scieee Open visual document viewer

Structural insights into RNA binding by NusA and interaction studies of Nun with E. coli Nus factors.

Pagadala Santhanam, Sujatha

Full text

S uc u al insigh s in o RNA binding by NusA and in e ac ion s udies o Nun wi h E. coli Nus ac o s Disse a ion Zu E langung des Dok o g ades de Fakul ä Biologie, Chemie und Geowissenscha en de Uni e si ä Bay eu h o geleg on M. Sc. Pagadala San hanam Suja ha Bay eu h 2008 Die o liegende A bei wu de on Augus 2005 bis Juli 2008 am Leh s uhl ü S uk u und Chemie de Biopolyme e de Uni e si ä Bay eu h un e de Lei ung on P o . D . Paul Rösch ange e ig . Volls ändige Abd uck de on de Fakul ä ü Biologie, Chemie und Geowissenscha en de Uni e si ä Bay eu h genehmig en Disse a ion zu E langung des akademischen G ades eines Dok o s de Na u wissenscha en (D . e . Na .). P omo ionsgesuch einge eich am : 16.07.2008 Tag des wissenscha lichen Kolloquiums: 22.10.2008 E s e Gu ach e : P o . D . Paul Rösch Zwei e Gu ach e : P o . D . Ma hias Ullmann Vo si zende : P o . D . And eas Fe y P o . D . Raine Schobe Wi h ond memo ies o my mom CONTENTS I Con en s 1. In oduc ion......................................................................................................................1 1.1 Bac e iophages................................................................................................................1 1.2 Li e cycle o lambda bac e iophage................................................................................2 1.3 T ansc ip ion mechanism................................................................................................5 1.4 nu – RNA o bac e iophage λ.........................................................................................9 1.5 T ansc ip ion an i e mina ion and e mina ion in E. coli...............................................11 1.5.1 Phage λ N an i e mina ion....................................................................................11 1.5.2 Mechanism o Nun media ed e mina ion............................................................12 1.6 Elonga ion ac o NusA................................................................................................15 1.7 Thesis objec i es...........................................................................................................21 2. Ma e ials and Me hods..................................................................................................22 2.1 Cul u e media................................................................................................................22 2.1.1 Lu ia Be ani medium..........................................................................................22 2.1.2 Minimal medium (M9).........................................................................................22 2.1.3 P-5052 medium....................................................................................................23 2.2 Es ima ion o p o ein concen a ion..............................................................................24 2.3 SDS – polyac ylamide gel elec opho esis...................................................................24 2.4 Schagge and Jagow gel elec opho esis.......................................................................25 2.5 HK022 Nun p o ein.......................................................................................................26 2.5.1 Exp ession o Nun................................................................................................26 2.5.2 Cell lysis and pu i ica ion o HK022 Nun...........................................................26 2 INTRODUCTION phage mus pe o m some minimal unc ions o con inued su i al, like p o ec ion o i s nucleic acid om en i onmen al chemicals ha could al e he molecule, deli e y o i s nucleic acid o he inside o a bac e ium, con e sion o an in ec ed bac e ium o a phage- p oducing sys em which yields a la ge numbe o p ogeny phage and elease o p ogeny phage om an in ec ed bac e ium. These unc ions a e ca ied ou in a a ie y o ways by di e en phage species. All o he species ha e ce ain ea u es in common bu di e ences in de ail show he many ways in which speci ic biological unc ions can be accomplished [Voe e al., 2nd edi ion]. Lambda phage The o igins o molecula biology a e deeply enmeshed wi h he disco e y and cha ac e iza ion o he empe a e coliphage λ [Go esman 2004]. The isola ion o λ was i s epo ed in 1951 by Es he Lede be g and hen la e i was desc ibed in g ea e de ail, in 1953 by Es he and Joshua Lede be g [Lede be g 1951; Lede be g e al., 1953]. The empe a e coliphage λ has se ed as a model o he ields o gene egula ion and empo al p og amming o gene exp ession [Go esman 1999]. The λ phage has been use ul because, ollowing in ec ion, λ de elopmen can p oceed along wo al e na i e pa hways. Some cells en e a p oduc i e cycle, in which phage DNA eplica es au onomously and is packaged in o p ogeny phage pa icles, which a e hen libe a ed by lysis. O he cells su i e in ec ion o become lysogenic and ha bo he phage DNA inse ed in o he ch omosome as a p ophage, which emains ansc ip ionally quiescen o genes o he p oduc i e cycle [Campbell 1994]. 1.2 Li e cycle o lambda bac e iophage The lysis-lysogeny decision o λ bac e iophage is a pa adigm o de elopmen al gene ic ne wo ks [Oppenheim e al., 2005; Cou e al., 2007]. The e a e h ee key ea u es which cha ac e ize he ne wo k. Fi s , a e in ec ion o he hos bac e ium, a decision be ween ly ic o lysogenic de elopmen is made ha is dependen upon en i onmen al signals and he numbe o in ec ing phages pe cell. Second, he lysogenic p ophage s a e is e y s able. Thi d, he p ophage en e s ly ic de elopmen in esponse o DNA-damaging agen s. INTRODUCTION 3 The CI (ac i a es pRM p omo e ) and C o egula o s de ine he lysogenic and ly ic s a es, espec i ely, as a bis able gene ic swi ch. Whe eas CI main ains a s able lysogenic s a e, ecen s udies indica e ha C o se s he ly ic cou se no by di ec ly blocking CI exp ession bu indi ec ly by lowe ing le els o CII which ac i a es cI ansc ip ion (Fig 1.1). Figu e 1.1 Gene and ansc ip ion map o λ bac e iophage egula o y egion. Genes a e shown in he shaded ec angle. The ea ly ansc ip s o pL and pR p omo e s a e shown as ed a ows. The la e ansc ip om pR´ is indica ed wi h black a ows. The CII-ac i a ed pI, pRE, and pAQ ansc ip s a e indica ed wi h blue a ows. The pRM ansc ip ac i a ed by CI is a g een a ow. T ansc ip ion e mina o s ( ) a e shown as ed le e s among he genes. The I e mina o is indica ed in pa en hesis because i is con ained wi hin he la ge sib p ocessing si e. The ope a o s OL and OR whe e CI and C o bind a e shown nex o he pL and pR p omo e s. Ly ic de elopmen T ansc ip ion is ini ia ed wi h he syn hesis o he ea ly ansc ip s om he pL and pR p omo e s (Fig 1.1). Ea ly ansc ip s which encode wo egula o s, N and C o, a e a enua ed a he L1 and R1 e mina o s. These ansc ip ional e mina o s play an impo an ole in con olling he cascade o gene exp ession. By ac ing as a weak ep esso o bo h pL and pR p omo e s, C o acili a es he ly ic mode. Fo example, he N p o ein which is a an i e mina ion ac o p omo es he assembly o a ansc ip ion complex [Ba ik e al., 1987; G eenbla e al., 1998]. This assembly occu s on he RNA a nu L and nu R si es and is made up o RNA polyme ase and a numbe o hos p o eins called Nus. Sib ( I) –a p-in -xis---cIII L1N nu L cI c o nu R- R1-cII-O-P- en- R2-Q R´ pL OL pI OR pR pR´ pRM pRE pAQ Sib ( I) –a p-in -xis---cIII L1N nu L cI c o nu R- R1-cII-O-P- en- R2-Q R´ pL OL pI OR pR pR´ pRM pRE pAQ 4 INTRODUCTION The N and Nus-modi ied RNA polyme ase can o e come he L1 and R1 ansc ip ion e mina o s, esul ing in exp ession o he dis al delayed ea ly unc ions. The delayed ea ly unc ions include he lysogenic egula o s CII and CIII, as well as he ly ic DNA eplica ion genes O and P, and he la e gene egula o Q [F iedman e al., 1995]. A e su icien accumula ion, he Q p o ein modi ies RNA polyme ase ha has jus ini ia ed ansc ip ion om he pR´ la e p omo e . This modi ica ion causes he RNA polyme ase o become esis an o ansc ip ion e mina o s p esen downs eam o pR´, allowing he exp ession o he la e genes, which encode p o eins o phage mo phogenesis and hos cell lysis. Du ing he las s age o he cascade, he la e gene p oduc s assemble phage i ions and lyse he hos . Lysogenic de elopmen Two phage p o eins, In and CI, a e equi ed o o m s able lysogens. In allows he in eg a ion o he phage genome in o he bac e ial ch omosome, and CI ep esses he wo ea ly phage p omo e s o p e en any ly ic phage gene exp ession. When λ bac e iophage i s in ec s, In and CI a e no ini ially made, and he λ phage ini ia es gene exp ession along a se o e en s ha a e common o bo h he ly ic and lysogenic pa hways. I condi ions a e a o able du ing his ini ial phase, In and CI syn hesis can be swi ched on, o enable lysogenic de elopmen . This ac i a ion depends p ima ily upon he phage CII unc ion. The cII gene is loca ed be ween he R1 e mina o and he eplica ion genes and, hus, is ansc ibed wi h he ea ly ly ic genes. Howe e , CII p o ein is equi ed only o lysogenic de elopmen o in ec ing phages. Ano he gene equi ed o lysogenic de elopmen is cIII, loca ed beyond L1 in he pL ope on. Mu a ions in hese genes as well as in he cI gene encoding he ep esso unc ion cause λ bac e iophage plaques o be clea , unlike he no mal u bid plaques whe e he u bidi y indica es g ow h o lysogenic cells. Whe eas he CI ep esso is equi ed o main ain he ep essed lysogenic s a e, he CII and CIII p o eins a e only equi ed o ini ially ac i a e CI syn hesis [Kaise 1957; F iedman e al., 2001]. Once CI has been made, he CII and CIII unc ions a e no longe equi ed because, CI can main ain i s own syn hesis. INTRODUCTION 5 1.3 T ansc ip ion mechanism RNA polyme ase T ansc ip ion is egula ed a se e al biochemical s eps by p o ein ac o s h ough gene ic signals ecognized in he o m o DNA o RNA [Das 1993; Bu gess e al., 1987]. T ansc ip ion o all E. coli (Esche ichia coli) genes is ca ied ou by a single o m o co e RNA polyme ase, cons i u ed by ou subuni s (α2ββ') ha a e encoded by poA, poB and poC genes, espec i ely. The co e RNA polyme ase binds o one o se e al sigma ac o s ha di ec s he RNA polyme ase holoenzyme o he p omo e o dis inc classes o genes. σ70, encoded by poD, se es as he ini ia o o mos E. coli genes. Hence, he comple e holoenzyme has 6 subuni s: α2ββ'σω (~480 kDa). The ca aly ic cen e is cons i u ed by bo h β and β' subuni s, which sha e homology o he la ges subuni s o euka yo ic RNA polyme ases. The β subuni can be c oss-linked o nucleo ides, DNA and he RNA p oduc . Mu a ions in poB encoding β a ec i ually e e y aspec o ansc ip ion like sensi i i y o an ibio ics, p omo e ecogni ion and in e ac ion wi h σ [G oss e al., 1992], abo i e ini ia ion, elonga ion kine ics, in insic e mina ion and egula ion by e mina ion and an i e mina ion ac o s [ on Hippel 1998; Rhodius e al., 1998]. Likewise, mu a ions in poC encoding β' al e p omo e -speci ici y and sensi i i y o i ampicin and egula ion by elonga ion con ol p o eins. The alpha subuni , equi ed o co e assembly, plays a pi o al ole in he posi i e con ol o ini ia ion by ac i a o s, such as he cAMP-CRP complex. α-CTD o RNA polyme ase Ac i a ion o gene ansc ip ion in a p oka yo e sys em is igge ed by se e al kinds o ansc ip ion ac i a o s [Ishihama 1988]. In he E. coli RNA polyme ase holoenzyme, one o he egions esponsible o ansc ip ion ac i a ion has been localized o he α subuni a COOH e minal. The ca boxyl- e minal domain α subuni (α-CTD), is ega ded as he con ac si e o ansc ip ion ac i a o p o eins and o he p omo e UP elemen . Dele ion o his egion does no in e e e wi h he assembly o he co e o he holoenzyme, bu econs i u ed RNA polyme ase con aining C- e minal unca ed alpha subuni s canno be ac i a ed by a g oup o ansc ip ion ac i a o p o eins [Ishihama 1992; Iga ashi e al., 1991]. 6 INTRODUCTION This g oup o p o eins con ains he class I ansc ip ion ac o s, and hei con ac si es ha e been placed a a ious posi ions in he C- e minal domain. The isola ed α subuni and i s C- e minal domain p o ec he UP elemen egion om deoxy ibonuclease I (DNase I) diges ion, which indica es ha he C- e minal po ion o he α subuni is esponsible o he con ac wi h cis-ac ing UP elemen s as well as wi h ans-ac ing ansc ip ion ac o s. The solu ion s uc u e o αCTD, a 98-amino acid COOH- e minal agmen ( esidues 233 o 329 plus me hionine a he NH2- e minus) was de e mined by NMR [Jeon e al., 1995]. The s uc u e is compac ly olded and comp ises ou helices and wo long loops a he e minals o he domain (PDB code - 1COO). T ansc ip ion ini ia ion In all o ganisms, ansc ip ion pe o med by DNA-dependen RNA polyme ases can be di ided in o h ee mechanis ically and s uc u ally dis inc s ages: ini ia ion, elonga ion, and e mina ion. In he i s s ep, RNA polyme ase binds o he p omo e , o ming a me as able “closed p omo e ” complex. The σ70 holoenzyme ecognizes wo conse ed hexame s cen e ed a ound -10 (TATAAT) and -35 (TTGACA) posi ions ela i e o he s a si e, u ilizing wo conse ed DNA-binding domains in σ70. The closed complex hen unde goes se e al s uc u al ans o ma ions o isome ize in o a hepa in- esis an “open p omo e ” complex ha con ains a single s anded DNA bubble encompassing he -12 o +4 egion. Finally, he open complex couples wo speci ic ibonucleo ides o ming a dinucleo ide e aphospha e ha se es as he p ime o subsequen RNA chain elonga ion. T ansc ip ion elonga ion Du ing elonga ion, RNA polyme ase pe o ms housands o nucleo ide addi ion cycles. Each cycle mus culmina e in o wa d ansloca ion by one nucleo ide (n ) o allow o he inco po a ion o he nex subs a e; his s ep en ails he sepa a ion o 1 bp o he dwDNA accompanied by he displacemen o one n o he nascen RNA om he DNA empla e a he ups eam edge o he RNA/DNA hyb id and subsequen annealing o he ups eam DNA duplex [ on Hippel e al., 2002]. Though he elonga ion complex is capable o he unin e up ed syn hesis o RNA chains housands o nucleo ides long, ye , he complex becomes ab up ly des abilized a e mina o s ha dema ca e he RNA end, in many cases wi h single n p ecision. The in e play be ween p ocessi e syn hesis, ansien hal ing a nume ous INTRODUCTION 7 ‘ oadblocks’ and RNA elease depends on he in ica e ne wo k o in e ac ions be ween RNA polyme ase, he nucleic acid signals and/o auxilia y ansc ip ion ac o s wi hin he elonga ion complex [Vassylye e al., 2007; Up ain e al., 1997; Nudle 1999]. T ansc ip ion e mina ion [Gusa o e al., 1999; G ei e e al., 2005] T ansc ip elonga ion by RNA polyme ase in ol es a p ocessi e mechanism. Ye , he RNA chain is no ex ended a a ixed a e along he DNA. Un il ecen ly, wo p e alen ypes o si es we e known o impede elonga ion: (a) he so-called “pause” si es, which induce a empo a y, e e sible block o nucleo ide addi ion and (b) e mina o s, which cause he elease o RNA and/o RNA polyme ase, ei he in insically, o upon ac i a ion by a di usible ac o such as NusA, Rho o Tau. The dissocia ion o he sigma ac o is hough o ma k he en y o NusA p o ein, a key elonga ion modula o ha couples e mina ion and an i e mina ion ac o s o RNA polyme ase and i sel p omo es pausing and e mina ion a speci ic empla e si es. As he elonga ion complex is he a ge o many mo e di usible ac o s, which also includes ansc ip clea age ac o s, which help RNA polyme ase o o e come he “dead-end” si es, and addi ional Nus ac o s help RNA polyme ase o ansc ibe p ocessi ely h ough bo h ac o -dependen and in insic e mina o s. Bac e ia use wo main modes o e mina ing ansc ip ion: Rho-independen o ‘in insic’ e mina ion, mainly equi ing elemen s loca ed on he mRNA, and Rho-dependen e mina ion, elying on bo h mRNA elemen s and ans-ac ing ac o s. Abou hal o he ansc ip ion e mina o s iden i ied in E. coli a e Rho-dependen . These e mina o s lie a he na u al end o genes o wi hin cis ons and in con ol egions p eceding he coding sequences o genes, whe e hey play an impo an ole in he egula ion o gene exp ession. Rho is a homohexame ic p o ein wi h RNA-dependen ATPase and helicase ac i i ies which binds o he mRNA. Essen ial si es on he mRNA a e he Rho-binding si e, known as he Rho u iliza ion si e ( u ), and a dis al egion whe e he ansc ip s a e e mina ed. Du ing he ansc ip ion e mina ion p ocess he Rho ac o which is a hexame ic RNA–DNA helicase o E. coli binds o he nascen ansc ip a a ‘loading si e’ ha is ich in cy osine esidues and also ela i ely uns uc u ed. Once bound, Rho in e ac s wi h he E. coli ansc ip ion ac o (NusG) and ansloca es di ec ionally (5′→3′) along he RNA chain by an ATP-d i en p ocess, mo ing owa ds he ansc ibing RNA polyme ase (Fig 1.2). 8 INTRODUCTION Mos Rho-dependen e mina ion posi ions on he empla e a e also pause si es, and he e o e unc ion (a leas in pa ) by allowing Rho o ‘ca ch up’ wi h he paused RNA polyme ase, which leads o e mina ion by allowing Rho o use i s RNA–DNA-helicase ac i i y o unwind he RNA–DNA hyb id wi hin he ansc ip ion bubble. The s abili y o elonga ion complexes, can be modula ed by ansc ip ion ac o s ha bind di ec ly o indi ec ly (by cis RNA looping) o he RNA polyme ase a e binding o he nascen RNA. These ansc ip ion ac o s include NusA and NusG, which inc ease and dec ease e mina ion e iciency a in insic e mina o s, espec i ely, and inc ease e mina ion e iciency (NusG) a Rho-dependen e mina o s. Howe e , when assembled in o complexes ha con ain an i e mina ion p o eins (such as he N p o ein ha is encoded by phage λ) — which a e o en bound in conjunc ion wi h hos p o eins NusB and NusE — NusA and NusG ope a e oge he o dec ease e mina ion e iciency. Figu e 1.2 A model o ho-dependen e mina ion. Rho RNAP RNAP RNAP Rho binds o ansc ip a ho loading si e and pu sues polyme ase Hai pin o ms; polyme ase pauses; ho ca ches up Rho helicase eleases ansc ip , RNAP dissocia es and causes e mina ion Rho RNAP RNAPRNAP RNAPRNAP Rho binds o ansc ip a ho loading si e and pu sues polyme ase Hai pin o ms; polyme ase pauses; ho ca ches up Rho helicase eleases ansc ip , RNAP dissocia es and causes e mina ion INTRODUCTION 9 1.4 nu - RNA o bac e iophage λ The genome o he phage λ codes o wo cis-ac ing elemen called nu si e (N-u iliza ion): nu L and nu R each o 60 basepai s long and lies in be ween 50-250 basepai s o he 3’ side o he p omo e PL and PR [Rosenbe g e al., 1978]. The nu L and nu R si es a e composed o h ee conse ed mo i s, including BoxA (8 nucleo ides [n ] loca ed ups eam om he BoxB s em loop s uc u e), BoxB (15 n s em loop s uc u e), and BoxC (8 n ) [Washbu n e al., 2006; Das e al., 1996]. T ansc ip ion o he nu si e p o ides a locus on which N and Nus ac o s can nuclea e he o ma ion o a speci ic ibonucleop o ein complex [Mog idge e al., 1998]. BoxA RNA ec ui s NusB and NusE in o an an i e mina ion complex ha includes RNA polyme ase, NusA, and NusG. BoxB RNA o ms a s em-loop ha binds N o HK022 Nun. As i binds BoxB, N associa es wi h NusA, NusG, and RNA polyme ase. I is p oposed ha N, Nus ac o s, and nu in e ac and complex wi h RNA polyme ase while e he ed on he same RNA [Nodwell e al., 1991]. Al hough N is he essen ial ac o o an i e mina ion, nu and he Nus ac o s con e s abili y and ull ac i i y o he an i e mina ion complex. BoxB RNA alone binds N and Nun wi h simila a ini ies. This equi alen a ini y o BoxB RNA does no e lec he inabili y o N o compe e wi h Nun a nu L in i o. A hi d conse ed mo i , BoxC (8 n ), lies downs eam o nu L and nu R and does no appea o play a ole in an i e mina ion. The wo nu si es di e in he space egions be ween BoxA, BoxB, and BoxC and by a single nucleo ide change in he BoxB loop and he six h nucleo ide in BoxC. The spacing be ween BoxA and BoxB is se en and eigh nucleo ides o nu L and nu R espec i ely (Fig 1.3) [Pa e son e al., 1994]. I has been p oposed [Washbu n e al., 2003] ha he pheno ypic di e ence be ween nu L and nu R migh be explained by he ela i e dis ances o he wo nu elemen s om hei espec i e p omo e s. nu L is 34 nucleo ides om pL, whe eas nu R lies 227 nucleo ides om i s cogna e p omo e . nu L also di e s om nu R in ha , i lies immedia ely p omo e p oximal o RNase III clea age si es ( III). 