scieee Science in your language
[en] (orig)
1
Stability and plasticity of IL-17
expression in TH17 cells
vorgelegt von
Diplom-Ingenieurin
Maria Helen Lexberg
aus Råholt, Norwegen
Von der Fakultät III - Prozesswissenschaften
der Technischen Universität Berlin
zur Erlangung des akademischen Grades
Doktorin der Ingenieurwissenschaften
Dr.-Ing.
genehmigte Dissertation
Promotionsausschuss:
Vorsitzender: Prof. Dr. Leif-Alexander Garbe
Berichter: Prof. Dr. Roland Lauster
Berichter: Prof. Dr. Andreas Radbruch
Tag der wissenschaftlichen Aussprache: 20.9.2010
Berlin 2010
D 83
2
Die vorliegende Arbeit wurde im Zeitraum Mai 2006 bis Juli 2010 in der Gruppe „Cell
Biologyam Deutschen Rheuma-Forschungszentrum unter der Leitung von Herrn Prof.
Dr. rer. nat. Andreas Radbruch angefertigt.
1. Gutachter: Prof. Dr. rer. nat. Roland Lauster
2. Gutachter: Prof. Dr. rer. nat. Andreas Radbruch
Disputation am 20.09.2010
3
Summary
The cytokine IL-17, inter alia produced by TH17 cells, plays an important role in
autoimmune diseases, but also for the clearing of extracellular pathogens and for the
recruitment of neutrophils during infection. Understanding the process, through which
TH cells alter their cytokine-producing potential can provide interesting insights into
effector cell commitment, gene regulation and provide us with important biological
implications for designing therapeutic regimens. So far, very little is known about the
stability and plasticity of the TH17 phenotype.
In order to analyze the stability of IL-17 expression on the single cell level, in
cooperation with Miltenyi Biotec, we have developed an IL-17 secretion assay, which
allows us to isolate viable IL-17-producing TH cells. We show here that IL-17+ TH cells
generated in vitro with the canonical TH17 differentiating signals TGFβ, IL-6 and IL-23
can readily be induced to express IFNγ with concomitant loss of IL-17 expression in
response to IL-12. This conversion of TH17 cells into TH1 cells was T-bet-dependent.
By contrast, IL-17+ TH cells generated in vivo do neither respond to IL-12 with IFNγ
expression nor to IL-4 with IL-4 expression. Transcriptome analysis comparing in vitro
and in vivo generated TH17 cells revealed that in vivo generated TH17 cells do not
express the β2 chain of the IL12R, rendering them refractory to IL-12 signaling.
However, they express a functional IFNγR. As has been demonstrated for naïve TH
cells and for TH2 cells expression of the IL12Rβ2 chain could be induced by IFNγ
restoring susceptibility to IL-12 signaling. Thus, we could demonstrate that in TH17 cells
generated in vivo, IFNγ expression can be induced by the synergistic action of IFNγ
and IL-12. In such cells the master transcription factors RORγt and T-bet were co-
expressed on the single cell level, as were the corresponding effector cytokines IL-17
and IFNγ. It remains to be clarified, however, whether such TH1/17 cells represent a
distinct stable lineage or a transitional state. We also analyzed the epigenetic
imprinting of IL-17+ TH cells and compared it to IFNγ+ TH cells. We identified a region
upstream of il17 that is unmethylated in cells expressing IL-17 and methylated in IFNγ+
TH cells. In addition, in CpG rich regions upstream of rorγt we identified an element,
which was specifically methylated in IL-17-single-positive TH cells and may represent a
putative silencer element.
In conclusion, the high plasticity of TH17 cells could help the immune system to adapt
and eliminate inflammation and infection. Thus, TH1/17 cells could have a physical
advantage through a combined effector repertoire of TH1 and TH17 cells on the single
cell level, which would be worth considering in studies of autoimmune diseases or in
optimization of vaccination strategies.
4
Zusammenfassung
Das Zytokin IL-17, welches unter anderem von TH17 Zellen produziert wird, spielt eine
wichtige Rolle bei Autoimmunerkrankungen sowie bei der Eliminierung von
extrazellulären Pathogenen und der Rekrutierung von Neutrophilen zum
Entzündungsort. Die Kenntnis darüber, wie TH Zellen ihr Potential ändern ein
bestimmtes Zytokin zu produzieren, effnet uns interessante Einblicke in die
Steuerung von Effektor TH Zelldifferenzierung, was wiederum die Entwicklung von
neuartigen therapeutischen Konzepten vorantreibt. Bisher war nicht viel über die
Plastizität und Stabilität von TH17 Zellen bekannt.
Um die Stabilität von TH17 Zellen auf Einzel-Zell-Ebene zu untersuchen, entwickelten
wir in Kooperation mit Miltenyi Biotec einen IL-17 Sekretionsassay, womit wir lebende
IL-17-produzierende TH Zellen isolieren konnten. Wir zeigen hier, dass in TH17 Zellen,
die in vitro mit den bekannten TH17 Differenzierungssignalen TGFβ, IL-6 und IL-23
generiert wurden, hinsichtlich der Produktion des Zytokins IL-17 instabil sind. So
beginnen sie bei Stimulation mit IL-12 IFNγ zu produzieren, während gleichzeitig die IL-
17 Expression verloren geht. Die Konversion von TH17 zu TH1 Zellen verlief T-bet-
abhängig. In vivo generierte TH17 Zellen verhalten sich allerdings stabil. So konnten
diese weder durch IL-12 zur IFNγ Expression, noch durch IL-4 zur IL-4 Expression
angeregt werden. Der Vergleich von in vitro vs in vivo generierten TH17 Zellen in einer
Transkriptomanalyse ergab, dass in vivo generierte TH17 Zellen die β2 Kette des IL12R
nicht exprimieren, was deren Nicht-reaktivität auf den IL-12 Stimulus erklärt. Allerdings
exprimieren sie einen funktionellen IFNγR. Wie schon für naive und TH2 Zellen gezeigt
wurde, konnte auch hier IL12Rβ2 durch IFNγ Stimulus induziert werden. Wir zeigen
daher, dass die IFNγ Expression in in vivo generierte TH17 Zellen durch die
synergistische Aktion von IFNγ und IL-12 induziert wird. Diese Zellen co-exprimieren
die Haupttranskriptionsfaktoren T-bet und RORγt sowie die Zytokine IFNγ und IL-17.
Inwieweit diese TH1/17 Zellen eine stabile TH Zell-Population oder eine Übergangs-
Population darstellen, muss weiter untersucht werden. Die epigenetische Prägung von
IL-17+ und IFNγ+ TH Zellen wurde ebenfalls verglichen. Vorgelagerte Regionen von il17
waren unmethyliert in IL-17+ und methyliert in IFNγ+ TH Zellen. Des weiteren haben wir
in einer CpG-reichen Region die rorc vorgelagert ist, ein mögliches regulatorisches
Element entdeckt, welches nur in IL-17-einzel-positiven TH Zellen methyliert war und
ein putatives Silencer-Element darstellt.
TH17 Zellen könnten durch ihre Plastizität dem Immunsystem helfen sich spezifischen
Umständen anzupassen und dadurch Entzündungen und Infektionen effektiver
eliminieren. Darüber hinaus könnten TH1/17 Zellen durch ihr kombiniertes TH1 und
TH17 Effektor-Repertoire einen Vorteil haben und sollten bei Autoimmunerkrankungen
und bei Optimierung von Vakzinierungs-Konzepten berücksichtigt werden.
Table of Contents
5
1 Table of Contents
2 Abbreviations ........................................................................................................ 7
3 Introduction ..........................................................................................................10
3.1 TH cell memory ..............................................................................................11
3.2 The role of cytokines in host defense ............................................................12
3.3 TH lymphocyte differentiation .........................................................................14
3.3.1 TH1 differentiation ...................................................................................15
3.3.2 TH2 differentiation ...................................................................................15
3.3.3 TH17 differentiation .................................................................................16
3.4 Epigenetic control of TH differentiation ...........................................................17
3.5 TH17 cells in EAE ..........................................................................................19
3.5.1 Function of IL-17 in EAE ........................................................................20
3.6 Project objectives and experimental design ...................................................20
4 Material and methods ...........................................................................................22
4.1 Cell Biology ...................................................................................................22
4.1.1 Mice and cells ........................................................................................22
4.1.2 Cell culture media and buffers ................................................................22
4.1.3 Preparation of a single-cell suspension ..................................................22
4.1.4 Magnetic cells sorting (MACS) ...............................................................22
4.1.5 Flow cytometric analysis and fluorescent activated cell sorting (FACS) ..23
4.1.6 Antibodies used for flow cytometric analysis and cell culture ..................23
4.1.7 Isolation of CD4+ and CD4+CD62L+ TH lymphocytes ..............................24
4.1.8 Cell culture .............................................................................................25
4.1.9 Mitogenic re-stimulation and intracellular cytokine staining ....................25
4.1.10 Isolation of viable cytokine-secreting TH cells .........................................26
4.2 Murine inflammation model ...........................................................................28
4.2.1 Experimental Autoimmune Encephalomyelitis ........................................28
4.3 Molecular Biology ..........................................................................................29
4.3.1 Real-time PCR .......................................................................................29
4.3.2 Microarray analysis ................................................................................30
4.3.3 Bisulfite-based cytosine methylation analysis .........................................31
5 Results .................................................................................................................33
5.1 TH1 and TH2 cells cannot be converted into TH17 cells ..................................33
Table of Contents
6
5.1.1 IFNγ producing TH1 cells generated in vivo are refractory to TH17
inducing signals ................................................................................................... 35
5.2 Development of a murine IL-17 cytokine secretion assay ............................. 36
5.3 Stability of IL-17 expression in in vitro generated TH17 cells ......................... 38
5.4 In vitro generated TH17 cells can cross-differentiate into TH1 and TH2 cells .. 41
5.5 T-bet up-regulation is responsible for the conversion of TH17 into TH1 cells . 44
5.6 TH17 cells generated in vivo maintain IL-17-expression in vitro .................... 45
5.7 Gene expression analysis of in vivo and in vitro generated IL-17-producing
CD4+ T cells ............................................................................................................ 46
5.8 Expression of IL12Rβ2 and IFNγR2 in in vitro and in vivo generated TH17
cells…. .................................................................................................................... 48
5.8.1 Most TH17 cells do not express IL12Rβ2 in vivo .................................... 49
5.9 IL12Rβ2 in in vivo generated TH17 cells can be induced by IFNγ signalling . 50
5.10 In vivo generated TH17 become susceptible to IL-12 signaling through IFNγ
and adopt a TH1/17 phenotype ................................................................................ 52
5.11 IL-17/IFNγ-producing TH cells co-express RORγt and T-bet ......................... 53
5.12 DNA methylation pattern of in vivo generated TH1, TH17 and TH1/17 cells .... 56
6 Discussion ........................................................................................................... 63
6.1 TH1 and TH2 cells cannot cross-differentiate into TH17 cells ......................... 64
6.2 In vivo generated TH17 cells are refractory to TH1- and TH2-inducing signals 66
6.3 TH1/17 cells are induced from TH17 cells by subsequent IFNγ- and IL-12-
signaling ................................................................................................................. 68
6.4 DNA methylation of TH17, TH1/17 and TH1 cells ........................................... 71
6.5 Conclusion and Perspective ......................................................................... 73
7 References .......................................................................................................... 75
8 Danksagung ........................................................................................................ 84
9 Erklärung ............................................................................................................. 85
10 Curriculum vitae ............................................................................................... 86
11 Schriftenverzeichnis ......................................................................................... 89
Abbreviations
7
2 Abbreviations
AP-1 activator protein 1
APC antigen-presenting cell
BBB blood brain barrier
bp base pair
BSA bovine serum albumin
CCL CC motif chemokine ligand
CCR CC motif chemokine receptor
c-MAF musculoaponeurotic fibrosarcoma oncogene homolog
CNS conserved non-coding sequence
CpG cytosine-phosphate-guanine
CTCF CCCTC-binding factor
CTLA-8 cytotoxic T-lymphocyte antigen-8 gene
CXCL CXC motif chemokine ligand
DNA desoxyribonucleic acid
EAE experimental autoimmune encephalomyelitis
FACS fluorescence-activated cell sorting
FITC fluorescein isothiocyanat
G-CSF granulocyte colony-stimulating factor
GM-CSF granulocyte-macrophage colony-stimulating factor
GFP green fluorescent protein
h human
HDAC histone deacetylase
Hlx H2.0-like homeobox
HPRT hypoxanthine guanine phosphoribosyl transferase
IFN interferon
IL interleukin
iTreg inducible regulatory T cell
m murine
Abbreviations
8
MACS magnetic cell sorting
MBD methyl-CpG-binding domain protein
MHC major histocompatibility complex
MMP matrix metalloproteinases
MOG myelin oligodendrocyte glycoprotein
MS multiple sclerosis
NFAT nuclear factor of activated T cells
NFκB nuclear factor of κ light chain enhancer in B cells
NK natural killer
NKT natural killer T
OVA ovalbumin
PBS phosphate-buffered saline
PCR polymerase chain reaction
PE phycoerythrin
PMA phorbol 12-myristate 13-acetate
r recombinant
RA rheumatoid arthritis
RNA ribonucleic acid
ROR retinoid-related orphan receptor
Runx3 Runt-related transcription factor 3
RT room temperature
Stat signal transducer of activated T cells
T-bet T-box expressed in T cells
TCM Central memory T
TCR T cell receptor
TEM Effector memory T
TGFβ1 Transforming growth factor β1
TH T helper
TLR toll like receptor
Treg regulatory T cell
v/v volume per volume
Abbreviations
9
w/v weight per volume
wt wildtype
Introduction
10
3 Introduction
The main role of the immune system is to protect the body from infection. The system
is divided into two major categories: the innate immune system and the adaptive
immune system. Early protective immune mechanisms are mediated by the innate
immune system and are followed by reactions of the adaptive immunity. Innate
immunity to microbes stimulates adaptive immune responses and can influence the
nature of the adaptive responses to make them optimally effective against different
types of microbes.
