Special barley B-amylase allele in a Finnish landrace line HA52 with high grain enzyme activity

Hereditas 134: 91-95 (2001) ~~~ Brief report Special barley P-amylase allele in a Finnish landrace line HA52 with high grain enzyme activity MARIA J. ERKKILA and HANNU AHOKAS Plant Production Research, Agricultural Research Centre, Myllytie 10, FIN-31 600 Jokioinen, Finland E-mail: [email protected] (Received February 19, 200 1. Accepted May 2 1, 200 1) Barley (Hordeum uulgare L.) grain mainly consists of starch, which provides energy during germination and seedling growth (for review, see MACGREGOR and FINCHER 1993). Starch degradation requires concerted action of limit dextrinase, P-amylase, a-glucosidase (SUN and HENSON 1990) and a-amylase. Liberation of maltose and limit dextrins from the nonreducing ends of starch is catalysed by P-amylase (1,Ca-D-glucan maltohydrolase, EC 3.2.1.2) (ROBYT and WHELAN 1968; SOPANEN and LAURIERE 1989). Being synthesised during grain development (KREIS et al. 1987), P-amylase is one of the major proteins found in the starchy endosperm (HEJGAARD and BOISEN 1980). The endosperm P-amylase gene (Pamyl) is located in chromosome 4H (KREIS et al. 1987). Another P-amylase gene (P-amy2), called ubiquitous, is located in chromosome 2H and the protein is found in leaves and roots (KREIS et al. 1988; SHARP et al. 1988). Modern plant breeding has reduced the genetic variability in domesticated barley (THOMPSON et al. 1990; FORSTER et al. 1991) and declined landraces in Finland prior to about 1950 (AHOKAS 2000). Large genetic diversity is found in wild barley H. vulgare ssp. spontaneum (K. Koch) A. & Gr., abbreviated as H. spontaneum (AHOKAS 1982; ZHANG et al. 1993; SAGHAI MAROOF et al. 1995). High P-amylase trait was inherited in the backcrossed progeny of H. spontaneum and domesticated barley (AHOKAS and ERKKILA 1992). However, H. spontaneum was not widely used in breeding for several reasons such as shattering of spikelets, adverse growth rythm at high latitudes, and apparent low grain yield. Because landraces are better adapted to local environments and are morphologically closer to desired domesticated types than wild barley, they are a more suitable source of genetic variation for barley breeding. Compared with the variation in wild barley grown in Finland (AHOKAS and NASKALI 1990), landraces had significantly higher mean activities for aand P-amylase and for P-glucanase (AHOKAS and POUKKULA 1999). The line HA52 was selected from Finnish landraces (AHOKAS 1977), a diverse genetic resource (AHOKAS and MANNINEN 2001). Later, HA52 was found to have a high P-amylase activity (AHOKAS et al. 1996) and also a high thermostability (AHOKAS and MANNINEN 2000). The result presented here is an extension previous studies of P-amyl alleles found in barley (ERKKILA et al. 1998; ERKKILA 1999). YOSHIGI et al. (1995) described an allele in cv. Haruna Nijo (EMBL-GenBank database accession number D49999). We have previously found two P-amyl alleles, one in cv. Adorra and another in H. spontaneum strain PI 296897 (EMBL-GenBank database accession numbers AF061203 and AF061204, ERKKILA et al. 1998). All the alleles differ from each other through their nucleotide sequences especially in intron 111, but not significantly in the open reading frame (ERKKILA et al. 1998). Further studies showed that several barley cultivars, lines and wild strains had either a cv. Adorra-like, cv. Haruna Nijo-like or H. spontaneum PI 296897-like P-amyl allele (ERKKILA 1999). To study the P-amyl locus in the Finnish landrace barley line having high enzyme activity, the gene of the line HA52 was sequenced and compared with previously found alleles. The P-amyl sequence in HA52 - The locus of 0-amyl in the Finnish landrace line HA52 was PCR amplified from genomic DNA using primers based on the sequence of the cv. Haruna Nijo (YOSHIGI et al. 1995). DNA sequencing was performed on ALF DNA Sequencer (Pharmacia-LKB) and sequences were analysed with the PC/Gene software package (IntelliGenetics). The sequence of the HA52 P-amyl gene obtained was 4951 bp in length and