GENYOi004-A: An induced pluripotent stem cells (iPSCs) line generated from a patient with autism-related ADNP syndrome carrying a pTyr719* mutation
Abstract
This work was supported by the Postdoctoral Subprogramme Juan de la Cierva (JCI_2012_12666) to RM and Ramon y Cajal (RYC-2015- 18382) to PJR founded by the Ministry of Economy and Competitiveness; the Instituto de Salud Carlos III-FEDER (CP12/03175 and CPII17/00032) to V.R-M. and (PI12/1598, CPII15/00018 and PI16/01340) to PJR; the Instituto de Investigación Valdecilla (IDIVAL) 2014.041 to JLF-L and DG-L and APG/03 to JLF-L.
Full text
Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr Lab Resource: Stem Cell Line GENYOi004-A: An induced pluripotent stem cells (iPSCs) line generated from a patient with autism-related ADNP syndrome carrying a pTyr719* mutation Rosa Montes a , Pilar Mollinedo b,c , Sonia Perales a,d , Domingo Gonzalez-Lamuño c,e , Veronica Ramos-Mejía a , Jose L. Fernandez-Luna b,c,⁎ , Pedro J. Real a,d,⁎⁎ a Gene Regulation, Stem Cells and Development Group, Department of Genomic Oncology, GENYO: Centre for Genomics and Oncological Research-Pfizer, University of Granada, Junta de Andalucía, PTS, 18016 Granada, Spain b Genetics Unit, Hospital Valdecilla, 39008 Santander, Spain c Instituto de Investigación Valdecilla (IDIVAL), 39012 Santander, Spain d Department of Biochemistry and Molecular Biology I, Faculty of Science, University of Granada, 18016 Granada, Spain e Pediatrics Service, Hospital Valdecilla, 39008 Santander, Spain ABSTRACT ADNP syndrome is an intellectual disability associated with Autism spectrum disorder caused by mutations in ADNP. We generated an iPSC line from an ADNP syndrome pediatric patient harboring the mutation p.Trp719* (GENYOi004-A). Peripheral blood mononuclear cells were reprogrammed using a non-transmissible form of Sendai viruses expressing the four Yamanaka factors (Oct3/4, SOX2, KLF4 and c-MYC). Characterization of GENYOi004-A included mutation analysis of ADNP by allele-specific PCR, genetic identity by Short Tandem Repeats polymorphism profiling, alkaline phosphatase enzymatic activity, expression of pluripotencyassociated factors and pluripotency studies in vivo. GENYOi004-A will be useful to evaluate ADNP syndrome alterations at early developmental stages. Resource table. Unique stem cell line identifier GENYOi004-A Alternative name(s) of stem cell line ASD-PBMC-iPS4F2 Institution Gene Regulation, Stem Cells and Development Group, GENYO: Centre for Genomics and Oncological Research Pfizer-University of Granada-Junta de Andalucía, PTS, Granada 18,016, Spain; Contact information of distributor Pedro J. Real: [email protected] Jose L. Fernández-Luna: [email protected] Type of cell line iPSC Origin Human Additional origin info Age: 8 Sex: Female Ethnicity: Spaniard Caucasian Cell Source Blood Clonality Clonal Method of reprogramming Sendai Virus (Cytotune iPS 2.0 Reprograming System) Genetic Modification YES Type of Modification Spontaneous mutation Associated disease ADNP Syndrome Gene/locus pTyr719* mutation in ADNP gene Method of modification N/A Name of transgene or resistance N/A Inducible/constitutive system N/A Date archived/stock date September 2017 Cell line repository/bank hpscreg.eu/user/cellline/edit/GENYOi004-A Ethical approval Comisión de Garantías para la Donación y Utilización de Células y Tejidos Humanos. Junta de Andalucia. PR-05-2017 Resource utility GENYOi004-A is the first iPSC line generated from ADNP syndrome patients. GENYOi004-A will be a very useful tool to understand ADNP syndrome alterations