealed that sprA was expressed at significantly higher level in low-nutrient conditions in Rz 155 and R types, and the same pattern was detected in sprF expression in R type (Table 3; Figure 156 4). However, significant interaction of colony type and nutrient was detected in gldH, gldL, 157 sprA and sprE (Table 2), indicating that gene expression of colony types may differ between 158 nutrient conditions. Indeed, direct associations between spreading behaviour and gliding 159 motility gene expression were challenging to form as different colony types seemed to 160 respond differently to the nutrient level with motility gene expression. Even though a 161 significant effect of colony type was not observed in either sprT or porV, a significant 162 difference between Rz and R was observed in sprT and between Rz and S in porV expression 163 (Table 3). 164 Proteolytic activity and extracellular secretion in different nutrient concentrations 165 Colony types Rz, R and S were cultivated on 0.5xN and 2xN Shieh plates containing 1.5 % 166 skim milk. Proteolytic activity was observed in each colony variant, seen as formation of a 167 clear degradation zone peripheral to the bacterial growth, but no differences between the 168 colony types were observed and the nutrient concentration did not affect to the proteolytic 169 activity (Supplementary Figure S1). Effect of colony type and nutrient availability on 170 contents of extracellularly secreted products (ECP) was analysed further. Generally, Rz, R 171 and S grown in 0.5xN and 2xN liquid Shieh cultures shared a common overall ECP profile, 172 with some moderate changes between individual protein bands between colony types 173 (Supplementary Figure S2). However, a strong protein band, approximately 13 kD in 174 molecular weight, was detected in Rz type grown in both 0.5xN and 2xN Shieh media. The 175 corresponding band was absent or barely detectable in R or S types. 176 7 DISCUSSION 177 Ability to move towards nutrient sources and the host is essential for the survival of bacteria, 178 and bacterial virulence has been shown to be associated with motility in several bacterial 179 species (e.g. (27-29)). Comparative genomic analysis has revealed that members of 180 Bacteroidetes employ a unique gliding motility machinery and a motility-related secretion 181 system T9SS (1). Cells possessing functional gliding motility system form characteristically 182 spreading colonies (2). F. columnare and F. psychrophilum are pathogenic in fish, affecting 183 freshwater aquaculture at a global scale (30-32). It has been suggested that T9SS may have a 184 central role in the pathogenesis of these species (20, 33), but so far this connection has 185 remained poorly understood. We imaged gliding motility of spreading and non-spreading 186 colonies of F. columnare and measured the expression of genes related to gliding and 187 secretion. Colony types Rz and S responded to decreased nutrient concentration by increasing 188 spreading behaviour, but R type did not have this plastic feature, as reported previously by 189 Laanto et al. (20). However, mutations were not found in the studied gliding motility genes, 190 indicating that also other genes may be needed in formation of spreading colonies. Although 191 decrease in nutrients remarkably increased spreading of colonies, it did not correspond to 192 expression of gliding motility genes in a uniform manner. We also found that capacity for 193 extracellular secretion of proteases was maintained in the non-spreading morphologies, which 194 may denote presence of functionally intact secretion systems. 