10 INTRODUCTION Figu e 1.3 nu sequence showing h ee elemen s: BoxA, BoxB and he space egion loca ed be ween BoxA and BoxB. The di e ences a e highligh ed by ed colo ed alphabe s. Al hough he basic elemen s o he λ nu egion a e conse ed in many lambdoid phages, he e a e lambdoid phages ha a y om λ pa adigm. The mos di e gen example is phage HK022, which in place o nu si es, has pu si es [Weisbe g e al., 1999]. Unlike nu si es, which se e as a nuclea ion si e o p o ein an i e mina ion complexes, he pu RNA s uc u e i sel appea s o be necessa y and su icien o modi ica ion o RNA polyme ase in o an an i e mina ion mode. Howe e , HK022 encodes a p o ein, Nun, ha appea s o be an o holog o N, bu does no modi y ansc ip ion o HK022. Ins ead, Nun, which is exp essed om he HK022 p ophage, ac s as an exclusion unc ion by binding a λ nu si es o a es ansc ip ion. A A G G G C 5’ C G C U C U U A AA AA U U A A G boxA AG boxB 34 47 3’ U C C C G A Space λnu L A G G G C 5’ C G C U C U U A CA CA U U C C A G boxA AA boxB 34 47 3’ U C C C G A A Space λnu R A A G G G C 5’ C G C U C U U A AA AA U U A A G boxA AG boxB 34 47 3’ U C C C G A Space λnu L A G G G C 5’ C G C U C U U A AA AA U U A A G boxAboxA AG boxB 34 47 3’ U C C C G A Space Space λnu L A G G G C 5’ C G C U C U U A CA CA U U C C A G boxA AA boxB 34 47 3’ U C C C G A A Space λnu R A G G G C 5’ C G C U C U U A CA CA U U C C A G boxAboxA AA boxB 34 47 3’ U C C C G A A Space Space λnu R INTRODUCTION 11 1.5 T ansc ip ion an i e mina ion and e mina ion in E. coli 1.5.1 Phage λ N an i e mina ion An i e mina ion is a c i ical e en o gene ic egula ion o ansc ip ion in bo h euka yo ic and p oka yo ic cells. An i e mina ion in ol es he in e play o p o ein hos ac o s wi h RNA and he RNA polyme ase ansc ip ion complex o allow ansc ip ion h ough ea ly e mina ion si es [G eenbla e al., 1993]. The ansc ip ional egula ion p ocess in bac e iophage λ can be iewed as a pa adigm o an i e mina ion. In phage λ an i e mina ion, he N p o ein gene p oduc om bac e iophage λ plays an essen ial ole in ansc ip ional an i e mina ion in he wo phage ea ly ope ons, which a e c i ical o phage de elopmen . The inhibi ion o e mina ion a in insic and Rho-dependen e mina o s by λ N depends upon he ecogni ion o nu RNA on he nascen phage ansc ip [Das 1992]. The key componen o he an i e mina ion complex is he highly basic 107 amino acid λ N p o ein, which is la gely un olded in solu ion [Mog idge e al., 1998]. λ N consis s o h ee unc ionally dis inc egions wi h di e en in e ac ion pa ne s: aminoacid esidues om 1-22 binds he nu BoxB RNA, 34-47 binds he ca boxy e minal pa o E. coli NusA acidic epea domain 2, 73-107 o ms he RNA polyme ase binding egion [Weisbe g e al., 1999; Whalen e al., 1988; De i o e al., 1994]. Highly e icien , p ocessi e N media ed an i e mina ion equi es E. coli ansc ip ion elonga ion ac o s NusA, NusB, NusG, and NusE (S10), as well as nu BoxA [F iedman e al., 1990; Henkin e al., 2002; Agnieszka e al., 2003]. NusA, a 56 kDa essen ial p o ein, was subsequen ly shown o a ec ansc ip ional pausing, e mina ion, and an i e mina ion. NusB, a 14 kDa p o ein essen ial o cell g ow h only a low empe a u es, may be in ol ed in ansla ion as well as ansc ip ion. The nusE71 mu a ion, which de ined he NusE p oduc , is an allele o psJ, encoding ibosomal p o ein S10. NusG, i s iden i ied h ough a nusG mu a ion ha supp essed he e ec s o he nusA1 and nusE71 mu a ions, is a equi ed ac o o he N an i e mina ion in i o as well as an enhance o e mina ion ac o Rho [F iedman e al., 1995]. The N and Nus p o eins unc ion as a complex modi ying RNA polyme ase o a e mina ion- esis an o m. A e his complex has been o med, i leads o e icien in i o and in i o supp ession o e mina o s loca ed housands o base pai s downs eam o he nu si e [Mog idge e al., 1995]. A model o N-dependen an i e mina ion is shown in Fig 1.4 [G ei e e al., 2005; on Hippel e al., 1996]. 18 INTRODUCTION Figu e 1.9 S e eo ibbon diag am o The mo oga ma i ima NusA. Domains a e indica ed wi h di e en colo s. PDB code – 1HH2. The c ys al s uc u es o wo non-E. coli NusA ac o s ha e been sol ed so a , The mo oga ma i ima [Wo bs e al., 2001] and Mycobac e ium ube culosis [Gopal e al., 2001]). These s uc u es show a common domain o ganiza ion (S1+KH1+KH2) as desc ibed be o e. This NusA co e o ganiza ion is conse ed in mos o he bac e ia. An addi ional ca boxy e minal egion, NusA-CTD, comp ising 160 esidues [(NusA(353–416) and NusA(431–490)] is ound in se e al α-, β-, and γ-p o eobac e ia like en e obac e ium E. coli. Though NusA-CTD is no as highly conse ed as he NusA co e, he la e egion is cha ac e ized by i s acidi y and equen ly by an in e nal sequence epea o 70 esidues. The solu ion s uc u e o NusA-CTD was sol ed wi h high- esolu ion by NMR [Eisenmann e al., 2005]. The wo subdomains o NusA-CTD a e connec ed by a linke egion. Ei he subdomain con ains wo helix-hai pin- helix (HhH) mo i s, each o med by wo an i-pa allel α helices connec ed by a sho hai pin (Fig 1.10). Figu e 1.10 S uc u e o NusA a 1 (PDB code – 1WCL) and NusA a 2 (PDB code – 1WCN). NTD hinge S1 KH1 KH2 NusA (353-416) a 1 NusA(417-430) linke NusA(431-490) a 2NusA (353-416) a 1 NusA(417-430) linke NusA(431-490) a 2 INTRODUCTION 19 Au oinhibi ion e ec o NusA N p o ein alone is su icien o bind and e a d he mobili y o RNA con aining a wild- ype nu si e, whe eas ull-leng h NusA canno shi he RNA on i s own and needs N o i s RNA binding ac i i y (Fig 1.11-A and 1.11-C) [Mog idge e al., 1995]. None o he NusA agmen s excep NusA (1-416) (Fig 1.11-B) can bind he RNA di ec ly in he absence o N. Recen ly, G eenbla and cowo ke s showed ha he ex a CTD o ecoNusA se es as an au oinhibi o o RNA binding [Mah e al., 2000]. A ca boxy- e minal dele ion mu an NusA (1–416), which e ains he S1 and KH homology egions o NusA bu only one o i s wo HhH mo i s, can bind RNA in he absence o N. This sugges s ha one o mo e o he RNA-binding domains o NusA migh be occluded by he second HhH mo i o o he de e minan s wi hin he 79 ca boxy- e minal amino acids o NusA (Fig 1.11). I has been in e ed ha au oinhibi ion o RNA binding in ecoNusA is media ed ia a nega i e pa ch on he CTD [Mog idge e al., 1995; Mah e al., 2000]. Consis en wi h RNA binding o NusA being media ed by he composi e posi i e lank, he CTD could nicely block his a ea o pa he eo h ough i s nega i e su ace. Role o α-CTD subuni o RNA polyme ase The inabili y o ull-leng h NusA o bind RNA esembles he inabili y o he in ac ini ia ion subuni σ70 o RNA polyme ase o bind DNA. In analogy o he way in which in e ac ion o σ70 wi h RNA polyme ase elie es he inhibi o y e ec o he amino e minus o σ70 on p omo e -speci ic DNA binding [Domb oski e al., 1993], i is possible ha he in e ac ion o NusA wi h RNA polyme ase elie es he inhibi o y e ec o he ca boxyl e minus o NusA and allows NusA o bind RNA. Nuclease p o ec ion expe imen s and p o ein-RNA c oss-linking expe imen s [Liu e al., 1995], ha e al eady shown ha NusA in e ac s wi h o is close o RNA nucleo ides ups eam o he 3´end o he nascen ansc ip in a ansc ip ion complex and hese esul s we e consis en wi h he obse a ion [Mah e al., 2000] made by a ini y ch oma og aphy expe imen s, ha he α-CTD subuni o RNA polyme ase s imula es RNA binding by NusA. Based on a ious obse a ions, i has been sugges ed ha du ing elonga ion, NusA uses i s RNA polyme ase-binding egion (1–137) [Mah e al., 1999] o in e ac wi h RNA polyme ase subuni s β and β', and i s ca boxy- e minal egion o in e ac wi h α-CTD subuni . 20 INTRODUCTION The in e ac ion wi h α-CTD subuni may hen cause a con o ma ional change in NusA such ha i s RNA-binding domains ei he old o become exposed and compe en o bind he nascen RNA (Fig 1.11-D). Thus, as pa o he ansc ip ion complex, NusA would be in a posi ion o bind and s abilize pause and e mina ion mo i s in he nascen RNA, leading o enhancemen o pausing and e mina ion a ce ain si es. Hence, he in e ac ion o he α-CTD wi h NusA is essen ial o NusA o s imula e e mina ion only i he inhibi o y ca boxy- e minal egion o NusA is p esen and no i i is dele ed. Figu e 1.11 Model showing he au oinhibi ion e ec o NusA on RNA binding. S1 KH1 KH2 1 -137 348 -416 RNA S1 KH1 KH2 1 -137 348 -416 RNA NusA (1-416) can bind RNA on i s own S1 KH1 KH2 1 -137 348 -416 417 - 495 S1 KH1 KH2 1 -137 348 -416 417 - 495 NusA (1-495) canno bind RNA on i s own (Au oinhibi ion) A B S1 KH1 KH2 1 -137 348 -416 nu si e RNA 417 - 495 N S1 KH1 KH2 1 -137 348 -416 nu si e RNA 417 - 495 N N ac i a es he RNA-binding ac i i y o NusA (1-495) C NTD NTD CTD CTD β β' α NTD NTD CTD CTD β β' α + S1 KH1 KH2 1 -137 348 -416 417 - 495 S1 KH1 KH2 1 -137 348 -416 417 - 495 S1 KH1 KH2 1 -137 348 -416 nu si e RNA 417 - 495 NTD NTD CTD CTD β β' α S1 KH1 KH2 1 -137 348 -416 nu si e RNA 417 - 495 NTD NTD CTD CTD β β' α D NusA+RNAP INTRODUCTION 21 1.7 Thesis objec i es T ansc ip ion is he p ima y egula o y p ocess ha is used by cells, issues and o ganisms o acili a e and con ol he complex p og ammes o gene exp ession, cellula me abolism, and o gan and issue de elopmen . In he mechanisms o ansc ip ion e mina ion and an i e mina ion, pa icipa ion o a ious Nus hos ac o s and hei in e ac ions plays a signi ican ole. Fou N-u iliza ion subs ances, NusA, NusB, NusE, and NusG, a e impo an elonga ion/ e mina ion modula o s. T ansc ip ion egula ion h ough hese Nus ac o s has been in ensi ely s udied in he exp ession o genes om lambdoid phages. In his con ex , a unique mechanism o ansc ip ion elonga ion con ol was ound in Nun p o ein o bac e iophage HK022. One pa o my wo k is ocused on unde s anding he ole o Nun in he e mina ion complex by s udying he in e ac ion o HK022-Nun wi h a ious Nus hos ac o s on a s uc u al le el by NMR. The o he pa o my p ojec was mainly aimed a a be e unde s anding o he egula ion o RNA binding by NusA and he au oinhibi ion e ec o NusA. Thus, his pa o he wo k is a ge ed on ●1H, 13C, and 15N backbone esonance assignmen o RNA binding domains o NusA (SKK domain). ●Analysis o he in e ac ion be ween RNA binding domains o NusA and nu si e RNA by NMR spec oscopy. ●NMR spec oscopy assessmen o RNA binding inhibi ion by au oinhibi ion domain o NusA. 22 MATERIALS AND METHODS 2 Ma e ials and Me hods 2.1 Cul u e media The cul u e media was p epa ed using he ul a pu e wa e (Fil e ing uni Milli-Q Biocel, 0.22 µm, Millipo e, Eschbo n) and hea s e ilized a 121 °C (30 min, 1.2 ba , au ocla e ype 23, Va iokla , Melag, Be lin o Va iokla Damp s e ilisa o , H+P labo echnik, Obe schleißheim). P io o use, s e ile il e ed (0.2 µm il e , Sa o ius, Goe ingen) an ibio ics we e added o he medium as equi ed. 2.1.1 Lu ia Be ani medium [Samb ook e al., 1989] Lu ia Be ani (LB) medium was p epa ed by dissol ing 10 g o pep one, 5 g o yeas ex ac , and 10 g o NaCl in 1000 mL o wa e and se o au ocla e. 2.1.2 Minimal medium (M9) [Samb ook e al., 1989; Meye e al., 1983] Uni o m labeling o p o eins wi h 15N and 13C iso opes we e achie ed by g owing he cells in minimal medium. To p epa e a li e o M9 medium, 200 mL o 5 x M9 medium was dilu ed wi h 800 mL o au ocla ed H2O and supplemen ed wi h 2 mL o TS2 - ace elemen solu ion [Meye e al., 1983], 2 mL o 1 M MgSO4, 1 mL o 10 mM Fe (III)-ci a e, 0.1 mL o 1 M CaCl2, 20 mL o 20 % (w/ ) glucose and 10 mL o 100 x MEM i amin solu ion (Gibco, In i ogen, Ka ls uhe). To p oduce 15N and 13C labeled p o eins, 15N NH4Cl o 15N (NH4)2SO4 and 13C glucose we e used as he sole ni ogen and ca bon sou ce espec i ely. Table 2.1 Componen s in he 5 x M9 and ace elemen s ock solu ion. 5 x M9−Medium: Na2HPO4. 12 H2O 85.5 g KH2PO4 15.0 g NaCl 2.5 g NH4Cl add 1000 mL o H2O 5.0 g MATERIALS AND METHODS 23 TS2: (componen s o be added o 1000 mL o H2O) ZnSO4 . 7 H2O 100 mg MnCl2 . 4 H2O 30 mg H3BO3 300 mg CoCl2 . 6 H2O 200 mg NiCl2 . 6 H2O 20 mg CuCl2 . 2 H2O 10 mg Na2MoO. 2 H2O 900 mg Na2SeO3 20 mg 2.1.3 P–5052 medium [Robe e al., 2005; S udie e al., 2005] All componen s o he medium we e p epa ed using millipo e wa e and we e ei he il e - s e ilized (0.2 µm il e , Sa o ius, Goe ingen) o hea -s e ilized (121 °C, 30 min, 1.2 ba , au ocla e ype 23, Va iokla , Melag, Be lin). P-5052 medium con ains 2 mM magnesium sulpha e, 1 x ace me als solu ion, 1 x 5052 solu ion, 1 x NPS solu ion, 1 x i amin solu ion, and espec i e an ibio ic. S ock solu ions: 5000 x ace elemen s: The ace me al solu ion con ains 50 mM FeCl3, 20 mM CaCl2, 10 mM MnCl2, 10 mM ZnSO4, 2 mM CoCl2, 2 mM CuCl2, 2 mM NiSO4, 2 mM Na2MoO4, 2 mM Na2SeO3 and 2 mM H3BO3. The solu ion was w apped in an aluminum oil and s o ed a oom empe a u e. 50 x NPS solu ion: 1.25 M Na2HPO4, 1.25 M KH2PO4 and 0.25 M Na2SO4. This p epa a ion was p epa ed esh, hea -s e ilized and used wi hin a week. [(An unlabeled 50 x NPS solu ion can be p epa ed by subs i u ion o ammonium chlo ide as he ni ogen sou ce (2.5 M NH4Cl)]. Fo labeling, he media con ains 5 g o 15N NH4Cl (Camb idge Iso ope Labo a o ies, Ando e , USA) pe li e . 50 x 5052 solu ion: 25 % glyce ol ( / ), 2.5 % glucose (w/ ) and 10 % lac ose (w/ ). This p epa a ion was p epa ed esh and hea -s e ilized. 24 MATERIALS AND METHODS 2.2 Es ima ion o p o ein concen a ion A measu e o p o ein and nucleic acid concen a ion was ob ained upon moni o ing he abso bance a 280 nm and 260 nm espec i ely. Abso p ion was measu ed ei he in a black wall qua z cu e e (Hellma, Müllheim) wi h a hickness o 1 cm, using a Helios γ spec opho ome e (The mo spec onic, Camb idge, UK) o else in he Nanod op ND-1000 ins umen (Peqlab Bio echnology GmbH, Ge many). A e measu ing, he p o ein concen a ion was hen de e mined by applying Bee -Lambe ’s law [Ingle e al., 1988] as ollows which is ela ed o he amoun o ligh abso bed by he sample. A (λ) = ε. c. b [2.1] Whe e A (λ) = measu ed abso bance a 280 nm ε = mola ex inc ion coe icien (M-1 cm-1) c = concen a ion o he subs ance ha abso bs ligh (M) b = pa h leng h o he sample cell (cm) Mola ex inc ion coe icien s [Gill e al., 1989] o p o eins and nucleic acids we e ob ained om amino acid analysis using P o Pa am Tool (ExPASy, Expe P o ein Analysis Sys em p o eomics se e , Swiss ins i u e o Bioin o ma ics, www.expasy.che, Swi ze land). 2.3 SDS – polyac ylamide gel elec opho esis [Laemmli 1970] The analy ical elec opho esis o p o eins was ca ied ou in polyac ylamide gels unde he condi ions ha ensu e dissocia ion o he p o eins in o hei indi idual polypep ide subuni s. The eby he molecula mass o he p o ein was de e mined by ele opho esing i oge he wi h “ma ke ” p o ein o known molecula masses ha b acke ha o he p o ein o in e es [Voe e al., 2nd edi ion]. In his echnique, he p o eins we e sepa a ed on a po ous suppo ing ma e ial p epa ed by c oss linking ac ylamide by N-N me hylene bis-ac ylamide. Ini ially he p o eins we e dena u ed by hea ing hem a 95 °C o 10 min in a bu e con aining sodium dodecyl sulpha e [(SDS)-an ionic de e gen ] and β-me cap oe hanol ( educing eagen ). The gels (10 x 8 x 0.75 cm) we e elec opho esed in Migh y small SE250/260 gel elec opho esis chambe s (Hoe e , San F ancisco, CA, USA) a a cons an ol age o 30 mA. MATERIALS AND METHODS 25 The SDS gel has wo dis inc zones, a s acking gel o e laying a sepa a ion gel, bo h o T is bu e ed sys em. The wo zones a e cha ac e ized by hei po osi y and pH condi ions. The composi ions o he p epa a ion o wo gels a e men ioned in Table 2.2. Table 2.2 Ing edien s o 19 % Sodium dodecyl sulpha e polyac ylamide gel (SDS-PAGE). 19 % SDS gel Sepa a ion gel S acking gel Na2SO3 50 mg - H2O 2.13 mL 8.70 mL 0.5 M T is/HCl; pH 6.8 - 5.0 mL 3 M T is/HCl; pH 8.8 3.75 mL - 30 % (w/ ) Ac ylamide o ipho ese® Gel A (Ro h, Ka ls uhe) 18.50 mL 2.6 mL 2 % (w/ ) Bisac ylamide o ipho ese® Gel B (Ro h, Ka ls uhe) 7.70 mL 1.08 mL 10 % SDS 0.3 mL 0.2 mL TEMED 20 µL 20 µL 10 % (w/ ) APS 200 µL 200 µL The sepa a ed p o eins we e isualized by Coomassie B illian Blue s aining [Wilson 1983] and des aining wi h concen a ed me hanol : ace ic acid solu ion. The gel a e des aining was pho og aphed using a Gel documen sys em (GEL DOC 2000, Bio ad, Munich). 