An exonic insertion within Tex14 gene causes spermatogenic arrest in pigs
Full text
RESEARCH ARTICLE Open Access
An exonic inse ion wi hin Tex14 gene causes
spe ma ogenic a es in pigs
Anu Si onen
1*
, Pekka Uima i
1
, Heli Venho an a
2
, Magnus Ande sson
2
and Johanna Vilkki
1
Abs ac
Backg ound: Male in e ili y is an inc easing p oblem in all domes ic species including man. Localiza ion and
iden i ica ion o genes in ol ed in de ec s causing male in e ili y p o ide aluable in o ma ion o speci ic e en s in
spe m de elopmen . Spe m de elopmen is a complex p ocess, whe e diploid spe ma ogonia de elop in o
haploid, highly specialized spe ma ozoa. Co ec exp ession and unc ion o a ious genes and hei p o ein
p oduc s a e equi ed o p oduc ion o e ile spe m. We ha e iden i ied an in e ili y de ec in Finnish Yo kshi e
boa s caused by spe ma ogenic a es . The aim o his s udy was o loca e he disease associa ed egion using
genome wide sc een wi h he Po cineSNP60 Beadchip and iden i y he causal mu a ion by candida e gene
app oach.
Resul s: In he Finnish Yo kshi e pig popula ion he spe ma ogenic a es (SA) de ec appea s o be o gene ic
o igin and causes se e e degene a ion o ge m cells and o al absence o spe ma ozoa. Genome wide scan wi h
he Po cineSNP60 Beadchip localized he SA de ec o po cine ch omosome 12 in a 2 Mbp egion. Sequencing o
a candida e gene Tex14 e ealed a 51 bp inse ion wi hin exon 27, which caused di e en ial splicing o he exon
and c ea ed a p ema u e ansla ion s op codon. The exp ession o Tex14 was ma kedly down egula ed in he
es is o a SA a ec ed boa compa ed o con ol boa s and no p o ein p oduc was iden i ied by Wes e n blo ing.
The SA inse ion sequence was also ound wi hin in on 27 in all analyzed animals, hus he inse ion appea s o be
a possible duplica ion e en .
Conclusion: In his s udy we epo he iden i ica ion o a causal mu a ion o in e ili y caused by spe ma ogenic
a es a an ea ly meio ic phase. Ou esul s highligh he ole o TEX14 speci ically in spe ma ogenesis and he
impo ance o speci ic genomic emodeling e en s as causes o inhe i ed de ec s.
Backg ound
Male in e ili y is a signi ican p oblem in all mammalian
species [1]. In humans, i is es ima ed ha 15% o couples
a e in e ile and in one hi d o hese cases in e ili y can be
a ibu ed solely o he male pa ne [2]. In p oduc i e li e-
s ock he economic losses due o ep oduc i e ine iciency
in males can be subs an ial, pa icula ly when in e ili y
a ec s a gene ically supe io indi idual [3]. Al hough some
ins ances o male ac o in e ili y can be explained by
in ec ions, en i onmen al causes, immunological o ho mo-
nal de iciencies, many a e caused by gene ic ac o s. P o-
blems wi h he p oduc ion and ma u a ion o spe ma ozoa
a e he mos common causes o male in e ili y esul ing in
a low spe m coun , mo phologically abno mal spe ma ozoa
o educed spe m mo ili y [4-6]. Despi e e o s o e eal
he genes in ol ed in spe ma ogenesis and hei unc ions,
li le is known abou he unde lying causes o male in e i-
li y. The e o e, he localiza ion and iden i ica ion o mu a-
ions a ec ing speci ically he spe ma ogenesis p o ide
in aluable in o ma ion o esea ch on he causes o male
in e ili y.
Mammalian spe ma ogenesis is a complex p ocess,
whe e diploid spe ma ogonia de elop in o haploid, highly
specialized spe ma ozoa. Spe ma ogenesis occu s in he
semini e ous ubules o he es is and can be di ided in
p oli e a i e phase, meio ic phase and di e en ia ion (spe -
miogenesis) [7]. Du ing he p oli e a i e phase spe ma ogo-
nia go h ough se e al mi o ic di isions. The inal mi o ic
di ision o di e en ia ed spe ma ogonia gi es ise o he
p ima y spe ma ocy es. Meiosis o p ima y spe ma ocy es
* Co espondence: [email p o ec ed]
1
Ag i ood Resea ch Finland, MTT, Bio echnology and Food Resea ch,
Genomics, FI-36100 Jokioinen, Finland
Full lis o au ho in o ma ion is a ailable a he end o he a icle
Si onen e al.BMC Genomics 2011, 12:591
h p://www.biomedcen al.com/1471-2164/12/591
© 2011 Si onen e al; licensee BioMed Cen al L d. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons
A ibu ion License (h p://c ea i ecommons.o g/licenses/by/2.0), which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in
any medium, p o ided he o iginal wo k is p ope ly ci ed.
leads o he p oduc ion o seconda y spe ma ocy es a e
he i s meio ic di ision, while haploid ound spe ma ids
a e o med ollowing he second meio ic di ision. A e
meiosis, spe ma ids a e connec ed wi h cy oplasmic b idges
sha ing ansc ip s and p o eins [8]. In spe miogenesis he
nucleus o he ge m cell is emodeled and he ac osome
and spe m ail a e o med. Finally, ma u e spe ma ozoa a e
eleased in o he lumen o semini e ous epi helium and
anspo ed o he epididymis o u he ma u a ion.