included a promoter, seven exons and six introns, which is consistent with the schematic structure of all the alleles sequenced before (Fig. 1, YOSHIGI et al. 1995; ERKKILA et al. 1998). The P-amyl sequence of HA52 has an EMBL accession number AJ301645. Transcription initiation site is situated at position 1205 bp from the beginning of the clone. Some promoter elements, such as TATA and CCAAT boxes, are common to many genes transcribed by polymerase 11. In the HA52 P-amyl a 92 M. J. Erkkila and H. Ahokas Hereditas 134 (2001) Fig. 1. Schematic presentation of P-amy I structural gene. Seven exons are marked with black boxes, and six introns with white boxes (numerals I-VI). Gray box, ATG and TAG indicate promoter, translational start and stop codons, respectively. The HASZspecific deletions and insertions are marked in introns I1 and 111. A segment of promoter is enlarged showing the relative positions of ATG translation start site, transcription initiation site, TATA box, I-box, two GGTTT motives and HA52-specific 92-bp deletion. TATA box is at - 31 bp, as can be expected, since in plants, it is normally between - 29 bp and - 33 bp (MESSING et al. 1983). Translation starts at position + 55 bp (Fig. 1) and has the same motive as common consensus sequence in plants, CCACCATG (KOZACK 1984). Introns and insertions - Compared with the alleles of cv. Haruna Nijo, cv. Adorra, and H. spontaneum PI 296897 (YOSHIGI et al. 1995; ERKKILA et al. 1998), the HA52 P-amy l allele had several substitutions, and additionally, both single-base and short multiple-base deletions and insertions (Table 1). Major sequence differences between the four P-amy 1 alleles were in the promoter region, and in the introns I1 and I11 (Fig. 1). There were short insertions of 3 bp and of 10 bp close to each other in the intron I1 of HA52 (Fig. 2B). The 10-bp insertion contains a repeat, 5'- ATATTTA-3', which is furthermore found once or twice in the introns I11 of the barleys studied so far. The intron I1 insertion in the HA52 P-amyl is 10 bp long and contains the ATATTTA repeat (Fig. 2B) and is also found twice in its intron 111, hence suggesting a conversion at replication. GNIADKOWSKI et al. (1 996) suggested that U-rich sequences stimulate splicing in RNA, regardless of their position within an intron. This holds in dicots, but the monocot splicing machinery is less dependent on UA composition (GOODALL and FILIPOWICZ 1991). Thus the short AT-rich insertion in HA52, a monocot, intron I1 has probably no effect on transcription. Deletions - There is a deletion of 21 bp in the intron I11 of HA52 (Fig. 2C). In cv. Adorra, cv. Haruna Nijo and H. spontaneum this fragment contains a repeat, GGTGGG, which is found four times at the end of the ORF in all P-amyl alleles, also in HA52 allele. The longer fragment in the intron I11 may serve as a binding site for a negative transcription factor being a reason for the higher p-amylase activity in HA52 than the barleys having the G-rich repeat. The 92-bp deletion in the promoter region of HA52 (Fig. 2A) is positioned 451 bp upstream from the TATA box (Fig. 1). OKADA et al. (2000) found two direct repeats in the same region in cv. Haruna Nijo. The other segments of the repeats are relatively close to the CCAAT box at - 194 bp. Only 15 bp upstream from the CCAAT HA52 has an I-box, defined as GATAA by TERZAGHI and CASHMORE (1995). Related motives to GATAA are found in many plant promoters, some of which are light regulated (reviewed by TERZAGHI and CASHMORE 1995). The I-box in P-amyl is 183 bp upstream from the TATA Table 1. Number of the bases involved in the unique alterations of the P-amyl alleles in barley Barley Total number of bases In deletions In insertions In substitutions ~~ Adorra 0 HA52 125 H. spontaneum 39 Haruna Nijo 25 Number of bases 132 28 1 0 8 40 5 7 In the longest deletion In the longest insertion Adorra 0 HA52 92 H. spontaneum 38 Haruna Nijo 25 126 10 0 0 Hereditas 134 (2001) Brief report 93 A Adorra HA5 2 H. spontaneum Haruna Nijo Adorra HA5 2 H. spontaneum Haruna Ni j o Adorra HA5 2 H. spontaneum Haruna Nijo B Adorra