2.4 Schagge and Jagow gel elec opho esis [Schagge e al., 1987] The mos gene ally used echnique o isualize he polypep ides wi h masses below abou 15 kDa is he one de eloped by Schagge and on Jagow. This echnique employs a discon inuous gel sys em con aining SDS. Howe e , he in e e ence o SDS wi h he s acking and sepa a ion o small polypep ides is diminished by changing he ailing ion (in he ca hode bu e ) om glycine o he mo e mobile T icine (N- is[hyd oxyme hyl]-me hylglycine) [Wisdom 1997] and by lowe ing he pH o he sepa a ing gel. The sepa a ion gel consis s o 16.5 % T and 6 % C in 1 M T is/HCl, pH 8.45, 0.1 % (w/ ) SDS and 6 M u ea. The s acking gel comp ises 4 % T and 6 % C in 0.775 M T is/HCl, pH 8.45 and 0.1 % (w/ ) SDS. The polyme iza ion was ini ia ed by addi ion o 10 µL o TEMED and 100 µL o 10 % (w/ ) APS o 20 mL gel solu ion. 26 MATERIALS AND METHODS The uppe pa o he elec opho esis ins umen was illed wi h ca hode bu e (0.1 M T is/HCl, pH 8.25, 0.1 M T icine, 0.1 % (w/ ) SDS and he base is illed wi h anode bu e (0.2 M T is/HCl, pH 8.9). A cons an ol age o 28 mA was applied un il he samples eached he end o he s acking gel and hen he ol age is inc eased o 40 mA. Fo he es ima ion o he molecula weigh in gels, Fluka molecula weigh s anda d (Fluka, New-Ulm) o Pep ide ma ke ki (GE Heal hca e li e sciences, Ge many) was used. S aining and des aining o he gels we e ca ied ou in he same manne as ha o SDS-PAGE. 2.5 HK022 Nun p o ein 2.5.1 Exp ession o Nun Nun ull leng h cons uc (1-112) was exp essed in he E. coli BL21(DE3). P e-inoculum was de eloped by inocula ing he glyce ol s ock wi h 200 mL o LB medium con aining ampicillin an ibio ic (1 μg/mL) and incuba ing o e nigh a 37 °C. Exp ession o p o ein was ca ied ou by inocula ing 1.2 li e o LB medium con aining ampicillin an ibio ic wi h o e nigh cul u e so as o ha e an ini ial concen a ion o cells co esponding o OD600 (Op ical densi y a 600) o abou 0.1. The cul u e was hen incuba ed wi h shaking (170 pm) (C25KC Incuba o shake , New B unswick Scien i ic, Edison, NJ, USA) a 37 °C, un il he cul u e has eached he mid-log phase o he g ow h (OD600 ~0.8). The exp ession was hen induced by addi ion o 1 mM isop opyl-β-D- hiogalac opy anoside (IPTG) (GERBU, Gaibe g). The cells we e allowed o g ow ill he s a iona y phase (~4 h) and we e hen ha es ed by cen i uging (Cen ikon T-124, Ro o A 6.9, Kon on, Eching) a 6000 pm (5000 g), 4 °C o 30 min. The cell pelle s we e washed wi h 50 mM T is-HCl, pH 8.0 and we e ha es ed again by cen i uga ion. The cells ob ained a e hen s o ed a –80 °C un il u he use. 2.5.2 Cell lysis and pu i ica ion o HK022 Nun P epa a ion o cell ex ac F ozen cell pelle s we e esuspended in lysis bu e (50 mM T is-HCl, pH 8.0, 2 mM e hylenediamine e aace ic acid (EDTA), 1 mM phenylme hylsul onyl lou ide (PMSF), 5 mM Di hio h ei ol (DTT), 0.2 mg/mL deoxy ibonuclease I (DNase I), one p o ease inhibi o able - EDTA ee (Roche, Mannheim). The cells we e eeze and hawed h ee imes. A e eeze MATERIALS AND METHODS 27 and haw, he suspension was s i ed on ice o 30 min. The cell suspension was soni ied o 2 imes o each 1 minu e wi h ul asound (Du y cycle 0.5, 200 Wa , Soni ie Labsonic U, B. B aun Bio ech In e na ional, Melsungen) wi h 10 min pause in be ween each s ep. Cellula deb is was clea ed om he cell lysa e by cen i uging (Bio uge S a us, Ro o 3334, He aeus) a 4 °C, 13000 pm (19000 g) o 30 min. The clea ed lysa e was il e ed (Minisa S e il il e , 0.45 μm, Sa o ius, Goe ingen) and used o he pu i ica ion. Pu i ica ion All he bu e s used we e il e ed and degassed be o e pu i ica ion. Binding bu e : 50 mM T is-HCl, pH 8.0, 2 mM EDTA Elu ion bu e : 50 mM T is-HCl, pH 8.0, 2 mM EDTA, 2 M NaCl HK022-Nun was pu i ied by employing ca ion exchange ch oma og aphy. The ÄKTA pu i ie 10-sys em (Ame sham Biosciences, F eibu g) was used o pu i y he p o ein wi h a HiT apTM Hepa in column (5mL ~ 1 CV) (Ame sham Bio ech). The column was equilib a ed wi h 10 CV o Binding bu e . The combined supe na an a e cen i uga ion we e applied on he hepa in column a a low a e o 1mL/min. Flow h ough was collec ed in each s ep. The column was washed wi h bu e A o 5 CV o mo e o emo e unbound p o eins. The bound p o ein was hen elu ed by bu e B wi h a s ep g adien o 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, and 100 % espec i ely. F ac ions collec ed du ing he elu ion we e analyzed by SDS- PAGE (2.3). High-pe o mance liquid ch oma og aphy (HPLC) [Ho a h e al., 1967] F ac ions con aining Nun which we e iden i ied on a 19 % SDS-polyac ylamide gel we e pooled and subjec ed o HPLC (Kon on, Eiching) o u he pu i ica ion. Bu e A: 0.1 % TFA in millipo e wa e Bu e B: 0.1 % TFA, 80 % ace oni ile in millipo e wa e Pu i ica ion was ca ied ou by using a HPLC C-18 column (P epLCTM 25 mm Module, Wa e s, Mil o d, Massachuse s, USA) by applying a slow linea g adien . F ac ions con aining Nun we e kep in he speed ac (ABM G ei enbe ge , Ma k edwi z) o d y. The d ied samples we e s o ed in he cold oom ill u he use. 34 MATERIALS AND METHODS 2.8 NusA acidic epea 1 (NusA a 1) 2.8.1 Exp ession o NusA a 1 NusA a 1 (cloned by D . S e an P asch, Depa men o Biopolyme s, Uni e si y o Bay eu h) was exp essed in E. coli BL21(DE3). The exp ession o 15N labeled NusA a 1 was ca ied ou as spa -p epa a ion [Ma ley e al., 2001]. The cells we e g own in 2 x 2 L LBamp medium un il OD600 eached 0.8. Cells we e hen cen i uged a 16 °C, 6000 pm (5000 g) o 15 min (Cen ikon T-124, Ro o A 6.9, Kon on, Eching) and he cell pelle was washed wi h 500 mL o wash bu e (6.4 g Na2HPO4, 1.5 g KH2PO4 and 0.25 g NaCl). A e washing, i was subjec ed o cen i uga ion a 16 °C, 6000 pm (5000 g) o 15 min and he cell pelle s we e esuspended in 1 L o 1 x M9 minimal medium con aining 15NH4Cl and all he addi i es. La e he cells we e incuba ed a 37 °C o 1 h wi h shaking a 170 pm. A e 1 h, he cells we e induced by 1 mM IPTG. A e 4 h o induc ion he cells we e ha es ed by cen i uging a 6000 pm, 4 °C o 15 min. Cell pelle s we e esuspended in binding bu e (20 mM sodium phospha e, pH 7.4, 500 mM NaCl and 1 mM DTT) and s o ed a -80 °C un il u he use. 2.8.2 Cell lysis and pu i ica ion o NusA a 1 P epa a ion o cell ex ac The cell pelle s we e eeze / hawed h ee imes. A e eeze and haw, added 0.2 µg/mL DNase I and 0.2 µg/mL lysozyme and s i ed on ice o 45 min. The cell suspension was soni ied (Soni ie Labsonic U, B. B aun Bio ech In e na ional, Melsungen) 2 x 1 minu e wi h 0.9 pulse and 90 % ampli ude and 1 x 10 min wi h 0.5 pulse and 60 % ampli ude wi h 1 min pause on ice and s i ing in be ween each s ep. The cell lysa e was hen cen i uged a 4 °C, 13000 pm (19,000 g) o 30 min o clea he cellula deb is. A e cen i uga ion he clea ed lysa e was il e ed by using a sy inge il e o po e size 0.45 µM. Pu i ica ion Binding bu e o His ap : 20 mM sodium phospha e, pH 8.0, 500 mM NaCl, 1 mM DTT Elu ion bu e o His ap : 20 mM sodium phospha e, pH 8.0, 500 mM NaCl, 1 mM DTT, 1 M imidazole MATERIALS AND METHODS 35 The ecombinan p o ein was pu i ied by nickel a ini y ch oma og aphy (5 mL His ap chela ing column, Ame sham Biosciences, F eibu g). The supe na an was loaded on o a Ni- ion a ini y column wi h a low a e o 1 mL/min and elu ed by applying a imidazole s ep g adien . The elu ed ac ions we e analyzed by Schagge -Jagow gel. Peak ac ions con aining NusA a 1 we e pooled and dialyzed (Spec a/Po dialysis ubing (MWCO-3500), 6.4mL/cm, Ro h, Ka ls uhe) agains 50 mM T is/HCl, pH 8.0, 150 mM NaCl and 1 mM DTT o e nigh . A e dialysis, N- e minal deca-His idine ag was clea ed o using P eScission p o ease (1 uni o 100 µg) by incuba ing he enzyme wi h he dialyzed ac ions o e nigh wi h gen le shaking. The clea ed sample was hen dialyzed agains 50 mM T is/HCl, pH 7.4, 1 mM DTT o e nigh . Fu he pu i ica ion was ca ied ou by loading he sample on o a 5 mL HiT apTM QXL column (Ame sham Biosciences, F eibu g). Binding bu e o QXL : 50 mM T is/HCl, pH 7.4, 1 mM DTT Elu ion bu e o QXL : 50 mM T is/HCl, pH 7.4, 1 mM DTT, 1 M NaCl The sample was elu ed om he QXL column by a NaCl s ep g adien and he elu ed ac ions we e pooled and concen a ed using Vi aspin concen a o s o MWCO–5000 (Vi ascience AG, Hanno e , Ge many). Concen a ion was ca ied ou by cen i uging he concen a o s a 4 °C, 5000 pm (Uni e sal 320R, Ro o 1494, He ich). 2.9 NusA acidic epea 2 (NusA a 2) 2.9.1 Exp ession o NusA a 2 The ecombinan NusA a 2 cons uc was cloned in pET 19b (by D . S e an P asch, Depa men o Biopolyme s, Uni e si y o Bay eu h) and exp essed in E. coli BL21 (DE3). P e-day cul u e was g own in 50 mL LB wi h 0.1 mg/mL ampicillin o 8 h a 37 °C, 180 pm (Incuba o shake Ce oma HK/R, B. B aun Bio ech In e na ional, Melsungen) and hen ans e ed in o 500 mL o LB and g own o e nigh a 37 °C. 5 L o LBamp was inocula ed wi h he o e nigh cul u e o a s a OD600 o ~ 0.2, and g own a 37 °C un il he OD600 eached 0.8. The gene exp ession was induced o 4 h wi h 1 mM IPTG. 4 h a e induc ion, cells we e ha es ed by cen i uga ion a 4 °C, 6000 pm (5000 g) o 10 min (Cen ikon T-124, Ro o A 6.9, Kon on, Eching) and pelle was esuspended in binding bu e and s o ed a -80 °C o u he use. Gene exp ession was moni o ed by Schagge -Jagow gel analysis. 36 MATERIALS AND METHODS 2.9.2 Cell lysis and pu i ica ion o NusA a 2 Cell lysis and pu i ica ion Cells we e esuspended in (4 mL/g) 20 mM sodium phospha e bu e , pH 7.4, 500 mM NaCl, 1 mM DTT. A e h ee eeze– haw cycles, lysozyme, DNase I and one p o ease inhibi o cock ail able we e added and he suspension was s i ed on ice o 30 min. The cell suspension was soni ied (Soni ie Labsonic U, B.B aun Bio ech In e na ional, Melsungen) o 3 x 1 min, pulse 0.9, 100 % ampli ude. A e sonica ion he cell ex ac was cen i uged (Bio uge S a us, Ro o 3334, He aeus) o 45 min a 4 °C, 13,000 pm (19,000 g) o sepa a e he cell deb is. The supe na an was il e ed using Minisa S e il il e , 0.45 μm. Pu i ica ion o he usion p o ein was pe o med by a s ep g adien using nickel ion a ini y (10 mL His ap column, Ame sham Biosciences, F eibu g, Ge many) ch oma og aphy by a ÄKTA pu i ie sys em. Binding bu e : 20 mM sodium phospha e, pH 7.4, 500 mM NaCl, 1 mM DTT Elu ion bu e : 20 mM sodium phospha e, pH 7.4, 500 mM imidazole, 1 mM DTT The il e ed supe na an was loaded on o he column wi h a low a e o 1 mL/min. A e loading he sample, he column was washed wi h 5 CV o binding bu e and elu ed wi h a imidazole s ep g adien . F ac ions con aining NusA a 2 we e pooled, dialyzed agains 50 mM T is/HCl, pH 8.0, 500 mM NaCl, 1 mM DTT and clea ed wi h P eScission p o ease (1 uni o 100 µg p o ein) o e nigh a 4 °C. To u he pu i y he p o ein and o emo e he NaCl, he clea ed sample was dialyzed agains 50 mM T is/HCl, pH 7.4, 1 mM DTT o e nigh in he cold oom. The dialyzed sample was loaded on o a 5 mL Q XL column connec ed in andem o a 5 mL GST column. A e loading, he column was washed wi h 5 CV o binding bu e and elu ed by a NaCl g adien . Binding bu e : 50 mM T is/HCl, pH 7.4, 1mM DTT Elu ion bu e : 50 mM T is/HCl, pH 7.4, 1mM DTT, 1 M NaCl F ac ions elu ed we e analyzed by Schagge -Jagow gel. The pu e ac ions we e hen dialyzed agains NMR bu e (50 mM sodium phospha e bu e , pH 7.6, 100 mM NaCl, 10 mM β- me cap oe hanol, 1 % glyce ol ( / ), 0.5 mM EDTA) o e nigh and concen a ed in Vi aspin concen a o s wi h a MWCO-5000 (Vi ascience, S onehouse, UK). MATERIALS AND METHODS 37 2.10 S1+KH1+KH2 domain o NusA (SKK) 2.10.1 Exp ession o SKK The NusA RNA binding domains con aining amino acid 132–348 e e ed as SKK was cloned ia BamHI and NdeI es ic ion si es in o he E. coli exp ession ec o pET11a (D . S e an P asch, Depa men o Biopolyme s, Uni e si y o Bay eu h). The N- e minal His6 agged SKK domain was exp essed and pu i ied acco ding o he published p o ocols [Mah e al., 1999; Mah e al., 2000] wi h mino changes. To s udy he in e ac ion o NusA wi h nu RNA, cons uc (SKK) lacking he N- e minal domain and he wo acidic epea domains was used, since hese egions a e no di ec ly in ol ed in RNA binding [Mah e al., 2000]. Fo he exp ession o unlabeled SKK, plasmid pET 11a-SKK domain was ans o med in o E. coli BL21(DE3) hos cells. The p e-inoculum was se by g owing he s ain ha bo ing he ecombinan plasmid in 100 mL LB medium a 37 °C con aining ampicillin an ibio ic. The p e-cul u e was used o inocula e 2 L o LB medium o an OD600 o 0.2. Cells we e hen incuba ed a 37 °C, 170 pm (C25KC Incuba o shake , New B unswick Scien i ic, Edison, NJ, USA). A an OD600 o 0.6, exp ession was induced by addi ion o 0.1 mM IPTG ollowed by incuba ion a 37 °C o 4 h. To moni o he exp ession, aliquo s con aining equal amoun s o cells we e aken om he cul u e e e y hou and applied o a Schagge -Jagow gel. Cells we e ha es ed 4 h a e induc ion by cen i uga ion (Cen ikon T-124, Ro o A 6.9, Kon on, Eching) a 6000 pm (5000 g) o 15 min a 4 °C and he cell pelle was s o ed a −80 °C. Inc easing molecula size o he p o ein leads o c owded spec a, inc ease in numbe o esonances, as e elaxa ion, b oad lines, low in ensi y, o e lapping signals, and long expe imen ime. So in o de o imp o e he esolu ion and sensi i i y o he NMR spec a in iple esonance expe imen s and in he binding s udies, deu e a ed SKK was p epa ed. Deu e a ed 15N-labeled samples we e exp essed in cells g own on M9 minimal media con aining 1.5 g/L 15N (NH4)2SO4 and 2 g/L glucose. While p epa ing 13C,15N labeled samples he unlabeled glucose was eplaced by 2 g/L o 13C glucose. In o de , o op imize he exp ession o SKK domain, cell cul u es we e adap ed o g ow in D2O by inc easing he amoun o D2O in he M9 minimal medium om 0 o 100 % wi h each g ow h cycle. To p oduce deu e a ed SKK, i e p e-cul u es wi h inc easing D2O con en we e g own p io o inocula ion o he main cul u e. A i s , an o e nigh p e-cul u e was se a 37 °C in LB 38 MATERIALS AND METHODS con aining ampicillin an ibio ic (100 µg/mL). Fu he cul u es we e g own a 37 °C in M9 minimal medium wi h inc easing D2O concen a ion o 25 %, 50 %, 75 %, and 100 % espec i ely. All o he cul u es we e main ained a subsa u a ing cell densi ies, wi h A600 ypically below 0.6. Each p e-cul u e was inocula ed o an OD600 o 0.2 wi h he espec i e amoun o he p eceding p e-cul u e. The inal cell cul u e con aining ~ 100 % D2O was induced wi h 0.1 mM IPTG when he cul u e densi y eached A600 = 0.6 and g own o u he 4 h be o e ha es ing. Cells we e pelle ed a 6000 pm (5000 g) (Cen ikon T-124, Ro o A 6.9, Kon on, Eching) o 10 min and s o ed a -80 °C o e nigh . 2.10.2 Cell lysis and pu i ica ion o SKK domain Cell lysis and pu i ica ion F ozen cell pelle s we e hawed and esuspended in cell lysis bu e (20 mM T is/HCl, pH 7.9, 500 mM NaCl, 10 % glyce ol ( / ), 5 mM β-me cap oe hanol; 10 mL/g pelle ). The cell suspension was shock eezed h ee imes. Lysozyme, DNase I (0.1 mg/mL) and one p o ease inhibi o cock ail able (Comple e, EDTA ee, Roche) we e added o he suspension. Now he cell suspension was s i ed on ice o 30 min and ollowed by sonica ion (Soni ie Labsonic U, B. B aun Bio ech In e na ional, Melsungen) on ice. The cells we e sonica ed 4 x 1 minu e wi h 1.0 pulse and 100 % ampli ude wi h 1 minu e pause on ice and s i ing in be ween each s ep. The lysa e was hen cen i uged (Bio uge S a us, Ro o 3334, He aeus) a 13,000 pm (19,000 g) o 45 min a 4 °C. The supe na an was il e ed by using a sy inge il e o po e size 0.45 µM. Pu i ica ion o he soluble his- agged p o ein was pe o med by nickel ion a ini y ch oma og aphy on an ÄKTA pu i ie 10-FPLC sys em. The supe na an was loaded on a 5 ml His ap column (Ame sham Biosciences, F eibu g, Ge many) a 1 mL/min which was p e-equilib a ed wi h cell lysis bu e . Binding bu e :10 mM HEPES, pH 7.6, 100 mM NaCl, 10 % glyce ol ( / ), 5 mM β- me cap oe hanol Elu ion bu e : 10 mM HEPES, pH 7.9, 100 mM NaCl, 10 % glyce ol ( / ), 5 mM β- me cap oe hanol, 300 mM imidazole MATERIALS AND METHODS 39 The column was i s washed wi h 10 CV o cell lysis bu e ollowed by 10 CV o binding bu e . A e he washing s ep, he bound p o ein was elu ed by applying a imidazole s ep g adien consis ing o 5, 10, 20, 50, 80, and 100 % elu ion bu e . The ac ions con aining p o ein we e dialyzed (Spec a/Po , MWCO 3500, ROTH, Ka ls uhe, Ge many) agains 5 L o 50 mM sodium phospha e bu e , pH 7.6, 100 mM NaCl, 10 mM β-me cap oe hanol, 0.5 mM EDTA, and 1 % glyce ol ( / ). The sample was dialyzed 3 imes agains 5 L o he abo e men ioned bu e . The i s wo dialysis s ep was done o 5–6 hou s and he inal dialysis s ep was done o e nigh . All he dialysis s eps we e ca ied ou a 4 °C. A e he dialysis, he p o ein sample was concen a ed using i aspin concen a o s o MWCO–5000 Da (Vi ascience AG, Hanno e , Ge many). The concen a ion was ca ied ou by cen i uging he concen a o s a 4 °C, 5000 pm (Uni e sal 320R, Ro o 1494, He ich) ill a concen a ion o 400 – 500 µM was eached. The concen a ed sample was s o ed a -80 °C ill u he use. 2.11 NusG 2.11.1 Exp ession o NusG BL21 (DE3) cells we e ans o med wi h pET 11a/NusG in LB medium con aining ampicillin an ibio ic and g own wi h shaking a 170 pm (Incuba o shake Ce oma HK/R, B. B aun Bio ech In e na ional, Melsungen) o e nigh . Exp ession was ca ied ou by inocula ing 1.2 L o LB medium con aining ampicillin an ibio ic wi h he o e nigh cul u e so as o ha e an ini ial concen a ion o cells co esponding o OD600 o abou 0.1. The cul u e was hen incuba ed wi h shaking (170 pm) a 37 °C (C25KC Incuba o shake , New B unswick Scien i ic, Edison, NJ, USA), un il he cul u e has eached he mid-log phase o he g ow h (OD600 ~0.7). A his poin he exp ession was induced by he addi ion o 1 mM IPTG. The cells we e hen allowed o g ow ill he s a iona y phase (~4 h) and we e hen ha es ed by cen i uging a 6000 pm, 4 °C o 30 min (Cen ikon T-124, Ro o A 6.9, Kon on, Eching). The cell pelle s we e s o ed a –80 °C un il u he use. Exp ession analysis was ca ied ou by 19 % SDS page. 40 MATERIALS AND METHODS 2.11.2 Cell lysis and pu i ica ion o NusG P epa a ion o cell ex ac and pu i ica ion [Pasman e al., 2000] The cell pelle s we e esuspended a 10 mL/g o lysis bu e (20 mM T is-HCl, pH 7.8, 3 mM EDTA, 1 mM DTT, 100 mM NaCl, 1mM PMSF, lysozyme, DNase I, p o ease inhibi o cock ail able (Comple e, EDTA- ee, Roche Diagnos ics GmbH, Mannheim). A e esuspending he cells we e incuba ed o 10 min a 22 °C (The momixe 5436, Eppendo ), and hen 20 min on ice. Sodium deoxychola e was added o a inal concen a ion o 0.06 % (w/ ), and he esul ing solu ion was incuba ed o 20 min on ice. A e incuba ion, NaCl was added o a inal concen a ion o 0.3 M om a s ock solu ion o 4 M and s i ed o 10 min on ice. The lysa e was sonica ed 4 imes o 30 s a oom empe a u e by applying 0.7 pulse and 70 % ampli ude wi h 3 min on ice be ween each sonica ion ea men s. Polymin P was added d op wise ( om a s ock solu ion o 10 % a pH 7.8) wi h s i ing o a inal concen a ion o 0.6 %, a e which he lysa e was incuba ed o 30 min on ice and he lysa e was sonica ed once again as p e iously men ioned. A e sonica ion he sample was cen i uged a 13,000 pm (19,000 g) o 30 min (Bio uge S a us, Ro o 3334, He aeus). Sa u a ed ammonium sulpha e solu ion a pH 8.0 was p epa ed (515,3g/L a 4 °C). Ammonium sul a e a 50 % o sa u a ion was added o he supe na an d op wise, wi h s i ing. A e his, he sample was incuba ed o 30 min on ice. The lysa e was cen i uged o 30 min a 13,000 pm (Bio uge S a us, Ro o 3334, He aeus) a 4 °C and