195 Each colony type was viable both at low and high nutrient conditions when they 196 were cultivated in liquid medium. Even though each colony type succeeded better in high 197 nutrient level (in liquid), they all expressed low colony spreading when they were cultivated 198 under the same nutrient conditions on agar plate. This finding indicates that smaller colonies 199 are not produced on high-nutrient-agar due to unfavourable growth conditions but rather as a 200 result of reduced cell motility. In biofilm measurements, we found that Rz type was the most 201 efficient biofilm producer in the low nutrient treatment. However, S type failed to produce 202 biofilm, although this type increased colony spreading under low nutrient conditions. This 203 indicates that spreading per se is not an indicator of biofilm formation. Biofilm formation is a 204 process in which successful adhesion is required in order to attach to a surface (34). As the 205 biofilm formation capacity of S type was comparable to control (growth medium without 206 bacteria) it may be incapable of proper surface adhesion, possibly due to lack of functional 207 cell surface adhesins. Indeed, the colonies of the S type are only moderately adherent (35) 208 and can be easily removed from agar plates compared to the Rz and R colony types. 209 8 However, capacity for extracellular secretion, gliding and adhesion to other cells 210 demonstrated in the S colony type indicates that different adhesins are needed for surface 211 adhesion and social motility of F. columnare. The adhesins required for F. columnare 212 attachment to surfaces of different composition (abiotic or biotic) are yet to be identified. 213 Microscopic microrhizoids were observed at the edge of spreading colonies. 214 Importantly, the cells involved in microrhizoids expressed cooperative behaviour in terms of 215 social motility as they glided along neighbouring cells and thereby mediated the spreading of 216 the biofilm. Previously, we have proposed the involvement of social movements in F. 217 columnare biofilm formation due to coordinated cell organization (22). Indeed, bacterial 218 pathogens are known to cooperate, especially with regards to biofilm formation (see e.g. 219 (36)). Furthermore, high nutrient level reduced gliding behaviour in biofilm. We have 220 recently shown that high environmental nutrient level leads to higher virulence via increased 221 virulence factor expression (23). Therefore, it remains to be resolved whether motility itself is 222 essential for F. columnare virulence or if gliding motility and virulence are related solely via 223 a common secretion route for adhesins and virulence factors. 224 Previous studies in F. johnsoniae have demonstrated that a mutation in any of 225 the gliding motility genes will result in disruption of the gliding motility machinery and 226 formation of non-spreading colonies (see e.g. (2)). In order to study the genetic background 227 of gliding motility in F. columnare spreading and nonspreading colony types, we sequenced 228 genes involved in gliding motility apparatus and T9SS; gldH, sprA, sprE, sprF, sprT, porV 229 and genomic regions spanning gldFG, gldKLMN and sprCD. Surprisingly, these genes were 230 identical between the spreading (Rz and S) and the nonspreading (R) colony types. 231 Furthermore, genetic differences were not found in the predicted regulatory regions. 232 Sequence analysis of other gld genes could provide information on differences between the 233 colony types, but it is possible that also other genes are involved in colony spreading. In F. 234 johnsoniae, for example, secDF mutants were incapable for gliding motility and chitin 235 utilization, and produced non-spreading colonies (37). It was hypothesized that SecDF may 236 not be involved in gliding directly, but may have a role in translocation of GldJ (37). 237 Furthermore, transposon mutagenesis revealed that a thiol oxidoreductase-like protein TlpB 238 is associated with gliding motility and virulence in F. psychrophilum (38). Thiol 239 oxidoreductases are essential for folding of several proteins, including those related to 240 virulence (39), but their function in F. columnare has not been studied. 