at early developmental stages and to test experimental treatments for these patients in vitro. https://doi.org/10.1016/j.scr.2019.101446 Received 27 February 2019; Received in revised form 11 April 2019; Accepted 18 April 2019 ⁎ Correspondence to: J. L. Fernandez-Luna, Genetics Unit, Hospital Valdecilla, 39008 Santander, Spain. ⁎⁎ Correspondence to: Pedro J. Real, Gene Regulation, Stem Cells and Development Group, Department of Genomic Oncology, GENYO: Centre for Genomics and Oncological Research-Pfizer, University of Granada, Junta de Andalucía, PTS, 18016 Granada, Spain. E-mail addresses: [email protected] (J.L. Fernandez-Luna), [email protected] (P.J. Real). Stem Cell Research 37 (2019) 101446 Available online 22 April 2019 1873-5061/ © 2019 Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/). T
(caption on next page) R. Montes, et al. Stem Cell Research 37 (2019) 101446 2
Resource details Autism spectrum disorder (ASD) is a developmental disorder characterized by alterations in communication and behavior. Several ASD genes have been recently identified (De Rubeis et al., 2014;Iossifov et al., 2014). Mutations in Activity-Dependent Neuroprotective Protein gene (ADNP) have been associated with Helsmoortel-Van der Aa Syndrome (OMIM: 615873) (Helsmoortel et al., 2014), also known as ADNP syndrome that is considered an ASD. We have generated an iPSC line from peripheral blood mononuclear cells (PBMCs) obtained from an ADNP syndrome pediatric patient carrying a de novo p.Trp719*mutation (Mollinedo et al., 2019). This new iPSC line was named ASD-PBMC-iPS4F2 (registered as GENYOi004-A at www. hPSCreg.com). In parallel, we also generated an iPSC line from her mother (PBMC2-iPS4F8) that does not harbor any mutation in ADNP and will be consider as a negative control for genetic assays. Our group has a broad experience on the use of CytoTune iPS 2.0 Reprograming System (Life Technologies, Invitrogen) to reprogram PBMCs from donors and patients. PBMCs from the ADNP patient and her mother were exposed to Sendai virus vectors (SeV) expressing the reprogramming factors Oct3/4, SOX2, KLF4 and c-MYC. 3 weeks after transduction several clones were selected and characterized as described below. Firstly, we determined the presence of the mutation p.Trp719* in ADNP by allele specific PCR from genomic DNA in both cell lines, GENYOi004-A and PBMC2-iPS4F8 (Mollinedo et al., 2019) (Fig. 1A). Next, Short Tandem Repeat polymorphism (STR) analysis confirmed the same genetic identity between PBMCs from the patient (ASDPBMCs) and GENYOi004-A (Table 1). GENYOi004-A cells silenced the expression of exogenous reprogramming transgenes (Fig. 1B) and activated the expression of the endogenous pluripotent transcription factors, SOX2,REX1,NANOG and OCT4 (Fig. 1C) at passage 4. Importantly, GENYOi004-A cells showed normal karyotype at passage 7 (46, XX) (Fig. 1D). This new cell line grows forming typical roundshaped colonies and shows alkaline phosphatase activity (Fig. 1E). Moreover, expression of the pluripotent markers SSEA3, SSEA4, Tra1–60, Tra1–81 and OCT3/4 was evaluated by flow cytometry analysis (Fig. 1F). Finally, functional pluripotency was assessed in vitro (by embryo body formation) (Fig. 1G) and in vivo (teratoma formation assays) (Fig. 1H). In both cases, GENYOi004-A cells generate embryo bodies (EBs) and teratomas containing all three germ layers: ectoderm (GFAP or β3-Tubulin), mesoderm (Vimentin) and endoderm (Cytokeratin CK AE1-AE) as shown in Fig. 1G and H. Materials and methods Generation of GENYOi004-A and PBMC2-iPS4F8 lines