he pelle was esuspended in 30 mL ( o 1 L cul u e olume) o bu e Q (10 mM T is-HCl, pH 7.8, 1 mM EDTA, 1 mM DTT, 5 % glyce ol ( / )). The lysa e was hen dialyzed agains 4 x 1 L o bu e Q o a o al o 16 h and a e dialysis he solu ion was spunned a 13,000 pm (Bio uge S a us, Ro o 3334, He aeus) o 30 min and he supe na an was il e ed using a sy inge il e o po e size 0.45 µM and applied on o HiT apTM QXL column (Ame sham Biosciences, F eibu g) a a low a e o 0.5 mL/min. Binding bu e : 10 mM T is-HCl, pH 7.8, 1 mM EDTA, 1 mM DTT, 5 % glyce ol ( / ) Elu ion bu e : 10 mM T is-HCl, pH 7.8, 1 mM EDTA, 1 mM DTT, 5 % glyce ol ( / ), 200 mM NaCl Washed he column wi h 10 CV o binding bu e and hen elu ed wi h a linea o 0-200 mM NaCl g adien . Pu e ac ions we e pooled and concen a ed wi h Vi aspin concen a o s. MATERIALS AND METHODS 41 2.12 NusB 2.12.1 Exp ession o NusB To p oduce NusB, au o-induc ion o ecombinan p o ein exp ession, a me hod in oduced by S udie [S udie 2004; G abski e al., 2003] was ca ied ou . Exp ession plasmids we e ans o med in o E. coli BL21 DE3, by elec opo a ion (Mic oTM Pulse , BioRad, Munich). The ans o med cells we e hen pla ed on a LB aga pla e wi h kanamycin an ibio ic and g own o e nigh a 37 °C. In he mo ning, a single colony was picked om he ans o ma ion pla e and ans e ed in o a cul u e ube con aining 20 mL o P-5052 medium (2.1.3). The cul u e was g own a 37 °C wi h shaking a 170 pm o e nigh (Incuba o shake Ce oma HK/R, B. B aun Bio ech In e na ional, Melsungen). On he nex day, 10 mL o he o e nigh cul u e was used o inocula e 1 L o 1 x P-5052 medium. Cells we e g own a 37 °C ill i eaches an OD600 o 0.5 and hen ans e ed o 20 °C and allowed o g ow o e nigh . F om he o e nigh cul u e he cells we e ha es ed by cen i uga ion a 6000 pm o 15 min and he cell pelle s we e esuspended in he lysis bu e (20 mM o 50 mM T is/HCl, pH 7.5, 150 mM NaCl) and s o ed a -80 °C. 2.12.2 Cell lysis and pu i ica ion o NusB P epa a ion o cell ex ac F ozen cell pelle s we e eeze/ hawed h ee imes. A e adding one p o ease inhibi o able , 0.2 mg/mL DNase I and 0.2 mg/mL lysozyme, he cell lysa e was s i ed on ice o 45 min. The sample subjec ed o sonica ion (0.5 pulse and 100 % ampli ude) o 5 x 1 minu e. The c ude cell lysa e was cen i uged a 4 °C wi h 13,000 pm o 30 min. A e sonica ion, o he supe na an added 20 mM imidazole as an end concen a ion and il e ed he sample ia sy inge il e s o po e size 0.45 µM. Pu i ica ion Binding bu e (A1) : 50 mM T is/HCl, pH 7.5, 150 mM NaCl and 20 mM imidazole Binding bu e (A2) : 50 mM T is/HCl, pH 7.5, 150 mM NaCl and 50 mM imidazole Elu ion bu e (B) : 50 mM T is/HCl, pH 7.5, 150 mM NaCl and 500 mM imidazole 42 MATERIALS AND METHODS His ap chela ing column, was equilib a ed wi h 10 CV o bu e A1. The clea ed lysa e was loaded on o he column wi h a e y slow low a e o 0.2 mL/min. The column was washed wi h bu e A2 o abou 10 CV and elu ed wi h a s ep g adien by using he bu e B. The peak ac ions con aining NusB we e pooled and dialyzed agains 50 mM T is/HCl, pH 7.5, 10 mM NaCl, 2 mM DTT, and TEV p o ease o clea e he N- e minal his idine ag. The clea ed sample was u he loaded on o he his ap column and he low h ough was collec ed. The low h ough was pooled and dialyzed agains 50 mM T is/HCl, pH 7.5. The dialyzed sample was loaded on o he QXL column o u he pu i ica ion. Binding bu e o QXL : 50 mM T is/HCl, pH 7.5 Elu ion bu e o QXL : 50 mM T is/HCl, pH 7.5, 1 M NaCl The loaded p o ein was hen elu ed wi h a s ep g adien anging om 0 o 1 M NaCl. The co esponding ac ions con aining pu e p o ein we e pooled, dialyzed agains wa e and subjec ed o lyophiliza ion. 2.13 RNA oligonucleo ide In i o ansc ip ion and RNA p epa a ion All RNAs we e p epa ed by in i o ansc ip ion om syn he ic DNA empla es (IBA GmbH, Gö ingen, Ge many) using a single polypep ide chain enzyme-T7 polyme ase. The sequence o he nu L DNA empla e was (GCC CTT CTT CAG GGC TTA ATT TTT AAG AGC GCT ATA GTG AGT CGT ATT A) and he nu R was (GCC CTT TTT CAG GGC TGG AAT GTG TAA GAG CGC TAT AGT GAG TCG TAT TA) espec i ely. The ansc ip ion cock ail con ains 100 µM DNA empla e, 20 mM o each NTP's, 0.5 M o MgCl2, 40 % PEG 8000, 200 µM T7 p omo e , 0.1 mg/mL o T7 RNA polyme ase enzyme and 10 x ansc ip ion bu e which con ains (40 mM T is-HCl pH 8.1, 50 mM DTT, 10 mM spe midine, 0.1 % ( / ) T i on X-100) was se o a o al olume o 5 ml and incuba ed o 4 h a 37 °C (Incuba o Model 200, Memme , Schwabach). The eac ion was quenched by adding 0.2 M EDTA, pH 8.0. The eac ion mix u e was p ecipi a ed by adding 3 M sodium ace a e, pH 5.3 and 100 % chilled e hanol and incuba ed o e nigh a -80 °C. La e , he sample was cen i uged o 30 min a 5000 pm. The pelle was subjec ed o speed ac (ABM G ei enbe ge An iebs echnik, Ma k edwi z) o d ying. MATERIALS AND METHODS 43 The d ied sample was dissol ed by hea ing wi h 8 M u ea a 95 °C (Block he mos a BT100, Klein eld labo echnique, Geh den) o 5 min. The RNA was pu i ied on dena u ing 20 % polyac ylamide gels con aining 8 M u ea by an o e nigh un. 600–1000V cons an by a Mul id i e XL (Ame sham Biosciences, F eibu g) was used o unning he RNA gel. P oduc bands we e cu om he gel using UV shadowing. The RNA was elec oelu ed using a Schleiche and Schuell elec oelu ion appa a us and subsequen e hanol p ecipi a ion. To emo e mul i alen ions and o he low molecula weigh impu i ies he RNA sample was i s dialyzed agains 10 mM po assium phospha e, pH 6.4, 100 mM NaCl, 5 mM EDTA and hen inally dialyzed agains wa e . RNA was quan i ied by UV abso p ion a 260 nm wa eleng h. The ex inc ion-coe icien o he RNAs we e ob ained om h p://www.ambion.com/ echlib/misc/oligo_calcula o .h ml. The RNA sample was lyophilized and s o ed a -20 °C ill u he use. App oxima ely i e eac ions on a 5 mL scale yielded a ound 6–7 mg o pu i ied RNA. 2.14 NMR spec oscopy 2.14.1 NMR sample p epa a ion NMR samples we e p epa ed by dialyzing he pu i ied p o ein agains he espec i e NMR bu e . A e dialysis, he samples we e ei he concen a ed wi h Vi aspin concen a o s (Vi ascience AG, Hanno e , Ge many). Fo he in e ac ion s udy o Nun wi h a ious Nus ac o s (NusA a 1, NusB, NusG) ei he bu e con aining 10 mM KPO4, pH 6.4, 50 mM NaCl o bu e wi h 50 mM NaPO4, pH 7.0, 50 mM NaCl was used. NMR samples o SKK domain we e p epa ed in 50 mM sodium phospha e, pH 7.6, 100 mM NaCl, 10 mM β-me cap oe hanol, 0.5 mM EDTA and 1 % glyce ol ( / ). All he NMR samples con ained 0.04 % sodium azide as an an imic obial agen , 2 x comple e p o ease inhibi o able om a s ock o 25 old (p epa ed by dissol ing one able in 2 ml o s e ile wa e ) and 10 % ( / ) D2O o he ield equency lock. The o al olume was adjus ed o 550 µL o 600 µL and he solu ion was hen ans e ed o a 5 mm ul a p ecision NMR ubes (No ell, Lands ille, NJ, USA). 50 MATERIALS AND METHODS Table 2.4 Summa y and pa ame e s o all NMR expe imen s eco ded o he in e ac ion s udies and o he backbone assignmen o SKK domain. Dimension Resonance NS SW (Hz) TD SF0 (MHz) Re e ence 1H15N-HSQC F1 15N 1155.54 192 F2 1H 16/32 7788.16 1024 600 [1, 2] 1H15N-HSQC F1 15N 1905.49 256 F2 1H 16/32 10416.67 1024 800 [1, 2] TROSY F1 15N 1864.98 256 F2 1H 8 11160.71 1024 800 [3] HNCO F1 13C 2817.19 80 F2 15N 1864.90 64 F3 1H 8 10416.67 1024 800 [4] HNCA F1 13C 6036.12 96 F2 15N 1864.98 64 F3 1H 16 10416.67 1024 800 [4] HNCACB F1 13C 13078.08 128 F2 15N 1864.98 64 F3 1H 16 11160.71 1024 800 [5] MATERIALS AND METHODS 51 Dimension Resonance NS SW (Hz) TD SF0 (MHz) Re e ence HN(CO)CACB F1 13C 13078.08 128 F2 15N 1864.98 64 F3 1H 16 11160.71 1024 800 [4] HN(CA)CO F1 13C 2615.96 64 F2 15N 2108.24 64 F3 1H 16 10416.67 1024 800 [6] HN(CO)CA F1 13C 6036.12 72 F2 15N 1864.98 64 F3 1H 8 11160.71 1024 800 [7] 1H15N1H-NOESY F1 1H 10401.74 256 F2 15N 1864.98 64 F3 1H 8 10416.67 1024 700 [8] 15N15N1H-NOESY F1 15N 1864.98 64 F2 15N 1864.98 64 F3 1H 32 10416.67 1024 700 [9] SW = spec al wid h (Hz) in he obse e dimension; TD = o al numbe o da a poin s being acqui ed; SF0 = spec ome e equency used; NS = numbe o scans. (1) [Mo i e al., 1995]; (2) [Vuis e e al., 1992]; (3) [Kojima e al., 2000]; (4) [G zesiek e al., 1992b]; (5) [Wi ekind e al., 1993]; (6) [Clubb e al., 1992]; (7) [Bax e al., 1991]; (8) [Sekha e al., 1996]; (9) [Iku a e al., 1990]. 52 MATERIALS AND METHODS 2.14.5 P o ein-P o ein, P o ein-RNA in e ac ion s udies NMR is e y well sui ed o he s udy o p o ein-p o ein and p o ein-RNA in e ac ions. To s udy he in e ac ions we ca ied ou i a ions, because his allows, in addi ion o he mapping o he in e ace, a good es ima ion o he a ini y, s oichiome y, and speci ici y o binding as well as he kine ics o binding [Zuide weg 2002]. In a nu shell, he 15N-1H HSQC o 15N-1H TROSY spec um o one p o ein is moni o ed when he unlabeled in e ac ion pa ne is i a ed in, and he pe u ba ions o he chemical shi s a e eco ded. The in e ac ion causes en i onmen al changes on he p o ein in e aces and, hence, a ec he chemical shi s o he nuclei in his a ea [Pellacchia e al., 2000; S e en e al., 2001]. The chemical shi s o he labeled p o ein change du ing he i a ion is de e mined by he kine ics o he in e ac ion. I he complex dissocia ion is e y as , hen he esonances o he nuclei a he in e ace mo e in a con inuous ashion du ing he i a ion. This egime is e e ed o as “ as chemical exchange” and is o en obse ed o weake in e ac ions [Hall e al., 2001]. The ajec o ies o he shi ing esonances in as exchange a e in o ma i e. I all wo-dimensional ajec o ies a e linea and occu a he same a e, a single binding e en is indica ed. I he ajec o ies o di e en esonances occu a a di e en a e, and/o i hey a e cu ed, mo e han one binding si e is implica ed. I he complex dissocia ion is e y slow, we obse e one se o esonances o he ee p o ein and one se o he bound p o ein. Du ing he i a ion, he “ ee se ” will disappea and will be eplaced by he bound se . Mos o he esonances o he wo se s will o e lap wi h each o he , bu he di e ences will ma k he in e ac ion in e ace. This egime is e e ed o as “slow chemical exchange”. In slow exchange one does no au oma ically know o which new loca ion he esonance has mo ed, unless one ca ies ou an independen assignmen p ocedu e o he bound s a e. Consequen ly, we canno easily quan i a e he deg ee o change. One app oach o his p oblem is o assume ha he new esonance which appea s closes o he “ ee” esonance co esponds o i s bound s a e [Williamson e al., 1997; Muske e al., 1998]. In he slow exchange case, he binding cons an can s ill be quan i a ed by measu ing he in ensi ies o he disappea ing and/o appea ing peaks as a unc ion o he i a ion p og ession [Van nuland e al., 1993]. MATERIALS AND METHODS 53 In he “in e media e chemical exchange” he equencies o he changing esonances become poo ly de ined, and ex ensi e kine ic b oadening se s in [Zuide weg e al., 1981]. I he lines become b oad enough, he esonances may disappea om he NMR spec um. He e, he in e ac ion in e ace become delinea ed by p og essi ely disappea ing esonances. Depending on he na u e o he exchange p ocess, he di e en en i onmen s unde going exchange will be cha ac e ized by di e en alues o he NMR pa ame e s: chemical shi , coupling cons an and elaxa ion a es. I he measu ed a iable is chemical shi , wi h exchange occu ing be ween wo en i onmen s cha ac e ized by shi s δA and δB, hen he h ee exchange egimes a e de ined by [Je emy 1995]. Slow exchange K << | δA - δB| In e media e exchange K ≈ | δA - δB| Fas exchange K >> | δA - δB| Gene ally a ule o humb is ha he in e ac ion wi h Kd < 10 µM a e in slow exchange and in e media e/ as exchange o he wise. Howe e , he e a e always many excep ions. Du ing his s udy 1H-15N labeled samples o Nun- ull leng h, Nun N- e minal domain, Nun C- e minal domain, NusA a 1, NusG, NusB, and 2H-15N labeled sample o SKK domain we e used o s udy he in e ac ion wi h hei espec i e in e ac i e pa ne s. The mos common expe imen ca ied ou wi h hese labeled p o eins was 1H-15N-he e onuclea single quan um co ela ion expe imen (2.14.4.1). To in es iga e he in e ac ion o Nun wi h o he Nus ac o s, a se ies o [15N, 1H]-HSQC spec a was eco ded upon g adual addi ion o he espec i e in e ac ing pa ne o a 3 o 4 old mola excess. The 1H-15N esonance shi , disappea ing o signals and line wid h changes we e moni o ed by analyzing he spec a. The i a ions we e ca ied ou un il no u he changes could be obse ed in he spec a o in o he wo ds ill he poin o sa u a ion. On ega d o SKK domain, o inc ease he spec al esolu ion and o dec ease he elaxa ion a es o many o he nuclei du ing iple esonance expe imen s, (2H, 13C, 15N) labeled SKK domain samples we e p epa ed. Fo he backbone assignmen and o s udy he in e ac ion wi h RNA and o he p o eins o SKK domain, he me hods we e combined wi h TROSY. 54 MATERIALS AND METHODS 2.14.6 Chemical shi mapping Chemical shi mapping is used o iden i y pu a i e si es o in e ac ion on a p o ein su ace by de ec ing chemical shi pe u ba ions in simple 1H,15N-HSQC NMR spec a o a uni o mly labeled p o ein as a unc ion o added (unlabeled) a ge p o ein. In o ma ion on he backbone esonance assignmen and he p o ein s uc u e (o a homology based model) o a p o ein is a p e equisi e o chemical shi mapping. The iden i y and loca ion o esonances ha unde go binding-dependen chemical shi pe u ba ions a e mapped on o he h ee-dimensional s uc u e o he p o ein o yield he binding si e o he pa ne p o ein [Je emy 1995; Rajagopal e al., 1997]. Ligand binding causes change in he elec onic en i onmen o he esidues which a e in he icini y o he ligand. This changed en i onmen induces change in he chemical shi o hese esidues in he 1H,15N-HSQC o 1H,15N-TROSY expe imen s. When he assignmen s o he ee p o ein we e a ailable, hey can be eadily ans e ed o he complex by acking he changes ha occu du ing he i a ion. No malized chemical-shi changes a e exp essed as he weigh ed geome ic a e age o 1HN and 15N chemical shi changes o each esidue. Δδno m=  Δδ1H 20.1Δδ15 N 2 [2.2] Δδ(X) ep esen s he chemical shi di e ence o spin X be ween ee and bound s a es. The analysis o pe u ba ion spec a is usually ocused on he di e ence be ween he pe u bed (X) and he non-pe u bed (Y) spec a. The c oss peaks we e picked om he Y spec a and used o de ine he in eg a ion a eas o he X spec a. Fo each X spec a, he in eg a ion o da a poin s om hese a eas a e compa ed wi h he co esponding ones om he Y spec a o calcula e he simila i y (co ela ion coe icien ) be ween he X and he Y spec a. I he shi changes a e mapped on o he p o ein s uc u e, a clea su ace pa ch o a ec ed esidues is gene ally obse ed, and his indica es he loca ion o he binding si e. Due o he high sensi i i y o 1H,15N-HSQC and 1H,15N-TROSY expe imen , hese in es iga ions a e equen ly used in d ug disco e y- ela ed ligand binding s udies like o example, S uc u e Ac i i y Rela ionships (SAR) by NMR [Shuke e al., 1996]. MATERIALS AND METHODS 55 2.14.7 Dissocia ion cons an The dissocia ion cons an KD, in he simples case o a p o ein wi h a single binding si e is de ined as ollows KD = [P][L] / [PL] [2.3] whe e [P], [L] and [PL] a e he equilib ium concen a ions o p o ein, ligand and complexed s a e, espec i ely. A alue o KD in he mM ange implies an app oxima ely 1:1000 a io o ee o bound s a es in an equimola mix u e o P and L and a KD in he µM ange implies an app oxima ely 1:10,00,000 a io o hese s a es, i.e., a much mo e s able complex wi h less o he ‘ ee’ species p esen [Fielding e al., 2007]. To measu e KD by means o NMR expe imen s implies quan i a i e analysis o solu ions ha a e po en ially µM in he obse ed nucleus. The signi icance o KD is ha ligands o weake a ini y ha e la ge KD and hus equi e he addi ion o mo e ligand o sa u a e he ecep o binding si e [Ch is ophe e al., 2004]. The dissocia ion cons an KD is de e mined om he changes in chemical shi s o 15N-labeled SKK domain in 1H-15N TROSY a e g adual addi ion o he co esponding unlabeled binding pa ne . In he as exchange egion he obse ed chemical shi ep esen s he popula ion a e age o he chemical shi o he ee and bound s a e. The e o e, he obse ed chemical shi is desc ibed by he equa ion 2.4 and can be used o KD de e mina ion [Mo on e al., 1996]. δobs =δP  δPL−δP  [ { KD  1 +  [ P ] 0 } 2 [ P ] 0 −   KD  1+  [ P ] 0  2−4 [ P ] 0 2 2 [ P ] 0 ] [2.4] whe e δobs, δP, and δPL a e he chemical shi s o he ac ual mix u e, he ee p o ein, and he comple ely bound p o ein, espec i ely. [P]0 is he o al concen a ion o SKK domain, and desc ibes he SKK/RNA o SKK/NusA a 2 a io. The cu es we e i ed using he p og am MATLAB (6.0.0.88 Release 12, The Ma h Wo ks Inc., Na ick, Massachuse s ,USA) by using he sc ip kd_ i _ unc2.m (Appendix 9.1) (in-house w i en sc ip by D . K is ian Schweime , Depa men o Biopolyme s, Uni e si y o Bay eu h). 