241 We studied the gene expression of gliding motility or spreading -associated 242 genes in low nutrient (0.5x Shieh) and high nutrient (2x Shieh) agar media. Colony 243 15 sequencing instrument, Applied Biosystems 3130xl Genetic Analyzer. The identity of each 433 base was determined with at least two good quality reads. Basecalling was done using 434 Sequence Analysis 6 (Applied Biosystems). Gene sequence assembly and the alignment of 435 homologous sequences of different colony types were performed with Geneious 8.1.5 436 (Biomatters Ltd). The assembled gene and regulative region sequences of Rz, R and S colony 437 types are found in GenBank (accession number in brackets); gldFG (MF278296), upstream 438 region of operon comprising gldH (MF278297), gldH (MF278298), gldKLMN (MF278299), 439 upstream region of operon comprising sprA (MF278305), sprA (MF278306), sprCD 440 (MF278307), sprE (MF278308), sprF (MF278309), sprT (MF278300), upstream region of 441 operon comprising porV (MF278301), porV (MF278302), porX (MF278303) and porY 442 (MF278304). 443 Protease activity and ECP production in different nutrient concentrations 444 To study the effect of nutrient level on proteolytic activity, B067 colony types Rz, R and S 445 were cultivated in 0.5xN and 2xN Shieh medium and 10 µl of bacterial culture (containing 446 1.4 × 10 6 CFUs +/- 4 × 10 4 S.E. on average) were spotted respectively on 0.5xN or 2xN 447 Shieh agar plates containing 1.5 % skim milk (Merck). Plates were incubated for 2 days at 448 RT after which the clear zone (indicating proteinase production) around the bacterial growth 449 was detected. 450 Extracellular product (ECP) samples were prepared as follows: eight ml from F. 451 columnare Rz, R and S liquid cultures were added to 100 ml of fresh 0.5xN and 2xN Shieh 452 media. The cultures were grown for 19 hours. 100 ml of dense bacterial culture was 453 centrifuged at 4 °C (4500 rpm, 15 minutes). The supernatant was first filtered through 0.45 454 µm Supor® membrane (Pall Corporation) and then concentrated with 10 K Amicon Ultra-15 455 Centrifugal Filter Units (Merck Millipore) at 4 °C to final volume of 2-3 ml. ECP samples 456 were divided in 500 µl aliquots and stored at -20 °C. Protein concentration of the ECP 457 samples was determined using Bradford method (55) against standard curve made with 458 known amounts of bovine serum albumin (BSA). 50 µg of each ECP sample (except 150 µg 459 of Rz grown in 2xN Shieh) was loaded on 14 % Tricine-SDS-PAGE gel. The gel was run for 460 24 hours at 90 V/30 mA and stained with Coomassie Brilliant Blue solution. 461 16 AUTHOR CONTRIBUTIONS 462 RP and L-RS designed the study. RP and VH conducted the laboratory experiments. RP, L-463 RS and VH wrote the manuscript. 464 FUNDING INFORMATION 465 This work has been funded by grants from Academy of Finland for the Centre of Excellence 466 in Biological Interactions 2012-2017 (#252411) and for L-RS (#266879), the Maj and Tor 467 Nessling Foundation, Jane and Aatos Erkko Foundation and the Doctoral Programme in 468 Biological and Environmental Science of University of Jyväskylä. 469 ETHICS STATEMENTS 470 This study does not involve human or animal subjects and therefore is not considered to 471 require ethical approval procedures. 472 ACKNOWLEDGEMENTS 473 The authors would like to thank Professor Mark McBride for his valuable advice and 474 expertise concerning flavobacterial gliding motility. Dr Hanna Kinnula, Dr Elina Laanto and 475 Mr Juha Meriläinen are acknowledged for assistance in the laboratory and Mr Petri Papponen 476 and MSc Visa Ruokolainen of technical support. In memory of Professor Jaana Bamford. 