Du ing he whole p ocess, he exp ession and he in e ac-
ions be ween a ious genes and hei p o ein p oduc s a e
equi ed and egula ed in an o de ed manne . Some o
hese genes o hei al e na i e ansc ip s a e speci ically
exp essed in he es is. Iden i ica ion o hese genes and
hei oles is impo an in unde s anding he mechanism o
spe ma ogenesis.
Spe ma ogenic a es a a ious s ages o spe ma ogen-
esis is known o cause in e ili y in se e al mammalian
species [9-11], bu only ecen ly genes and in e ac ion ne -
wo ks behind hese de ec s ha e been unde in es iga ion.
Di e en mouse models ha e e ealed se e al genes asso-
cia ed wi h male in e ili y caused by spe ma ogenic a es
[12-15], bu he ull unde s anding o e en s leading o
spe ma ogenic a es a speci ic phases equi es u he
s udies. Wi hin he Finnish Yo kshi e popula ion se e al
boa s wi h azoospe mia we e iden i ied du ing yea s 1995-
2008. In his s udy we epo an in e ili y de ec in he
Finnish Yo kshi e boa s caused by spe ma ogenic a es
(SA) in ea ly meio ic cells. The aim o he s udy was o
iden i y he mu a ion causing he SA de ec and e eal he
ole o he a ec ed gene in spe ma ogenesis. The disease
associa ed egion was localized o po cine ch omosome 12
wi hin a 1.9 Mbp egion and a p omising candida e gene,
Tes is exp essed 14 (Tex14), was iden i ied. Sequencing o
he Tex14 mRNA showed a SA speci ic inse ion in exon
27, which esul ed in a p ema u e ansla ion s op codon
and dec eased exp ession o he TEX14 mRNA and p o-
ein p oduc s speci ically in he es is.
Resul s
Spe ma ogenic a es in Finnish Yo kshi e boa s esul s in
se e e degene a ion o ge m cells
The in e ili y o SA a ec ed boa s was i s iden i ied in
boa s a ions. The es icula size appea ed o be
app oxima ely hal o he no mal size in a ec ed boa s
and mic oscopical examina ion o he ejacula e e ealed
o al absence o spe ma ozoa [16]. Fu he his ological
examina ion o he SA a ec ed es is sec ions showed
ma kedly educed numbe o la e meio ic cells and
absence o pos meio ic cells (Figu e 1, [16]). Fu he -
mo e, a ec ed es es displayed se e e degene a ion o
ge m cells and acuoliza ion p obably due o inc eased
ge m cell apop osis (Figu e 1).
Genome wide associa ion analysis localized he SA de ec
in po cine ch omosome 12
Call a e ( he p opo ion o success ully geno yped SNPs
o e all SNPs on he chip) was o e 95% o all geno yped
samples in his s udy. In he ini ial genome wide sc een
(GWS), 27,510 SNPs had mino allele equency (MAF) >
0. The Manha an plo o P- alues o hese SNPs is shown
in Figu e 2A. In he ini ial GWS 45 SNPs had P- alue less
han 1.81E-06 ha co esponds o Bon e oni co ec ed
o e all P- alue < 0.05 (Addi ional ile 1, Table S1). All he
signi ican SNPs we e loca ed in a 10 Mbp long egion
(posi ion: 23.9 - 34.1 Mb, Ssc o a9, h p://www.ensembl.
o g) on ch omosome 12 excep one SNP on ch omosome
1 (ALGA0065844). This single SNP is mos likely a alse
posi i e inding and was igno ed in he la e analysis.
When a la ge con ol g oup was used in GWS only
wo SNPs (ALGA0066210 and ALGA0066216) sup-
po ed a ully pene an ecessi e mode o inhe i ance
(Addi ional ile 1, Table S1). All SA a ec ed boa s, bu
none o he con ols, we e homozygous o alleles C and
A in ALGA0066210 and ALGA0066216, espec i ely.
Addi ionally, all SA a ec ed boa s had wo copies o he
same haplo ype con aining 29 SNPs and all con ols
ha we e he e ozygous o ALGA0066210 and
ALGA0066216 had one copy o ha haplo ype (haplo-
ype 1 in Table 1). Thus, he e appea s o be a single
o igin o he SA causal mu a ion.
The SA associa ed haplo ype co e s a 2 Mbp egion in
SSC 12, which con ains a la ge numbe o anno a ed
genes (Figu e 2B). Wi hin hese genes a p omising can-
dida e gene o he spe ma ogenic a es , Tex14,was
ound a posi ion 32834226-32934785 bp. Tex14 has
been shown o be c ucial o success ul spe ma ogenesis
ha ing a ole in con e ing midbodies in o s able in e -
cellula b idges [17]. In addi ion, Tex14 knockou mice
ha e a simila spe ma ogenic pheno ype [15] as was
seen in SA a ec ed boa s. One o he SNPs wi h a
s ong associa ion wi h he SA de ec , ALGA0066216,
also esides wi hin he Tex14 genomic sequence.