The characteristics, which define the adaptive immunity, are the specificity for distinct
molecules and an ability to “remember” and to respond more vigorously upon repeated
exposures to the same microbe. Cells of the adaptive immune system, the T and B
lymphocytes, bear variable antigen-recognition receptors on the cell surface encoded
by somatically rearranged gene segments. Each T and B cell individually rearranges
the genes that encode the variable part of the antigen receptor during the development
in the thymus and bone marrow, respectively, creating an enormous diversity of
different specificities. Since among these specificities some receptors potentially
recognize self structures, it is necessary to eliminate self-reactive T and B cells from
the repertoire before maturation of the cells. However, some autoreactive T and B cells
escape elimination and are detectable in the blood of healthy individuals. Those
potentially pathogenic cells are kept under control by a mechanism called peripheral
tolerance. A delicate balance between inflammation and tolerance needs to be
maintained as dysregulated immune reactions can lead to autoimmunity on one hand
and allergy on the other. Aberrant CD4+ T helper (TH) type 1 (TH1) and TH17 cell
responses play critical roles in organ-specific autoimmunity, whereas TH2 cells have
been implicated in the pathogenesis of asthma and allergy. TH cells have a central role
in the immune system, coordinating both adaptive and innate responses. The function
of TH cells is mainly mediated through the secretion of cytokines. The cytokines of the
adaptive immunity are critical for the development of immune responses and for the
activation of effector cells that serve to eliminate microbes and other antigens. The
stability of cytokine production by a TH cell in a specific microenvironment can have a
great impact on the development of an autoimmune disease. As observed in numerous
diseases, excessive production or effects of cytokines can lead to pathologic
consequences. For instance, Interleukin-17 (IL-17), a cytokine produced by TH17 cells,
has been shown to play a major part in autoimmune diseases, but also for the clearing
Introduction
11
of extracellular pathogens and for the recruitment of neutrophils during infection.
Therefore, a potential approach for modifying biologic responses associated with
inflammatory diseases is the administration of cytokines or their inhibitors.
This work was focused on examining the plasticity and stability of IL-17 expression in
TH17 cells. Understanding the process through which TH cells alter their cytokine-
producing potential will provide interesting insights into subset commitment and gene
regulation. These findings may also allow the development of strategies to change TH
function in autoimmunity and allergy.
3.1 TH cell memory
Upon exposure to an antigen, antigen specific T cells are activated, proliferate and
differentiate into effector cells. The antigen specific effector cells act to clear the
infection. While the majority of these cells die by apoptosis, some survive and as
memory T cells provide a long-lasting protection upon re-exposure to the same
antigen. These remaining pathogen-specific memory T cells are present at higher
frequencies than the original naïve T cell, thereby increasing the probability that any re-
infection with the same pathogen will be detected and cleared rapidly without having
time to spread in the organism.
Memory cells can be distinguished from naïve cells based on the expression of surface
molecules. After activation of T cells, the receptor for hyaluronate, CD44, is up-
regulated. CD44 allows activated and memory T cells to enter inflamed peripheral
sites. T cell activation further results in the down-regulation of CD62L and CCR7,
molecules that are required to enter lymph nodes and to access the T cell area of the
lymph node. Whereas the up-regulation of CD44 is probably a permanent change,
some memory T cells re-express CD62L and CCR7, which is used to subdivide the
memory T cells pool into two major populations (Sallusto et al., 1999). Central memory
T (TCM) cells are similar to naïve T cells in that they express CD62L and CCR7 and
produce IL-2 following re-activation. Effector memory T (TEM) cells rapidly produce
effector cytokines (such as IL-4, IL-17 and IFNγ) upon activation by antigen. Due to the
low expression of CD62L and CCR7 they are less likely to traffic through the lymph
nodes and can be detected predominately in the peripheral organs, e.g. in cutaneous
and intestinal tissue.
Another difference between memory and naïve T cells is that memory cells are able to
mount cytokine responses faster than cells responding for the first time. Cytokine
Introduction
12
production by T cells is transient and requires activation of the cell through the T cell
receptor (TCR) recognizing its specific antigen. Upon primary activation it takes days
until the cells express cytokine genes such as IL-4, IL-17, IFNγ, IL-2 and IL-10,
although the kinetics of expression varies between the different cytokines. After
secondary stimulation, cytokine expression is initiated within hours with similar and
rapid kinetics for various cytokines. The ability of a re-activated TH cell to re-express the
cytokines it was instructed to express in the absence of the instructing signals, is
referred to as cytokine memory. Murine TH1 and TH2 cells generated in vitro show
different degrees of stability of cytokine memory, depending on the duration of
polarization. The memory for IL-4 is refractory to IL-12 after 1-2 weeks of TH2
polarization, whereas the memory for IFNγ becomes refractory to IL-4 after 3-4 weeks
of TH1 polarization (Assenmacher et al., 1998; Murphy et al., 1996). Information about
the memory for the pro-inflammatory cytokine IL-17 is so far very limited.
3.2 The role of cytokines in host defense
Activated TH cells proliferate and differentiate into effector cells whose functions are
mediated largely by secreted cytokines. Their commitment depends on complex
interactions with antigen-presenting cells, antigenic type and load, costimulatory
molecules and cytokine signaling. Committed CD4+ T cells may differentiate into TH1,
TH2, TH17 phenotypes, with distinct cytokine products and biological functions, or
evolve into the inducible regulatory T cell (iTreg) lineage, with immunomodulatory
functions. The cytokines present in the microenvironment of the cell during activation,
determine the later phenotype of the cell.
Cytokines are polypeptides produced in response to microbes and other antigens and
mediate many of the responses of innate and adaptive immunity. A complex network of
cytokines exist which is crucial for the regulation of cellular events, thereby establishing
a link between the innate and adaptive immune system. Most cytokines act in close
proximity to where they are produced, either in an autocrine (effect on the same cell
that secretes the cytokine) or in a paracrine (effect on a nearby cell) fashion. The
actions of cytokines are very often pleiotropic, which refers to the ability of a cytokine to
act on different cell types, allowing a cytokine to mediate diverse biological effects. This
effect is further enhanced by the ability of cytokines to influence the synthesis and
actions of other cytokines. Two cytokines may antagonize each other`s action, produce
additive effects or synergistic effects.
Introduction
13
A cytokine that has only recently been discovered to be of tremendous importance in
the immune system is IL-17A. The IL-17A gene, originally called cytotoxic T-
lymphocyte antigen-8 gene (CTLA-8), was first cloned from a murine cytotoxic T-
lymphocyte hybridoma cDNA library (Rouvier et al., 1993). IL-17 is the founding
member of the IL-17 family of cytokines, which includes IL-17A (also called IL-17), IL-
17B, IL-17C, IL-17D, IL-17E (also called IL-25), and IL-17F (Aggarwal and Gurney,
2002; Kawaguchi et al., 2004). Among these cytokines, IL-17F has the highest amino
acid homology to IL-17. The il17f gene is located close to the il17a gene in humans and
mice. Both IL-17 and IL-17F induce the production of antimicrobial peptides (defensins
and S100 proteins) (Kao et al., 2004; Liang et al., 2006), inflammatory cytokines (IL-6,
granulocyte colony-stimulating factor (G-CSF)), and granulocyte-macrophage colony-
stimulating factor (GM-CSF) (Fossiez et al., 1996; Hymowitz et al., 2001; Kawaguchi et
al., 2001; Numasaki et al., 2004); chemokines (CXCL1, CXCL5, IL-8, CCL2 and CCL7)
(Kawaguchi et al., 2004; Kawaguchi et al., 2003; Kawaguchi et al., 2002; Yang et al.,
2008a) and matrix metalloproteinases (MMP1, MMP3, MMP9 and MMP13) (Chabaud
et al., 2000; Koenders et al., 2005; Park et al., 2005; Prause et al., 2004), from
fibroblasts, endothelial cells and epithelial cells. Besides being produced by TH17 cells,
both IL-17 and IL-17F are also produced by a variety of cell types, including γδ T cells,
natural killer (NK) cells, natural killer T (NKT) cells, neutrophils, CD8 cells and
eosinophils (Ferretti et al., 2003; He et al., 2006; Liu et al., 2007; Lockhart et al., 2006;
Molet et al., 2001; Starnes et al., 2001).