HA5 2 H. spon t aneum Haruna Nijo C Adorra HA5 2 H. spontaneum Haruna Nijo -616 -524 -615 -615 -567 -566 -566 -517 -482 -516 -516 TTTTTTTGGCCCCC-GAAGCATATTCTTCCGGGAGCCAAATTGACATTCC TTTTTTTGGTCCCTGGAAGCATATTCTCCCTTGAGCCAAATT-------- TTTTTTTGGCCCCC-GAAGCATATTCTTCCGGGAGCCAAATTGACATTCC TTTTTTTGGCCCCC-GAAGCATATTCTTCCGGGAGCCAAATTGACATTCC GGTCATGATGTGWTTGGATC-GTTAGTTATACAGATAAGGATATAT mTACCTCAACCGAATCTAGGTTACAACAAGCTTAACACTCATGCATTAG .................................. AACATTCATGCATTAG CPTACCTCAACCGAATCTAGGTTACAACAAGCTTAACACTCATGCATTAG CPTACCTCAACCGAATCTAGGTTACAACAAGCTTAACACTCATGCATTAG 739 CTAGTTCTCTGATGCATAT-T---TATA---------- TAGAAGTTCAAG 736 CTAGTTCTCTGATGCATATATAGATATACATATTTAGATAGAAGTTCAAG 739 CTAGTTCTCTGATGCATAT-T---TATA----------TAGAAGTTCAAG 739 CTAGTTCTCTGATGCATAT-T---TATA---------- TAGAAGTTCAAG 1982 1871 1835 1877 TGCTTATGGAGAAAGGTQTATGCATTTATACTTCAACAATAAGAATA TGCTTATGGA--------------------- TACTTCAACAATAAGAATA TGCTTATGGGGAAAGGTQTATGCATTTATACTTCAACAATAAAAATA TGCTTATGGGGAAAWTGGGCTATGCATTTATACTTCAACAATAAAAATA Fig. 2A-C. Sections of nucleotide sequence alignments of P-arnyl alleles of cv. Adorra, HA52, H. spontaneurn PI 296897 and cv. Haruna Nijo. A A deletion of 92 bp in the promoter region of HA52. Palindromic sequences are in italics and inverted repeats are in boldface. B Insertions in intron I1 of HA52 with the AT-motive in boldface. C A deletion of 21 bp in intron I11 of HA52 with the bold GT-motive. The sequence in boldface in B also appears in intron I11 twice, and the bold sequence in C appears four times in towards the end of the seventh exon of the P-amyl gene. box (Fig. 1). This is in agreement with many lightregulated ribulose1,5-bisphosphate carboxylase genes having a single I-box 100-300 bp upstream from the TATA box (BORELLO et al. 1993). The deleted fragment of 92 bp in the promoter of HA52 is relevant in the other 0-amyl alleles. Three inverted repeats, four palindromic sequences, and seven hairpin loops were found from the 92 bp fragment in the promoter region in P-amyl of cv. Adorra, cv. Haruna Nijo and H. spontaneum PI 296897 (Fig. 2A and data not shown). This highly repetitive sequence in promoter region 482 bp upstream of the transcription initiation site (Fig. 1) is a putative binding site for a negative transcription factor. Its absence may contribute to the high 0-amylase activity for grain mass in HA52, being 2.5 times that of cv. Haruna Nijo and 2.9 times that of cv. Adorra (AHOKAS and MANNINEN 2000). GGTTT motive and substitutions - Two GGTTT motives were found at position -421 bp and -436 bp from transcription initiation site (Fig. 1). The GGTTT motive and additionally a GCCGC motive are critical for expression in endosperm and embryo in the maize Adhl (alcohol dehydrogenase 1) gene promoter expressed in transgenic rice (KYOZUKA et al. 1994). Because these motives are also required for expression in other tissues, KYOZUKA et al. (1994) assumed that there might be tissue-specific post-translational modifications of binding proteins or possibly additional promoter elements. These motives may also hold true for the Adhl -like genes in other monocots but not necessarily for other genes. Because no GCCGC motive was found in 0-amyl gene, further investigations are needed to explore if the GGTTT motive (Fig. 1) alone is adequate for specifying the gene expression in endosperm. In 0-amyl promoter, 94 M. J. Erkkilu and H. Ahokas Hereditas 134 (2001) OKADA et al. (2000) did not find any specific sequence similar to the endosperm box, which is known as a common sequence in the promoter region of prolamin genes and which seems to be associated with seed specific expression (HAMMOND-KOSACK et al. 1993). Four single-base substitutions were found in the open reading frame of HA52. All of these led to amino acid substitutions. The amino acid substitutions in P-amyl of HA52 are unique compared with known amino acid sequences of cv. Adorra, cv. Haruna Nijo, and H. spontaneum PI 296897 namely Arg-115 + Cys, Asp-164 --t Glu, Phe-246 + Leu, and Val-430 --f Ala. None of these substitutions is found in conserved regions or in the