SA de ec in he Finnish Yo kshi e popula ion is caused
by an exonic inse ion
The p edic ed pig Tex14 ansc ip [EMBL:
ENSSSCT00000019208] con ains 4496 n and 34 exons.
Sequencing o he con ol es is mRNA o Tex14 [Gen-
Bank: JN638886] showed a ansc ip including 4194 n .
Sequence alignmen wi h he Sequence so wa e (Gene
Codes Co po a ion) showed di e ences in exon con en
be ween he pig Tex14 da abase sequence and ou
esul s. The es is mRNA s a s a exon 2 and one addi-
ional exon was p esen a e exon 13. In addi ion, he
sequence o exon 15 was di e en in he EMBL an-
sc ip and in he es is mRNA and exon 16 was missing
Si onen e al.BMC Genomics 2011, 12:591
h p://www.biomedcen al.com/1471-2164/12/591
Page 2 o 10
in ou da a. The ansla ion s op codon loca es a e
posi ion 4191 n in ou es is ansc ip , hus he pig
TEX14 p o ein sequence in he es is con ains 1397 aa.
The p o ein sequence con ains anky in epea egion a
posi ion 1-99 (E- alue 5.7e-16) and PKc_like-domain a
posi ion 154 - 466 aa (E- alue 1.9e-14). Sequencing o a
con ol and SA a ec ed boa samples e ealed se e al
polymo phisms wi hin he coding egion o Tex14
(Table 2). Fi e o hese polymo phisms lead o amino
acid changes possibly a ec ing he p o ein s uc u e and
unc ion. Howe e , he mos likely cause o he SA
de ec was ound in exon 27. In he mRNA sequence o
Figu e 1 The spe ma ogenesis is ma kedly a ec ed in SA boa s. A. In he es is c oss sec ions o SA a ec ed boa s no spe miogenic cells
a e p esen and inc eased acuoliza ion can be seen compa ed o he con ol es is. B. Clea educ ion in he amoun o spe ma ogonia and
spe ma ocy es in SA a ec ed animals can be seen compa ed o con ol animals. No spe ma ids a e p esen in he es is o SA boa s. The
numbe o ge m cells is compa ed o he amoun o Se oli cells.
Si onen e al.BMC Genomics 2011, 12:591
h p://www.biomedcen al.com/1471-2164/12/591
Page 3 o 10
all SA a ec ed boa s a 67 n dele ion (del) and a 33 n
inse ion (ins) was ound in he exon 27. This del/ins
esul ed in a p ema u e ansla ion s op codon a aa
1287 in he SA a ec ed mRNA (Figu e 3A).
The iden i ied egion con aining he del/ins poly-
mo phism in he Tex14 mRNA was u he analysed in
he genomic DNA o all SA a ec ed boa s and a g oup
o con ol animals (n = 40). All a ec ed boa s had a
homozygous 51 bp inse ion wi hin he genomic
sequence o Tex14 exon 27. The inse ion c ea es a
no el exon/in on splicing accep o si e causing di e en-
ial splicing o his exon in a ec ed animals, hus c ea -
ing he iden i ied del/ins in he Tex14 mRNA (Figu e
3A). In con ol boa s i e he e ozygous animals we e
iden i ied and in 35 analyzed boa s he exonic inse ion
was absen . In addi ion, DNA om wo si es o SA
a ec ed boa s was a ailable and bo h o hese boa s
we e he e ozygous o he inse ion.
In o de o iden i y he o igin o he 51 bp inse ion, a
Blas sea ch agains he pig genome build 9 was done.
The inse ion sequence was ound in he Tex14 in on
27. The p esence o his in onic sequence in SA a ec ed
animals was con i med by sequencing. Thus, he causal
mu a ion o spe ma ogenic a es in he Finnish Yo k-
shi e popula ion appea s o be a duplica ion o a 51 bp
sequence wi hin Tex14 gene (Figu e 3A).
Tex14 exp ession is dec eased in he es es o SA a ec ed
boa s
The exp ession o Tex14 mRNA was examined by RT-
PCR on aga ose gels and qPCR. Bo h me hods indica ed
clea educ ion in Tex14 exp ession in he SA a ec ed
es is (Figu e 3C). Fu he mo e, TEX14 p o ein p oduc
was absen in he es is o a SA a ec ed boa (Figu e 3D).
TEX14 has a ole in he o ma ion o emb yonic in e cel-
lula b idges, which a e o med du ing he male and
Figu e 2 The SA associa ed egion in he Finnish Yo kshi e was iden i ied in ch omosome 12. A. Manha an plo showing he P- alues
(-log10(P) on he y-axis) o di e en ch omosomes using a ecessi e mode o inhe i ance-model based on 9 cases and 21 con ols. B. The SA
associa ed homozygous egion be ween 32.5-34.4 Mbp con ains a p omising candida e gene Tes is exp essed 14 (Tex14).
Si onen e al.BMC Genomics 2011, 12:591
h p://www.biomedcen al.com/1471-2164/12/591
Page 4 o 10
emale game ogenesis [18] indica ing ha down egula-
ion o Tex14 exp ession may also a ec he emale e i-
li y. Since no samples om homozygous sows o he
Tex14 inse ion we e a ailable, we in es iga ed he
exp ession o Tex14 in he o a y, o iduc and u e us o
con ol sows. Tex14 exons 17-19 we e sligh ly exp essed
also in all emale issues, bu no exp ession o exons 31-
34 was de ec ed in he aga ose gel (Figu e 4A). The
Tex14 exp ession was also quan i ied wi h qPCR, which
indica ed a ma kedly lowe exp ession in he emale
ep oduc i e o gans compa ed o he es is (Figu e 4B).