Numerous studies have investigated the role of IL-17 in immunity. Using a model of
LPS-induced lung inflammation in mice it was shown that IL-17, produced mainly by
CD4+ cells, but also by neutrophils, played a major role in the mobilization of lung
neutrophils following bacterial challenge (Ferretti et al., 2003). IL-17 overexpression in
knee joints of mice induces joint inflammation, bone erosion and cartilage proteoglycan
loss (Lubberts et al., 2001). Furthermore, numerous groups have shown that blockade
or deficiency of IL-17 receptor (IL-17R) or neutralization of IL-17 with antibodies
reduces the severity of murine collagen-induced arthritis and adjuvant-induced arthritis
and has a significant protective effect against joint damage (Bush et al., 2002; Lubberts
et al., 2004; Nakae et al., 2003). Due to these and many other studies, blocking IL-17 is
considered a future therapy in rheumatoid arthritis and other autoimmune diseases.
Introduction
14
3.3 TH lymphocyte differentiation
Naïve CD4+ T cells, which mature in the thymus and have not yet encountered antigen,
are the common precursors of TH cells. In response to an antigen naïve CD4+ T cells
may differentiate into subsets of effector cells that produce distinct sets of cytokines
enable them to perform distinct effector functions. The adapted fate of the T cells is
preserved in subsequent rounds of cell division. In this respect, CD4+ T cell subsets are
thought to be distinct lineages, as defined by the cytokines they produce. Classically
divided into TH1 and TH2 cell (Mosmann et al., 1986; Mosmann and Coffman, 1989), a
novel lineage of CD4+ T cells was recently added, which is characterized by the
production of IL-17 and named TH17 (Harrington et al., 2005; Park et al., 2005).
Regulatory TH cell subsets (CD4+CD25+/Foxp3+) are essential for immune homeostasis
by controlling activation, proliferation and functionality of the effector lineages.
Regulatory T cells, which differentiate from naïve CD4+ T cells are called inducible
Tregs (iTreg) (Figure 1).
CD28
APC
Naïve CD4+ T cell
MHC
B7
TCR
Antigen
IFNγ, IL-12
IL-6, TGFβ1
TGFβ1, IL-2
IFNγ,
TNFα
IL-4,
IL-5,
IL-13
IL-17A,
IL-17F,
IL-22,
IL-21
TGFβ1,
IL-10
TH1
(T-bet)
TH2
(Gata3)
TH17
(RORγt)
iTreg
(Foxp3)
Figure 1. The cytokine milieu determines CD4+ T cell differentiation. After recognizing an
antigen presented by antigen-presenting cells (APC), naïve TH cells become activated and
differentiate into effector (TH1, TH2, TH17 cells) and regulatory (iTreg) subsets, depending on
instructive signals. The master transcription factors of the associated TH cell subset are in
parentheses. Cytokines, produced by these cells, are listed (italic).
Introduction
15
3.3.1 TH1 differentiation
TH1 cells are essential for clearing intracellular bacteria and viruses, and their signature
cytokine is Interferon gamma (IFNγ). TH1 differentiation (Figure 2) is induced by signals
from antigen-presenting cells (APC): IL-12, which is mainly produced by monocytes
and dendritic cells and IFNγ, which is secreted by already differentiated TH1 cells and
by NK and NKT cells. IFNγ activates signal transducer and activator of transcription 1
(Stat1) via the IFNγ receptor (IFNγR). Together with the TCR-induced transcription
factors (NFAT, NFκB and AP-1), these signals activate the transcription factor Tbox21
(T-bet). T-bet is a member of the T-box family of transcription factors and is considered
to be the master regulator of TH1 differentiation. Subsequently, T-bet induces the
production of IFNγ and the activation of the transcription factor H2.0-like homeobox
(Hlx) and Runx3. TCR-signaling represses the up-regulation of the IL12Rβ2 subunit in
an NFAT-dependent manner (Afkarian et al., 2002). The termination of TCR-signaling
finally allows the up-regulation of IL12Rβ2. As a consequence, Stat4 activation through
IL-12 signaling together with T-bet, Hlx and Runx3 activate the ifnγ locus and thereby
positively enhance Stat1 signaling (Schulz et al., 2009). The ability of IFNγ to stimulate
T-bet expression and the ability of T-bet to enhance IFNγ transcription sets up a
positive feedback loop which drives differentiation of T cells toward the TH1 phenotype.
The stability of the phenotype is further enhanced by the cooperation of Runx3 with T-
bet in silencing of the il4 gene in TH1 cells by binding to the il4 silencer and by binding
to the ifnγ promoter to further promote IFNγ production (Djuretic et al., 2007; Naoe et
al., 2007).
3.3.2 TH2 differentiation
TH2 cells, essential in eliminating extracellular pathogens, including helminths, express
IL-4, IL-5, IL-10, IL-13, and IL-25. The differentiation of antigen-stimulated T cells to the
TH2 subset (Figure 2) is dependent on IL-4 provided by mast cells, basophils, NKT
cells, eosinophils or previously differentiated TH2 cells. IL-4 signaling through the IL-4
receptor, which is expressed on naïve CD4+ T cells, activates the transcription factor
Stat6, which together with TCR signals induces the expression of Gata-binding protein
3 (Gata3) (Zheng and Flavell, 1997). Gata3 is a transcription factor that acts as a
master regulator of TH2 differentiation, enhancing expression of IL-4, IL-5 and IL-13,
which are located in the same genetic locus. Gata3 induces the transcription of the
long form of viral musculoaponeurotic fibrosarcoma oncogene homolog (c-MAF), which
additionally helps to activate il4 transcription (Kurata et al., 1999; Ouyang et al., 2000).
This activation results in a strong autocrine feedback loop that activates il4, il5 and il13.
Furthermore, IL-4 appears to repress IL-12 signaling through inhibition of IL12Rβ2
Introduction
16
expression, thus antagonizing TH1 differentiation and stabilizing the TH2 phenotype
(Szabo et al., 1997).
3.3.3 TH17 differentiation
The TH17 subset, determinant in fighting Gram negative bacteria, fungi, and some
protozoa, secretes IL-17, IL-21 and IL-22 with strong proinflammatory effects.
Transforming growth factor β1 (also called TGFβ) provided by dendritic and epithelial
cells, is required for the generation of TH17 cells and also Treg cells, a process that is
dependent on co-stimulatory signals and occurs in a concentration-dependent manner
(Veldhoen et al., 2006). At the same time TGFβ inhibits TH1 and TH2 differentiation. If
the cytokine milieu additionally provides IL-6, which is mainly produced by monocytes,
differentiation into the TH17 lineage is induced (Bettelli et al., 2006). The IL6R activates
Stat3, which subsequently induces the master transcription factor of TH17
differentiation, the retinoid-related orphan receptors, RORγt and RORα (Ivanov et al.,
2006; Yang et al., 2008b). However, full induction of RORγt is only achieved in the
presence of TGFβ (Zhou et al., 2008). IL-6 has been implicated in the induction of il21
expression, which is induced in a Stat3-dependent manner. IL-21, together with TGFβ,
also induces IL-17 production and expression of RORγt (Wei et al., 2007). It has been
suggested that IL-21 serves as an autocrine factor secreted by TH17 cells that
promotes or sustains TH17 lineage commitment. RORγt expression has no impact on
IL-21 production, as RORγt KO mice express normal levels of IL-21 (Zhou et al., 2007).
In addition, IL-23 plays a critical role establishing inflammatory immunity and enhancing
IL-17 production in vivo. At lower concentrations, together with IL-6 or IL-21, TGFβ is
required for the initial induction of IL23R on naïve CD4+ T cells, which renders TH17
cells responsive to IL-23 and therefore promotes their maturation. IL-23 further up-
regulates IL23R expression, by this imposing another positive feedback loop (Zhou et
al., 2008).
Conversely, the TH1 and TH2 cytokines IFNγ and IL-4 both inhibit the induction of IL-17
(Harrington et al., 2005). Additionally, IL-27, a member of the heterodimeric IL-12
cytokine family, promotes TH1 cell differentiation by inducing T-bet and IL12Rβ2 (Lucas
et al., 2003; Takeda et al., 2003) and concurrently inhibits TH17 cell differentiation in a
Stat1-dependent manner (Batten et al., 2006; Diveu et al., 2009; Stumhofer et al.,
2007). The genetic loss of T-bet strongly favors IL-17 expression in CD4+ T cells.
Introduction
17
3.4 Epigenetic control of TH differentiation
Several factors contribute to the ability of transcription factors to bind to the DNA,
including their concentration, post-translational modifications as well as their
subcellular localization, and the state of chromatin and DNA. The latter implies the
position and aggregation of nucleosomes, post-translational histone modifications and
the methylation status of the DNA. Although the DNA sequence remains unchanged,
epigenetic modifications can be heritable, but plastic as the potential for change in
response to altered environmental signals is retained.
IL-21
Smads
Figure 2. TH cell differentiation. TH1 cells are induced when activated in the presence of IFNγ
and IL-12. IFNγ activates Stat1, which induces T-bet. T-bet induces transcription of IL12Rβ2,
which allows for Stat4 activation and further induction of T-bet. TH2 cells are induced through IL-4
signaling. Stat6 induces the expression of Gata3 which in turn leads to the transcription of il4. IL-6,
IL-21 and TGFβ signaling leads to the induction of RORγt. RORγt upregulates IL23R, thus
rendering the cell susceptible to IL-23 signaling.
Stat1
Stat6
Stat3
IFNγ
IL-4
IL-6
IL-23
TGFβ1
Gata3
il4
RORγt
IL23R
T-bet
il21
IL-12
IL12Rβ2
TH1
TH2
TH17
Stat4
Introduction
18
DNA can be methylated at cytosines in cytosine-phosphate-guanine (CpG)
dinucleotides which is the only proven mechanism by which epigenetic information is
faithfully propagated from one cell to the next. Methylation of cytosines at gene
promoters and at distal regulatory elements can directly inhibit transcription by blocking
the binding of transcription factors and regulatory elements and indirectly by generating
binding sites for methyl-CpG-binding domain proteins (MBDs). Thereby, recruitment of
RNA polymerase II is inhibited.