vicinity of active sites. The amino acids at the positions 115, 164 and 430 are identical in cv. Harrington (cf. KANEKO et al. 2000) and in HA52. Because there is no P-amylase activity data from same trial, we can only speculate on the role of the two amino acid differences, Phe-246 + Leu and Thr-520 --t Ala, between cv. Harrington and HA52. The promoter region and the introns probably have more effect on the P-amylase activity than amino acid substitutions, although these may affect secondary modifications or affinities of the protein. The Canadian cv. Harrington has ancestors among Swedish and Norwegian landraces. There is a 25% chance that cv. Harrington inherited its P-amy 1 allele from cv. Bjmneby, provided that there was no intragenic recombination. Cv. Bj~rneby originated from the area of Trysil, Norway (HAUGUM 1940). Around 1600 Finns, especially from Savonia, a south-eastern province of Finland, immigrated to this area where they used slash-and-burn cultivation (HANSEN 1904; HAMALAINEN 1947). The Finns brought cereal seeds with them (NORDMANN 1888; HAMALAINEN 1947). Therefore, the cv. Bjarrneby and the line HA52 may represent a common gene pool from SE Finland. Other similarities of their P-amyl genes would be worth comparing. The promoter region lacking from the HA52 Pamyl allele provides grounds to postulate that this region serves as binding site for a negative regulation factor. The HA52-specific promoter and amino acid sequence may also cumulate in the P-amylase activity. Comparison between the different P-amy 1 alleles and P-amylase activities suggest that the promoter and the intron regions exert more influence on P-amyl gene expression than the observed amino acid changes. Further studies of the promoter region are needed to confirm present postulations and to determine specific regions of enhancing, repressing and endospermspecific expression. ACKNOWLEDGEMENTS We thank Ms A Virta for the ALF operations. This research was funded by the Raisio Yhtyman Tutkimussaati6 Foundation and Finnish Cultural Foundation. REFERENCES Ahokas H, (1977). Increase in protein content by partial fertility. Barley Genet. Newsl. 7: 6-8. Ahokas H, (1982). Cytoplasmic male sterility in barley. XI. The msm2 cytoplasm. Genetics 102: 285-295. Ahokas H, (2000). Impacts on agricultural development by Constantin Boije, a missionary and the first plant breeder in Finland. Yliopistopaino, Helsinki. Ahokas H and Erkkila MJ, (1992). Barley P-amylase and P-glucanase activities at germination in vulgare-type lines from backcrosses of wild, spontaneum strains with cv. Adorra. Agric. Sci. Finl. 1: 339-350. grain P-amylase and P-glucanase in Finnish landrace barleys and their putative past adaptedness. Hereditas 132: 111-118. Ahokas H and Manninen M-L, (2001). Polymorphisms of phosphate acquisition parameters in barley (Hordeum vulgare) landraces: secreted acid phophatase and milieu acidification of roots after germination in vitro. Biol. Agric. Hortic. 18: 385-399. Ahokas H and Naskali L, (1990). Variation of @-amylase, P-amylase, P-glucanase, pullulanase, proteinase and chitinase activity in germinated samples of the wild progenitor of barley. J. Inst. Brew. 96: 27-31. Ahokas H and Poukkula M, (1999). Malting enzyme activities, grain protein variation and yield potentials in the displaced genetic resources of barley landraces of Finland. Genet. Resour. Crop Evol. 46: 251-260. Ahokas H, Uutela P, Erkkila MJ and Vahamiko S, (1996). Another source of genes with high beta-amylase activity in barley grain: Finnish landraces. Barley Genet. Newsl. 25: 36-40. Bore110 U, Ceccarelli E and Giuliano G, (1993). Constitutive, light-responsive and circardian clock-responsive factors compete for the different I box elements in plant light-regulated promoters. Plant J. 4: 61 1-619. Erkkila MJ, (1999). Intron 111-specific markers for screening of P-amylase alleles in barley cultivars. Plant Mol. Biol. Rep. 17: 139-147. Erkkila MJ, Leah R, Ahokas H and Cameron-Mills V, (1998). Allele-dependent barley grain P-amylase activity. Plant Physiol. 