In addi ion, no o he symp oms ha e been de ec ed in
SA boa s and no p oblems in ep oduc i e pe o mance
in sows ha e been epo ed indica ing ha he SA de ec
a ec s only male e ili y. The SA pheno ype and low
Tex14 exp ession in he o a y, o iduc and u e us indi-
ca e a mino ole o TEX14 in hese issues and he e-
o e he p ema u e ansla ion s op codon may no ha e
a majo e ec on emale e ili y. These da a highligh he
ole o TEX14 and he o ma ion o in e cellula b idges
speci ically in spe ma ogenesis.
Ma ke and gene assis ed selec ion a ailable o selec ion
agains he spe ma ogenic a es de ec
Gene assis ed selec ion based on he causal mu a ion o
he SA de ec p o ides a 100% accu a e DNA es agains
he de ec . PCR ampli ica ion wi h sequence speci ic p i-
me s lanking he 51 bp inse ion in he genomic sequence
o Tex14 gene can be used o gene assis ed selec ion
agains he SA de ec in he Yo kshi e popula ion. The
size di e ence o he PCR agmen can be de ec ed on
aga ose gel (Figu e 3B) and he disease s a us de ined as
SA a ec ed, ca ie o con ol. The agmen size o he
allele wi hou he inse ion is 496 bp (con ol) and includ-
ing he inse ion is 547 bp (a ec ed).
In o de o a oid addi ional gene es we also e alu-
a ed he usabili y o associa ed SNPs o ma ke assis ed
selec ion. He e ozygous boa s (n = 17) o SNPs
ALGA0066210 and ASGA0054360 om Illumina bead-
chip geno yping we e selec ed o sequencing wi h p i-
me s lanking he Tex14 inse ion. Fi e boa s we e
he e ozygous o bo h SNPs and appea ed o be SA ca -
ie s based on he Tex14 inse ion. These boa s we e
also ca ie s o he haplo ype 1 (Table 1). None o he
boa s (n = 12) he e ozygous only o one SNP we e SA
ca ie s. SA associa ed alleles we e C and A o SNPs
ALGA0066210 and ASGA0054360, espec i ely. Thus,
he haplo ype o hese ma ke s appea s o be a eliable
indica o o he p esence o he SA inse ion a leas in
he Finnish Yo kshi e popula ion.
Discussion
The SA a ec ed boa s show almos no la e meio ic and
pos meio ic ge m cells and educed amoun o spe ma o-
gonia. This pheno ype is e y simila o Tex14 knockou
mice pheno ype and he e o e he sea ch o causal mu a-
ion was ocused on Tex14 gene. In Tex14 knockou mice,
ini ially ma kedly educed numbe s o la e meio ic and
pos meio ic cells a e de ec ed and in olde animals mo e
se e e pheno ype wi h dec ease in all ge m cell numbe s is
p esen [15]. In addi ion, he acuoliza ion is inc eased in
olde animals in he mouse and was e iden also in he
pig. In mice, as spe ma ogonia di ide and di e en ia e,
TEX14 oge he wi h o he midbody p o eins o m in e -
cellula b idges, a s able s uc u e o med by mi o ic and
meio ic di isions and main ained un il o ma ion o
Table 1 The mos common haplo ypes a he egion 32.5
- 34.4 Mbp on ch omosome 12 and hei equencies
among cases and con ols
Haplo ypes
SNP Posi ion 1 2 3 45678
DIAS0000466 32486728 A A G AAAAA
DRGA0011732 32552621 C C A CCCCC
MARC0040388 32564534 G A G GGGAA
ALGA0066208 32594630 G A G AAAAA
ALGA0066210 32620047 C A A AAAAA
ASGA0054360 32676377 A G G GGGAG
ALGA0066214 32706622 A C C C C A A A
ASGA0054362 32729466 A A A A A G G G
MARC0016326 32762378 A G G G G A A A
ALGA0066216 32843547 A G G GGGGG
ALGA0116573 32936852 A A G A G A A A
ALGA0066218 33179967 G G A G A G G G
ALGA0066217 33236507 G A G G G A G A
ASGA0097668 33738117 A A A G A G A A
ASGA0103400 33776732 A A A A A G A A
ALGA0066221 33825748 A G A AAAGA
ALGA0066222 33852536 G A A G G A A A
MARC0039239 33887438 C C A C C A C C
DRGA0011741 33924664 C A A C AAAA
DRGA0011742 33965584 A A A AAAAG
INRA0038984 34016194 A C A C A C C A
ALGA0066230 34081571 A G G G A G G G
H3GA0034268 34115708 C C A A C A C A
ALGA0066234 34129776 G A G G A G A G
MARC0084960 34150307 G G A A G A G A
H3GA0034269 34183841 G A A G G A A A
ASGA0054380 34233636 G G A A A G G G
H3GA0034274 34343301 C C C C A C C A
ALGA0066247 34362626 G G G G G A G A
Cases 18 0 0 00000
Con ols 25 146 129 87 78 49 47 47
Haplo ype 1 is he longes haplo ype ha is sha ed by all cases in his
ch omosome egion. The SNPs ha ul il ecessi e mode o inhe i ance in he
la ge da a se a e ma ked in bold ace.