477 17 REFERENCES 478 479 1. McBride MJ, Zhu Y. Gliding motility and Por secretion system genes are widespread 480 among members of the phylum Bacteroidetes. J Bacteriol (2013) 195:270-8 doi: 481 10.1128/JB.01962-12; 10.1128/JB.01962-12. 482 2. McBride MJ, Nakane D. Flavobacterium gliding motility and the type IX secretion system. 483 Curr Opin Microbiol (2015) 28:72-7 doi: 10.1016/j.mib.2015.07.016 [doi]. 484 3. Agarwal S, Hunnicutt DW, McBride MJ. Cloning and characterization of the 485 Flavobacterium johnsoniae (Cytophaga johnsonae) gliding motility gene, gldA. Proc Natl 486 Acad Sci U S A (1997) 94:12139-44. 487 4. Hunnicutt DW, McBride MJ. Cloning and characterization of the Flavobacterium 488 johnsoniae gliding-motility genes gldB and gldC. J Bacteriol (2000) 182:911-8. 489 5. Hunnicutt DW, McBride MJ. Cloning and characterization of the Flavobacterium 490 johnsoniae gliding motility genes gldD and gldE. J Bacteriol (2001) 183:4167-75 doi: 491 10.1128/JB.183.14.4167-4175.2001 [doi]. 492 6. Hunnicutt DW, Kempf MJ, McBride MJ. Mutations in Flavobacterium johnsoniae gldF 493 and gldG disrupt gliding motility and interfere with membrane localization of GldA. J 494 Bacteriol (2002) 184:2370-8. 495 7. McBride MJ, Braun TF, Brust JL. Flavobacterium johnsoniae GldH is a lipoprotein that is 496 required for gliding motility and chitin utilization. J Bacteriol (2003) 185:6648-57. 497 8. McBride MJ, Braun TF. GldI is a lipoprotein that is required for Flavobacterium 498 johnsoniae gliding motility and chitin utilization. J Bacteriol (2004) 186:2295-302. 499 9. Braun TF, McBride MJ. Flavobacterium johnsoniae GldJ is a lipoprotein that is required 500 for gliding motility. J Bacteriol (2005) 187:2628-37 doi: 10.1128/JB.187.8.2628-2637.2005. 501 10. Sato K, Naito M, Yukitake H, Hirakawa H, Shoji M, McBride MJ, et al. A protein 502 secretion system linked to bacteroidete gliding motility and pathogenesis. Proc Natl Acad Sci 503 U S A (2010) 107:276-81 doi: 10.1073/pnas.0912010107; 10.1073/pnas.0912010107. 504 11. Rhodes RG, Samarasam MN, Shrivastava A, van Baaren JM, Pochiraju S, Bollampalli S, 505 et al. Flavobacterium johnsoniae gldN and gldO are partially redundant genes required for 506 gliding motility and surface localization of SprB. J Bacteriol (2010) 192:1201-11 doi: 507 10.1128/JB.01495-09; 10.1128/JB.01495-09. 508 12. Nelson SS, Glocka PP, Agarwal S, Grimm DP, McBride MJ. Flavobacterium johnsoniae 509 SprA is a cell surface protein involved in gliding motility. J Bacteriol (2007) 189:7145-50 510 doi: 10.1128/JB.00892-07. 511 18 13. Rhodes RG, Samarasam MN, Van Groll EJ, McBride MJ. Mutations in Flavobacterium 512 johnsoniae sprE result in defects in gliding motility and protein secretion. J Bacteriol (2011) 513 193:5322-7 doi: 10.1128/JB.05480-11; 10.1128/JB.05480-11. 514 14. Kharade SS, McBride MJ. Flavobacterium johnsoniae PorV is required for secretion of a 515 subset of proteins targeted to the type IX secretion system. J Bacteriol (2015) 197:147-58 516 doi: 10.1128/JB.02085-14 [doi]. 517 15. Nelson SS, Bollampalli S, McBride MJ. SprB is a cell surface component of the 518 Flavobacterium johnsoniae gliding motility machinery. J Bacteriol (2008) 190:2851-7 doi: 519 10.1128/JB.01904-07; 10.1128/JB.01904-07. 520 16. Shoji M, Sato K, Yukitake H, Kondo Y, Narita Y, Kadowaki T, et al. Por secretion 521 system-dependent secretion and glycosylation of Porphyromonas gingivalis hemin-binding 522 protein 35. PLoS One (2011) 6:e21372 doi: 10.1371/journal.pone.0021372 [doi]. 523 17. Rhodes RG, Nelson SS, Pochiraju S, McBride MJ. Flavobacterium johnsoniae sprB is 524 part of an operon spanning the additional gliding motility genes sprC, sprD, and sprF. J 525 Bacteriol (2011) 193:599-610 doi: 10.1128/JB.01203-10; 10.1128/JB.01203-10. 526 18. Tekedar HC, Karsi A, Gillaspy AF, Dyer DW, Benton NR, Zaitshik J, et al. Genome 527 sequence of the fish pathogen Flavobacterium columnare ATCC 49512. J Bacteriol (2012) 528 194:2763-4 doi: 10.1128/JB.00281-12 [doi]. 