117: 679-685. Forster BP, Thompson DM, Watters J and Powell W, (1991). Water-soluble proteins of mature barley endosperm: genetic control, polymorphism, and linkage with P-amylase and spring/winter habit. Theor. Appl. Genet. 81: 787-792. Gniadkowski M, Hemmings-Mieszczak M, Klahre U, Liu H-X and Filipowicz W, (1996). Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia. Nucleic Acids Res. 24: 6 19-627” Goodall GJ and Filipowicz W, (1991). Different effects of intron nucleotide composition and secondary structure on pre-mRNA splicing in monocot and dicot plants. EMBO J. 10: 2635-2644. Ahokas H and Manninen M-L, (2000). Thermostab Hereditas 134 (2001) Brief report 95 Hamalainen A, (1947). Keski-Skandinavian suomalaiset. Werner Soderstrom Oy, Porvoo, Helsinki. Hammond-Kosack MCU, Holdsworth MJ and Bevan MW, (1993). In vivo footprinting of a low molecular weight glutenin gene (LMWG-IDl) in wheat endosperm. EMBO J. 12: 545-554. Hansen AM, (1904). LandnHm i Norge. WC Fabritius & Smner A/S, Kristiania. Haugum 0, (1940). VHre kornsorter. C Dahls Bok- & Kunsttrykkeri A/S, Oslo. Hejgaard J and Boisen S, (1980). High-lysine proteins in Hiproly barley breeding: identification, nutritional significance and new screening methods. Hereditas 93: 311-320. Kaneko T, Kihara M and Ito K, (2000). Genetic analysis of P-amylase thermostability to develop a DNA marker for malt fennentability improvement in barley, Hordeum vulgare. Plant Breeding 119: 197-201. Kozack M, (1984). Compilation and analysis of sequences upstream from the translational start site in eucaryotic mRNAs. Nucleic Acids Res. 12: 857-872. Kreis M, Williamson M, Buxton B, Pywell J, Hejgaard J and Svendsen I, (1987). Primary structure and differential expression of P-amylase in normal and mutant barleys. Eur. J. Biochem. 169: 517-525. Kreis M, Williamson MS, Shewry PR, Sharp P and Gale M, (1988). Identification of a second locus encoding P-amylase on chromosome 2 of barley. Genet. Res. 51: 13-16. Kyozuka J, Olive M, Peacock WJ, Dennis ES and Shimamoto K, (1994). Promoter elements required for developmental expression of the maize Adhl gene in transgenic rice. Plant Cell 6: 799-810. MacGregor AW and Fincher GB, (1993). Carbohydrates of the barley grain. In: Barley: Chemistry and Technology. (eds AW MacGregor and RS Bhatty), American Association of Cereal Chemists, St. Paul, MN, p. 73-130. Messing J, Geraghty D, Heidecker G, Hu N-T, Kridl J and Rubenstein I, (1983). Plant gene structure. In: Genetic engineering of plants. (eds T Kosuge, CP Meredith and A Hollaender), Plenum Publishing Corp, p. 21 1-227. Nordmann P, (1888). Finnarne i mellersta Sverige. Tidnings- & Tryckeriaktiebolaget, Helsingfors. Okada Y, Kihara M, Kuroda H, Yoshigi N and Ito K, (2000). Cloning and sequencing of the promoter region of the seed specific P-amylase gene from barley. J. Plant Physiol. 156: 762-767. Robyt JF and Whelan WJ, (1968). The P-amylases. In: Starch and its derivatives (ed J Radley). Chapman and Hall, London, p. 430-476. Saghai Maroof MA, Zhang Q and Biyashev R, (1995). Comparison of restriction fragment length polymorphisms in wild and cultivated barley. Genome 38: 298306. Sharp PJ, Kreis M, Shewry PR and Gale MD, (1988). Location of P-amylase sequences in wheat and its relatives. Theor. Appl. Genet. 75: 286-290. Sopanen T and Lauriere C, (1989). Release and activity of bound P-amylase in a germinating barley grain. Plant Physiol. 89: 244-249. Sun Z and Henson C, (1990). Degradation of native starch granules by barley cl-glucosidases. Plant Physiol. 94: 320-327. Terzaghi WB and Cashmore AR, (1995). Light-regulated transcription. Annu. Rev. Plant Physiol. Plant Mol. Biol. 46: 445-474. Thompson DM, Powell W and Forster BP, (1990). Use of isoelectrofocusing in barley varietal identification. Ann. Appl. Biol. 117: 625-631. Yoshigi N, Okada Y, Sahara H and Tamaki T, (1995). A structural gene encoding P-amylase of barley. Biosci. Biotech. Biochem. 59: 19911993. Zhang Q, Saghai Maroof MA and Kleinhofs A, (1993). Comparative diversity analysis of RFLPs and isozymes within and among populations of Hordeum vulgare ssp. spontaneum. Genetics 134: 909-916.