Si onen e al.BMC Genomics 2011, 12:591
h p://www.biomedcen al.com/1471-2164/12/591
Page 5 o 10
spe ma ozoa. TEX14 in e ac ion wi h CEP55 has been
shown o be c i ical o sub e ing abscission owa d a
s able in e cellula b idge [19].
In Tex14 knockou male mice, ge m cells con inue o
o m midbodies du ing elophase o cy okinesis, bu he
midbody is ansien , as in soma ic cells, and no in e cel-
lula b idges a e o med [17]. Thus, Tex14 knockou
mice comple ely lack in e cellula b idges, and spe ma o-
genesis ails be o e he i s meio ic di ision esul ing in
male in e ili y [15]. In Finnish Yo kshi e boa s he spe -
ma ogenic a es a i s meio ic di ision appea s also o
be caused by a mu a ion in he Tex14 gene. Al hough
se e al polymo phisms we e de ec ed wi hin he Tex14
coding ame, a 51 bp inse ion in exon 27 appea s o be
he ob ious cause o he de ec . This inse ion esul s in
di e en ial splicing o exon 27, which c ea es a p ema-
u e ansla ion s op codon a e posi ion 3858 n in he
SA a ec ed Tex14 ansc ip . The exp ession o all exam-
ined Tex14 agmen s we e ma kedly down egula ed in
he SA a ec ed boa and he p o ein p oduc o 150 kDa
was absen . The p obable cause o he down egula ion
o he Tex14 mRNA is he nonsense media ed deg ada-
ion o he inco ec ly spliced mRNA, bu we ha e no
en i ely excluded he possibili y o down egula ion o
mRNA ansc ip ion o changes in cy oplasmic mRNA
s abili y. The sequencing o he p omo e egion (152 bp
ups eam o he ansc ip ion ini ia ion si e) did no
show any SA associa ed mu a ions indica ing ha he
ansc ip ion is no a ec ed by mu a ions in he p omo-
e egion, bu egula o y egions u he ups eam ha e
no been in es iga ed. Howe e , he p o ein p oduc o
TEX14 appea s o be absen in he SA a ec ed es is
highligh ing he ole o his gene in de elopmen o he
SA de ec .
In he Finnish Yo kshi e pigs no e ec on emale ep o-
duc ion has been epo ed and no o he symp oms excep
in e ili y in boa s we e de ec ed. Thus, he inse ion
wi hin Tex14 appea s o only a ec spe ma ogenesis. This
has also been seen in mice. In Tex14 knockou emales no
signi ican di e ence in he numbe o ge m cells a p ena-
al day 11.5 was de ec ed and li e size was only sligh ly
a ec ed, al hough he in e cellula b idges we e missing
[18]. In his s udy we ha e also analyzed he exp ession o
Tex14 in he es is, o a y, o iduc and u e us o con ol
pigs. Tex14 appea s o be highly exp essed in he es is
and subs an ially lowe exp ession o no exp ession was
de ec ed in he emale ep oduc i e o gans indica ing a
mo e p ominen ole o TEX14 in he es is. This esul is
consis en wi h s udies in he mouse showing ha TEX14
is no essen ial o pos na al oocy e g ow h and o a ian
olliculogenesis [18].
The ances al SA inse ion sequence loca es in he pig
genome wi hin Tex14 in on 27 360 bp downs eam
om he SA inse ion si e. All a ec ed boa s also ha e
he o iginal sequence in in on 27, hus he disease caus-
ing agmen appea s o be copied in he same o ien a-
ion o exon 27. The SA inse ion egion was no
iden i ied as an in e spe sed epea o a low complexi y
DNA sequence, hus i appea s o be a unique duplica-
ion e en in he po cine genome. In he human, indels
cause mul iple gene ic diseases [20] and a e a sou ce o
na u al in a- and in e speci ic gene ic a ia ion [21-24].
Sho unique sequences a e being ac i ely duplica ed in
mammalian genomes and a e o en sepa a ed by some
dis ance [25]. I has been pos ula ed ha dis an ly loca ed
duplica es a e gene a ed by di ec andem duplica ions,
and sepa a ed apa by la e inse ions [26]. Howe e , he
SA inse ion in o an exis ing a ge sequence was c ea ed
Table 2 SA associa ed polymo phisms de ec ed wi hin he Tex14 mRNA.
Posi ion n Con ol SA a ec ed P o ein Posi ion aa
388 A G S - > G 131
461 G C
1140 G A
1419 GGC +G 475
1677 C A
1755 T C
1941 A G
1994 C T S - > L 665
2139 C T
2228 G A R - > H 743
2466 A G
2511 T G
3307 G A G - > S 1103
3844 66 bp dele ion +33 bp inse ion KRLPA- > RETS s op 1283-1287
4061 G A N - > S 1354
The e ec o he polymo phism on p o ein sequence and posi ion in con ol ansc ip [GenBank: JN638886] and co esponding p o ein sequence a e indica ed.