529 19. Tekedar HC, Karsi A, Reddy JS, Nho SW, Kalindamar S, Lawrence ML. Comparative 530 Genomics and Transcriptional Analysis of Flavobacterium columnare Strain ATCC 49512. 531 Frontiers in Microbiology (2017) 8:588 doi: 10.3389/fmicb.2017.00588. 532 20. Laanto E, Bamford JKH, Laakso J, Sundberg L. Phage-driven loss of virulence in a fish 533 pathogenic bacterium. Plos One (2012) 7:e53157 doi: 10.1371/journal.pone.0053157. 534 21. Kunttu HM, Suomalainen LR, Jokinen EI, Valtonen ET. Flavobacterium columnare 535 colony types: connection to adhesion and virulence? Microb Pathog (2009) 46:21-7 doi: 536 10.1016/j.micpath.2008.10.001 [doi]. 537 22. Laanto E, Penttinen RK, Bamford JKH, Sundberg L. Comparing the different 538 morphotypes of a fish pathogen - implications for key virulence factors in Flavobacterium 539 columnare. BMC Microbiol (2014) 14:170 doi: 10.1186/1471-2180-14-170. 540 23. Penttinen R, Kinnula H, Lipponen A, Bamford JKH, Sundberg L. High Nutrient 541 Concentration Can Induce Virulence Factor Expression and Cause Higher Virulence in an 542 Environmentally Transmitted Pathogen. Microb Ecol (2016) 72:955-64 doi: 10.1007/s00248-543 016-0781-1. 544 24. Kinnula H, Mappes J, Valkonen JK, Pulkkinen K, Sundberg L. Higher resource level 545 promotes virulence in an environmentally transmitted bacterial fish pathogen. Evol Appl 546 (2017) 10:462-70 doi: 10.1111/eva.12466. 547 19 25. Dumpala PR, Gulsoy N, Lawrence ML, Karsi A. Proteomic analysis of the fish pathogen 548 Flavobacterium columnare. Proteome Sci (2010) 8:26,5956-8-26 doi: 10.1186/1477-5956-8-549 26 [doi]. 550 26. Klesius PH, Pridgeon JW, Aksoy M. Chemotactic factors of Flavobacterium columnare 551 to skin mucus of healthy channel catfish (Ictalurus punctatus). FEMS Microbiol Lett (2010) 552 310:145-51 doi: 10.1111/j.1574-6968.2010.02060.x. 553 27. McGee DJ, Coker C, Testerman TL, Harro JM, Gibson SV, Mobley HL. The 554 Helicobacter pylori flbA flagellar biosynthesis and regulatory gene is required for motility 555 and virulence and modulates urease of H. pylori and Proteus mirabilis. J Med Microbiol 556 (2002) 51:958-70 doi: 10.1099/0022-1317-51-11-958 [doi]. 557 28. Josenhans C, Suerbaum S. The role of motility as a virulence factor in bacteria. Int J Med 558 Microbiol (2002) 291:605-14 doi: 10.1078/1438-4221-00173. 559 29. Haiko J, Westerlund-Wikstrom B. The role of the bacterial flagellum in adhesion and 560 virulence. Biology (2013) 2:1242-67 doi: 10.3390/biology2041242 [doi]. 561 30. Nilsen H, Sundell K, Duchaud E, Nicolas P, Dalsgaard I, Madsen L, et al. Multilocus 562 sequence typing identifies epidemic clones of Flavobacterium psychrophilum in Nordic 563 countries. Appl Environ Microbiol (2014) 80:2728-36 doi: 10.1128/AEM.04233-13 [doi]. 564 31. Wagner B, Wise D, Khoo L, Terhune J. The epidemiology of bacterial diseases in food-565 size channel catfish. J Aquat Anim Health (2002) 14:263-72 doi: 10.1577/1548-566 8667(2002)0142.0.CO;2. 567 32. Declercq AM, Haesebrouck F, Van den Broeck W, Bossier P, Decostere A. Columnaris 568 disease in fish: a review with emphasis on bacterium-host interactions. Vet Res (2013) 569 44:27,9716-44-27 doi: 10.1186/1297-9716-44-27 [doi]. 570 33. Castillo D, Christiansen RH, Dalsgaard I, Madsen L, Middelboe M. Bacteriophage 571 resistance mechanisms in the fish pathogen Flavobacterium psychrophilum: linking genomic 572 mutations to changes in bacterial virulence factors. Appl Environ Microbiol (2015) 81:1157-573 67 doi: 10.1128/AEM.03699-14 [doi]. 574 34. Garrett TR, Bhakoo M, Zhang Z. Bacterial adhesion and biofilms on surfaces. Progress 575 in Natural Science (2008) 18:1049-56 doi: http://doi.org/10.1016/j.pnsc.2008.04.001. 