56 EXPERIMENTS AND RESULTS 3 Expe imen s and Resul s 3.1 Exp ession and pu i ica ion o Nun cons uc s 3.1.1 Exp ession and pu i ica ion o Nun (1-112) The nucleo ide sequence and he physical/chemical pa ame e s o Nun encoding 1-112 amino acids a e ep esen ed in Appendix 9.2. The o e exp ession and pu i ica ion o ecombinan Nun was pe o med as desc ibed in sec ion 2.5.1/2.5.2. O e exp ession o Nun ull leng h was analyzed by 19 % SDS-PAGE (Fig 3.1). F om he gel we can obse e ha he exp ession a e o Nun was e icien . Figu e 3.1 Exp ession o HK022-Nun (1-112) in E. coli BL21 (DE3). The o e exp ession o ecombinan HK022-Nun p o ein was induced by 1 mM IPTG. The whole cell ex ac we e subjec ed o SDS-PAGE and s ained wi h Coomassie B illian Blue. As molecula weigh s anda d, low ange molecula weigh ma ke om Bio ad was laid on he gel. Lane 1, p o ein ma ke ; Lane 2, uninduced s a e; Lane 3, 1 hou a e induc ion; Lane 4, 2 hou s a e induc ion; Lane 5, 3 hou s a e induc ion; Lane 6, 4 hou s a e induc ion. 1 2 3 4 5 6 97,400 66,200 = 45,000 31,000 21,500 14,400 Nun (1-112) EXPERIMENTS AND RESULTS 57 Following he exp ession, he cell lysis and pu i ica ion we e pe o med as desc ibed in sec ion 2.5.2. Nun was pu i ied by using ca ion exchange ch oma og aphy applying a s ep g adien elu ion (Fig 3.2 (A)). F ac ions con aining Nun we e iden i ied on a 19 % SDS- PAGE (Fig 3.2 (B)). We had obse ed ha he Nun p o ein elu e om 20 % ill 60 % g adien s ep. Among all he ac ions, he elua e a 30 % g adien was mo e pu e compa ed o he o he ac ions. (A) (B) Figu e 3.2 Pu i ica ion o Nun (1-112) using ca ion exchange ch oma og aphy. (A)- Ch oma og am o he pu i ica ion moni o ed a A280. The numbe s in he ch oma og am co esponds o he lane in he SDS-PAGE. (B)-Lane 1, p o ein ma ke ; Lane 2, low h ough; Lane 3, wash; Lane 5-10 ep esen s he elua es. 97,400 66,200 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 10 97,400 66,200 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 10 -3000 -2000 -1000 0 1000 2000 3000 mAU 0 20 40 60 80 100 %B 0 50 100 150 200 250 300 ml F3 F5 1 2 3 4 5 6 7 8 9 10111213141516171819202122232425262728293031323334353637383940 4142434445464748495051525354555657585960 61 A280 (mAU) % Elu ion bu e Volume (ml) 3 7 5 6 4 8 9 10 58 EXPERIMENTS AND RESULTS The Nun ac ions which we e no pu e a e he ca ion exchange ch oma og aphy we e pooled and u he subjec ed o HPLC o pu i ica ion. The HPLC un was ca ied ou as men ioned in he sec ion 2.5.2. The elu ion o Nun p o ein om he HPLC column was pe o med by applying a slow linea g adien (Fig 3.3 (A)). The peak ac ions elu ed we e analyzed by 19 % SDS-PAGE (Fig 3.3 (B)). The elu ed ac ions om HPLC column was su icien ly pu e o u he s udies. (A) (B) Figu e 3.3 (A) Ch oma og am o he HPLC moni o ed a A280. The numbe s in he ch oma og am co espond o he bands assigned in SDS-polyac ylamide gel. (B) The alphabe (M) s ands o p o ein ma ke ; Lane 1 and 2 shows he elua e om he HPLC un. 1 2 1 2 97,400 66,200 = 45,000 31,000 21,500 14,400 1 2 M EXPERIMENTS AND RESULTS 59 3.1.2 Exp ession and pu i ica ion o Nun (45-112) The nucleo ide sequence o he Nun C- e minal domain (CTD) is shown in Appendix 9.3. A de ailed p o ocol abou he exp ession and pu i ica ion o Nun CTD is men ioned in sec ion 2.6.1/2.6.2. Nun CTD was cloned in o he exp ession ec o pET-GB1. The usion p o ein ca ied a hexa-his idine- ag a he N- e minus and wi h a TEV p o ease clea age si e be ween GB1 and Nun CTD. The exp ession was achie ed by inducing he cells wi h 1 mM IPTG. The e iciency o he exp ession o Nun CTD was isualized on a 19 % SDS-PAGE (Fig 3.4) Figu e 3.4 Exp ession o Nun CTD. Lane 1, Bio ad ma ke ; Lane 2, Uninduced Nun CTD; Lane 3, 3.5 hou s a e induc ion. Exp essed ecombinan p o ein was pu i ied by nickel a ini y ch oma og aphy. In elu ing he p o ein, a s ep g adien anging om 0-500 mM imidazole was used (Fig 3.5 (A)). The elu ed ac ions we e analyzed on a 19 % SDS-PAGE (Fig 3.5.(B)). The Nun CTD elu ed a 10 % g adien was abou 90 o 95 % pu e. (A) 97,400 66,200 = 45,000 31,000 21,500 14,400 1 2 3 0 500 1000 1500 2000 2500 3000 3500 mAU 0 20 40 60 80 100 %B 0 100 200 300 400 500 600 700 ml F3 F5 Was e 1 3 5 7 9 11 14 17 20 23 26 29 32 35 38 41 44 47 50 53 56 59 62 65 68 71 74 77 80 83 86 89 92 9596 A280 (mAU) Volume (ml) % Elu ion bu e 2 3 45 66 EXPERIMENTS AND RESULTS Pu i ica ion o he soluble his- agged p o ein om he cla i ied c ude cell ex ac was pe o med by nickel ion a ini y ch oma og aphy on an ÄKTA pu i ie 10-FPLC sys em as desc ibed in sec ion 2.10.2. The supe na an was loaded on o a 5 ml His ap column and he bound p o ein was elu ed using a s epwise g adien o imidazole. The collec ed ac ions we e analyzed o i s pu i y on a 19 % SDS-PAGE (Fig 3.15). Pu e p o ein was elu ed a 20 % g adien . F ac ions con aining he p o ein was combined and dialyzed agains he equi ed bu e and concen a ed using Vi aspin concen a o s. (Fig 3.16). Figu e 3.15 19 % SDS-PAGE analysis o he pu i ica ion o SKK domain. The numbe s in he ch oma og am co esponds o he lane in he gel. Lane 1, supe na an a e sonica ion; Lane 2, pelle a e sonica ion; Lane 3, Bio ad ma ke ; Lane 4-10, elu ed ac ions om he His ap a ini y column. F ac ions 8-10 shows he pu e SKK p o ein. Figu e 3.16 Concen a ed sample o SKK p o ein. The pu i ied ac ions we e pooled oge he and concen a ed o a concen a ion o 400-500 µM. Lane 1, Bio ad ma ke ; Lane 2, concen a ed sample. A280 (mAU) % Elu ion bu e Volume (mL) 97,400 66,200 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 10 4 5 6 7 8 9 10 A280 (mAU) % Elu ion bu e Volume (mL) 97,400 66,200 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 10 4 5 6 7 8 9 10 97,400 66,200 45,000 31,000 21,500 14,400 1 2 97,400 66,200 45,000 31,000 21,500 14,400 1 2 EXPERIMENTS AND RESULTS 67 E ec o pe deu e a ion on SKK domain Deu e a ion educes he elaxa ion a es o NMR-ac i e nuclei, in pa icula 13C, because he gy omagne ic a io o 2H (γ[2H]) is 6.5 imes smalle han 1H (γ[1H]) and he eby i imp o es he esolu ion and sensi i i y o he NMR expe imen s. Du ing deu e a ion, eplacemen o p o ons wi h deu e ons emo es con ibu ions o p o on line wid hs om p o on-p o on dipola elaxa ion and 1H-1H scala couplings. Pe deu e a ion o SKK was necessa y o yield spec a in a sui able quali y o sequen ial esonance assignmen . Signi ican imp o emen s ha e been no ed in be ween non-deu e a ed and deu e a ed SKK p o ein sample as shown in he ollowing igu e (Fig 3.17). Figu e 3.17 E ec o pe deu e a ion on 1H-15N TROSY spec um o he 24.4 kDa SKK domain o NusA. Bo h p o eins a e uni o mly 15N labeled, while he deu e a ed p o ein is app oxima ely 80-90% uni o mly deu e a ed. a) non-deu e a ed sample. b) deu e a ed sample. 1 H (ppm) 1 H (ppm) 15 N (ppm) a b 1 H (ppm) 1 H (ppm) 15 N (ppm) a b 68 EXPERIMENTS AND RESULTS 3.3 Exp ession and pu i ica ion o NusG Full leng h NusG was exp essed in E. coli BL21 (DE3) cells in pET 11a/NusG ec o . The p o ein was cons uc ed wi h no a ini y ag. The exp ession, cell lysis and p o ein pu i ica ion we e pe o med as desc ibed in he sec ion 2.11.1/2.11.2. The nucleo ide sequence and o he pa ame e s conce ning NusG cons uc is shown in Appendix 9.8. A e cell lysis, mos o he p o ein was in he soluble ac ion. The supe na an was subjec ed o ammonium sul a e p ecipi a ion. The pelle ob ained was esuspended and dialyzed agains he espec i e bu e and pu i ied using anion exchange ch oma og aphy (QXL) wi h a linea g adien . The elu ed ac ions we e analyzed by 19 % SDS-PAGE o pu i y (Fig 3.18). The pu e ac ions con aining NusG we e pooled o concen a ion by Vi aspin concen a o s. Figu e 3.18 SDS-PAGE analysis o NusG pu i ica ion. The numbe s in he ch oma og am co esponds o he lane in he SDS-PAGE. Lane 1, ma ke ; Lane 2, pelle a e cell lysis; Lane 3, supe na an a e cell lysis; Lane 4, low h ough; Lane 5, wash; Lane 6-10, ac ions elu ed om he QXL column. 15N NUSG 311006:1_UV1_280nm 15N NUSG 311006:1_Conc 15N NUSG 311006:1_F ac ions 0 200 400 600 800 1000 1200 1400 1600 mAU 0 20 40 60 80 100 %B 0 50 100 150 200 250 300 350 ml F3 F3 F5 1 2 3 4 5 6 7 8 9 1011 1314 1617 1920 22 2425 2728 3031 3334 3637 3940 4243 4546 4849 51 1 2 3 4 5 6 7 8 9 10 97,400 66,200 = 45,000 31,000 21,500 14,400 A280 (mAU) Volume (ml) % Elu ion bu e 4 5 6 7 8 9 10 EXPERIMENTS AND RESULTS 69 3.4 Exp ession and pu i ica ion o NusB To p oduce high yield o labeled p o ein and o ha e ep oducible esul s, one p omising ecen app oach has been he de elopmen o au o-induc ion o ecombinan p o ein exp ession, a me hod in oduced by S udie . This app oach is based upon he p e e ences o bac e ia o selec i ely use di e en ca bon sou ces du ing diauxic g ow h and upon he o en- obse ed nega i e egula ion o gene exp ession by ca aboli e ep ession. The au o-induc ion app oach has many ad an ages o e adi ional induc ion me hods including a oidance o he s ong induc ion and appa en oxici y associa ed wi h chemical induce s such as IPTG, he abili y o o mula e medium composi ions o ob ain a desi ed le el o cell g ow h be o e exp ession and minimal equi emen s o handling o he exp ession cul u e associa ed wi h g ow h-dependen induc ion o a ge p o ein exp ession. Nucleo ide sequence o NusB is shown in Appendix 9.9. The exp ession and pu i ica ion is explained in de ail in sec ion 2.12.1/2.12.2. Au o-induc ion o NusB was ca ied ou as men ioned by S udie e al., 2004. The p o ein was pu i ied using a His ap a ini y column. The bound p o ein was elu ed wi h a s ep g adien using a bu e con aining imidazole. The ac ions elu ed we e analyzed by 19 % SDS-PAGE (Fig 3.19). The elu ed ac ions we e e y pu e. The peak ac ions con aining NusB we e pooled oge he and se o clea e he N- e minal his idine ag using he TEV p o ease. The clea ed sample was dialyzed agains he equi ed bu e o u he pu i ica ion. The NusB p o ein was u he pu i ied o high le el o pu i y by applying he clea ed sample o an anion exchange ch oma og aphy. The sample was loaded on o he QXL column and hen elu ed wi h a s ep g adien anging om 0 o 1 M NaCl. The ac ions elu ed om he QXL column we e analyzed by SDS-PAGE (Fig 3.20). The ac ions co esponding o NusB we e pooled o u he use. 70 EXPERIMENTS AND RESULTS Figu e 3.19 Pu i ica ion analysis o NusB. The numbe s in he ch oma og am co esponds o he lane in he SDS gel. Lane 1, ma ke ; Lane 2, pelle a e cell lysis; Lane 3, supe na an a e cell lysis; Lane 4, wash; Lane 5-9, he ac ions collec ed om he His ap column. Figu e 3.20 Analysis o he ac ions elu ed om he QXL column as he inal pu i ica ion s ep o NusB. Lane 1, ma ke ; Lane 2-5, he ac ions elu ed om he QXL column. NusB second his ap001:1_UV1_280nm NusB second his ap001:1_Conc NusB second his ap001:1_F ac ions -1000 0 1000 2000 3000 mAU 0 20 40 60 80 100 %B 0 50 100 150 200 ml 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 97,400 66,200 = 45,000 31,000 21,500 14,400 1 2 3 4 5 6 7 8 9 A280 (mAU) Volume (ml) % Elu ion bu e 45 6 7 8 9 NusB qxl un 180707:1_UV1_280nm NusB qxl un 180707:1_Conc NusB qxl un 180707:1_F ac ions -1000 -500 0 500 1000 1500 2000 2500 mAU 0 20 40 60 80 100 %B 0 50 100 150 200 ml 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 A280 (mAU) Volume (ml) % Elu ion bu e 97,400 66,200 = 45,000 31,000 21,500 14,400 1 2 3 4 5 2 3 4 5 EXPERIMENTS AND RESULTS 71 3.5 In e ac ion o Nun wi h E. coli hos ac o s 3.5.1 In e ac ion o Nun wi h NusA a 1 domain The Nun p o ein o bac e iophage HK022 is a membe o he a ginine- ich mo i amily o RNA binding p o eins, which also includes he phage λ N ansc ip ion an i e mina ion p o ein. In con as o λ N, which supp esses ansc ip ional e mina ion, Nun e mina es ansc ip ion jus dis al o BOXB (1.5.2) The Nun C e minus in e ac s wi h RNA polyme ase and con ac s DNA empla e, which is 7-8 bp downs eam o he RNA polyme ase ac i e cen e . I is likely, ha Nun in e cala es in o empla e ia W108 and his in e cala ion physically blocks RNA polyme ase ansloca ion. I has been al eady epo ed [Wa nick e al., 1998] ha NusA, a ansc ip ion elonga ion p o ein binds o he C e minus o Nun and s imula es he Nun binding o BoxB. In doing so, howe e , NusA inhibi s he in e ac ion be ween Nun and RNA polyme ase, which equi es he C e minus o Nun. The mechanism by which NusA s imula es Nun binding appea s o be no el among RNA binding p o eins. The idea, ha NusA in e ac s wi h he C- e minal egion o Nun consis ing o amino acids VMHRVVNHAHQRNPNKKWS was suppo ed based on he esul s om a binding assay [Wa nick e al., 1998]. By in e ac ion wi h Nun C- e minus, NusA exposes he RNA binding domain and allows Nun o bind BOXB. In an o he publica ion by Kim e al., 2006, i has been shown ha Nun binding o NusA, like ha o λ N, equi es NusA a 1 egion loca ed be ween NusA esidues 364 and 415. To de e mine his, hey had exp essed N- e minal hexahis idine agged de i a i es o ull leng h NusA and ou NusA C- e minal dele ion mu an s. Nun binding o hese de i a i es we e de e mined by Ni2+ a ini y ch oma og aphy. The esul s ob ained indica ed ha NusA a 1 is c ucial o Nun binding as i is o N. Based on he abo e wo epo ed esul s, one could sugges ha NusA a 1 in e ac s wi h he C- e minal domain o Nun. On he con ex o his ac , in e ac ion be ween Nun and NusA a 1 was s udied a a omic le el by NMR. 72 EXPERIMENTS AND RESULTS To obse e he in e ac ion be ween hese wo p o eins, 15N-labeled samples o NusA a 1 (2.8) was used o he i a ion expe imen s by NMR. In o de o iden i y which amino acid esidues o Nun a e in ol ed in he in e ac ion wi h NusA a 1, h ee cons uc s o Nun (Nun C- e minal pep ide (92-112); Nun CTD (45-112); Nun (1-112) ha e been used in his s udy (Appendix 9.2 and 9.3). Th ee sepa a e i a ion expe imen s we e pe o med in which 15N HSQC spec a o NusA a 1 we e collec ed as a unc ion o added Nun cons uc s: (1) NusA a 1 + Nun (92-112), (2) NusA a 1 + Nun (45-112), (3) NusA a 1 + Nun (1-112). The NMR i a ions we e op imized by adop ing di e en bu e s, pH and sal concen a ion. Amide (1HN, 15N) chemical shi s a e e y sensi i e o local s uc u al changes. The e o e, obse a ion o chemical shi changes on i a ion o a binding pa ne o a 15N labeled p o ein p o ides a powe ul me hod o he iden i ica ion o he in e ac ion and he binding su ace. Howe e , no de ec able signal shi ing is obse ed du ing i a ion, up o an ou old mola excess o Nun cons uc s. Consonan wi h he lack o chemical shi pe u ba ions (2.14.5) obse ed in all he h ee i a ion expe imen s, we could conclude ha he e is a lack o an in e molecula in e ac ion be ween NusA a 1 and Nun. An o e lay o 1H,15N-HSQC spec a o h ee NMR i a ions we e shown in Fig 3.21; Fig 3.22, and Fig 3.23 espec i ely. All he spec a shown he e clea ly depic s ha he e is no in e ac ion su ace and no signi ican changes in he con o ma ion o NusA a 1 upon i a ing wi h Nun p o ein. EXPERIMENTS AND RESULTS 73 Figu e 3.21 O e lay o he 1H,15N-HSQC spec a o ee NusA a 1 (black) upon i a ing wi h Nun pep ide (92-112) (blue). No signi ican changes a e obse ed in NusA a 1 upon in e ac ing wi h nun pep ide. The appea ance o he o e lay did no change wi h o he bu e s and in he p esence and absence o sal in he bu e . 1 H (ppm) 15 N (ppm) 1 H (ppm) 15 N (ppm) 74 EXPERIMENTS AND RESULTS Figu e 3.22 Supe imposed 1H,15N-HSQC spec a o ee NusA a 1 in he absence (black) and p esence ( ed) o Nun CTD (45-112). Du ing he i a ion he black colo ed peaks did no shi indica ing ha he e migh be no in e ac ion wi h Nun CTD. 1 H (ppm) 15 N (ppm) 1 H (ppm) 15 N (ppm) EXPERIMENTS AND RESULTS 75 Figu e 3.23 An o e lay o he 1H,15N-HSQC spec a o ee NusA a 1 (black) upon i a ing wi h Nun (1-112) (magen a). No majo changes in he chemical shi we e obse ed o any esidues. 1 H (ppm) 15 N (ppm) 1 H (ppm) 15 N (ppm) 82 EXPERIMENTS AND RESULTS Figu e 3.26 S ips o HN(CO)CACB and HNCACB spec a o 2H,13C,15N uni o mly labeled SKK domain. S ips om wo spec a a e shown, co esponding o a single amino acid. Se e al o hese s ips a e placed in a ow o show he sequen ial connec i i ies om each amino acid o he p eceding one. The cohe ence ans e in bo h o hese expe imen s o a pai o consecu i e esidues a e shown below. The a ows indica e he magne iza ion ans e pa hway. HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB S295 S295 I296 I296 V297 V297 V298 V298 D299 D299 CA (i-1) CB (i-1) CB (i-1) CA (i-1) HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB S295 S295 I296 I296 V297 V297 V298 V298 D299 D299 CA (i-1) CB (i-1) CB (i-1) CA (i-1) HNCACB HN(CO)CACBHNCACB HN(CO)CACB EXPERIMENTS AND RESULTS 83 Figu e 3.27 S ips showing backbone sequen ial connec i i ies o esidues 295 o 299 o he SKK domain. The s ips a e aken om HNCO and HN(CA)CO spec a o 2H,13C,15N uni o mly labeled SKK domain and each s ips om wo spec a co esponds o a single amino acid. Se e al o hese s ips a e placed in a ow o show he sequen ial connec i i ies. The low o magne iza ion is indica ed by a ows. S295 S295 I296 I296 V297 V297 V298 V298 D299 D299 HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO S295 S295 I296 I296 V297 V297 V298 V298 D299 D299 HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HNCO HN(CA)CO HN(CA)CO HNCOHN(CA)CO HNCO 84 EXPERIMENTS AND RESULTS Figu e 3.28 1H,15N-TROSY spec um o 2H,13C,15N uni o mly labeled SKK domain (400 µM; 800 MHz; 298K). Assigned backbone esonances a e labeled wi h amino acid ype in one le e code and esidue numbe . The yp ophan NH a e ma ked by “W sc”. The unassigned esonances a e indica ed by hash (#). 15 N (ppm) 1 H (ppm) 15 N (ppm) 1 H (ppm) EXPERIMENTS AND RESULTS 85 3.7 In e ac ion s udies o NusA RNA binding domains (SKK) 3.7.1 Binding o SKK wi h nu RNA As desc ibed ea lie , he N p o ein, wi h a g oup o E. coli encoded p o eins ha , in addi ion o NusA, include NusB, NusG, and NusE, ac a nu RNA si es, o modi y RNA polyme ase o a e mina ion- esis an o m. The nu RNA sequences a e componen s o ansc ip s ini ia ing a he ea ly λ p omo e s PR and PL. The espec i e nu si e in he PR and PL ope ons a e nu L and nu R which lies ups eam o he i s e mina o (sec ion 1.4). Sequence analyses iden i ied h ee egions in NusA ha ing homologies wi h sequences associa ed wi h RNA binding; one S1 and wo KH domains, in he cen al po ion o ecoNusA. The c ys al s uc u e o The ma oga ma i ima NusA [Wo bs e al., 2001] sugges s ha NusA c ea es an ex ended, mosaic RNA in e ac ion su ace by domain a aying. Consis en ly, all po ions o he molecule ha e been implica ed by mu a ional analyses in RNA binding: he R199A mu a ion in he in e ace o S1 and KH1, and poin mu a ion in he GXXG mo i s o bo h KH elemen s, all impai binding o nu si e RNA. I has been shown by aniso opic luo escence i a ions [P asch e al., 2008; in e ision] ha i a ion o SKK domain wi h λ nu R showed only weak p o ein-RNA in e ac ions compa ed wi h λ nu L which showed sligh ly highe a ini y owa ds SKK domain. Based on hese epo s, he in e ac ion o RNA binding domains o NusA wi h λ nu L RNA was in es iga ed by NMR i a ion s udies. To iden i y he in e ac ion be ween SKK and λ- nu L, 2H,15N labeled SKK p o ein was i a ed wi h an inc easing mola a io o unlabeled λ- nu L RNA. The chemical shi changes ha e been moni o ed in he 1H,15N-TROSY spec a du ing each s ep o he i a ion upon g adual addi ion o he λ nu L RNA. Table 3.1 shows he de ails o he i a ion expe imen s. 86 EXPERIMENTS AND RESULTS Table 3.1 Ti a ion able o s udying he in e ac ion o SKK wi h λ nu L RNA. Expe imen . No SKK domain (mM) λ nu L RNA (mM) To al olume (µL) Ra io 1 0.1000 0.000 550 1:0 2 0.0965 0.025 570 1:0.25 3 0.0932 0.050 590 1:0.50 4 0.0902 0.075 610 1:0.75 5 0.0873 0.100 630 1:1.0 6 0.0821 0.150 670 1:1.5 7 0.0775 0.200 710 1:2.0 8 0.0733 0.250 750 1:2.5 9 0.0696 0.300 790 1:3.0 An o e lay o he 1H,15N-TROSY spec a a each NMR i a ion s ep is shown in Fig 3.29. Fo SKK-λ nu L RNA complex, many peaks had signi ican Δδ (sec ion 2.14.6) as compa ed o he ee SKK p o ein, indica ing a binding in e ace. Few esonances mo ed in a con inuous ashion (ex., T240, K235, V238, T264, R270, D272, S295, V297 e c.,) alling in he as exchange egime on NMR ime scale. Thus, he esonances o he nuclei a ec ed by RNA binding g adually shi hei posi ion om he esonance o he ee s a e owa ds he esonance o he bound s a e. Apa om he di e ences in chemical shi s o ce ain esidues, i was also no ed ha some o he esonances disappea comple ely (Fo ex., V179, G192, A234, I236, C251, G267, I271, I273, M288, I318 