Si onen e al.BMC Genomics 2011, 12:591
h p://www.biomedcen al.com/1471-2164/12/591
Page 6 o 10
wi h minimal colla e al damage o he a ge . This sepa-
a ed andem duplica ion may ha e a isen by ecombina-
ion a e duplica ion e en , since duplica ions unde go
high equencies o ecombina ion and a e consequen ly
uns able [25]. Duplica ions ha e been shown o a ibu e
om eplica ion slippage e o s [27,28], bu also he sig-
ni icance o ecombina ion o he o ma ion o small
indels, in pa icula inse ions, has been demons a ed
[29,30]. Howe e , hese mechanisms equi e an exis ing
duplica e in he DNA sequence [28]. In he pig, wi hin
he egion con aining he SA inse ion sequence and o i-
ginal sequence wi hin Tex14 in on 27 no duplica ion
sequences we e p esen in he wild ype animals. One
possible mechanism o he SA duplica ion e en could
also be he impe ec epai o DNA double-s and b eaks
by classical nonhomologous end joining (NHEJ) [31-33].
NHEJ equi es only sho mic ohomologies o 1-4 bp and
can e en liga e o e hangs wi hou homologies [28,34].
The iden i ica ion o he inse ion wi hin Tex14 exon
27 enables he gene assis ed selec ion agains he de ec .
Al hough he SA ca ie s a us is ai ly easy o de e -
mine on an aga ose gel, we u he examined he possi-
bili y o use SNPs on Illumina Po cineSNP60 beadchip
o iden i ica ion o he SA ca ie s and a ec ed animals.
Two SNPs (ALGA0066210 and ASGA0054360) we e
s ongly associa ed wi h he SA de ec and a haplo ype
o hese SNPs appea s o be a usable ma ke o ma ke
SSC 12 genomicTex14
SA Tex14 mRNA
Con ol Tex14 mRNA
A
33bp 30bp
TAG
Exon 27 Exon 28Exon 26 Exon 29
63bp
No
p o ein
Exon 27 Exon 28 Exon 29Exon 26
97bp
150 kDa
p o ein
33bp
In on 26 In on 27
360bp
51bp
AG
67bp
SA inse ion
Exon 27
Tex14
SOD1
BC D
600
500
TEX14
150
ubulin
50
S
S
bp
kDa
0
20
40
60
80
100
120
140
Con ol
SA
%
Figu e 3 The SA de ec is caused by an inse ion wi hin exon 27 o Tex14. A. A genomic inse ion o 51 bp o igina ing om Tex14 in on
27 (g ey ba ) has been duplica ed in o exon 27. This duplica ion ca ies an addi ional splicing si e (AG) 18 bp om he duplica ion s a si e. In
he mRNA o SA a ec ed es is he Tex14 exon 27 has been eplaced by 33 n o he di ec duplica ion and 30 n o he 3’end o he exon 27.
Thus, he 67 bp o he 5’end o he exon 27 is absen in he Tex14 mRNA o SA a ec ed boa s. The abe an splicing in he mRNA c ea es a
p ema u e ansla ion s op codon (TAG) in he exon 28. B. The genomic inse ion o 51 bp can be de ec ed on an aga ose gel wi h PCR p ime s
adjacen o he inse ion. C. Tex14 exp ession (exons 17-19) is ma kedly lowe in he SA a ec ed es is compa e o con ol boa s. The exp ession
di e ence was quan i ied wi h qPCR (P < 0.001) and is p esen ed as pe cen age o he con ol es is exp ession. SOD1 gene was used as a
loading con ol. D. TEX14 p o ein exp ession in he SA a ec ed and con ol es is was e alua ed by wes e n blo ing. TEX14 appea ed o be
absen in he SA a ec ed es is. a- ubulin was used as a loading con ol.
Si onen e al.BMC Genomics 2011, 12:591
h p://www.biomedcen al.com/1471-2164/12/591
Page 7 o 10
assis ed selec ion agains he de ec a leas wi hin he
Finnish Yo kshi e popula ion.
Tex14 gene appea s o be c ucial o succes ul spe ma o-
genesis in he mouse and pig. The unc ional s udies
e ealing he ole o TEX14 in he in e cellula b idges
be ween de eloping male ge m cells indica e he impo -
ance o his gene in spe m p oduc ion ac oss species. A
s a is ically signi ican di e ence in Tex14 gene exp ession
has also been iden i ied in azoospe mic men [35]. Howe e ,
no s a is ically signi ican associa ions be ween Tex14 SNPs
and azoospe mia ha e been iden i ied in his s udy o in
o he genome wide associa ion analyses o azoospe mic
men [36]. The lack o s a is ically signi ican associa ions
may be pa ly due o he he e ogeni y o azoospe mic cases
and low equency o Tex14 mu a ions. Genome wide asso-
cia ion analyses o he e ogenic samples equi e high num-
be o cases and con ols. Thus, he low amoun o
samples hinde s he analyses in hese s udies and la ge
genome-wide associa ion s udies a e equi ed in o de o
iden i y no el SNPs associa ed wi h azoospe mia. Howe e ,
Tex14 is a good candida e gene o causal mu a ions in
azoospe mic men.