576 35. Kunttu HM, Jokinen EI, Valtonen ET, Sundberg LR. Virulent and nonvirulent 577 Flavobacterium columnare colony morphologies: characterization of chondroitin AC lyase 578 activity and adhesion to polystyrene. J Appl Microbiol (2011) 111:1319-26 doi: 579 10.1111/j.1365-2672.2011.05149.x [doi]. 580 36. Nadell CD, Drescher K, Foster KR. Spatial structure, cooperation and competition in 581 biofilms. Nat Rev Microbiol (2016) 14:589-600 doi: 10.1038/nrmicro.2016.84 [doi]. 582 37. Nelson SS, McBride MJ. Mutations in Flavobacterium johnsoniae secDF result in defects 583 in gliding motility and chitin utilization. J Bacteriol (2006) 188:348-51 doi: 584 10.1128/JB.188.1.348-351.2006. 585 20 38. Alvarez B, Secades P, Prieto M, McBride MJ, Guijarro JA. A mutation in 586 Flavobacterium psychrophilum tlpB inhibits gliding motility and induces biofilm formation. 587 Appl Environ Microbiol (2006) 72:4044-53 doi: 10.1128/AEM.00128-06. 588 39. Fabianek R, Hennecke H, Thony-Meyer L. Periplasmic protein thiol : disulfide 589 oxidoreductases of Escherichia coli. FEMS Microbiol Rev (2000) 24:303-16 doi: 590 10.1016/S0168-6445(00)00028-0. 591 40. LaFrentz BR, LaPatra SE, Call DR, Wiens GD, Cain KD. Proteomic analysis of 592 Flavobacterium psychrophilum cultured in vivo and in iron-limited media. Dis Aquat Org 593 (2009) 87:171-82 doi: 10.3354/dao02122. 594 41. Perez-Pascual D, Menendez A, Fernandez L, Mendez J, Reimundo P, Navais R, et al. 595 Spreading versus biomass production by colonies of the fish pathogen Flavobacterium 596 psychrophilum: role of the nutrient concentration. Int Microbiol (2009) 12:207-14. 597 42. McCarter L. The multiple identities of Vibrio parahaemolyticus. J Mol Microbiol 598 Biotechnol (1999) 1:51-7. 599 43. Harshey RM, Matsuyama T. Dimorphic transition in Escherichia coli and Salmonella 600 typhimurium: surface-induced differentiation into hyperflagellate swarmer cells. Proc Natl 601 Acad Sci U S A (1994) 91:8631-5. 602 44. Toguchi A, Siano M, Burkart M, Harshey RM. Genetics of swarming motility in 603 Salmonella enterica serovar typhimurium: critical role for lipopolysaccharide. J Bacteriol 604 (2000) 182:6308-21. 605 45. Wong ML, Medrano JF. Real-time PCR for mRNA quantitation. BioTechniques (2005) 606 39:75-85 doi: 05391RV01 [pii]. 607 46. Shrivastava A, Johnston JJ, van Baaren JM, McBride MJ. Flavobacterium johnsoniae 608 GldK, GldL, GldM, and SprA are required for secretion of the cell surface gliding motility 609 adhesins SprB and RemA. J Bacteriol (2013) 195:3201-12 doi: 10.1128/JB.00333-13 [doi]. 610 47. Sato K, Sakai E, Veith PD, Shoji M, Kikuchi Y, Yukitake H, et al. Identification of a new 611 membrane-associated protein that influences transport/maturation of gingipains and adhesins 612 of Porphyromonas gingivalis. J Biol Chem (2005) 280:8668-77 doi: M413544200 [pii]. 613 48. Newton JC, Wood TM, Hartley MM. Isolation and partial characterization of 614 extracellular proteases produced by isolates of Flavobacterium columnare derived from 615 channel catfish. J Aquat Anim Health (1997) 9:75-85 doi: 10.1577/1548-616 8667(1997)0092.3.CO;2. 617 49. Laanto E, Sundberg LR, Bamford JK. Phage specificity of the freshwater fish pathogen 618 Flavobacterium columnare. Appl Environ Microbiol (2011) 77:7868-72 doi: 619 10.1128/AEM.05574-11 [doi]. 620 50. Song Y, Fryer J, Rohover J. Comparison of six media for the cultivation of Flexibacter-621 Columnaris. Fish Pathol (1988) 23:91-4. 622 21 51. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, et al. 623 Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of 624 multiple internal control genes. Genome Biol (2002) 3:RESEARCH0034. 625 52. Wobbrock JO, Findlater L, Gergle D, Higgins JJ. The Aligned Rank Transform for 626 Nonparametric Factorial Analyses Using Only ANOVA Procedures. In: Anonymous 627 Proceedings of the ACM Conference on Human Factors in Computing Systems ; Vancouver, 628 BE, Canada. (2011). p. 143-146. 629 53. Mao F, Dam P, Chou J, Olman V, Xu Y. DOOR: a database for prokaryotic operons. 