Each of the core histones contains a 20-35 amino acid long N-terminal tail rich in basic
amino acids protruding from the nucleosome. These tails can be post-translationally
modified by addition or removal of acetyl, methyl, phosphate, ubiquitin, sumoyl or ADP-
ribose groups. Acetylation changes the charge of the histone, thereby reducing the
interactions between histones and DNA and enhancing nucleosome mobility. The
modifications can also create or remove binding sites for regulatory proteins that
enable or restrain transcription. The presence of histones H3 and H4 that are
acetylated and H3 lysine 4 (H3K4) modified by one (monomethylated H3K4), two
(dimethylated H3K4) or three (trimethylated H3K4) methyl groups are typical
characteristics of promoters and enhancers of active or recently transcribed genes. In
silent genes these modifications are absent, whereas dimethylated and trimethylated
H3K27 and trimethylated H3K9 are present. Interestingly, promoters of genes that are
poised to be either activated or silenced either do not have any of these histone
modifications or have a bivalent modification pattern meaning, they have both
permissive and repressive histone modifications.
Numerous studies have shown the relevance of epigenetic modifications in TH cell
differentiation and the significance for imprinting cytokine genes for memory
expression. When T cell lines were treated with 5-azacytidine, an inhibitor of DNA
methylation, this resulted in the production of IL-2 and IFNγ (Ballas, 1984; Young et al.,
1994), although the cells were formerly not producing these cytokines. It was also
shown that treatment of CD4+ T cells with inhibitors of histone deacetylases (HDACs)
augmented the expression of both IFNγ and TH2 type cytokines. Thus, DNA
methylation and histone deacetylation dampen the expression TH1 and TH2 cytokines
and help to restrict cytokine expression to the appropriate lineage. Information on how
regulatory mechanisms and epigenetic processes control TH17 differentiation and
memory is so far very limited.
Introduction
19
3.5 TH17 cells in EAE
Experimental autoimmune encephalomyelitis (EAE) is a CD4+ T cell-mediated
demyelinating disease of the central nervous system that is frequently used as a model
for the human disease multiple sclerosis (MS; (Sospedra and Martin, 2005)). EAE can
be induced in susceptible mice by adoptive transfer of myelin-reactive CD4+ T cells or
by immunization with myelin antigens. The course of EAE can be subdivided into an
initiation stage involving activation and expansion of myelin-specific T cells in the
periphery, which then cross the blood brain barrier (BBB), an effector stage involving
re-activation of myelin-specific T cells in the central nervous system, resulting in
cytokine-induced chemokine expression in the central nervous system-resident cells
and a stage of remission and repair in which the immune response is down-regulated
(McFarland and Martin, 2007; Steinman, 2001). Dysregulated TH1 responses have
been associated with organ-specific immunity and have been shown to play a critical
role in the initiation of inflammatory responses in the central nervous system (Agrawal
et al., 2006; Bettelli et al., 2004; Yang et al., 2009). IFNγ expression in the target
tissues correlates with clinical signs in EAE. It has been widely accepted that
dysregulated IFNγ-producing TH1 cells are pathogenic in EAE, while TH2 cells are
thought to be protective (Butti et al., 2008; Kleinschek et al., 2007; Ramirez and
Mason, 2000). T-bet- and Stat4-deficient mice are resistant to EAE, and targeting IL-12
with polyclonal antibodies to IL-12 turned out to be an efficient therapy for EAE.
However, the TH1 paradigm was put into doubt when it was discovered that mice
lacking IL-12p35, IL12Rβ2 or IFNγ were more susceptible to EAE, whereas IL-12p40-
deficient mice were resistant to disease (Ferber et al., 1996; Gran et al., 2002;
Krakowski and Owens, 1996; Zhang et al., 2003). In 2000 a novel cytokine chain, p19,
was discovered (Oppmann et al., 2000). This p19 chain forms heterodimers with the
p40 chain of IL-12, together forming a cytokine named IL-23. Thus, all approaches that
targeted the p40 chain of IL-12 would affect both IL-12 and IL-23. The discovery of IL-
23, and later of TH17 cells, filled an important gap in the understanding of EAE
pathogenesis and autoimmunity. By creating IL-23p19 deficient mice and comparing
them with IL-12p35 deficient mice, it was demonstrated that IL-23 and not IL-12 was
crucial for the induction of EAE (Cua et al., 2003). EAE can be induced in IL-23p19
deficient mice when exogenous IL-23 is delivered into the central nervous system (Cua
et al., 2003). Investigating the mechanism underlying the essential role of IL-23
revealed that autoreactive CD4+ T cells producing IL-17 were not induced in IL-23
deficient mice in EAE. TH1 and TH17 cells have been shown in several studies to
independently induce EAE with different, albeit overlapping pathological features
Introduction
20
(Jager et al., 2009; Kroenke et al., 2008; Lees et al., 2008a; Lees et al., 2008b; Park et
al., 2005). TH17 cells are recognized as an important mediator of tissue damage seen
in EAE (Axtell et al., 2010; Gyulveszi et al., 2009; Yang et al., 2009). EAE is
significantly suppressed in IL-17- and IL-17 receptor-deficient mice and inhibition of IL-
17 attenuates inflammation, indicating that IL-17-mediated signaling plays an important
role in the effector stage of EAE (Fitzgerald et al., 2007; Gonzalez-Garcia et al., 2009;
Komiyama et al., 2006). Recently, the chemokine receptor CCR6, which is highly
expressed on TH17 cells, has been implicated in development of EAE (Reboldi et al.,
2009; Yamazaki et al., 2008). CCR6-/- mice were resistant to EAE, which was
associated with a reduced ability of TH1 and TH17 cells to infiltrate the central nervous
system despite normal polarization of both subsets in draining lymph nodes.
Inflammation was triggered by a CCR6-dependent infiltration of TH17 cells, followed by
a second wave of both TH1 and TH17 cells in a CCR6-independent manner (Reboldi et
al., 2009). These data indicate that CCR6+ TH17 cells are crucial in the early phase of
disease.
3.5.1 Function of IL-17 in EAE
Although the precise mechanism by which IL-17 participates in EAE is unknown, many
functions of how IL-17 induces inflammation have been deciphered. A major function of
IL-17 involves coordination of local tissue inflammation through up-regulation of
proinflammatory and neutrophil-mobilizing cytokines and chemokines such as IL-6, IL-
1, TNFα, G-CSF, CXCL1, CCL2, CXCL2, CCL7, CCL20 and matrix metalloproteases
(MMPs), which allow activated T cells to cross the extracellular matrix (Agarwal et al.,
2008; Awane et al., 1999; Huang et al., 2007; Jovanovic et al., 1998). IL-17 signals
through a heterodimeric receptor complex consisting of IL-17RA and IL-17RC, which
are transmembrane proteins expressed on a variety of cells such as astrocytes and
microglia (Inoue et al., 2006; Kolls and Linden, 2004; Trajkovic et al., 2001). Act1 has
been described as a key component in the signaling of IL-17 (Qian et al., 2007). In a
recent study, by using cell-type specific deletion of Act1, it was shown that Act1
deficiency in the central nervous system-resident cells originated from neuroectodermal
cells (neurons, oligodendrocytes and astrocytes) delayed the onset and reduced the
severity of EAE (Kang et al., 2010).
3.6 Project objectives and experimental design
The regulation of IL-17 memory in the newly discovered TH17 cells has so far not been
sufficiently investigated. Knowledge about the plasticity of cytokine memory is crucial
for the development of new therapies against diseases involving repeatedly activated
Introduction
21
CD4+ T cells. These diseases include many autoimmune and allergic inflammatory
disorders and are associated with the presence of different subsets of TH cells that
could have a significant influence on these disorders. If TH cells responses are plastic,
it might be possible to reprogram these cells therapeutically. For example in MS it
could be of advantage to shift the balance from destructive TH17 and/or TH1 cells
towards more benign TH2 cells.
The aim of this work was to 1) analyze the susceptibility of TH1 and TH2 cells to TH17
inducing signals, 2) analyze the susceptibility of TH17 cells to TH1 and TH2 inducing
signals and to 3) analyze TH17 cells, which had been generated in vivo. In order to
investigate the stability of IL-17 expression in TH17 cells, an IL-17 secretion assay was
developed in cooperation with Miltenyi Biotec. With this assay it was possible to
analyze the plasticity of IL-17 producing cells without the interference of potentially
uncommitted T cells from in vitro cultures. Also, in vivo generated IL-17 producing cells
could be isolated and studied in in vitro cultures under various conditions. The main
focus was directed at the relationship between TH17 and TH1 cells, since CD4+ T cells
producing both IFNγ and IL-17 have been observed in vivo in both mice and humans.
Material and methods
22
4 Material and methods
4.1 Cell Biology
4.1.1 Mice and cells
BALB/c and OVA-TCR transgenic DO11.10 mice, IFNγR-deficient and C57Bl/6 mice
were ordered from Charles River Laboratories” or bred under specific pathogen free
(SPF) conditions at the Bundesinstitut für Risikobewertung in Marienfelde in Berlin. T-
Bet-deficient mice were a kind gift from J. Penninger (Vienna, Austria). Unless stated
otherwise, 6-12 week old mice were used.
4.1.2 Cell culture media and buffers
Murine lymphocytes were cultured in RPMI supplemented with 10% fetal calf serum
(Sigma Chemicals, St. Louis, MO), 100 U/ml penicillin, 0,1 mg/ml streptomycin, 0,3
mg/ml glutamine (Invitrogen) and 10 µM β-mercaptoethanol at 37°C in 5% CO2. Unless
indicated differently, lymphocytes were in phosphate-buffered saline (PBS)
supplemented with 0,5% (w/v) bovine serum albumin (PBS/BSA) during cell-sorting
and -isolation.
4.1.3 Preparation of a single-cell suspension
All mice were sacrificed by cervical dislocation. Spleen, peripheral and mesenteric
lymph nodes were isolated and pressed through a cell strainer with a pore size of 70
µm (BD Biosciences) and transferred into PBS/BSA.
4.1.4 Magnetic cells sorting (MACS)
Specific cell subsets were isolated by using MACS (high gradient magnetic cell sorting)
technology (Miltenyi Biotech, Bergisch-Gladbach, Germany). Cells were specifically
labeled with monoclonal antibodies conjugated to superparamagnetic particles and
loaded onto a MACS column. The MACS column is surrounded by a magnetic field
generated by a permanent magnet. Cells labeled with MACS MicroBeads are retained
in the MACS Column, whereas unlabeled cells pass through the column and are
depleted. When the MACS column is removed from the magnetic field, the labeled cells
can be eluted.
Material and methods
23
4.1.5 Flow cytometric analysis and fluorescent activated cell sorting (FACS)
Flow cytometry is used to analyze cells, by suspending them in a stream of fluid and
passing them by an electronic detection apparatus. A laser light is directed onto the
hydrodynamically-focused stream of fluid, where the cells pass by one-by-one. Two
detectors detect the light which is scattered by the cell. Light scattered at a slight angle
(3-10°) is called forward scatter (FCS) and at a 90° angle, side scatter (SSC). The
forward scatter correlates with the size of the cell, whereas the side scatter depends on
the granularity of the cell. With these two parameters it is possible to differentiate
between for example lymphocytes and granulocytes due to their cell size. Here, a
FACSCalibur (BD Biosciences, Heidelberg, Germany) was used, which has four
additional detectors (FL1, 530 nm; FL2, 585 nm; FL3, 650 nm; FL4, 670 nm. These
detectors are able to measure the light emitted from various fluorescent dyes excited
by an argon-laser (488 nm) and a diode-laser (635 nm). A FACSCanto II was also
used, which has three lasers (405 nm, 488 nm, 633 nm), and allows the use of six
different dyes at the same time.