e c.,). Upon immedia e i a ion o λ nu L RNA (0.25 mola equi alence) disappea ance in he esonances o hese esidues we e obse ed. Absence o signals in he 1H,15N-TROSY spec a o some o he esidues, could be p obably due o exchange p ocesses on he in e media e ime scale, sugges ing ha hese esidues a e in ol ed in binding. This is cha ac e is ic o a ini ies in he low-mic omola ange. I is impo an o ecognize ha “NMR imescale” is a ela i e one. Fo a gi en equilib ium, di e en esonances will show slow, in e media e o as exchange beha io , depending on how much hei chemical shi s di e be ween he ee and bound s a es. The Fig 3.30 shows a expanded egion o he o e laid 1H,15N-TROSY spec a om SKK-λ nu L RNA i a ion. EXPERIMENTS AND RESULTS 87 Figu e 3.29 Ti a ion o SKK domain wi h λ nu L RNA. O e lay o 1H,15N-TROSY spec a eco ded du ing he i a ion wi h di e en RNA/p o ein a ios. Key; black 0.0, magen a 0.25, blue 0.50, cyan 0.75, magen a 1.0, yellow 1.5, blue 2.0, g een 2.5, and ed 3.0. Resonance signals in ol ed in binding a e anno a ed. 1 H (ppm) 15 N (ppm) A294 R270 V297 G253 G192 I245 L275 I221 C251 M288 I318 T264 V238 K235 T240 R228 I236 A227 D229 I271 I273 S295 D272 A234 1 H (ppm) 15 N (ppm) A294 R270 V297 G253 G192 I245 L275 I221 C251 M288 I318 T264 V238 K235 T240 R228 I236 A227 D229 I271 I273 S295 D272 A234 88 EXPERIMENTS AND RESULTS Figu e 3.30 1H,15N-TROSY spec a o SKK upon i a ing wi h λ nu L RNA. (A/B)-Residues showing di e en chemical en i onmen due o λ nu L RNA binding 1 H (ppm) 15 N (ppm) A B L275 A237 I271 I273 V179 T240 I236 T264 V238 K235 1 H (ppm) 15 N (ppm) A B L275 A237 I271 I273 V179 T240 I236 T264 V238 K235 EXPERIMENTS AND RESULTS 89 3.7.2 No malized chemical shi changes Pe u ba ions o 15N and HN chemical shi s o a p o ein upon complexa ion wi h a ligand a e a quali a i e ool o mapping o esidues in ol ed in binding si es and/o iden i ying con o ma ional ea angemen s (sec ion 2.14.6). Hence, chemical shi mapping was used in o de o iden i y he pu a i e si es o in e ac ion on SKK domain, by de ec ing he chemical shi pe u ba ion in he 1H,15N-TROSY o SKK upon i a ing wi h λ nu L RNA. In Fig 3.31 (A), changes in chemical shi s a e displayed h ough he use o he no malized weigh ed chemical shi a e age be ween he ee SKK and i s complex wi h λ nu L RNA (equa ion 2.2). No malized chemical shi changes la ge han 0.04 ppm a e conside ed o be signi ican [Hajduk e al., 1997] as indica ed by dashed line in Fig 3.31 (A). Nea ly all 1HN and 15N esonances in he KH domains a e a ec ed upon binding o λ nu L RNA, whe eas, he mo e p ominen changes occu ing in he egion R210-W276 which encodes o KH1 domain. P e iously, i has been implica ed ha he KH domains a e he impo an con ibu o s o NusA binding o RNA [Wo bs e al., 2001]. F om ou expe imen al esul s, i could be deduced ha he KH1 domain plays a signi ican ole in nu RNA binding. The obse ed chemical shi changes we e mapped on o he su ace o he c ys al s uc u e o The mo oga ma i ima NusA (S1+KH1+KH2) o ge u he insigh in o he binding in e ace. The Figu e 3.31 (B) shows he su ace ep esen a ion o SKK domain highligh ing he binding in e ace and he esidues whose esonances a e a ec ed upon binding o λ nu L RNA. 90 EXPERIMENTS AND RESULTS Figu e 3.31 (A) Chemical shi changes o SKK upon binding o λ nu L RNA as a unc ion o p ima y sequence; Do ed line ep esen s he signi icance le el o 0.04 ppm; X = esidues no assigned. The colo ed ba s ep esen he h ee RNA binding domains. (B) Su ace ep esen a ion o SKK highligh ing he binding in e ace. Few o he esidues wi h esonances showing signi ican chemical shi changes (0.04 < Δδ ≤ 0.1) a e shown in g een, hose wi h Δδ > 0.1 a e in ed. Disappea ing esonances a e p esen ed in o ange. Sequence posi ion No malized chemical shi changes (ppm) 126 176 226 276 326 XXXXXXX X X X X X XXXXXXXX XXXX X X X XX XX X XXXX X X XXX XXX XXXXX XXXXX S1 KH1 KH2 A Sequence posi ion No malized chemical shi changes (ppm) 126 176 226 276 326 XXXXXXX X X X X X XXXXXXXX XXXX X X X XX XX X XXXX X X XXX XXX XXXXX XXXXX S1 KH1 KH2 Sequence posi ion No malized chemical shi changes (ppm) 126 176 226 276 326 XXXXXXX X X X X X XXXXXXXX XXXX X X X XX XX X XXXX X X XXX XXX XXXXX XXXXX S1 KH1 KH2 A E218 E216 I211 V262 T264 R270 V238 A234 D272 S295 R258 B A346 K347 H348 E218 E216 I211 V262 T264 R270 V238 A234 D272 S295 R258 B A346 K347 H348 EXPERIMENTS AND RESULTS 91 3.7.3 Dissocia ion cons an o SKK-λ nu L complex The dissocia ion cons an KD is de e mined om he changes in chemical shi s o 2H,15N- labeled SKK in a 1H,15N-TROSY a e g adual addi ion o λ nu L RNA (sec ion 2.14.7). Signals showing a beha iou in he limi o as exchange on he NMR ime scale we e i ed o equa ion (2.4) o a wo s a e model. K235, V297 and R270 o SKK domain which show as exchange egime du ing he i a ion was chosen o de e mine he KD alue (Fig 3.32). I has been obse ed by luo escence i a ion ha λ nu L binds o SKK wi h an a ini y o 71 µM [P asch e al., 2008, in e ision]. The di e ence be ween he KD alues ob ained om NMR and luo escence expe imen could be suppo ed by he ac ha an accu a e measu emen o KD equi es he use o p o ein concen a ions ≤ KD and he low sensi i i y o NMR in e ms o concen a ions equi ed ob iously se s a p ac ical limi o he ange o dissocia ion cons an s which can be measu ed. Fo he analysis o KD, ligand concen a ions g ea e han he p o ein concen a ion a e used, which gi es an e o up o a ac o o en [Feeney e al., 1979]. Figu e 3.32 Dissocia ion cons an s o SKK- λ nu L complex. Fi ing he cu es yielded he calcula ed KD alues shown in he inse . V297 K235 R270 10.0R270 10.2V297 16.4K235 K D µM 10.0R270 10.2V297 16.4K235 K D µM No malized chemical shi s No malized chemical shi s No malized chemical shi s nu L/SKK nu L/SKK nu L/SKK 98 EXPERIMENTS AND RESULTS 3.8.2 Displacemen by α-CTD subuni o RNA polyme ase Based on he obse a ion ha NusA could bind nu -si e RNA in he p esence o α, bu no in he absence, Mah and co-wo ke s had sugges ed, ha he e migh be a di ec in e ac ion be ween NusA and α subuni o RNA polyme ase. The gel mobili y shi expe imen s [Mah e al., 2000] had shown ha he binding o NusA o nu si e RNA is indeed inhibi ed by he 70 ca boxy- e minal amino acids o NusA and sugges s ha his inhibi ion could be elie ed by an in e ac ion o his po ion o NusA wi h he CTD o he RNA polyme ase α subuni . To cha ac e ize he α-dependen RNA binding by SKK domain, we i a ed he complex con aining SKK + NusA a 2 wi h α-subuni o RNA polyme ase. A se ies o 1H,15N-TROSY spec a o he complex (SKK + NusA a 2) was eco ded by g adually adding an inc eased mola a io o unlabeled α-CTD. Ou main idea h ough his expe imen is o obse e whe he α-CTD displaces NusA a 2 om SKK domain and eleases he au oinhibi ion e ec o NusA a 2 o no . O e lay o he i a ion spec a a e shown in Fig 3.37-A. The same se o amide esonances which showed chemical shi changes du ing he i a ion o SKK wi h NusA a 2, we e also a ec ed on i a ing he complex (SKK + NusA a 2) wi h α- CTD. Bu he di ec ion in which he esonances ha e shi ed could be e e sed. Fig 3.37-B, shows one such example o he esidue G249 exhibi ing such kind o shi . When i a ing he SKK domain wi h NusA a 2 he esidue G249 showed signi ican chemical shi change and he eby alling in he as exchange egime. Upon i a ing wi h NusA a 2, he esonances o G249 g adually shi ed i s posi ion om downwa ds ( ee s a e) owa ds upwa ds (bound s a e). Du ing he i a ion o he complex (SKK + NusA a 2) wi h α-CTD, he esonances o G249 shi ed om upwa ds owa ds downwa ds di ec ion, indica ing ha α-CTD is displacing NusA a 2 om i s bound s a e, he eby opening he SKK domain o RNA binding. EXPERIMENTS AND RESULTS 99 Figu e 3.37 (A) O e lay o 1H,15N-TROSY spec a eco ded du ing he i a ion o complex (SKK + NusA a 2) wi h inc easing mola a ios o α-CTD. The esonances which we e a ec ed du ing he i a ion a e indica ed. (B) G249 o SKK showing he di ec ion o he shi o esonances in bo h he i a ion. 1 H (ppm) 15 N (ppm) A R270 G249 A261 S263 Q260 A234 1 H (ppm) 15 N (ppm) 1 H (ppm) 15 N (ppm) A R270 G249 A261 S263 Q260 A234 G249 G249 SKK + NusA a 2 [SKK + NusA a 2] + α-CTD 100 DISCUSSIONS 4 Discussions 4.1 E ec o Nus ac o s on HK022 Nun The Nun p o ein o bac e iophage HK022 is a membe o he a ginine- ich mo i amily o RNA binding p o eins which includes he phage λ N ansc ip ion an i e mina ion p o ein and he HIV Ta and Re p o eins. In con as o λ N, which supp esses ansc ip ion e mina ion, Nun e mina es ansc ip ion jus dis al o BoxB (1.5.2). Like λ N, ac ion o Nun also equi es he hos Nus p o eins. As desc ibed ea lie , he E. coli NusA p o ein in e ac s wi h he C- e minal egion o Nun and s imula es he binding o Nun o BoxB. In pa icula , i has been epo ed ha NusA a 1 which is esponsible o binding o phage λ N p o ein as well as o he C e minus o he RNA polyme ase α subuni is also equi ed o he Nun binding [Wa nick e al., 1998]. In he con ex o he epo ed esul s, s udies ha e been ca ied ou o de e mine he in e ac ion be ween Nun and NusA by NMR i a ion expe imen s. To moni o his in e ac ion, h ee cons uc s o Nun con aining 1-112, 45-112, and 92-112 we e used (3.5.1). Upon i a ing he Nun cons uc s wi h NusA a 1, no de ec able changes in chemical shi s as well as no new signals ha e been obse ed. Based on hese expe imen al esul s om NMR, i suppo s he idea ha he e migh no be any di ec in e ac ion be ween NusA a 1 and Nun. To op imize he expe imen al condi ions we had used wo bu e condi ions wi h di e en pH (10 mM KPO4, pH 6.4, 50 mM NaCl / 50 mM NaPO4, pH 7.0, 50 mM NaCl). The esul s ob ained wi h hese di e en bu e s emained he same. As he binding ee ene gies associa ed wi h he o ma ion o mac omolecula complexes a e gene ally ex emely sensi i e o ionic s eng h, we had pe o med he i a ion wi h h ee di e en sal condi ions (0, 50, and 100 mM NaCl espec i ely) in he abo e men ioned bu e , o see whe he is he e any obse able changes due o he di e en sal concen a ion o no . Howe e , we ha e no obse ed any signi ican pe u ba ions in he chemical shi du ing he i a ion. DISCUSSIONS 101 As he C e minus o Nun includes h ee his idine esidues ha o m a po en ial zinc binding mo i [Wa nick e al., 2000], all he NMR expe imen s ha e been epea ed in he p esence o zinc, wi h an aim ha i migh acili a e he binding o Nun wi h NusA. Again, no obse able changes occu ed in he i a ion e en in he p esence o zinc. Wi h he obse ed esul s, now he ques ion a ises, whe he NusA a 1 is c i ical o Nun binding o no , whe he o he domains o NusA is also equi ed o binding. Wi h a ques o answe hese ques ions, ull leng h NusA (1-495) ha e been used o he binding s udies. As he en i e complex is p ohibi i ely la ge o s udying by NMR spec oscopy, we eplaced he Nun ull leng h wi h Nun C- e minal domain con aining 45-112 amino acids (3.1.2) which co esponds o he in e ac ing egion. I has been al eady shown ha NusA binds di ec ly o Nun C- e minal domain by a ini y ch oma og aphy expe imen s [Wa nick e al., 1998]. 15N labeled Nun C- e minal domain was i a ed wi h g adually adding unlabeled NusA o a mola a io o 1:3. On using he ull leng h NusA as well, no signi ican chemical shi pe u ba ions ha e been obse ed. I has been al eady epo ed ha λ N o ms a complex wi h NusA a 1 [P asch e al., 2006]. So, in ou case o ha e a posi i e con ol, he i a ion o λ N wi h NusA (1-495) ha e been pe o med o obse e he changes. E en wi h he ull leng h NusA, one supposed o see ew o hose changes co esponding o he changes ha was obse ed when he λ N o ms a complex wi h NusA a 1. Same sample condi ions we e used o a oid he a i ac s esul ing om he non-simila sample condi ions. As expec ed, dis inc esonance changes we e seen on λ N upon i a ing wi h NusA ull leng h, indica ing clea ly he in e ac ion be ween λ N and NusA. Based on ou expe imen al esul s om NMR and in acco dance o he lack o chemical shi pe u ba ions om all o he pe o med i a ion expe imen s, i is ob ious ha he e is p obably a lack o in e molecula in e ac ion be ween Nun and NusA. I migh be ha he in e ac ion be ween Nun and NusA is also in need o o he ac o s which could acili a e Nun binding o NusA. Like λ N p o ein, apa om NusA, Nun also equi es addi ional hos ac o s (NusB, NusE and NusG) o e icien e mina ion, whe eas he p esence o NusA alone inhibi s he e mina ion ac i i y. Wi h he con inuing in e es o know mo e abou he in e ac ion o HK022 Nun wi h Nus ac o s, has p o ided us a po en d i ing o ce o s udy he in e ac ion 102 DISCUSSIONS o Nun wi h a ious Nus ac o s (NusG and NusB) by NMR i a ion s udies. Fo he in e ac ion s udies o Nun wi h o he Nus ac o s, 15N labeled NusG and NusB ha e been p epa ed (3.3 and 3.4). The sample condi ions we e main ained he same as used o s udy he in e ac ion o HK022 Nun wi h NusA. I has been epo ed p e iously, ha E. coli NusG gene p oduc is equi ed o ansc ip ion e mina ion by phage HK022 Nun p o ein in i o [Bu o a e al., 1999]. Bu so a , he e a e no expe imen s showing a di ec in e ac ion be ween Nun and NusG. Wi h his as a subjec , we p oceeded o s udy he in e ac ion o NusG wi h Nun. F om he o e lay o 1H,15N-HSQC expe imen s (Fig 3.24), no dynamic changes we e obse ed in all s ages o i a ion. This indica es ha no di ec binding be ween NusG and Nun exis . The e o e, he ole o NusG ac ion in HK022 Nun media ed e mina ion migh be no di ec ly in e ac ing wi h Nun bu could be in p esence o o he Nus ac o s, NusG migh s imula e Nun e mina ion. Mu a ional s udies had desc ibed ha mu a ion in nusB genes blocks bo h Nun and N ac ion in i o [F iedman e al., 1976]. Bu up o now, i has no been shown, whe he he e is any di ec binding o Nun o NusB. Hence, we wan ed o obse e he in e ac ion be ween NusB and HK022 Nun by NMR. Howe e , i a ion o NusB upon adding inc eased mola a io o Nun, does no cause any signi ican de ec able changes (Fig 3.25). The in e ac ion s udies was ca ied ou wi h he ull leng h and as well as wi h C- e minal domain o Nun alone, bu he esul s emained he same, leading o he conclusion ha he e is no di ec in e ac ion be ween HK022 Nun and NusB. In he e mina ion pa hway, HK022 Nun uses he hos ac o s NusA, NusB, NusG and NusE. Ne e heless, he in ol emen o E. coli hos ac o s in Nun e mina ion is s ill no clea ly explained. Based on ou NMR expe imen al esul s, we we e unable o obse e a di ec binding o any o hese Nus ac o s o HK022 Nun. Based on he published esul s i is clea ha , Nun e mina ion is acili a ed by Nus hos ac o s, bu om ou esul s we deduce ha he acili a ion is no by a di ec binding o HK022 Nun. The e o e, he p oposed ole o NusA in Nun media ed e mina ion migh be di e en and he ole o NusG and NusB s ill emains o be sol ed. DISCUSSIONS 103 4.2 Backbone assignmen o RNA binding domains o NusA (SKK) The cen al S1 and KH domain egions o NusA (SKK) a e in ol ed in in e ac ions wi h nu si e RNA and a e equi ed o bo h ansc ip ion e mina ion and an i e mina ion. In o de o explo e he de ails o he binding su ace on SKK domain upon nu RNA binding, we p ima ily p oceeded o ob ain sequence speci ic backbone esonance assignmen . Deu e ium labeling s a egy (2.10) was used o he SKK domain o inc ease he sensi i i y and he esolu ion in iple esonance expe imen s. The labeling s a egy esul s in deu e ium inco po a ion h oughou a p o ein in a oughly si e-independen manne (uni o m o andom labeling). One o he signi ican ad an age o deu e a ion is ha many c oss- elaxa ion pa hways a e emo ed, he eby educing he o e all esonance line wid hs and spin di usion e ec s in he sys em. To achie e high a e o deu e a ion o he in e ac ion s udies, media con aining > 99.9 % D2O was used. The main p oblem o exp ess a deu e a ed p o ein is he inco po a ion o 2H which educes g ow h a e o o ganisms up o 50 %. Since, exp ession o highly deu e a ed p o ein also equi es s epwise adap a ion o he bac e ia o he high deu e a ion le el, he SKK p o ein p oduc ion wi h deu e a ed media usually esul ed in signi ican ly lowe yield han ha wi h nondeu e a ed media. Fo he backbone esonance assignmen o SKK domain, TROSY-based iple esonance expe imen s wi h 2H,15N,13C-labeled SKK was ca ied ou which was supe io han he con en ional iple- esonance expe imen s. Line b oadening a highe magne ic ields which is a mani es a ion o inc eased ans e se elaxa ion a es and de e io a ion o he sensi i i y in iple- esonance expe imen s, has been la gely supp essed by using TROSY echnique. Du ing he cou se o s udy, TROSY combined wi h deu e a ed SKK domain was used o he backbone esonance assignmen s. TROSY based iple- esonance expe imen s we e eco ded o allow sequen ial assignmen o he backbone o SKK domain. Typically hese expe imen s include -HNCO, -HNCA, - HN(CA)CO, -HN(CO)CA, -HNCACB and -HN(CO)CACB which a e p edominan ly un as 3D expe imen s, eco ding he chemical shi s o 1HN, 13C and 15N. 104 DISCUSSIONS Du ing he cou se o inding sequen ial connec i i ies o he backbone esonances, we had buil chemical shi “clus e s” by compa ing and co ela ing se e al he e onuclea 3D expe imen s, so ha each clus e is composed o he co ela ed backbone chemical shi s o one amino acid esidue and o i s p eceding o ollowing esidue. We hen link hese clus e s o ob ain sequen ial s e ches o chemical shi se s o amino acid esidues, s a ing om he esidue i and looking o i-1 and so on. Sequen ial connec i i ies we e also con i med by he iden i ica ion o NOE c oss-peaks be ween sequen ial HN g oups, using a 3D-15N-HSQC- NOESY and 3D-NNH-NOESY. Fo a a ie y o easons, e en modes inc ease in p o ein size g ea ly complica e he assignmen p ocess and he same was obse ed wi h he SKK domain as well. The SKK domain consis o 222 esidues, 9 o which we e p oline esidues and 7 esidues in he N- e minal pa belongs o he ag egion, a maximum o 206 backbone amide 1HN-15N co ela ion peaks would be p edic ed in he TROSY spec a o SKK domain (3.6). Sequence speci ic esonance assignmen s we e made o 166 ou o 206 esidues (80.5%). The p oblems encoun e ed du ing he assignmen p ocedu e is depic ed in Fig 4.1, showing he s ip plo s om amino acid T198-K201 de i ed om HN(CO)CACB and HNCACB. In he s ip plo we could obse e ha i s possible o walk along he p o ein backbone only by using he Cα connec i i ies because Cβ [in posi ion (i) and (i-1)] a e missing o hese esidues. Bu in his case, i s no possible o unambiguously assign hese esidues based on Cα esonances, since he chemical shi o Cα esonances could ma ch o a ious o he esidues in he amino acid sequence as well. In he p ocess o sequen ial assignmen , always wo chemical shi s we e ma ched, and in case