Conclusions
In his s udy we epo a speci ic in e ili y de ec in Yo k-
shi e pigs. The in e ili y is caused by spe ma ogenic a es
in ea ly meio ic spe m cells esul ing in absence o spe ma-
ocy es and spe ma ids. The genome wide scan loca ed he
disease associa ed a ea wi hin 2 Mbp egion in po cine
ch omosome 12. Sequencing o a candida e gene, Tex14,
e ealed se e al polymo phisms wi hin he coding
sequence. The mos likely causal mu a ion was iden i ied
wi hin exon 27 esul ing in p ema u e s op codon in he
mRNA sequence. In addi ion, he exp ession o TEX14
mRNA and p o ein p oduc s was ma kedly down egula ed
in he es is o a SA a ec ed boa compa ed o con ol ani-
mals. The genomic mu a ion appea ed o be a 51 bp inse -
ion, which o igina es om Tex14 in on 27. Thus, he SA
inse ion is p obably an o iginal duplica ion e en sepa-
a ed by ecombina ion.
Me hods
Animal ma e ial and geno yping
In he ini ial genome wide scan he da a se included nine
SA a ec ed Finnish Yo kshi e boa s (cases) and 21 con-
ol boa s. The la ge ollow up s udy included addi ional
318 con ol boa s ha ha e been used in a i icial insemi-
na ion. DNA was ex ac ed om semen ollowing phe-
nol/chlo o o m ex ac ion. Fo each sample, 20 μlo
ex ac ed DNA wi h a ge DNA concen a ions o 100
ng/μl in TE-bu e was p o ided o he Ins i u e o
Molecula Medicine Finland (FIMM) whe e geno yping
was conduc ed using he Po cineSNP60 BeadChip (Illu-
mina L d, San Diego, USA) and he p o ocol p o ided by
he manu ac u e .
The gene es o he Tex14 inse ionwi hinexon27
was pe o med using genomic DNA and gene speci ic p i-
me s ( o wa d GTAAGACTGGCATGATGTAACACA-
GAA and e e se ACTCAGGGTATCTTTCTGGAG
TTCT).
PCR ampli ica ion and DNA sequencing
PCR ampli ica ion o Tex14 using SA a ec ed and con ol
cDNA ex ac ed om he es is o genomic DNA as a
empla e was pe o med wi h gene speci ic p ime s. The
PCR amplicons we e pu i ied using ExoSAP-IT™(Ame -
sham Biosciences) and sequenced in bo h di ec ions wi h
he same p ime s used in he ampli ica ion p ocedu es.
Sequencing was pe o med on MegaBace 500 capilla y
DNA sequence (Ame sham Biosciences) using DYEnamic
Figu e 4 Exp ession o Tex14 in emale ep oduc i e ac s. A. The exp ession o wo Tex14 agmen s up- and downs eam o he SA
duplica ion si e was in es iga ed in he o a y, o iduc and u e us o con ol animals. Tex14 exons 17-19 we e sligh ly exp essed in all examined
emale issues, bu he exp ession appea ed ma kedly lowe han in he es is. Exons 31-43 o Tex14 showed no exp ession in any o he emale
ep oduc i e issues con i ming he signi ican ly lowe exp ession o Tex14 in he o a y, o iduc and u e us compa ed o he es is. B. The
quan i y o Tex14 exons 17-19 exp ession in he o a y, o iduc and u e us in compa ison o he es is was analysed wi h qPCR and is p esen ed
as pe cen age o he es is exp ession. Tex14 exp ession was signi ican ly (P < 0.001) lowe in all examined issues compa ed o he es is.
Si onen e al.BMC Genomics 2011, 12:591
h p://www.biomedcen al.com/1471-2164/12/591
Page 8 o 10
ET Te mina o Ki s wi h The mo Sequenase™II DNA
Polyme ase (Ame sham Biosciences).
Gene exp ession
Fo analysis o candida e gene exp ession, samples o he
o iduc , o a y and u e us om wo no mal sows and es i-
cula issue om wo no mal and one SA a ec ed boa
we e collec ed and s o ed in RNAla e bu e (Qiagen).
To al RNA pu i ica ion was pe o med wi h RNeasy P o-
ec Mini and Midi ki s (Qiagen). To al RNA was e e se
ansc ibed (RT-PCR) wi h andom p ime s and an RNA
PCR ki (ImP om-II Re e se T ansc ip ion Sys em, P o-
mega, h p://www.p omega.com) acco ding o he manu-
ac u e ’s ins uc ions and ampli ied using gene speci ic
p ime s. Exp ession o Tex14 exons 17-19 and 31-34 was
assessed i s by gel elec opho esis and quan i ied he e-
a e by quan i a i e PCR (qPCR). Con ol eac ions we e
pe o med wi h SOD1 gene.
qPCR was pe o med wi h an ABI 7000 Sequence
De ec ion Sys em in 96-well mic o i e pla es using Abso-
lu e qPCR SYBR G een ROX Mix (ABgene). Ampli ica ion
by qPCR con ained 12.5 μl o Absolu e qPCR SYBR G een
Mix, 50 ng o cDNA, and 70 nM o each p ime in a inal
olume o 25 μl. Ampli ica ions we e ini ia ed wi h a 15-
min enzyme ac i a ion a 95°C ollowed by 40 cycles o
dena u a ion a 95°C o 15 s, p ime annealing a 60°C o
30 s, and ex ension a 72°C o 30 s. All samples we e
ampli ied in iplica e, and he mean alue was used o
u he calcula ions. Each un comp ised o wo una ec ed
samples o he es is, o a y, o iduc and u e us, one SA
a ec ed es is sample and a nega i e con ol sample in i-
plica e. A s anda d cu e o each p ime pai was p o-
duced by se ially dilu ing con ol es is cDNA. Quan i ies
o speci ic mRNA in he sample we e measu ed acco ding
o he co esponding gene-speci ic s anda d cu e. Raw
da a we e analyzed wi h he sequence de ec ion so wa e
(Applied Biosys ems) and ela i e quan i a ion was pe -
o med wi hin GeneEx so wa e (Mul iD Analyses AB).