In order to characterize different lymphocyte subsets, antibodies coupled to fluorescent
dyes were used, such as fluorescein isothiocyanate (FITC), AlexaFluor 488 and 405,
phycoerythrin (PE), Cy5, Allo-Phyco-Cyanin (APC) and phycoerythrin-Cy5 (PE-Cy5).
The data was analyzed using Cellquest software or FlowJo (BD Biosciences).
Different cell populations can also be sorted based on their fluorescent characteristics
by fluorescent activated cell sorting. After passing the cells through the laser and
acquisition of the fluorescent characteristics, the liquid stream of cells is disrupted into
droplets containing only one cell. The cells are given an electrical charge based on
their individual fluorescent characteristics and are then deflected into different tubes. In
order to sort different cells subsets a FACSAria and a FACSDiva (BD Biosciences) was
employed.
4.1.6 Antibodies used for flow cytometric analysis and cell culture
Anti-IL-4 (11B11), anti-IL-12 (C17.18), anti-IFNγ (AN17.18.24) antibodies purified from
hybridoma supernatants at the Deutsches Rheuma-Forschungszentrum (DRFZ Berlin,
Germany) were used at 20 µg/ml final concentration. FITC-conjugated anti-CD4
(GK1.5, Miltenyi Biotec), Alexa Flour 405-conjugated anti-CD4 (GK1.5, purified and
coupled at the DRFZ), PE-conjugated anti-CD62L antibody (clone MEL14, purified and
coupled at the DRFZ) and PE-conjugated anti-IL12Rb2 antibody (Clone 305719, R&D
Systems) were used for surface staining. FITC-conjugated anti-IL-17 (eBio17B7;
eBioscience) Alexa Flour 647-conjugated anti-T-bet (eBio4B10, eBioscience), PE-
Material and methods
24
conjugated anti-RORγt (AFKJS-9, eBioscience) and PE-Cy7 conjugated anti-IFNγ (BD
Biosciences) were used for intracellular stainings. For staining of pStat4 and pStat1, we
used an Alexa Fluor 647-conjugated anti-pStat4 (pY693) and anti-pStat1 (pY701)
antibody, respectively (both from BD Biosciences).
4.1.7 Isolation of CD4+ and CD4+CD62L+ TH lymphocytes
Murine CD4+ TH lymphocytes were isolated by positive selection using anti-CD4
microbeads (Miltenyi Biotec). The single-cell suspension was adjusted to 107 cells/90 µl
in PBS/BSA and 10µl/107 cells of the anti-CD4 microbeads were added and incubated
for 20 minutes at 4°C. The cells were washed in PBS/BSA to remove unbound
microbeads and loaded onto a LS column (Miltenyi Biotec) which had previously been
equilibrated with PBS/BSA. The LS column was situated in a magnetic field
(MidiMACS, Miltenyi Biotec) where the labeled cells retain, whereas the unlabeled cells
are caught in the flowthrough. CD4+ cells are eluted with PBS/BSA from the column by
removing it from the magnetic field. Purity of the subsets was controlled using a
FACSCalibur after staining the cells with anti-CD4 FITC (Miltenyi Biotec) for 10
minutes. When the purity was below 97%, the cells were loaded onto an additional LS
column.
Naïve TH lymphocytes were sorted according to their expression of CD4 and CD62L.
From spleen and lymph nodes a single-cell suspension was prepared. The cells were
stained with anti-CD4 FITC (Miltenyi Biotec) by incubating the cells for 10 minutes at 4-
8°C. In order to remove unbound antibodies, the cells were washed with PBS/BSA.
The cell-pellet was resuspended in PBS/BSA and incubated with anti-FITC multisort
beads (Miltenyi Biotec) for 20 minutes at 4-8°C. Unbound multisort beads were
removed by washing the cells with PBS/BSA. Labeled and unlabeled cells were
isolated using an LS column. To the purified CD4+ cells 20µl/1ml multisort release
reagent (Miltenyi Biotec) was added and incubated at 4-8°C for 30 minutes. The
protease contained in this reagent enables the cleavage of the multisort beads from the
cells. The cells were loaded onto a LS column. In this process the beads remain in the
magnetic field inside to column, whereas the cells are in the flowthrough. The CD4+
cells were adjusted to 107 cells/100 µl with PBS/BSA. Anti-CD62L microbeads (Miltenyi
Biotec) was added in the ratio of 1:25 and incubated for 20 minutes at 4-8°C. Unbound
microbeads were removed by washing the cells with PBS/BSA. The cells were
separated on a LS column and purity was controlled by surface staining with a PE-
conjugated anti-CD62L antibody.
Material and methods
25
4.1.8 Cell culture
CD4+ or CD4+CD62L+ cells of at least 97% purity were mixed with antigen-presenting
cells (APC) in a ratio of 1:5. Irradiated (30 Gy) CD4- or freshly prepared splenocytes
from BALB/c mice were used as APC. The cultures were set up at 2x106 cells/ml. All
cultures were done in complete RPMI at 37°C in 5% CO2. TH cells from TCR transgenic
DO11.10 mice were stimulated with the cognate peptide OVA323-339 (R. Volkmer-Engert,
Humboldt University of Berlin, Berlin, Germany) at 0,5 µM in the presence of APC,
whereas TH from Balb/c mice were stimulated with 1 µg/ml soluble or 3 µg/ml plate-
bound anti-CD3 and 1 µg/ml soluble anti-CD28 (BD Biosciences). For TH1
differentiation, the TH cells were stimulated in the presence of 5 ng/ml recombinant
murine IL-12 (R&D Systems) and 20 μg/ml anti-IL-4 antibody (11B11). For TH2
differentiation, the cells were stimulated in the presence of murine IL-4 (100 ng/ml;
culture supernatant of HEK293T cells transfected with an expression plasmid encoding
murine IL-4), 20 μg/ml anti-IL-12 antibody (C17.8.6) and 20 μg/ml anti-IFNγ antibody
(AN18.17.24). TH17 cells were induced by stimulating the cells in the presence of 1
ng/ml TGFβ1, 20 ng/ml IL-6, 20 ng/ml IL-23 (all from R&D Systems), 20 μg/ml anti-IL-4
antibody and 20 μg/ml anti-IFNγ antibody. Dead cells were removed by density
gradient centrifugation (Ficoll-Histopaque). Every 6 days viable TH cells were harvested
and re-stimulated under the original conditions, except that 10 ng/ml murine IL-2 (R&D
Systems) was added to the TH1 and TH2 cultures.TH cells stimulated with anti-CD3 and
anti-CD28 were harvested every 5 days.
4.1.9 Mitogenic re-stimulation and intracellular cytokine staining
Murine TH cells were re-stimulated with 10 ng/ml phorbol 12-myristate 13-acetate
(PMA) and 1 μg/ml ionomycin (Sigma chemicals) in complete RPMI medium.
Prior to intracellular staining of cytokines, the cells were stimulated for 1 h with
PMA/ionomycin and additional 3 h with 5 µg/ml of brefeldin A blocking the secretion of
cytokines. Cells were washed twice in PBS and fixed with 2% formaldehyde in PBS for
15 min. The fixation was stopped by washing with PBS, and the cells were transferred
into PBS/BSA. For intracellular staining, the cells were permeabilized with 0,5% (w/v)
saponin (Sigma) in PBS/BSA supplemented with staining antibodies. After 15 min on
ice the cells were washed once with saponin buffer, transferred into PBS/BSA and
analyzed by flow cytometry.
For intracellular T-bet and RORγt staining, the Foxp3 staining buffer set (eBioscience)
was used according to the manufacturer’s instructions. Intracellular IL-17 and IFNγ in
murine cells were stained under the same conditions for co-staining of transcription
Material and methods
26
factors and cytokines. For pStat4 and pStat1 staining, Phosflow Lyse/Perm buffer and
Perm Buffer III (BD Biosciences) were used according to the manufacturer’s
instruction. The cells were stimulated with IL-12 (10 ng/ml) for 30 minutes for pStat4
and with IFNγ (10 ng/ml) for 15 minutes for pStat1 staining. IL12Rβ2 was stained
according to the manufactor`s instructions.
4.1.10 Isolation of viable cytokine-secreting TH cells
Cells were cultured under IL-17 inducing conditions for 6 days, or CD4+CD62Llo cells
were isolated from spleen of 6-months old ex breeder DO11.10 and Balb/c mice. Cells
were harvested and re-stimulated with 10 ng/ml PMA and 1 µg/ml ionomycin for 1.5
hours. The cells were washed twice in ice-cold PBS with 0.5% w/v BSA (PBS/BSA).
Cells were labeled for 5 min at 4°C with an IL-17-specific high-affinity capture matrix,
i.e., bi-specific Ab-Ab conjugates of an anti-CD45 antibody with an anti-IL-17 antibody
(Miltenyi Biotec GmbH, Bergisch Gladbach, Germany). Cell samples were taken for low
control (kept on ice) and high control (incubated with recombinant IL-17 (0,5 µg/ml);
Peprotech, Hamburg, Germany), washed after 10 minutes and kept on ice. The rest of
the cells were transferred into 37°C warm RPMI medium at a low density (105 cells/ml)
and placed at 37°C. Every 5 minutes the cells were mixed gently. After 30 minutes, the
cells were transferred into ice-cold PBS/BSA and kept on ice for 10 minutes. The
captured IL-17 was detected with an anti-IL-17 biotin conjugated antibody followed by
staining with an APC-conjugated anti-biotin antibody (Miltenyi Biotec) (Figure 3). The
IL-17 producing cells and the IL-17 non-producing cells were separated by FACSAria™
cell sorter (BD Biosciences). After sorting, the purity of the sort was confirmed with a
FACSCalibur (BD Biosciences). Specificity of the IL-17 secretion assay was confirmed
by intracellular staining.
Material and methods
27
Figure 3. The principle of the cytokine secretion assay. A bispecific affinity matrix, the
catch reagent, attaches to CD45, which is expressed by all leukocytes. The secreted IL-
17 binds to the cytokine catch matrix. Anti-IL-17 Biotin binds to IL-17, and can
subsequently be detected by Streptavidin (SA)-PE.
Material and methods
28
4.2 Murine inflammation model
4.2.1 Experimental Autoimmune Encephalomyelitis
Experimental Autoimmune Encephalomyelitis (EAE) is an established murine model of
multiple sclerosis (MS) and can be induced in susceptible mouse strains either by
immunization with spinal cord homogenate and isolated myelin proteins/peptides
(active EAE), or by adoptively transferring lymphocytes pre-activated with the above
proteins (passive EAE) into naïve mice. Pre-existing autoreactive T cells are in both
protocols activated under pro-inflammatory conditions, they expand and target the
central nervous system causing paralysis and ataxia. Here, a protocol for active EAE
was applied.