630 Nucleic Acids Res (2009) 37:D459-63 doi: 10.1093/nar/gkn757 [doi]. 631 54. Dam P, Olman V, Harris K, Su Z, Xu Y. Operon prediction using both genome-specific 632 and general genomic information. Nucleic Acids Res (2007) 35:288-98 doi: gkl1018 [pii]. 633 55. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities 634 of protein utilizing the principle of protein-dye binding. Anal Biochem (1976) 72:248-54 doi: 635 S0003269776699996 [pii]. 636 637 22 FIGURES AND TABLES 638 Figure 1. F. columnare B067 colony types Rz, R and S growing on 0.5xN and 2xN Shieh 639 agar plates. N refers to peptone and yeast extract concentrations which were either halved 640 (0.5xN) or doubled (2xN). See Figure 2 for the mean colony sizes. 641 642 Figure 2. Growth characteristics of F. columnare B067 colony types Rz, R and S in 643 different nutrient levels. Mean colony size (+/- S.E.) of colonies growing on 0.5x and 2x 644 Shieh agar plates (A). Maximum optical density (A 600 ) (+/- S.E.) reached during a 65-hour-645 liquid cultivation is presented as open circles (B). Biofilm formation (A 595 ) (+/- S.E.) after 44 646 hours is presented as filled squares (B). 647 648 Figure 3. Organization of F. columnare B067 cells as microrhizoids on the edges of 649 biofilm. Rz colony type grown under 1x Shieh agar layer (A) and S type under 0.5xN Shieh 650 agar (B). Scale bars 10 µm. 651 652 Figure 4. Relative gene expressions of gliding motility and T9SS genes (+/- S.E.) in F. 653 columnare B067 colony morphologies Rz, R and S cultivated on 0.5x and 2x Shieh agar 654 plates. The concentration of all Shieh components was either halved (0.5x) or doubled (2x) 655 compared to the normal Shieh medium. For detailed statistical analysis of the gene expression 656 results, see Tables 2 and 3. 657 658 659 660 23 Table 1. Primer sequences and properties used in RT-qPCR study of F. columnare. 661 Primer Sequence Amplicon length Tm (°C) Efficiency (%) Reference FC_gap1_fwd ACCATCCCAAACAGGAGCCGC 98 56 105.7 Penttinen et al. 2016 FC_gap1_rev CGTCTGCTGTAGGTACGCGCA Penttinen et al. 2016 FC_glyA_fwd CCAAACCCTTGGGGCTATACAACCC 98 60 102.8 Penttinen et al. 2016 FC_glyA_rev AGAGGGCCTCCTTGATTACCTGGAA Penttinen et al. 2016 FC_gldG_fwd AGCAGAAGCAGTGATGCAGCA 125 58 100.95 This study FC_gldG_rev TGCCTTTGTAGGTAGCAATAGCCCA This study FC_gldH_fwd CTTTGAAAACGGATGGCC 221 56 99.15 Klesius et al. 2010 FC_gldH_rev CTTGCCCCATAAGACTTCC Klesius et al. 2010 FC_gldL_fwd GCAAGCGCTATGCTTATTGCTGGT 131 58 101.4 This study FC_gldL_rev GCAGTTGGTTGTCCCCCTGCT This study FC_sprA_fwd GCAGAAAATGTTTGGCCCGT 162 60 99.95 This study FC_sprA_rev ACCGGCAGTTGCTCCATTAT This study FC_sprB_fwd ACCAGCTGCTCCATGGTCAACTAC 157 60 100.1 This study FC_sprB_rev CGAAGGTGTCGTAGGGGCCG This study FC_sprE_fwd AGCCGTGCAGAAGATAAAGC 151 60 100.8 This study FC_sprE_rev ACGCTTCTAATGCGGGTACAA This study FC_sprF_fwd AGTCGTCAAATGGGGGCTAA 148 60 99.65 This study FC_sprF_rev TCACGCTTCCATCAAAGGTT This study FC_sprT_fwd AACCAGGACTGCATTACGGA 144 60 101.1 This study FC_sprT_rev GCTTGATGTTACCTGTGCGTT This study FC_porV_fwd GTGCCAACTCCTAAAACAGCC 152 60 96.85 This study FC_porV_rev AAACCTCCTGGAGCATCACC This study 662 663 24 Table 2. Statistical analysis of gliding motility and T9SS gene expression of F. 664 columnare B067 Rz, R and S colony types grown on 0.5x and 2x Shieh agar plates. 665 Gene Colony type Nutrient Colony type* nutrient interaction F df p F df p F df p sprB 0.225 2 0.800 6.583 1 0.016 0.185 2 0.832 gldG 10.148 2 <0.001 0.5223 1 0.476 1.289 2 0.291 gldH 6.093 2 0.006 0.229 1 0.636 3.918 2 0.032 gldL 7.118 2 0.003 19.605 1 <0.001 5.912 2 0.007 sprT 3.063 2 0.063 0.469 1 0.499 0.519 2 0.601 porV 2.268 2 0.122 0.654 1 0.426 0.493 2 0.616 sprA 0.807 2 0.456 21.363 1 <0.001 4.433 2 0.021 sprE 11.647 2 <0.001 0.448 1 0.509 3.382 2 0.048 sprF 1.681 2 0.204 7.312 1 0.012 1.072 2 0.356 666