Peripheral blood sample was obtained from a pediatric patient with ADNP syndrome and her mother after informed consent according with the Andalusian Ethics Review Board for Cellular Reprogramming requirements and with Spanish and EU legislation. PBMCs were isolated by centrifugation using Ficoll Paque™ PLUS (GE Healthcare). Isolated mononuclear cells were cultured in StemSpan™ SFEM (StemCell Technologies) supplemented with hSCF, hFLT3L, hTPO, G-CSF and hIL3 (Peprotech) for four days, transferred to a 12-well fibronectin coated plate (BD BioCoat™) and exposed to Sendai virus (SeV) (CytoTune®-iPS 2.0 Reprogramming kit, Life Technologies, Invitrogen) as formerly described (Lopez-Onieva et al., 2016). One month after reprogramming GENYOi004-A and PBMC2-iPS4F8 lines were adapted to grow in Essential 8 growth medium on Matrigel (BD Bioscience). Cells were split at a ratio from 1:6 to 1:8 every 4–5 days using PBS/EDTA (0.5 M) and cultured in a conventional incubator (37 °C, 5% CO 2 ). Fig. 1. (A) Allele-specific PCR from GENYOi004-A, PBMC2-iPS4F8 and PBMCs from a healthy donor (Control PBMCs). Amplification of the b-Actin gene was used as a control. (B) Silencing of exogenous reprogramming factors and SeV vector confirmed by RT-PCR. PBMCs transduced cells from the patient at day 4 after Sendai virus exposure was used as a positive control. (C) Expression of the endogenous pluripotent transcription factors SOX2, REX1, NANOG and OCT 3 was assessed by RTPCR. Human embryonic stem cell H9 was used as positive control. (D) GTG-banding shows a normal karyotype in GENYOi004-A cell line. (E) Alkaline phosphatase enzymatic activity staining. (Scale bar = 150 μm). (F) Expression of pluripotency-associated markers SSEA3, SSEA4, TRA1-81, TRA 1-60 and OCT3/4 at protein level by FACS analysis. The inset shows the staining of the isotype-matched antibody. (G) Embryo body (EB) differentiation assay. Immunohistochemistry analysis for endoderm (CKAE1-AE3), mesoderm (Vimentin) and ectoderm (β-III-Tubulin) from 3 week developed EBs. (Scale bar = 100 mm) (H) In vivo differentiation test by teratoma formation assay. Histological sections from 15 week-teratomas developed in the dorsal flanks of NOD/LtSz-scid interleukin-2Rγ_/_ mice following injection with ASD-PBMC-iPS4F2 cells. Hematoxylin and eosin (H&E) staining and immunohistochemistry analysis showed differentiation to endoderm (CK AE1-AE3), mesoderm (Vimentin) and ectoderm (GFAP). (Scale bar = 250 μm). Table 1 Characterization and validation. Classification Test Result Data Morphology Photography Visual record of the line: normal Fig. 1 panel E Phenotype Qualitative analysis (RT-PCR) Positive for SOX2, REX1, NANOG and OCT4 Fig. 1 panel C (Alkaline Phosphatase staining) Positive Fig. 1 panel E Quantitative analysis (Flow cytometry) Oct3/4: 80%Tra 1–60: 96%; Tra1–81:30%; SSEA-4: 99%; SSEA-3: 37% Fig. 1 panel F Genotype Karyotype (G-banding) and resolution 46, XX Resolution 450–500 Fig. 1 panel D Identity STR analysis 16 loci tested, all matched Available with the authors Mutation analysis (IF APPLICABLE) Allele specific PCR Specific amplication of mutant ADNP in ASD-PBMC-iPS4F4 Fig. 1 panel A Southern Blot OR WGS Microbiology and virology Mycoplasma Mycoplasma testing by RT-PCR Negative Supplementary file 2 Differentiation potential Embryoid body formation Immunohistochemistry for Vimentin, CK-AE1-AE3, β-IIItubulin Fig. 1 panel G Teratoma formation Immunohistochemistry for Vimentin, CK-AE1-AE3, GFAP Fig. 1 panel H Donor screening (OPTIONAL) HIV 1 + 2 Hepatitis B, Hepatitis C Negative Not shown but available with author Genotype additional info (OPTIONAL) Blood group genotyping N/A HLA tissue typing HLA-I A* 03/24 - B* 35/55 - C* HLA-II DRB1* 1401/1401 - DQA1* 01/01 - DQB1* 0503/ 0503 Not shown but available with author R. Montes, et al. Stem Cell Research 37 (2019) 101446 3