Active EAE was induced in 8- to 12-week-old C57Bl/6 mice by subcutaneous injection
of 200 µg MOG35-55 peptide (Brustle et al., 2007; Nogai et al., 2005)
(mevgwyrspfsrvvhlyrngk; synthesized by Dr. R. Volkmer, Charité, Berlin, Germany)
emulsified in complete Freund's adjuvant (containing 1mg/ml M. tuberculosis H37RA;
Sigma) together with i.v. administration of 200 ng pertussis toxin (Sigma) on days 0
and 2. The additional pro-inflammatory signals through administration of pertussis toxin
enhance the inflammatory response; facilitating the invasion of the central nervous
system with encephalitogenic MOG-specific TH cells and with it increases the disease
severity. Disease severity was assigned scores daily on a scale of 05 as follows: 0, no
paralysis; 1, limp tail; 2, limp tail and partial hindleg paralysis; 3, complete hindleg
paralysis; 4, tetraparesis; and 5, moribund. Cells were isolated from the spleen of mice
at day 7 after immunization. The experiments were performed in collaboration with the
group of Thomas Kamradt (Friedrich Schiller University Jena, Germany).
Material and methods
29
4.3 Molecular Biology
4.3.1 Real-time PCR
Real-time PCR was used to quantify the gene expression of selected genes. The cells
were lysed, their mRNA was isolated and reverse transcribed into cDNA. In the
subsequent PCR with primers specific for the gene of interest (Table 1), the fluorescent
compound SYBR green was used to quantify the synthezised DNA. SYBR green
intercalates into double stranded DNA. The emitted fluorescence, which is quantified
once per amplification cycle, is proportional to the amount of PCR product. The number
of cycles that is required until the fluorescence exceeds the threshold (crossing point,
cp) is a measure for the starting amount of template DNA.
Total RNA was prepared using NucleoSpin RNA II (Macherey-Nagel) kit. Reverse
transcription (TaqMan Reverse Transcription Reagent, Applied Biosystems) was
performed in a conventional thermocycler (10 min at 25°C, 40 min at 48°C, and 5 min
at 95°C) with 100-500 ng of total RNA and a 1:1 mixture of oligo(dT) and random
hexamer primers. Real-time PCR was performed with the LightCycler instrument using
the FastStart DNA Master SYBR Green I kit (Roche Diagnostics) and the following
cycle conditions: 9 min at 95°C, followed by 45 cycles of 15 sec at 95°C, 15 sec at 60-
65°C, 15 sec at 72°C. For the normalization of murine cDNA, the transcripts of the
housekeeping genes hypoxanthine guanine phosphoribosyl transferase (HPRT) were
quantified. Data were evaluated using Lightcycler software. Relative expression was
calculated as follows: EtCp target gene (reference - sample)/EhCp housekeeping gene (reference - sample). E
represents the reaction efficiency. E is calculated after serial dilution of template DNA
and plotting the log of amount of template against the cp values as follows: E = 10-
1/slope.
Primer sequences:
HPRT forward
GCTGGTGAAAAGGACCTCT
HPRT reverse
CACAGGACTAGAACACCTGC
RORγt forward
TGCAAGACTCATCGACAAGG
RORγt reverse
AGGGGATTCAACATCAGTGC
IL17 forward
TCCAGAAGGCCCTCAGACTA
IL17 reverse
AGCATCTTCTCGACCCTGAA
IL17F forward
CAAAACCAGGGCATTTCTGT
IL17F reverse
ATGGTGCTGTCTTCCTGACC
IL22 forward
GTCAACCGCACCTTTATGCT
IL22 reverse
CATGTAGGGCTGGAACCTGT
Material and methods
30
IL21 forward
ATCCTGAACTTCTATCAGCTCCAC
IL21 reverse
GCATTTAGCTATGTGCTTCTGTTTC
IL21R forward
TGTCAATGTGACGGACCAGT
IL21R reverse
CACGTAGTTGGAGGGTTCGT
RORα forward
CCCCTACTGTTCCTTCACCA
RORα reverse
TGCCACATCACCTCTCT
IL23R forward
AACATGACATGCACCTGGAA
IL23R reverse
TCCATGCCTAGGGAATTGAC
Gata3 forward
CCTACCGGGTTCGGATGTAAGT
Gata3 reverse
AGTTCGCGCAGGATGTCC
T-bet forward
TCCTGCAGTCTCTCCACAAGT
T-bet reverse
CAGCTGAGTGATCTCTGCGT
IL12Rβ2 forward
CTGATCCTCCATTACAGAA
IL12Rβ2 reverse
CGGAAGTAACGAATTGAGAA
IFNγR2 forward
CCGAGTGAAGTACTGGTTTC
IFNγR2 reverse
GTGTTTGGAGCACATCATC
4.3.2 Microarray analysis
Oligonucleotide microarrays (GeneChipTM, Affymetrix) were used to analyze the gene
expression in in vitro and in vivo generated IL-17+ TH cells on a genome-wide scale.
Those arrays contain spots of short oligonucleotides representative of the coding
regions of all genes. The RNA of the cells of interest is isolated, labeled and incubated
with the array. Complementary sequences hybridize and the amount of hybridized RNA
is later quantified by fluorescence detection after washing and staining.
Total RNA was extracted using NucleoSpin RNA II (Macherey-Nagel). RNA
concentration, purity and integrity were assessed with the Agilent 2100 Bioanalyzer
and the RNA 6000 Nano LabChip. 300 ng of total RNA was reverse-transcribed,
followed by cDNA extraction using a PhaseLock gel (Eppendorf) and precipitation with
ethanol and ammonium acetate. Biotinylated cRNA was in vitro transcribed using the
MEGAscript high yield transcription kit (Ambion) according to the manufacturer's
recommendations. Biotinylated cRNA was fragmented, and the hybridization cocktail
was prepared according to Affymetrix protocols (15 µg fragmented biotin-labeled cRNA
spiked with Eukaryotic Hybridization control). The Murine Genome 430A version 2
GeneChipTM arrays (Affymetrix) was loaded with the hybridization cocktail, hybridized
at 45°C for 16 h in a rotisserie motor, washed and stained with streptavidin-
phycoerythrin using the Affymetrix GeneChip Fluidics Workstation 400. Arrays were
scanned on a Hewlett-Packard Gene Array Scanner (MGU74Av2 arrays) or on an
Affymetrix GeneChip Scanner 3000 (MG430Av2 arrays). Data were analyzed using the
Table 1. Real-time PCR Primer sequences for the genes of interest.
Material and methods
31
Microarray Suite 5.0 software (Affymetrix). Microarrays were globally normalized and
scaled to a trimmed mean expression value of 200. Quality checks were performed
according to the manufacturer's recommendations. All arrays were compared to each
other, and a relational database was generated using Microsoft Access software and
including the following parameters: expression heights, call for presence of transcripts,
p value for presence or absence of transcripts, log2 value of fold change and 95%
confidence intervals, call for the significance of differentially expression and the p value
for that call. For each transcript the significance of differential expression between the
groups of arrays was calculated using strict Bonferroni corrected Welch t-tests.
Significantly differentially expressed genes were filtered according to the following
criteria: mean fold change >= 2 or 1,5; difference of means >= 200; p-value <= 0,05
and excluding immunoglobulin genes. The microarrays were hybridized at DRFZ, and
the relational data base for data analysis was created by Joachim Gruen (DRFZ,
Berlin, Germany).
4.3.3 Bisulfite-based cytosine methylation analysis
In order to analyze how genes are silenced in the investigated TH cell subsets, DNA
methylation in the IL-17 and RORγt promoter was determined. Only regions conserved
between mouse and human as determined by mVista and containing high numbers of
CpGs were considered.
DNA of the samples to be analyzed was isolated using a DNeasy Blood and Tissue Kit
(Qiagen) and the bisulfite conversion was carried out using EpiTect bisulfite kit
(Qiagen). During the bisulfite conversion, sodium bisulfite converts unmethylated
cytosine residues into uracil but does not affect 5-methylcytosine. Thus, bisulfite
treatment introduces specific changes in the DNA sequence that depends on the
methylation status of individual cytosine residues, which can be analyzed by
sequencing of the DNA fragment. PCR primers specific for bisulfite modified DNA were
designed and the sequence to be analyzed was amplified by nested PCR (Table 2).
Nested PCR is a modification intended to reduce the contamination in products due to
the amplification of unexpected primer binding sites. Nested polymerase chain reaction
involves two sets of primers, used in two successive runs of polymerase chain reaction,
the second set amplifying a secondary target within the first run product.
Material and methods
32
Primer sequences:
1st set of Primers:
IL17 5kb up forward
TATTTTTTTTTTTAAAATGTAGTT
IL17 5kb up reverse
ACCTCATAAAAACTAAAACTACTT
IL-17 promoter forward
AAGTATTTTTGTTTATCTTTTAA
IL-17 promoter reverse
AATACACTTATACCTCATATAAAA
RORγt 10kb up foreward
TTGTAATTTTAATGTTTTTATT
RORγt 10kb up reverse
TCCCAAAAAAACTATAATATC
RORγt 1kb up foreward
AAGTTATTTTATATTTTTATATTTTT
RORγt 1kb up reverse
AATATTAAATACCTCAATTCAACA
RORγt promoter foreward
GATTAGTAGTTTTGTTTTTAAAG
RORγt promoter reverse
CACAAATAACCAAATAACAAC
2nd set of Primers:
IL17 5kb up forward
TGTGGTTGTTTAAGTTATGTTA
IL17 5kb up reverse
CTAAATAAATTCCTCACTAATC
IL-17 promoter forward
GAAGTTATGTTTTTTTGTATAGTG
IL-17 promoter reverse
AAAATAATACTCCTTTCTCTCTT
RORγt 10kb up foreward
GTTGTAATTTTAATGTTTTTATTTT
RORγt 10kb up reverse
CAATTAACAACAAAAAAAATCC
RORγt 1kb up foreward
TAGTTTTTTTGGGGTTAAGA
RORγt 1kb up reverse
TCCTCTACCCAAAATTTAAT
RORγt promoter foreward
ATAGAGGGTATTTGTTTGATG
RORγt promoter reverse
CATTAAATATAATAACAAACACC
The PCR products were purified from an agarose gel by using NucleoSpin extract II
(Macherey-Nagel) and cloned into a pCR®2.1 vector by means of a TA cloning Kit
(Invitrogen). The construct was then transformed into competent E.coli cells and the
mixture was spread on LB agar plates containing 100 µg/ml ampicillin and X-Gal. The
plates were incubated over night at 37°C. Next day 24 white colonies were picked and
sequenced (GATC Biotec). The sequences were analyzed with BiQ Analyzer (Bock et
al., 2005), a software tool for DNA methylation analysis. Sequences with a conversion
rate below 90% or with a high error rate, were excluded from the analysis.