Ra ios be ween he a ge and e e ence gene we e calcu-
la ed by using he mean o hese measu emen s. Speci ici y
o qPCR p oduc s was de e mined by a mel ing cu e ana-
lysis. No p ime -dime o ma ions we e de ec ed du ing
he applica ion o 40 eal- ime PCR ampli ica ion cycles.
P o ein de ec ion
Tissue samples we e homogenized in lysis bu e (50 mM
T is-HCl [pH 8.0], 170 mM NaCl, 5 mM e hylenediamine-
e a-ace ic acid, 1 mM di hio h ei ol, 1% NP-40, 0.5%
sodium deoxychola e, 0.05% SDS and p o ease inhibi o s
[Comple e mini; Roche Diagnos ics GmbH]) and quan i-
ied using B ad o d p o ein assay eagen [37]. Samples
we e sepa a ed unde dena u ing condi ions by 8% SDS-
PAGE and elec oblo ed o poly inylidene luo ide mem-
b ane. Nonspeci ic si es we e blocked wi h 5% non a d y
milk in 0.3% Tween-20 in PBS o 1 h a oom empe a-
u e, and he memb ane was incuba ed o e nigh wi h
an i-TEX14 (1:500, Sigma-Ald ich), o an i-alpha ubulin
(1:1000; NeoMa ke s) an ibody. An igen-an ibody com-
plexes we e de ec ed by incuba ion o he memb anes
wi h he an i- abbi o an i-mouse seconda y an ibody
(ho se adish pe oxidase-conjuga ed; Bio-Rad) o 2 h a
oom empe a u e. The bound seconda y an ibodies we e
loca ed wi h he Immun-S a Wes e nC Chemilumines-
cen Ki (Bio-Rad) acco ding o he manu ac u e ’s
ins uc ions and exposed o a ilm he ea e .
S a is ical analysis
Each SNP was es ed o a ecessi e mode o inhe i ance
whe e he equency o ecessi e homozygo es was com-
pa ed o he equency o he e ozygo es and he o he
homozygo es be ween SA a ec ed (cases) and non-
a ec ed boa s (con ols). The ecessi e mode o inhe i-
ance -model was chosen, because he SA a ec ed boa s
we e ela ed and he equency o he de ec is low in he
popula ion. When se e al housand SNPs a e es ed, he
p obabili y o alse posi i e indingsishigh.Ino de o
a oid alse posi i e indings only SNPs ha emained sig-
ni ican a e Bon e oni co ec ion o numbe o in o -
ma i e SNPs we e conside ed as s a is ically signi ican
(P < 1.81E-06). So wa e package Plink [38] was used o
he associa ion es . Manha an and linkage disequilib ium
plo s and he mos plausible haplo ypes we e p oduced
wi h Haplo iew so wa e [39].
Addi ional ma e ial
Addi ional ile 1: Signi ican SNPs (a e Bon e oni co ec ion) on
ch omosome 12 based on a da a se wi h 9 cases and 21 con ols
(P- alue small se ) and co esponding P- alues om he la ge da a
se wi h 339 con ols (P- alue la ge se ). The SNPs ha ul il ecessi e
mode o inhe i ance in he la ge da a se a e ma ked in bold ace.
Acknowledgemen s and unding
This wo k was suppo ed by he Academy o Finland (Regula ion o spe m
ail and cilia de elopmen ) and he Finnish Minis y o Ag icul u e and
Fo es y (Make a, Genomic selec ion) The assis ance o Ta ja Ho i uo i, Ulla-
Ma ia Jokipii and Anneli Vi a in DNA ex ac ion, p o ein analysis and
sequencing is g ea ly app ecia ed.
Au ho de ails
1
Ag i ood Resea ch Finland, MTT, Bio echnology and Food Resea ch,
Genomics, FI-36100 Jokioinen, Finland.
2
Uni e si y o Helsinki, Depa men o
Clinical Ve e ina y Sciences, Saa en aus, Finland.
Au ho s’con ibu ions
AS ca ied ou he molecula gene ics s udies, sequence alignmen s and
d a ed he manusc ip . PU pe o med he s a is ical analysis and pa icipa ed
in d a ing he manusc ip . HV pa icipa ed in he sequence analysis. MA
pa icipa ed in he design and coo dina ion o he s udy. JV pa icipa ed in
he design and helped o d a he manusc ip . All au ho s ead and
app o ed he inal manusc ip .
Si onen e al.BMC Genomics 2011, 12:591
h p://www.biomedcen al.com/1471-2164/12/591
Page 9 o 10