Allele-specific PCR Genomic DNA was isolated from GENYOi004-A and PBMC2-iPS4F8 lines using the DNA extraction kit (Qiagen). DNA purified from PBMCs from a healthy donor not related to the patient was used as a wildtype control. PCR amplification with a set of primers that specifically recognizes wildtype or mutant alleles (Set ADNP, see Table 2) was performed in all three samples following the manufacturer's instructions (KapaBiosystems) in a SureCycler 8800 thermal cycler (Agilent). The PCR conditions were: 5 min (95 °C) initial denaturation, 35 cycles (30 s 95 °C denaturation, 30 s 55 °C annealing, 30 s 72 °C extension) followed by a 7-min final extension segment. The resulting PCR products were size fractionated onto a 2% agarose gel and stained with ethidium bromide. Short Tandem Repeat polymorphism (STR) profiling The genetic identity of PBMCs from the ASD patient (ASD-PBMC) and GENYOi004-A was determined as previously described (LopezOnieva et al., 2016) (Table 1). Semiquantitative RT-PCR Total RNA from undifferentiated GENYOi004-A line and the human embryonic stem cell H9 (positive control) line was isolated using the High pure RNA isolation kit (Roche). cDNA was generated using the Transcription First Strand c-DNA synthesis kit (Roche) following the manufacturer's instructions. PCR was performed using GoTaq Flexi DNA Polymerase kit (Promega). The PCR conditions were optimized to get semiquantitative data within the linear range of amplification in a SureCycler 8800 thermal cycler (Agilent). The PCR conditions were: 2 min (95 °C) initial denaturation, 30–35 cycles (30 s 95 °C denaturation, 30 s 55–60 °C annealing, 30 s 72 °C extension) followed by a 5-min final extension segment. PCR products were electrophoresed in an agarose gel. For exogenous gene clearance analysis (Fig. 1B), PBMCs transduced cells from the patient at day 4 after Sendai virus exposure was used as a positive control. H9 hESCs cells were used as a positive control for endogenous pluripotent transcription factors. Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti-SSEA3-PE 1:100 eBioscience Cat# 12–8833-42 RRID:AB_10854121 Pluripotency Markers Rabbit anti-SSEA4-PE 1:100 BD Pharmingen Cat# 560128 RRID:AB_1645533 Pluripotency Markers Rabbit anti-Tra1–60-PE 1:100 eBioscience Cat# 12–8863-82 RRID:AB_891602 Pluripotency Markers Rabbit anti-Tra1–81-PE 1:100 BD BioScience Cat# 560161 RRID:AB_1645540 Pluripotency Markers Mouse anti-OCT4 1:100 BD BioScience Cat# 611203 RRID:AB_398737 Secondary antibodies Goat Anti-Mouse IgG/IgM FITC 1:200 BD BioScience Cat# 554001 RRID:AB_395197 Isotype control PE Mouse IgM, PE conjugated 1:100 BD BioScience Cat# 555584 RRID:AB_395960 Differentiation Markers Mouse Anti-CKAE1-AE3 1:50 DAKO Cat # M3515 RRID:AB_2132885 Differentiation Markers Mouse Anti-Vimentin (V9) Ready to use Roche Tissue Diagnostics Cat # 790–2917 RRID: N/A Differentiation Markers Mouse Anti-β-III-Tubulin 1:50 Millipore Cat # MAB1637 RRID:AB_2210524 Differentiation Markers Mouse Anti-GFAP 1:200 DAKO Cat # M0761 RRID:AB_2109952 Primers Target Forward/Reverse primer (5′-3′) Sendai Virus Plasmids (RT-PCR) SeV (181 bp) Forward: GGATCACTAGGTGATATCGAGC Reverse:ACCAGACAAGAGTTTAAGAGATATGTATC Sendai Virus KOS Plasmid (RT-PCR) KOS (528 bp) Forward: ATGCACCGCTACGACGTGAGCGC