Potential transcription factor binding sites in the here analyzed regions were
determined using MatInspector (Genomatix software) (Quandt et al., 1995).
Table 2. Nested PCR primers.
Results
33
5 Results
5.1 TH1 and TH2 cells cannot be converted into TH17 cells
To what extend TH1 and TH2 cells could be converted into a TH17 phenotype,
identifiable through up-regulation of IL-17 and RORγt, was examined in an in vitro
culture system. Naïve CD4+CD62L+ T cells from TCR transgenic DO11.10 mice were
activated with their cognate antigen (OVA323-339) and antigen-presenting cells (APC),
differentiated into TH1 cells with IL-12 and anti-IL-4 antibody, or into TH2 cells with IL-4,
anti-IL-12 and anti-IFNγ antibody. The APCs were γ-irradiated, still enabling them to
initially present the antigen while precluding their survival. After 6 days the TH1 and TH2
cells were re-stimulated with antigen, this time however under TH17 inducing
conditions, i.e. in the presence of TGFβ, IL-6, IL-23, anti-IL-4 and anti-IFNγ antibody. 6
days later, the cells were re-stimulated with PMA/ionomycin, fixed after 4 hours,
permeabilized and stained intracellularly for cytokine expression. Induction of IL-17 by
TGFβ and IL-6 was not effective in either TH1 (1.6% IL-17+ cells) or TH2 (4.7%) cells
(Figure 4A and 4B). As has been shown in several publications, IFNγ inhibits TH17
differentiation (Harrington et al., 2005). To exclude inhibition of TH17 differentiation by
IFNγ in established TH1 cells, we also analyzed cells deficient for the IFNγ receptor
(IFNγR-/-). Once the cells had been polarized into TH1 cells, IL-17 expression was not
effectively induced (4%) (Figure 5) as compared to naïve cells (25%) (Figure 4C). As
shown by real-time PCR, T-bet was up-regulated even under TH17-inducing conditions
in TH1 cells (Figure 4D). The transcription factors RORα and RORγt were up-regulated
2-fold and 6-fold, respectively, in TH1 cells under TH17-inducing conditions. In TH2 cells
Gata3 was down-regulated 2-3-fold when the cells had been re-stimulated under TH17
inducing conditions and RORγt expression was up-regulated 5-fold. Expression of
IL23R and RORα remained unchanged. From these results we concluded that in vitro
generated TH1 and TH2 cells could not be converted into a TH17 phenotype.
Results
34
Results
35
5.1.1 IFNγ producing TH1 cells generated in vivo are refractory to TH17 inducing
signals
Next we wanted to analyze if in vivo generated TH1 cells behave similarly under TH17
inducing conditions as in vitro generated TH1 cells. IFNγ-producing CD4+ T cells were
isolated from ex breeder Balb/c mice to a purity of >99% (Figure 6). The cells were
stimulated with anti-CD3, anti-CD28 antibody and APC under TH17 inducing conditions
(TGFβ, IL-6, IL-23, anti-IL-4, anti-IFNγ and anti-IL-12 antibody) and TH1 conditions (IL-
12, anti-IL-4 antibody). After 5 days in culture the cells were re-stimulated with
Figure 4. TH1 and TH2 cells are refractory to TH17 polarization. Naïve CD4+CD62L+ cells
from DO11.10 mice were stimulated with irradiated APC and OVA323-339 and A) differentiated in
the presence of IL-12 and anti-IL-4 antibody to TH1, B) in the presence of IL-4, anti-IL-12 and
anti-IFNγ antibody to TH2 or C) in the presence of TGFβ, IL-6, IL-23, anti-IL-4 and anti-IFNγ
antibody to TH17 cells for 6 days. The cells were cultured for another 6 days in the presence of
IL-17-inducing conditions (TGF-β, IL-6, IL-23, anti-IL-4 and anti-IFNγ antibody). IFNγ, IL-4 and
IL-17 expression was analyzed after 5 hours of re-stimulation with PMA/Ionomycin by
intracellular cytokine staining. Data are representative of 4 experiments. D) RNA was extracted
from unstimulated (unst) cells and cells stimulated (stim) for 3 hours and quantitative real-time
PCR was performed. Data are representative of 2 experiments.
Figure 5. In vitro generated IFNγR-/- TH1 cells cannot be converted into a TH17
phenotype. CD4+CD62L+ cells from wt and IFNγ receptor deficient mice were stimulated with
anti-CD3 and anti-CD28 antibody and cultured under TH1-inducing conditions (IL-12, anti-IL-4
antibody) for 6 days and then re-stimulated with PMA/Ionomycin for cytokine expression
analysis. The TH1 cells were cultured for another 6 days in the presence of IL-17-inducing
conditions (TGFβ, IL-6, IL-23, anti-IL-4 and anti-IFNγ antibody). The cells were re-stimulated
with PMA/ionomycin, fixed and stained intracellularly for IFNγ and IL-17.
Results
36
PMA/Ionomycin, fixed and stained for IL-17, IFNγ, T-bet and RORγt. Under TH17
conditions IL-17 expression was not induced in in vivo generated TH1 cells. IFNγ was
similarly expressed under both conditions and RORγt was up-regulated under none of
the tested conditions. T-bet was slightly down-regulated under TH17 conditions. This is
not unexpected as it has been shown that T-bet is suppressed by TGFβ-signalling
(Gorham et al., 1998; Lin et al., 2005).
5.2 Development of a murine IL-17 cytokine secretion assay
To analyze the stability of IL-17 expression on the single-cell level, we developed a
cytokine secretion assay for murine IL-17 in cooperation with Miltenyi Biotech GmbH.
Naïve CD4+CD62L+ T cells were isolated from spleen and lymph nodes of DO11.10
mice and stimulated with antigen and APC in the presence of TGFβ, IL-6, IL-23, anti-IL-
4 and anti-IFNγ antibody to induce TH17 differentiation. Upon PMA/Ionomycin re-
stimulation the maximal frequency of IL-17-expressing TH cells is reached already after
2 hours (Figure 7).
Figure 6. Ex vivo isolated murine IFNγ-producing T cells are refractory to TH17
reprogramming. IFNγ-producing T cells were isolated ex vivo from spleen and lymph nodes
from ex breeder Balb/c mice using IFNγ and IL-17 secretion assays and cultured for 5 days
under TH1 (+IL-12) or TH17-inducing (+TGFβ + IL-6 + IL-23) conditions. IL-17, IFNγ, RORγt and
T-bet expression was assessed by intracellular staining. Data are representative of three
independent experiments.
Results
37
In order to isolate IL-17-producing T cells, TH17 cells were re-stimulated for 2 hours to
induce cytokine expression, labeled with the capture matrix and allowed to secrete IL-
17 for 30 minutes. The secreted IL-17 bound to the capture matrix was then detected
using a fluorochrome-conjugated antibody. The cells were analyzed by flow cytometry
or sorted by FACS (Figure 8A). Cells, which had been placed on ice in order to block
secretion, were used as a low control (Figure 8B). The capacity of the capture matrix
was determined by adding recombinant IL-17 to the cells (Figure 8B). To control for
false-positive cells due to cross-feeding of IL-17 from secreting cells to the capture
matrix of non-secreting cells, cells were fixed after staining with the detection antibody
and stained for IL-17 in the presence or absence of the membrane-permeabilizing
agent saponin. All of the cells secreting IL-17 were also positive for IL-17 intracellularly,
whereas IL-17 non-secreting cells were negative for IL-17 intracellularly (Figure 8C).
Therefore, the IL-17 secretion assay could be used for specific labeling of viable TH17
cells and subsequent sorting of these cells.
Figure 7. Kinetic of IL-17
expression in TH17 cells after re-
stimulation. CD4+CD62Lhigh cells
were cultured under IL-17-inducing
conditions for 6 days and then re-
stimulated with PMA/ionomycin. The
cells were fixed and stained
intracellularly for IL-17 at different
time-points as indicated.
Results
38
5.3 Stability of IL-17 expression in in vitro generated TH17 cells
Naïve CD4+CD62L+ TH cells were isolated from spleen and lymph nodes of DO11.10
mice and cultured under TH17-inducing conditions. After 6 days in culture, these cells
were separated into IL-17-producing and non-producing cells, with a purity >97%
(Figure 9A). The sorted IL-17+ and IL-17- cells were re-stimulated with the cognate
antigen, cultured under various conditions, and analyzed for IL-17 re-expression. Cell
numbers were comparable and viability was above 90% during the culture period. We
did not observe selective outgrowth of contaminating cells in any of the tested culture
conditions (Figure 10). When cultured in the absence of exogenous cytokines and
blocking antibodies, only 13% of the IL-17+ TH cells re-expressed IL-17, whereas 49%
now expressed IFNγ (Figure 9A). In the presence of blocking antibodies to IL-4 and
IFNγ more than 60% of the IL-17+ cells re-expressed IL-17, irrespective of whether IL-
Fig 4. Testing of the murine IL-17 cytokine secretion assay.
Figure 8. Isolation of viable IL-17-producing and non-producing cells with the IL-17
secretion assay. A) Naïve CD4+CD62L+ cells were differentiated under IL-17-inducing
conditions for 6 days and an IL-17 secretion assay was performed. IL-17-secreting and IL-17-
non-secreting cells were separated by FACS sorting. B) As controls, after labeling with IL-17
capture matrix, cells were either put on ice immediately to prevent secretion or incubated with
recombinant murine IL-17 at room temperature for 15 min. IL-17 captured on the cell surface
was then detected by an anti-IL-17 biotin conjugated antibody followed by staining with an
APC-conjugated anti-biotin antibody. C) The staining of secreted IL-17 correlates with the
staining of intracellular IL-17. After the IL-17 secretion assay, the cells were fixed in 2%
formaldehyde and stained for intracellular IL-17 with a PE-conjugated antibody. To verify that
staining of intracellular IL-17 selectively identified intracellular IL-17 and not IL-17 bound to
the cell surface, the staining of intracellular IL-17 was performed either in the absence or
presence of saponin.
Results
39
23 was blocked by adding anti-IL12p40. Addition of TGFβ and IL-6 did not have any
effect on the re-expression of IL-17. When IL-23 was added without anti-IL-4 and anti-
IFNγ antibody, 35% of the IL-17+ cells re-expressed IL-17, 16% of them re-expressed
IFNγ. IL-17 non-expressing cells expressed IFNγ (35%) but no IL-17 (<1%) if no
cytokines or antibodies were added. In the presence of IL-23 2% of these cells
expressed IL-17. Blocking of IFNγ and IL-4 resulted in the expression of IL-17 in 9% of
the IL-17- cells in the absence of IL-23, 12% in the presence of IL-23 and 18% in the
presence of TGFβ, IL-6 and IL-23 (Figure 9A). When comparing mRNA of IL-17+ and
IL-17- cells directly after sorting RORγt and RORα were similarly expressed. mRNA
expression of these transcription factors were down-regulated when the cells were
cultured without the addition of exogenous antibodies or cytokines. Regulation of
RORγt expression correlated with the expression of IL-17, being highly expressed
under conditions when IL-17 was expressed (anti-IL-4 and anti-IFNγ antibody with anti-
IL12p40 antibody, IL-23 or TGFβ/IL-6). RORα was generally down-regulated upon re-
culture, except for a 4-fold up-regulation in the presence of TGFβ/IL-6 compared to
cells cultured just in the presence of anti-IL-4, anti-IFNγ antibody and IL-23. T-bet
expression in IL-17+ cells was 3-fold enhanced in the presence of endogenous IFNγ
and particularly higher in IL-17- than in IL-17+ cells. IL-17F, IL-22, IL23R and IL-21 were
selectively expressed by IL-17+-sorted cells and their expression was down-regulated
in the absence of added cytokines or antibodies. IL-23 receptor expression was
maintained in the presence of IL-23, but down-regulated in the presence of TGFβ and
IL-6. IL-17F expression was only maintained in the presence of TGFβ, IL-6 and IL-23.