o mul iple possibili ies, we ca y ou pa allel sea ches o each possible connec ion un il one pa h leads o he nea es check poin . DISCUSSIONS 105 Figu e 4.1 S ip plo showing he di icul ies aced du ing esonance assignmen s. S ips o HN(CO)CACB and HNCACB spec a o 2H,13C,15N uni o mly labeled SKK domain (T198- K201). S ips om wo spec a a e shown, co esponding o a single amino acid. Se e al o hese s ips a e placed in a ow o show he sequen ial connec i i ies om each amino acid o he p eceding one. The cohe ence ans e in bo h o hese expe imen s o a pai o consecu i e esidues a e shown below. The a ows indica e he magne iza ion ans e pa hway. The do ed line ep esen s b eak o u he connec i i ies. (x) indica es he peaks which a e nea o noise le el. HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB T198 T198 R199 R199 S200 S200 K201 K201 X CA CB X X CA(i-1) CB(i-1) CA(i-1) CA(i-1) CA CA CA(i-1) CA CB CB(i-1) HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB HN(CO)CACB HNCACB T198 T198 R199 R199 S200 S200 K201 K201 X CA CB X X CA(i-1) CB(i-1) CA(i-1) CA(i-1) CA CA CA(i-1) CA CB CB(i-1) HNCACB HN(CO)CACBHNCACB HN(CO)CACB 106 DISCUSSIONS Because o he la ge size o he p o ein, chemical shi degene acy ( o ex., missing o Cβ chemical shi ) poses a challenging p oblem. To o e come his p oblem, we u ilized he 3D-15N-HSQC-NOESY and 3D-NNH-NOESY spec a o assign hose esidues whe e he chemical shi s o Cα o Cβ a e missing by obse ing he NOE c oss peaks. In a NOESY spec a, he c oss peaks indica e which p o ons a e close in space and also co ela es p o ons which a e dis an in he amino acid sequence bu close in space due o he e ia y s uc u e. The in ensi y o he NOE is in i s app oxima ion p opo ional o 1/ 6, wi h being he dis ance be ween he p o ons. The p esence o a NOE peak is di ec e idence ha 2 p o ons a e wi hin 5 Angs oms (5 Å) h ough space. Assignmen o esonances is achie ed by de ec ing he sequen ial connec i i ies be ween amide p o ons in he bonding ne wo k be ween nuclei. Suppo ing in o ma ion o he sequen ial connec i i ies which was ob ained om he NOESY spec a is ep esen ed as a s ip plo in Fig 4.2. By using he NOESY spec a, we we e able o ob ain he sequen ial connec ion o spin sys ems by obse ing he c oss peaks om he amide p o ons o one esidue o he amide, alpha, o be a p o ons o he nex esidue. Howe e , o be su e whe he he NOEs which we e obse ed a e o sequen ial connec i i y o no , we e e back o HNCACB and obse e he Cα chemical shi , combining bo h o hese allow s ong peak associa ion o T198-R199-S200- K201. Though using TROSY iple- esonance expe imen s combined wi h 3D-NOESY expe imen s, we s ill we e no able o assign all he esonances. The main di icul y was he missing esonances o some o he esidues and degene a e esonances o some o he , o which he e was no NOESY c oss peaks as well. The big s e ch which was no assigned in SKK domain lied in he egion o S1 domain om esidue L183-V197 which cons i u es he β4 and β5 shee o S1 mo i . The possible easons o he missing esonances could be c oss-peak o e lap, incomple e deu e on amide exchange o exchange peak b oadening o wi h p o ein dynamics, whe e changes in mobili y o p o ein occu s o e a wide ime scale. I migh be possible ha he esidues a e no locked in a mo e igid con o ma ion leading o he b oadening o he esonance. I could also be possible ha du ing he cou se o measu emen s, p o ein deg ada ion occu s which leads o a educ ion in he signal due o sample ins abili y which will hen a ec he line shape. In some expe imen s, low signal o noise a io also hinde ed us o assign hose peaks, which we e nea o he noise le el. DISCUSSIONS 107 Figu e 4.2 NOESY S ip plo s o 2H,13C,15N uni o mly labeled SKK domain o ace he sequen ial connec i i ies. The c oss peaks a e indica ed by connec ing lines. The s ips show ha esidues T198-K201 make a se ies o backwa d and o wa d NOEs, indica ing ha his egion could be sequen ially connec ed; (x) indica es he peaks o long ange NOEs. T198 R199 S200 K201 3D-NNH-NOESY X S200.HN K201.HN R199.HN T198 R199 S200 K201 3D-NNH-NOESY X S200.HN K201.HN R199.HN T198 R199 S200 K201 3D-15N-HSQC-NOESY K201.HN S200.HN R199.HN T198.HN T198 R199 S200 K201 3D-15N-HSQC-NOESY K201.HN S200.HN R199.HN T198.HN 114 SUMMARY 5 Summa y In phage λ, an i e mina ion is ini ia ed by he λ-encoded N p o ein which ec ui s a numbe o hos p o eins called Nus ac o s. Se e al o hese hos p o eins which a e essen ial o e ec i e ansc ip ion e mina ion and an i e mina ion ha e been iden i ied, hese includes NusA, NusB, NusE and NusG. The subjec o his wo k is mainly ocused on cha ac e iza ion o in e ac ions be ween a ious Nus hos ac o s in he e mina ion and an i e mina ion sys em by NMR spec oscopy. Like N p o ein, Nun also equi es addi ional hos ac o s o e icien e mina ion. I has been epo ed al eady ha NusA in e ac s wi h C- e minal egion o Nun and also ha Nun binding o NusA equi es NusA a 1 egion. On he basis o hese esul s, 1H,15N-HSQC spec a we e eco ded o moni o he in e ac ion be ween HK022-Nun and NusA a 1. NMR i a ion expe imen s be ween Nun and NusA clea ly showed a lack o chemical shi pe u ba ions. The e o e, i can be concluded ha he e is no in e molecula in e ac ion be ween Nun and NusA a 1. Up o da e, no in o ma ion abou he in e ac ion be ween Nun and NusG as well as Nun and NusB a e known. Ti a ion expe imen s be ween Nun and bo h Nus ac o s, ha e also e ealed no di ec in e ac ion. Al oge he , i can be deduced ha he e migh be no di ec in e ac ion be ween Nun and NusA a 1, and NusG, and NusB. The NusA ansc ip ion elonga ion p o ein, which binds nu si e RNA, con ains sequences co esponding o he S1 and KH classes o iden i ied RNA binding domains. To gain comp ehensi e insigh s in o binding su ace on SKK domain upon nu RNA binding, backbone esonances o SKK domain was assigned using sequen ial Cα, Cβ and CO chemical shi in o ma ion de i ed om an a ay o TROSY based iple- esonance expe imen s. Wi h i ually comple e backbone assignmen (80.5 %) o he SKK domain i was possible o cha ac e ize he in e ac ion be ween SKK domain and λ nu L RNA by NMR i a ion expe imen s. Signi ican chemical shi changes obse ed on SKK domain upon addi ion o unlabeled λ nu L RNA, had e lec ed a di ec in e ac ion. Mapping o chemical shi pe u ba ions on SKK domain e ealed ha he RNA binding in e ace is mainly loca ed in he KH domains. The esul s implied a sequence-speci ic RNA binding. SUMMARY 115 In he ee s a e, NusA canno bind o RNA. Once α-CTD o RNA polyme ase is bound o NusA he RNA binding inhibi ion is eleased. A di ec in e ac ion be ween α-CTD and NusA a 2 ha e been epo ed and he e o e NusA a 2 could be a p ime candida e o inhibi ing he RNA binding o NusA. To u he e alua e he au oinhibi ion e ec o NusA a 2 on SKK domain, i a ions be ween NusA a 2 and SKK domain ha e been pe o med. Upon NusA a 2 binding, no able chemical shi changes we e obse ed in he KH1 egion o SKK domain. The esidues which we e a ec ed on binding o NusA a 2 we e also a ec ed du ing he SKK and λ nu L i a ion expe imen s. The esul s a e in good ag eemen wi h he p oposed idea ha NusA a 2 possibly occludes he RNA binding domains o NusA. To in es iga e he e ec o α-CTD on RNA binding by NusA, i a ion o he complex con aining SKK domain and NusA a 2 by g adually adding an inc eased mola a io o α-CTD ha e been ca ied ou . On addi ion o α-CTD, i was clea ly obse ed ha α-CTD displaced NusA a 2 om he complex sugges ing ha he inhibi ion o RNA binding by NusA a 2 could be eleased by α-CTD. 116 ZUSAMMENFASSUNG 6 Zusammen assung Im Phagen λ wi d die An i e mina ion du ch das λ-codie e N P o ein ini iie , das eine Vielzahl on Wi sp o einen, die sogenann en Nus Fak o en, ek u ie . Bishe sind nu einige on diesen Wi sp o einen, die ü eine e izien e Te mina ion und An i e mina ion de T ansk ip ion wich ig sind, iden i izie . Dazu gehö en NusA, NusB, NusE und NusG. Gegens and diese A bei wa die Cha ak e isie ung on möglichen Wechselwi kungen zwischen den e schiedenen Nus Wi s ak o en im Te mina ions- und An i e mina ions sys em mi Hil e on NMR Spek oskopie. Ebenso wie das N P o ein benö ig auch Nun zusä zliche Wi s ak o en ü eine unk ionie ende Te mina ion. Bishe wu de nu ge unden, dass NusA mi de C- e minalen Region on Nun in e agie , wobei ü die Bindung on Nun an NusA die NusA a 1 Region benö ig wi d. Da au au bauend wu de mi Hil e on 1H,15N-HSQC Spek en die Wechselwi kung zwischen HK022-Nun und NusA a 1 un e such . Dabei konn en keine lei Ve ände ungen de chemischen Ve schiebung wäh end de Ti a ion beobach e we den. Folglich inde keine In e ak ion zwischen NusA a 1 und Nun s a . Übe die Wechselwi kung zwischen Nun und NusG ode NusB gib es bis je z noch keine In o ma ionen. Die in diese A bei du chge üh en Ti a ionss udien mi Nun und diesen beiden Nus Fak o en zeig en ebenso keine di ek en In e ak ionen. Basie end au den du chge üh en Expe imen e kann ge olge we den, dass keine di ek en Wechselwi kungen zwischen Nun und NusA a 1, NusG ode NusB o handen sind. De T ansk ip ions-Elonga ions ak o NusA, de die nu RNA binde , en häl Be eiche, die zu de Klasse de S1 und KH homologen Domänen gehö en und als RNA Bindungsdomänen iden i izie wu den. Um einen de aillie en Einblick in die Bindungs läche de SKK Domänen bei de Bindung an die nu RNA zu bekommen, e olg e eine sequenzspezi ische Zuo dnung de Amid esonanzen des P o ein ückg a s. Die as olls ändige Zuo dnung (80,5%) e möglich e nun die Un e suchung de Wechselwi kung zwischen de SKK Domäne und de nu RNA mi Hil e on NMR Spek oskopie. ZUSAMMENFASSUNG 117 Bei de Ti a ion de SKK Domäne mi de unma kie en λ nu L RNA konn en deu liche Ve ände ungen de chemischen Ve schiebung beobach e we den, die au eine di ek e In e ak ion schließen lassen. Eine Visualisie ung de Ve ände ungen de chemischen Ve schiebung au de Obe läche on NusA SKK zeig , dass die RNA Bindungs läche haup sächlich im Be eich de beiden KH Domänen zu inden is . Dies deu e somi au eine sequenzspezi ische RNA Bindung hin. NusA kann im eien zus and keine RNA binden. E s du ch die Bindung an die α-CTD de RNA polyme ase wi d diese Selbs blockade au gehoben. Da Expe imen e au eine In e ak ion zwischen de α-CTD und NusA a 2 hindeu e en, könn e mögliche weise NusA a 2 die RNA Bindungss elle blockie en. Um diesen au oinhibi o ischen E ek zu un e suchen, wu de NusA a 2 zu de SKK Domäne i ie . Dabei konn e ü diejenigen Aminosäu en eine Ve ände ung de chemischen Ve schiebung beobach e we den, die auch an de Bindung de RNA be eilig sind, so dass hie du ch die Hypo hese de Selbs blockade du ch NusA a 2 bes ä ig we den konn e. Eine Ti a ion des Komplexes aus NusA a 2 und de SKK Domäne mi α-CTD zeig e, dass du ch die Zugabe on α-CTD NusA a 2 on de RNA Bindungss elle e d äng wi d und bes ä ig dami ebenso die au oinhibi o ische Rolle on NusA a 2. 118 ABBREVIATIONS 7 Abb e ia ions ε mola ex inc ion coe icien 1D one dimensional 2D wo dimensional 3D h ee dimensional aa amino acid A280 abso p ion a 280 nm APS ammonium pe oxy disul a e ARM a ginine ich mo i a 1 acidic epea 1 a 2 acidic epea 2 ATP adenosine-5'- iphospha e bp base pai CSA chemical shi aniso opy CTD ca boxy e minal domain CV column olume Da dal on DSS 2,2-dime hyl-2-silapen ane-5-sul onic acid DD dipole-dipole DNA deoxy ibonucleic acid DNase I deoxy ibonuclease I DTT di hio h ei ol EMSA elec opho e ic mobili y-shi assay E. coli Esche ichia coli EDTA e hylenediamine e aace ic acid FPLC as p o ein liquid ch oma og aphy Fig igu e h hou HK022 HongKong 022 HPLC high pe o mance liquid ch oma og aphy HSQC he e onuclea single quan um cohe ence INEPT Insensi i e Nuclei Enhancemen by Pola iza ion T ans e IPTG isop opyl-β-D- hiogalac opy anoside kDa kilo Dal on KDdissocia ion cons an L li e LB Lu ia Be ani medium mRNA messenge RNA µ mic o (10-6) µm mic omola (µmol/L) m milli (10-3) mAU milli-Abso p ion Uni ABBREVIATIONS 119 mL millili e mM millimola (mmol/L) M9 minimal medium min minu e M mola (mol/L) MWCO molecula weigh cu o nm nanome e NMR nuclea magne ic esonance NOE nuclea O e hause e ec NOESY nuclea O e hause e ec spec oscopy n nucleo ide NTD amino e minal domain NTPs nucleoside iphospha es NS numbe o scans Nus N-u iliza ion subs ance nu N-u iliza ion OD600 op ical densi y a 600 nm PAGE polyac ylamide gel elec opho esis PEG polye hylene glycol PCR polyme ase chain eac ion PDB p o ein da a bank PMSF phenylme hylsul onyl lou ide ppm pa s pe million pu polyme ase u iliza ion RNase ibonuclease RNA ibonucleic acid u ho-u iliza ion pm o a ions pe minu e RT oom empe a u e SDS sodium dodecyl sul a e SDS-PAGE sodium dodecyl sul a e-polyac ylamide gel elec opho esis sec second SKK S1+KH1+KH2 SW spec al wid h SF0 spec ome e equency used SAR S uc u e Ac i i y Rela ionships TEMED N-,N-,N´-,N´-Te ame hylenee hyldiamine TEV obacco e ch i us TD o al numbe o da a poin s TFA i luo oace ic acid TPPI ime p opo ional phase inc emen a ion T is is(hyd oxyme hyl)aminome hane TROSY T ans e se Relaxa ion Op imized Spec oscopy sp ansc ip ion s op poin s TS2 ace elemen solu ion 2 U uni / olume by olume w/ weigh by olume 120 REFERENCES 8 Re e ences Agnieszka S.P., Ba ba a S., An osiewicz A.H., Weg zyn G and Thomas M.S. (2003) Gene ic analysis o bac e iophage lambda-N dependen an i e mina ion sugges s a possible ole o he RNA polyme ase alpha subuni in acili a ing speci ic unc ions o NusA and NusE. A ch Mic obiol. 180, 161-168 Ahmad Z and Huang K.P. (1981) Dephospho yla ion o abbi skele al muscle glycogen syn hase (phospho yla ed by cyclic AMP-independen syn hase kinase 1) by phospha ases. J Biol Chem. 256, 757-760 A che S.J., Iku a M., To chia D.A and Bax A. (1991) An al e na i e 3D NMR echnique o co ela ing backbone 15N wi h side chain Hb esonances in la ge p o eins. J Magn Reson. 95, 636-641 A n ig K.B., Pennell S., Gopal B., Cols on M.J. (2004) A high-a ini y in e ac ion be ween NusA and he n nu si e in Mycobac e ium ube culosis. P oc Na l Acad Sci U S A. 101, 8325-8330 Ba ik S., Ghosh B., Whalen W., Lazinski D and Das A. (1987) An an i e mina ion p o ein engages he elonga ing ansc ip ion appa a us a a p omo e - p oximal ecogni ion si e. Cell. 50, 885-899 Ba khuijsen H., De Bee W., Bo ee M.M.J and an O mond D. (1985) Re ie al o equencies, ampli udes, damping ac o s, and phases om ime domain signals using a linea leas squa es p ocedu e. J Magn Reson. 61, 465-481 Bax A and Iku a M. (1991) An e icien 3D NMR echnique o co ela ing he p o on and 15N backbone amide esonances wi h he a-ca bon o he p eceding esidue in uni o mly 15N/13Cen iched p o eins. J Biomol NMR. 1, 99-104 Be g K.L., Squi es C and Squi es C.L. (1989) Ribosomal RNA ope on an i e mina ion. Func ion o leade and space egion boxB-boxA sequences and hei conse a ion in di e se mic o-o ganisms. J Mol Biol. 209, 345–358 REFERENCES 121 Bodenhausen G and Da id J.R. (1980) Na u al abundance ni ogen-15NMR by enhanced he e onuclea spec oscopy. Chem Phys Le . 69, 185-189 Bu gess R.R., E ickson B., Gen y D., G isko M and Hage D. (1987) RNA polyme ase and he egula ion o ansc ip ion. NewYo k: Else ie , pp. 3-15 Bu o a E., Hung S.C., Chen J., Cou D.L., Zhou J.G., Mogilni skiy G., Go esman M.E. (1999) Esche ichia coli nusG mu a ions ha block ansc ip ion e mina ion by coliphage HK022 Nun p o ein. Mol Mic obiol. 31, 1783–1793 Campbell A. (1994) Compa a i e molecula biology o lambdoid phages. Annu Re Mic obiol. 48, 193-222 Ca anagh J., Fai b o he W.J., Palme A.G and Skel on N.J. (1996) P o ein NMR Spec oscopy: P inciples and P ac ice. Academic P ess, Inc., San Diego Ch is ophe A.L., Jona han M.M and Je ey W.P. (2004) Theo y and applica ions o NMR based sc eening in pha amaceu ical esea ch. Chem Re . 104, 3641-3675 Clubb R.T., Thanabal V and Wagne G. (1992a) A cons an - ime 3-dimensional iple- esonance pulse scheme o co ela e in a esidue H-1(N), N-15, and C-13(') chemical shi s in N-15-C-13-labeled p o eins. J Magn Reson. 92, 213-217 Clubb R.T., Thanabal V and Wagne G. (1992b) A new 3D HN(CA)HA expe imen o ob aining inge p in HN-Halpha peaks in 15N- and 13C-labeled p o eins. J Biomol NMR. 2, 203-210 Cou D.L., Oppenheim A.B., and Adhya S.L. (2007) A new look a bac e iophage lambda gene ic ne wo ks. J Bac e iol. 189, 298-304 Das A. (1992) How he phage lambda N gene p oduc supp esses ansc ip ion e mina ion: communica ion o RNA polyme ase wi h egula o y p o eins media ed by signals in nascen RNA. J Bac e iol. 174, 6711–6716 Das A. (1993) Con ol o ansc ip ion e mina ion by RNA-binding p o eins. Annu Re Biochem. 62, 893-930 122 REFERENCES Das A., Pal M., Mena J.G., Whalen W., Wolska K., C ossley R., Rees W., Hippel P.Y., Cos an ino N., Cou D., Mazzulla M., Al ie i A.S., By d A., Cha opadhay S., De i o, B and Ghosh B. (1996) Componen s o mul ip o ein-RNA complex ha con ols ansc ip ion elonga ion in E. coli phage lambda. Me hods Enzymol. 274, 374-402 DeVi o J and Das A. (1994) Con ol o ansc ip ion p ocessi i y in phage λ Nus ac o s s eng hen he e mina ion- esis an s a e o RNA polyme ase induced by N an i e mina o . P oc Na l Acad Sci U S A. 91, 8660-8664 Dhillon E.K., Dhillon T.S., Lam Y.Y and Tsang A.H. (1980) Tempe a e coliphages: classi ica ion and co ela ion wi h habi a s. Appl En i on Mic obiol. 39, 1046-1053 Dhillon T.S., Dhillon E.K and Lai A.N. (1981) Gene ic ecombina ion be ween phage HK022, lambda, and phi 80. Vi ology. 109, 198–200 Dodd I.B., Shea win K.E and Egan B.J. (2005) Re isi ed gene egula ion in bac e iophage λ. Cu Opin Gene De . 15, 145-152 Domb oski A.J., Wal e W.A and G oss C.A. (1993) Amino- e minal amino acids modula e sigma- ac o DNA-binding ac i i y. Genes De . 7, 2446-2455 Eisenmann A., Schwa z S., P asch S., Schweime K and Rösch P. (2005) The E. coli NusA ca boxy- e minal domains a e s uc u ally simila and show speci ic RNAP and lambda N in e ac ion. P o ein Sci. 14, 2018-2029 Engelke J and Ru e jans H. (1995) Sequen ial p o ein backbone assignmen s using an imp o ed 3D-HN(CA)CO pulse scheme. J Magn Reson. Se ies B. 109, 318-322. E ns R.R., Bodenhausen B and Wokaun A. (1992) P inciples o Nuclea magne ic esonances in one o wo dimensions. Ox o d Uni e si y P ess Fabe C., Schä p M., Becke T., S ich H and Rösch P. (2001) The s uc u e o he coliphage HK022 Nun p o ein−lambda−phage boxB RNA complex. Implica ions o he mechanism o ansc ip ion e mina ion. J Biol Chem. 276, 32064−32070 Feeney J., Ba chelo J.G., Alb and J.P and Robe s G.C.K. (1979) The e ec s o in e media e exchange p ocesses on he es ima ion o equilib ium cons an s by NMR. REFERENCES 123 J Magn Reson. 