Reverse: ACCTTGACAATCCTGATGTGG Sendai Virus c-MYC Plasmid (RT-PCR) c-MYC (532 bp) Forward: TAACTGACTAGCAGGCTTGTCG Reverse: TCCACATACAGTCCTGGATGATGATG Sendai Virus KLF4 Plasmid (RT-PCR) KLF4 (410 bp) Forward: TTCCTGCATGCCAGAGGAGCCC Reverse: AATGTATCGAAGGTGCTCAA Targeted mutation analysis: Allele specific PCR ADNP (206 bp) Forward (wildtype): CACCTGTGAAGCGCACTTAC Forward (Mutant): CACCTGTGAAGCGCACTTAA Reverse: GGGATAGGGCTGTTTGTTGAA House-Keeping Genomics (RT-PCR) β-ACTIN (232 bp) Forward: GCGGGAAATCGTGCGTGACATT Reverse: GATGGAGTTGAAGGTAGTTTCGTG Pluripotency Markers (RT-PCR) NANOG (96 bp) Forward: TGCAGTTCCAGCCAAATTCTC Reverse: CCTAGTGGTCTGCTGTATTACATTAAGG Pluripotency Markers (RT-PCR) OCT4 (110 bp) Forward: AGTGAGAGGCAACCTGGAGA Reverse: ACACTCGGACCACATCCTTC Pluripotency Markers (RT-PCR) REX1 (306 bp) Forward: CAGATCCTAAACAGCTCGCAGAAT Reverse: GCGTACGCAAATTAAAGTCCAGA Pluripotency Markers (RT-PCR) SOX2 (80 bp) Forward: TCAGGAGTTGTCAAGGCAGAGAAG Reverse: CTCAGTCCTAGTCTTAAAGAGGCAGC House-Keeping Gene (RT-PCR) β-ACTIN (165 bp) Forward: CTGGAACGGTGAAGGTGACA Reverse: AAGGGACTTCCTGTAACAATGCA R. Montes, et al. Stem Cell Research 37 (2019) 101446 4
Karyotyping Chromosomal analysis from GENYOi004-A at passage 7 was performed by GTG-banding analysis at the Andalusian Public Health System Biobank, Spain. 20 metaphases were analyzed according to the International System Cytogenetics Nomenclature recommendations. Alkaline phosphatase GENYOi004-A colonies were assayed for phosphatase alkaline enzymatic activity using a commercial detection kit (Merck-Millipore) following manufacturer's instructions. Flow cytometry analysis GENYOi004-A colonies were dissociated using Tryple Express (Life Technologies) and the cell suspension was stained for SSEA3 (PE, BioScience), SSEA4 (Alexa Fluor®647, BD Pharmingen), Tra1–60 (PE, BioScience), Tra1–81 (Alexa Fluor®647, BD Pharmingen) and OCT3/4 (BD BioScience) as previously published (Lopez-Onieva et al., 2016). A relevant isotype-match antibody was always used as a negative control. Live cells were identified by 7-aminoactinomycin D exclusion and were analyzed using a FACS verse (BD Bioscience). Embryo body differentiation assay GENYOi004-A cells were gently scraped off centrifuged, resuspended into Essential 6 medium and plated over low attachment 6well plates (Corning) and embryo bodies were formed spontaneously. Three weeks later, embryo bodies were centrifuged, fixed and embedded in paraffin. Immunocytochemistry analysis were completed as previously described (Lopez-Onieva et al., 2016). In vivo teratoma formation GENYOi004-A cells were dissociated with collagenase IV (Invitrogen) and resuspended in PBS supplemented with 30% matrigel. 2 million cells were subcutaneously injected into the dorsal flanks of NOD/LtSz-scid interleukin-2Rγ _/_ mice (The Jackson Laboratory). At week 15, teratomas were removed, fixed in formaldehyde and embedded in paraffin. Immunocytochemistry analysis confirmed the presence of ectodermal (β3-Tubulin), mesodermal (Vimentin) and endodermal (CKAE1-AE3) tissues. Mycoplasma testing Mycoplasma detection analysis from GENYOi004-A cells was performed by quantitative PCR analysis (Venor GeM-qEP (Minerva Biolabs)) at the Genomics and Genotyping Unit in GENyO, Spain. Acknowledgments This work was supported by the Postdoctoral Subprogramme Juan de la Cierva (JCI_2012_12666) to RM and Ramon y Cajal (RYC-201518382) to PJR founded by the Ministry of Economy and Competitiveness; the Instituto de Salud Carlos III-FEDER (CP12/03175 and CPII17/00032) to V.R-M. and (PI12/1598, CPII15/00018 and PI16/01340) to PJR; the Instituto de Investigación Valdecilla (IDIVAL) 2014.041 to JLF-L and DG-L and APG/03 to JLF-L. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.scr.2019.101446. References De Rubeis, S., He, X., Goldberg, A.P., Poultney, C.S., Samocha, K., Cicek, A.E., Kou, Y., Liu, L., Fromer, M., Walker, S., Singh, T., Klei, L., Kosmicki, J., Shih-Chen, F., Aleksic, B., Biscaldi, M., Bolton, P.F., Brownfeld, J.M., Cai, J., Campbell, N.G., Carracedo, A., Chahrour, M.H., Chiocchetti, A.G., Coon, H., Crawford, E.L., Curran, S.R., Dawson, G., Duketis, E., Fernandez, B.A., Gallagher, L., Geller, E., Guter, S.J., Hill, R.S., IonitaLaza, J., Jimenz Gonzalez, P., Kilpinen, H., Klauck, S.M., Kolevzon, A., Lee, I., Lei, I., Lei, J., Lehtimäki, T., Lin, C.-F., Ma'ayan, A., Marshall, C.R., McInnes, A.L., Neale, B., Owen, M.J., Ozaki, N., Parellada, M., Parr, J.R., Purcell, S., Puura, K., Rajagopalan, D., Rehnström, K., Reichenberg, A., Sabo, A., Sachse, M., Sanders, S.J., Schafer, C., Schulte-Rüther, M., Skuse, D., Stevens, C., Szatmari, P., Tammimies, K., Valladares, O., Voran, A., Li-San, W., Weiss, L.A., Willsey, A.J., Yu, T.W., Yuen, R.K.C., DDD Study, E.H., Homozygosity Mapping Collaborative for Autism, C.M,UK10K Consortium, M, Cook, E.H., Freitag, C.M., Gill, M., Hultman, C.M., Lehner, T., Palotie, A., Schellenberg, G.D., Sklar, P., State, M.W., Sutcliffe, J.S., Walsh, C.A., Scherer, S.W., Zwick, M.E., Barett, J.C., Cutler, D.J., Roeder, K., Devlin, B., Daly, M.J., Buxbaum, J.D., 2014. Synaptic, transcriptional and chromatin genes disrupted in autism. Nature 515, 209–215. https://doi.org/10.1038/nature13772. Helsmoortel, C., Vulto-van Silfhout, A.T., Coe, B.P., Vandeweyer, G., Rooms, L., van den Ende, J., Schuurs-Hoeijmakers, J.H.M., Marcelis, C.L., Willemsen, M.H., Vissers, L.E.L.M., Yntema, H.G., Bakshi, M., Wilson, M., Witherspoon, K.T., Malmgren, H., Nordgren, A., Annerén, G., Fichera, M., Bosco, P., Romano, C., de Vries, B.B.A., Kleefstra, T., Kooy, R.F., Eichler, E.E., Van der Aa, N., 2014. A SWI/SNF-related autism syndrome caused by de novo mutations in ADNP. Nat. Genet. 46, 380–384. https://doi.org/10.1038/ng.2899. Iossifov, I., O'Roak, B.J., Sanders, S.J., Ronemus, M., Krumm, N., Levy, D., Stessman, H.A., Witherspoon, K.T., Vives, L., Patterson, K.E., Smith, J.D., Paeper, B., Nickerson, D.A., Dea, J., Dong, S., Gonzalez, L.E., Mandell, J.D., Mane, S.M., Murtha, M.T., Sullivan, C.A., Walker, M.F., Waqar, Z., Wei, L., Willsey, A.J., Yamrom, B., Lee, Y., Grabowska, E., Dalkic, E., Wang, Z., Marks, S., Andrews, P., Leotta, A., Kendall, J., Hakker, I., Rosenbaum, J., Ma, B., Rodgers, L., Troge, J., Narzisi, G., Yoon, S., Schatz, M.C., Ye, K., McCombie, W.R., Shendure, J., Eichler, E.E., State, M.W., Wigler, M., 2014. The contribution of de novo coding mutations to autism spectrum disorder. Nature 515, 216–221. https://doi.org/10.1038/nature13908. Lopez-Onieva, L., Montes, R., Lamolda, M., Romero, T., Ayllon, V., Lozano, M.L., Vicente, V., Rivera, J., Ramos-Mejía, V., Real, P.J., 2016. Generation of induced pluripotent stem cells (iPSCs) from a Bernard-Soulier syndrome patient carrying a W71R mutation in the GPIX gene. Stem Cell Res. 16. https://doi.org/10.1016/j.scr.2016.04.013. Mollinedo, P., Kapitansky, O., Gonzalez-Lamuño, D., Zaslavsky, A., Real, P., Gozes, I., Gandarillas, A., Fernandez-Luna, J.L., 2019. Cellular and animal models of skin alterations in the autism-related ADNP syndrome. Sci. Rep. 9, 736. https://doi.org/10. 1038/s41598-018-36859-2. R. Montes, et al. Stem Cell Research 37 (2019) 101446 5