33, 519-529 Fe nandez C and Wide G. (2003) TROSY in NMR s udies o he s uc u e and unc ion o la ge biological mac omolecules. Cu Opin S uc Biol. 13, 570-580 Fesik S.W and Zuide weg E.R.P. (1988) He e onuclea Th ee-Dimensional NMR Spec oscopy. A S a egy o he Simpli ica ion o Homonuclea Two-Dimensional NMR Spec a. J Magn Reson. 78, 588-593 Fielding L. (2007) NMR me hods o he de e mina ion o p o ein-ligand dissocia ion cons an s. P og ess in Nuclea Magne ic Resonance Spec oscopy. 51, 219-242 F ase C.M., Gocayne J.D., Whi e O., Adams M.D., Clay on R.A., Fleischmann R.D., Bul C.J., Ke la age A.R., Su on G and Kelley J.M. (1995). The minimal gene complemen o Mycoplasma geni alium. Science. 270, 397–403 F ei elde Da id. (2001) Uni e si y o Cali o nia, San Diego. Molecula biology. Second edi ion. Jones and Ba le Publishe s, Inc., U.S.A. F iedman D.I., Baumann M.F., Ba on L.S. (1976) Coope a i e e ec s o bac e ial mu a ions a ec ing λN gene exp ession: Isola ion and cha ac e iza ion o a nusB mu an . Vi ology. 73, 119 127 F iedman D.I., Olson E.R., Johnson L.L., Alessi D and C a en M.G. (1990) T ansc ip ion-dependen compe i ion o a hos ac o : The unc ion and op imal sequence o he phage λ boxA ansc ip ion an i e mina ion signal. Genes De . 4, 2210-2222 F iedman D.I and Cou D.L. (1995) T ansc ip ion an i e mina ion: he lambda pa adigm upda ed. Mol Mic obiol. 18, 191-200 F iedman D.I and Cou D.L. (2001) Bac e iophage lambda: ali e and well and s ill doing i s hing. Cu Opin Mic obiol. 4, 201-207 F ied ich M.S. (1995) A Model- ee algo i hm o he emo al o baseline a i ac s. J Biomol NMR. 5, 147-153 Ga be M.E., Wei P., Kewal Ramani V.N., Mayall T.P., He mann C.H, e al. (1998) The in e ac ion be ween HIV-1 Ta and human cyclin T1 equi es zinc and a c i ical cys eine esidue ha is no conse ed in he mu ine CycT1 p o ein. 130 REFERENCES si e may egula e an i e mina ion. J Mol Biol. 236, 217-228 Pellacchia M., Mon gome y D.L., S e ens S.Y., Vande Kooi C.W., Feng H.P., Gie asch L.M and Zuide weg E.R. (2000) S uc u al insigh s in o subs a e binding by he molecula chape one DnaK. Na S uc Biol. 7, 298-303 Pe ushin K. (2000) Impac o ans e se elaxa ion op imized spec oscopy (TROSY) on NMR as a echnique in s uc u al biology. Q Re Biophys. 33, 161-197 Pe ushin K., Riek R., Wide G and Wü h ich K. (1997) A enua ed T2 elaxa ion by mu ual cancella ion o dipole-dipole coupling and chemical shi aniso opy indica es an a enue o NMR s uc u es o e y la ge biological mac omolecules in solu ion. P oc Na l Acad Sci U S A. 94, 12366-12371 Pio o M., Saudek V and Sklena V. (1992) G adien - ailo ed exci a ion o single-quan um NMR spec oscopy o aqueous solu ions. J Biomol NMR. 2, 661-665. P asch S., Schwa z S., Eisenmann A., Wöh l B.M., Schweime K and Rösch P. (2006) In e ac ion o he in insically uns uc u ed phage λ N p o ein wi h Esche ichia coli NusA. Biochemis y. 45, 4542-4549 P asch S., Ju k M.A.W., Washbu n R.S., Go esman M.E., Wöh l B.M and Rösch P. (2008) E. coli NusA ecognizes phage λ nu space RNA sequences. In e ision. P ess W.H., Teukolsky S.A., Ve e ling W.T and Flanne y B.P. (1992) Nume ical ecipes in C 2nd ed. New Yo k: Camb idge Uni e si y P ess P ashne M and Gann A. (2002) Genes and signals. Cold sp ing ha bo , New Yo k, Cold Sp ing Ha bo Labo a o y P ess P ashne M. (1992) A gene ic swi ch:Phage lambda and highe o ganisms. Camb idge, MA: Blackwell Sci. 2nd edi ion. Rajagopal P., Waygood E.B., Reize J., Saie M.H and Kle i R.E. (1997) Demons a ion o p o ein-p o ein in e ac ion speci ici y by NMR chemical shi mapping. P o ein Sci. 6, 2624-2627 Rees W.A., Wei zel S.E., Yage T.D., Das A and on Hippel P.H. (1996) Bac e iophage lambda N p o ein alone can induce ansc ip ion an i e mina ion in i o. REFERENCES 131 P oc Na l Acad Sci U S A. 93, 342-346 Rhodius V.A and S ephen Busby J.W. (1998) Posi i e ac i a ion o gene exp ession. Cu Opin Mic obiol. 1, 152-159 Riek R., Pe ushin K and Wü h ich K. (2000) TROSY and CRINEPT: NMR wi h la ge molecula and sup amolecula s uc u es in solu ion. T ends Biochem Sci. 25, 462-468 Robe C.T., Hassan K.S., Shan e i S., Da id J.A., C aig A.B., John L.M and B ian G.F. (2005) Au o-induc ion medium o he p oduc ion o [U-15N]- and [U-13C, U-15N]-labelled p o eins o NMR sc eening and s uc u e de e mina ion. P o ein Exp Pu i . 40, 268-278 Robledo R.A and Go esman M.E. (1991) Esche ichia coli mu a ions ha block ansc ip ion e mina ion by phage HK022 Nun p o ein. J Mol Biol. 220, 613–619 Roge W Hend ix. (2003) Bac e iophage genomics. Cu Opin Mic obiol. 6, 506-511 Rosenbe g M., Cou D., Shima ake H., B ady C and Wul D.L. (1978) The ela ionship be ween unc ion and DNA sequence in an in e cis onic egula o y egion in phage lambda. Na u e. 272, 414−423 Samb ook J., F i sch E.F and Mania is M. (1989) Molecula cloning: a labo a o y manual. Sa le M., Schleuche J and G iesinge C. (1999) He e onuclea mul idimensional NMR expe imen s o he s uc u e de e mina ion o p o eins in solu ion employing pulsed ield g adien s. P og ess in Nuclea Magne ic Resonance Spec oscopy. 34, 93-158 Schagge H and Von Jagow G. (1987) T icine−sodium dodecyl−sul a e−polyac ylamide gel elec opho esis o he sepa a ion o p o eins in he ange om 1 o 100 kDa. Anal Biochem. 166, 368−379 Scha p M., S ich H., Schweime K., Boehm M., Ho mann S and Rosch P. (2000) An i e mina ion in bac e iophage λ. The s uc u e o he N36 pep ide-boxB RNA complex. Eu J Biochem. 267, 2397-2408 Schleuche J., Sa le M and G iesinge C. (1993) Cohe ence selec ion by g adien s wi hou signal a enua ion: applica ion o he h ee- 132 REFERENCES dimensional HNCO expe imen . Angew Chem. 105, 1518-1521 Schleuche J., Schwendinge M.G., Sa le M., Schmid P., Schedle zky O., Glase S.J., So ensen O.W and G iesinge C. (1994) A gene al enhancemen scheme in he e onuclea mul idimensional NMR employing pulsed ield g adien s. J Biomol NMR. 4, 301-306 Schweime K. (2000) Meh dimensionale NMR Spek oskopie zu Bes immung de S uk u en des Bi ken pollenalle gens Be 1, des Guilla dia he a Rub edoxins und des [2Fe-2S] Fe edoxins aus Halobak e ium salina ium. Doc o al Disse a ion, Uni e si y o Bay eu h, Bay eu h, Ge many. Sekha T and Ge ha d W. (1996) An op imized 3D NOESY-HSQC. J Magn Reson. B. 112, 200-205 Shuke S.B., Hajduk P.J., Meadows R.P and Fesik S.W. (1996) Disco e ing high-a ini y ligands o p o eins: SAR by NMR. Science. 274, 1531-1534 Sklena V., Pio o M., Leppik R and Saudek V. (1993) G adien - ailo ed wa e supp ession o 1H-15N HSQC expe imen s op imized o e ain ull sensi i i y. J Magn Reson. 102, 241-245 S a es D.J., Habe ko n R.A and Ruben D.J. (1982) A Two-Dimensional nuclea o e hause expe imen wi h pu e abso p ion phase in ou quad an s. J Magn Reson. 48, 286-292 S e en S.Y., Sanke S., Ken C and Zuide weg E.R. (2001) Delinea ion o he allos e ic mechanism o a cy idylyl ans e ase exhibi ing nega i e coope a i i y. Na S uc Biol. 8, 947-952 S udie F.W. (2004) Au o-induc ion o p o ein p oduc ion in inducible T7 exp ession sys ems. Annual Mee ing o he Ame ican C ys allog aphic Associa ion, Chicago, IL, July 17–22 S udie F.W. (2005) P o ein p oduc ion by au o-induc ion in high densi y shaking cul u es. P o ein Exp Pu i . 41, 207-234 Suga I.P and Neumann E (1984) S ochas ic model o elec ic ield-induced memb ane po es- Elec opo a ion. Biophys Chem. 19, 211–25 REFERENCES 133 Sulli an S.L and Go esman M.E. (1992) Requi emen o E. coli NusG p o ein in ac o -dependen ansc ip ion e mina ion. Cell. 68, 989–994 Szalewska-Palasz A., S zelczyk B., He man-An osiewicz A., Weg zyn G and Thomas M.S (2003) Gene ic analysis o bac e iophage lambda-N dependen an i e mina ion sugges s a possible ole o he RNA polyme ase alpha subuni in acili a ing speci ic unc ions o NusA and NusE. A ch Mic obiol. 180, 161-168 Thomas M.R. (1994) Simple, e ec i e clean-up o DNA liga ion eac ion p io o elec o− ans o ma ion o E. coli. Bio echniques. 16, 988−990. Up ain S.M., Kane C.M and Chambe lin M.J. (1997) Basic mechanisms o ansc ip elonga ion and i s egula ion. Annu Re Biochem. 66, 117-172 Van Nuland N.A., K oon G.J., Dijks a K., Wol e s G.K., Scheek R.M and Robilla d G.T. (1993) The NMR de e mina ion o he IIA (m 1) binding si e on Hp o he Esche ichia coli phosphoenol py u a e-dependen phospho ans e ase sys em. FEBS Le . 315, 11-15 Vassylye D.G., Vassylye a M.N., Pe ede ina A., Tahi o T.H and A simo i ch I. (2007) S uc u al basis o ansc ip ion elonga ion by bac e ial RNA polyme ase. Na u e. 448, 157-165 Voe Donald, Voe Judi h and Cha lo e w-P a . Fundamen als o Biochemis y. 2nd edi ion on Hippel P.H. (1998) An in eg a ed model o he ansc ip ion complex in elonga ion, e mina ion and edi ing. Science. 281, 660-665 on Hippel P.H., Rees W.A., Rippe K and Wilson K.S. (1996) Speci ici y mechanisms in he con ol o ansc ip ion. Biophys Chem. 59, 231-246 Von Hippel PH., Pasman Z. (2002) Reac ion pa hways in ansc ip elonga ion. Biophys Chem. 101-102, 401-423 Vuis e G.W and Bax A. (1992) Resolu ion enhancemen and spec al edi ing o uni o mly 13C en iched p o eins by homonuclea b oadband 13C decoupling. J Magn Reson. 98, 428-435 134 REFERENCES Washbu n R.S., Cou D.L and Go esman M.E. (2006) Role o Rnase III binding si e in ansc ip ion e mina ion an lambda nu L by HK022 Nun p o ein. J Bac e iol. 188, 6824-6831 Washbu n R.S., Wang Y and Go esman M.E. (2003) Role o E. coli ansc ip ion- epai coupling ac o M d in Nun-media ed ansc ip ion e mina ion. J Mol Biol. 329, 655–662 Wa nick R.S and Go esman M.E. (1998) Esche ichia coli NusA is equi ed o e icien RNA binding by phage HK022 nun p o ein. P oc Na l Acad Sci U S A. 95, 1546−1551 Wa nick R.S., He ing S.C., Palme A.G and Go esman M.E. (2000) The ca boxyl e minus o phage HK022 Nun includes a no el zinc−binding mo i and a yp ophan equi ed o ansc ip ion e mina ion. Genes De . 14, 731−739 Weisbe g R.A and Go esman M.E. (1999) P ocessi e an i e mina ion. J Bac e iol. 181, 359-367 Weisbe g R.A., Go esman M.E., Hend ix R.W and Li le JW. (1999) Family alues in he age o genomics:Compa a i e analyses o empe a e bac e iophage HK022. Annu Re Gene . 33, 565-602 Whalen W., Ghosh B and Das A. (1988) NusA p o ein is necessa y and su icien in i o o phage λN gene p oduc o supp ess a ho- independen e mina o placed downs eam o nu L. P oc Na l Acad Sci U S A. 85, 2494-2498 Wide G and Wü h ich K. (1999) NMR spec oscopy o la ge molecules and mul imolecula assemblies in solu ion. Cu Opin S uc Biol. 9, 594-601 William R. C and Robe M. K.C. (1994) Two-Dimensional NMR Spec oscopy. Applica ions o chemis s and Biochemis s. Second Edi ion Williamson R.A., Ca M.D., F enkiel T.A., Feeney J and F eedman R.B. (1997) Mapping he binding si e o ma ix me allop o einase on he N- e minal domain o he issue inhibi o o me allop o einases-2 by NMR chemical shi pe u ba ion. Biochemis y. 36, 13882-13889 Wilson C.M. (1983) S aining o p o eins on gels: Compa isons o dyes and p ocedu es. Me hods Enzymol. 91, 236-246 REFERENCES 135 Wisdom G.B. (1997) Molecula weigh de e mina ions using polyac ylamide gel elec opho esis wi h is- icine bu e s. Me hods Mol Biol. 73, 97 -100 Wi ekind M and Muelle L. (1993) HNCACB, a High-sensi i i y 3D NMR expe imen o co ela e amide-p o on and ni ogen esonances wi h he alpha and be a ca bon esonances in p o eins. J Magn Reson. 101, 201-205 Wo bs M., Bou enko G.P., Ba unik H.D., Hube R and Wahl M.C. (2001) An ex ended RNA binding su ace h ough a ayed S1 and KH domains in ansc ip ion ac o NusA. Mol Cell. 7, 1177-1189 Wü h ich K., Salzmann M., Pe ushin K., Wide G., Senn H. (1998) TROSY in iple- esonance expe imen s: New pe spec i es o sequen ial NMR assignmen o la ge p o eins. P oc Na l Acad Sci U S A. 95, 13585-13590 Zheng C and F iedman D.I. (1994) Reduced Rho-dependen ansc ip ion e mina ion pe mi s NusA-independen g ow h o Esche ichia coli. P oc Na l Acad Sci U S A. 91, 7543-7547 Zhou P., Lugo skoy A.A and Wagne G. (2001) A solubili y-enhancemen ag (SET) o NMR s udies o poo ly beha ing p o eins. J Biomol NMR. 20, 11-4 Zhou Y., Mah T.F., G eenbla J and F iedman D.I. (2002) E idence ha he KH RNA-binding domains in luence he ac ion o he E. coli NusA p o ein. J Mol Biol. 318, 1175-1188 Zuide weg E.R., Hame s L.F., Rollema H.S., de B uin S.H and Hilbe s C.W. (1981) 31P NMR s udy o he kine ics o binding o myo-inosi ol hexakisphospha e o human hemoglobin-obse a ion o as -exchange kine ics in high a ini y sys ems. Eu J Biochem. 118, 95-104. Zuide weg E.R. (2002) Mapping p o ein-p o ein in e ac ions in solu ion by NMR spec oscopy. Biochemis y. 41, 1-7 136 APPENDIX 9 Appendix 9.1 Sc ip o KD i ing clea ; global Da a; qz_1H = 700.13; qz_15N = 70.5; % qz_1H = 1.0; % qz_15N = 1.0; ilename_SHIFT = sp in ('../ ex .da a') p = open( ilename_SHIFT) shi da a = scan ( p,'%g %g',[2 in ]) close( p) ilename_CONC = sp in ('../ a io.da ') p = open( ilename_CONC) conc_da a = scan ( p,'%g %g',[2 in ]) close( p) shi da a = shi da a' conc_da a = conc_da a' a io = conc_da a(:,1) conc = conc_da a(:,2) conc = conc .* 1000.0 p o on = shi da a(:,1) p o on = p o on - p o on(1); p o on = p o on * qz_1H; ni ogen = shi da a(:,2) ni ogen = ni ogen(1) - ni ogen ni ogen = ni ogen * qz_15N; no m_shi = sq (p o on .* p o on + ni ogen .* ni ogen) % plo ( a io, no m_shi , ' o') Da a = ze os(leng h(conc), 3); Da a(:,1) = conc Da a(:,2) = a io Da a(:,3) = no m_shi a = Da a(:,2) b = Da a(:,3) plo (a, b, ' o') hold on global Plo handle Plo handle = plo (a, b, 'E aseMode','xo '); k = [10 1]; ace = 0; % I his is nonze o, in e media e s eps in he solu ion a e displayed. ol = .00001; % This is he e mina ion ole ance. k = minsea ch('kd_ i _ unc',k,[ ace ol]); k APPENDIX 137 9.2 Nucleo ide sequence o HK022 Nun a gc ga gg gaaaaaaacca a g gaacccgga agcggccagaaccgcaaag g M L M V K K T I Y V N P D S G Q N R K V agcga cgcggcc gaccagccgcga cgccgccgca gcgcgc gggaaaaacgca S D R G L T S R D R R R I A R W E K R I gcg a gcgc gaaaaacggcg gaccccgggc aacgcga ga ga ggcccggaa A Y A L K N G V T P G F N A I D D G P E a aaaa aacgaaga ccga gga aaag gga aaagcgc ggcgaccccg ccg Y K I N E D P M D K V D K A L A T P F P cgcga g ggaaaaaa gaaga gaaaaa a gaaga g ga gca cgcg gg gaac R D V E K I E D E K Y E D V M H R V V N ca gcgca cagcgcaacccgaacaaaaaa ggagc H A H Q R N P N K K W S Physical/Chemical pa ame e s o HK022 Nun Numbe o amino acids 112 Molecula weigh 13107.8 Theo e ical pI 9.52 Ex inc ion coe icien 16960 Ins abili y index 41.05 ----------------------------------------------------------------------------------------------------------------- 9.3 Nucleo ide sequence o Nun CTD ggcgcga gggcg gaccccgggc aacgcga ga ga ggcccggaa a aaaa G A M G V T P G F N A I D D G P E Y K I aacgaaga ccga gga aaag gga aaagcgc ggcgaccccg ccgcgcga g g N E D P M D K V D K A L A T P F P R D V gaaaaaa gaaga gaaaaa a gaaga g ga gca cgcg gg gaacca gcgca E K I E D E K Y E D V M H R V V N H A H cagcgcaacccgaacaaaaaa ggagc Q R N P N K K W S Physical/Chemical pa ame e s o Nun CTD Numbe o amino acids 69 Molecula weigh 7892.7 Theo e ical pI 5.21 Ex inc ion coe icien 8480 Ins abili y index 30.50 ------------------------------------------------------------------------------------------------- 138 APPENDIX 9.4 Nucleo ide sequence o NusA (1-495) a gaacaaagaaa c ggcgg gg ggaagcgg gagcaacgaaaaagcgc gccgcgc M N K E I L A V V E A V S N E K A L P R gaaaaaa gaagcgc ggaaagcgcgc ggcgaccgcgaccaaaaaaaaa a gaa E K I F E A L E S A L A T A T K K K Y E caggaaa ga g gcgcg gcaga ga cgcaaaagcggcga ga acc cgc Q E I D V R V Q I D R K S G D F D T F R cgc ggc gg gg gga gaag gacccagccgaccaaagaaa accc ggaagcggcg R W L V V D E V T Q P T K E I T L E A A cgc a gaaga gaaagcc gaacc gggcga a g ggaaga caga gaaagcg g R Y E D E S L N L G D Y V E D Q I E S V acc ga cgca accacccagaccgcgaaacagg ga g gcagaaag gcgcgaa T F D R I T T Q T A K Q V I V Q K V R E gcggaacgcgcga gg gg gga cag cgcgaaca gaaggcgaaa a accggc A E R A M V V D Q F R E H E G E I I T G g gg gaaaaaag gaaccgcga aaca agcc gga c gggcaacaacgcggaagcg V V K K V N R D N I S L D L G N N A E A g ga c gcgcgaaga a gc gccgcgcgaaaac cgcccgggcga cgcg gcgc V I L R E D M L P R E N F R P G D R V R ggcg gc g a agcg gcgcccggaagcgcgcggcgcgcagc g g gacccgcagc G V L Y S V R P E A R G A Q L F V T R S aaaccggaaa gc ga gaac g cgca gaag gccggaaa ggcgaagaag g K P E M L I E L F R I E V P E I G E E V a gaaa aaagcggcggcgcgcga ccgggcagccgcgcgaaaa gcgg gaaaacc I E I K A A A R D P G S R A K I A V K T aacga aaacgca ga ccgg gggcgcg gcg gggca gcgcggcgcgcgcg gcag N D K R I D P V G A C V G M R G A R V Q gcgg gagcaccgaac gggcggcgaacgca ga a g gc g ggga ga aacccg A V S T E L G G E R I D I V L W D D N P gcgcag g ga aacgcga ggcgccggcgga g ggcgagca g gg gga gaa A Q F V I N A M A P A D V A S I V V D E ga aaaca acca gga a gcgg ggaagcgggcaacc ggcgcaggcga ggccgc D K H T M D I A V E A G N L A Q A I G R aacggccagaacg gcgcc ggcgagccagc gagcggc gggaac gaacg ga gacc N G Q N V R L A S Q L S G W E L N V M T g gga ga c gcaggcgaaaca caggcggaagcgca gcggcga ga acc acc V D D L Q A K H Q A E A H A A I D T F T aaa a c gga a ga gaaga gcgaccg gc gg ggaagaaggc agcacc K Y L D I D E D F A T V L V E E G F S T c ggaagaac ggcg a g gccga gaaagaac gc ggaaa gaaggcc gga gaa L E E L A Y V P M K E L L E I E G L D E ccgaccg ggaagcgc gcgcgaacgcgcgaaaaacgcgc ggcgacca gcgcaggcg P T V E A L R E R A K N A L A T I A Q A caggaagaaagcc gggcga aacaaaccggcgga ga c gc gaacc ggaaggcg g Q E E S L G D N K P A D D L L N L E G V ga cgcga c ggcg aaac ggcggcgcgcggcg g gcaccc ggaaga c ggcg D R D L A F K L A A R G V C T L E D L A APPENDIX 139 gaacagggca ga ga c ggcgga a gaaggcc gaccga gaaaaagcgggcgcg E Q G I D D L A D I E G L T D E K A G A c ga a ggcggcgcgcaaca gc gg ggcga gaagcg L I M A A R N I C W F G D E A Physical/Chemical pa ame e s o NusA (1-495) Numbe o amino acids 495 Molecula weigh 54870.9 Theo e ical pI 4.53 Ex inc ion coe icien 31065 Ins abili y index 35.15 ----------------------------------------------------------------------------------------------------------------- 9.5 Nucleo ide sequence o NusA a 1 a gaccg gga ga c gcaggcgaaaca caggcggaagcgca gcggcga ga acc M T V D D L Q A K H Q A E A H A A I D T accaaa a c gga a ga gaaga gcgaccg gc gg ggaagaaggc F T K Y L D I D E D F A T V L V E E G F agcaccc ggaagaac ggcg a g gccga gaaagaac gc ggaaa gaaggcc g S T L E E L A Y V P M K E L L E I E G L ga gaaccgaccg ggaagcgc gcgcgaacgcgcgaaaaacgcgc ggcgacca gcg D E P T V E A L R E R A K N A L A T I A caggcgcaggaagaaagcc gggc Q A Q E E S L G Physical/Chemical pa ame e s o NusA a 1 Numbe o amino acids 88 Molecula weigh 9751.8 Theo e ical pI 4.11 Ex inc ion coe icien 2980 Ins abili y index 40.00 -----------------------------------------------------------------------------------------------------------------