IL-22 and IL-21 expression was down-regulated under all conditions analyzed (Figure
9B).
The TH17 phenotype of in vitro generated TH17 cells was only maintained in the
presence of the instructive signals. Under neutral conditions (stim) most of the cells
switched to a TH1 phenotype by up-regulating IFNγ (>40%) and T-bet expression.
Results
40
Figure 9. in vitro generated IL-17 producing TH cells fail to re-express IL-17. Naïve
CD4+CD62L+ cells from DO11.10 mice were differentiated under IL-17 inducing conditions for
6 days. A) IL-17 producing and non-producing cells were separated and re-cultured for
another 6 days in the presence of OVA323-339 and irradiated APC only (stim), under neutral
conditions (anti-IL-4, anti-IL-12, anti-IFNγ antibody) (Ab) or under different TH17 favoring
conditions (IL-23, IL-23 with anti-IL-4 and anti-IFNγ antibody (IL-23+Ab) or TGFβ, IL-6, IL-23,
anti-IL-4 and anti-IFNγ antibody (TH17)). Cytokine expression was analyzed by intracellular
staining after PMA/ionomycin for 5 h. Data are representative of 3 experiments. B) mRNA
was extracted from IL-17+ and IL-17- cells directly after the secretion assay and six days later
from cells re-stimulated for 2 h. This mRNA was reversely transcribed and quantified by
quantitative real-time PCR. Data are representative of 2 experiments.
Results
41
5.4 In vitro generated TH17 cells can cross-differentiate into
TH1 and TH2 cells
Next we wanted to analyze if IL-17-producing TH17 cells could be converted into a TH1
and TH2 phenotype by IL-12 and IL-4 signaling, respectively. Naïve CD4+CD62L+ TH
cells from DO11.10 mice were stimulated with OVA and APC in the presence of TGFβ,
IL-6, IL-23, anti-IL-4 and anti-IFNγ antibody. After 6 days in culture IL-17-producing and
non-producing cells were isolated and cultured for additional 6 days under TH1 inducing
(IL-12 and anti-IL-4 antibody) or TH2 inducing (IL-4, anti-IFNγ and anti-IL-12 antibody)
conditions. IL-17+ cells re-expressed IL-17 with a frequency of 8% under TH1 conditions
Figure 10. In vitro generated IL-17 producing and non-producing cells have the same
proliferative capacity. CD4+CD62L+ cells were cultured under TH17-inducing conditions for 6
days, re-stimulated with PMA/Ionomycin and subjected to IL-17 secretion assay. The IL-17
producing and non-producing cells were labeled with CFSE and cultured for another 6 days
without addition of antibodies or cytokines (stim), under neutral conditions (anti-IL-4, anti-IL-12,
anti-IFNγ antibody), under different TH17 favoring conditions (IL-23, IL-23 with anti-IL-4 and
anti-IFNγ antibody or TGFβ, IL-6, IL-23, anti-IL-4 and anti-IFNγ antibody) and TH1- (IL-12 and
anti-IL-4 antibody) or TH2-inducing (IL-4, anti-IFNγ and anti-IL-12 antibody) conditions. The
cells were re-stimulated with PMA/ionomycin for 5 h for cytokine analysis.
Results
42
and 26% under TH2 conditions (Figure 11A). IL-17+ and IL-17- cells started to produce
IFNγ (>70% of CD4+ cells) or IL-4 (19% in IL-17+ and 28% in IL-17- cultures),
respectively. RORγt, RORα, IL-17F, IL-22, IL23R and IL-21 expression was down-
regulated if cells were cultured under TH1 or TH2 polarizing conditions. Under TH1
conditions the cells up-regulated expression of T-bet 3-8 fold. Under TH2 conditions
Gata3 expression was up-regulated 16-20 fold (Figure 11C). Since it has been shown
for TH1 and TH2 cells that reversibility of these subsets is lost after long-term
stimulation, we tested TH17 cells, which had been cultured under TH17 polarizing
conditions for 3 weeks. Every 6 days resting viable TH17 cells were harvested and re-
stimulated under the original conditions. After 3 weeks, IL-17+ cells were isolated and
further cultured for 6 days under TH1 or TH2 polarizing conditions. TH memory for IL-17
re-expression was also not stabilized in 3 week old TH17 cells (Figure 11B). Only 9%
re-expressed IL-17 under such conditions. 64% of the IL-17+ or IL-17- cells expressed
IFNγ and 12-13% expressed IL-4 under TH1 or TH2 conditions, respectively.
Results
43
Figure 11. IL-17-producing TH17 cells can be converted into IL-4-producing TH2 and
IFNγ-producing TH1 cells. Naïve CD4+CD62L+ cells from DO11.10 mice were differentiated
under IL-17-inducing conditions. A) After 6 days, the cells were harvested and re-stimulated
for IL-17 secretion assay. The IL-17+ and IL-17- cells were cultured under TH1 (IL-12, anti-IL-
4 antibody) and TH2 (IL-4, anti-IL-12, anti-IFNγ antibody) polarizing conditions for 6 days.
Cytokine expression was analyzed by intracellular staining after PMA/ionomycin re-
stimulation. B) Cells were cultured for 18 days under TH17 polarizing conditions (TGFβ, IL-6,
IL-23, anti-IL-4, anti-IFNγ antibody). IL-17+ and IL-17- cells were separated and cultured
under TH1 and TH2 polarizing conditions. Data are representative of 3 experiments. C)
mRNA of 1-week-old IL-17+ and IL-17- cells directly after isolation and cells cultured under
TH1-and TH2-polarizing conditions for 6 days was isolated after 2 h re-stimulation with
PMA/ionomycin, reversely transcribed and quantified by quantitative real-time PCR. Data are
representative of 2 experiments.
Results
44
5.5 T-bet up-regulation is responsible for the conversion of
TH17 into TH1 cells
T-bet is the major transcription factor driving TH1 differentiation. It has been shown that
in T-bet KO mice the number of IL-17-producing CD4+ T cells is much higher after
immunization compared to wt mice (Park et al., 2005). As TH17 cells readily convert to
a TH1 phenotype, we compared T-bet KO to wt TH17 cells to determine the role of T-bet
in the conversion of TH17 into TH1 cells. To this end, naïve CD4+CD62L+ T cells were
isolated from T-bet KO and Balb/c wt mice and cultured under TH17-polarizing
conditions for 5 days. IL-17-producing cells from these cultures were isolated with the
aid of the IL-17 secretion assay and cultured in the presence of IFNγ and IL-12, IFNγ,
IL-12 or in the absence of IFNγ and IL-12. Under all conditions, IL-4 was blocked to
prevent the induction of a TH2 phenotype.
Under all the tested conditions IL-17 was re-expressed in >40% of the T-bet KO cells,
indicating that T-bet is responsible for the conversion of TH17 into TH1 cells. IL-17
expression in wt cells was only stable if all cytokines were blocked (Figure 12).
Figure 12. Instability of IL-17 expression is T-bet-dependent. Naïve CD4+CD62L+ cells
from T-bet KO mice and Balb/c wt mice were stimulated with anti-CD3, anti-CD28 antibody
and APC and cultured under TH17-inducing conditions (TGFβ, IL-6, IL-23, anti-IL-4, anti-
IFNγ antibody). IL-17-producing cells were isolated with the aid of the IL-17 secretion assay
and cultured under the indicated conditions for 5 days. Data are representative of 2
independent experiments.
Results
45
5.6 TH17 cells generated in vivo maintain IL-17-expression in
vitro
In order to analyze how in vivo generated TH17 cells are affected under TH1 and TH2
conditions, we isolated CD4+CD62Llo splenocytes from 6 month old ex breeder
DO11.10 mice and stimulated the cells with PMA/ionomycin and IL-17-expressing cells
were isolated with the aid of the IL-17 secretion assay. The cells stimulated with
PMA/Ionomycin expressed 32% IFNγ, 0,9% IL-4, and 2,8% IL-17, of which
approximately 25% co-expressed IFNγ (Figure 13A). The IL-17+ and IL-17- cells were
isolated using an IL-17 secretion assay, stimulated with OVA and APC and cultured
under TH1 inducing (IL-12 and anti-IL-4 antibody), TH2 inducing (IL-4, anti-IFNγ and
anti-IL-12 antibody), neutral (in the absence of exogenous cytokines and blocking
antibodies) or in the presence of IL-23 for 6 days (Figure 13B). In the absence of
antibodies or cytokines 72% of the IL-17+ cells re-expressed IL-17. When the cells
were cultured in the presence of IL-23, 83% re-expressed IL-17. Interestingly, ex vivo
isolated IL-17+ TH cells were refractory to TH1- and TH2-polarizing signals. Under TH1-
polarizing conditions the frequency of IFNγ expressing cells was 14%. When the IL-17+
cells were cultured under TH2-polarizing conditions, 4% of IL-4 expressing cells were
observed. 75% and 68% of the IL-17+ cells re-expressed IL-17 under TH1 and TH2
conditions, respectively. Expression of RORγt and RORα was down-regulated 5-fold
under TH2-inducing conditions. Gata3 expression was not induced in IL-17+ cells under
any condition. Expression of T-bet was up-regulated 2-fold under TH1-inducing
conditions in the IL-17+ cells. In IL-17- cells RORγt and RORα were not up-regulated.
T-bet was induced under neutral and TH1 conditions, whereas Gata3 was induced
under TH2 polarizing conditions. IL-23 receptor, IL-22 and IL-17F were highly
expressed in IL-17+ cells and their expression was down-regulated upon in vitro
culture. IL-21 expression was up-regulated at least 2-fold upon in vitro culture, except if
cultured under TH2-inducing conditions, which led to a 2-fold reduction in IL-21
expression (Figure 13C).
The expression of IL-17 in in vivo generated TH17 cells was stably re-expressed under
all tested conditions. Some of the TH17 associated genes, such as IL-17F, IL-22 and
IL23R, are similarly down-regulated as was observed in in vitro generated TH17 cells.
Results
46
5.7 Gene expression analysis of in vivo and in vitro generated
IL-17-producing CD4+ T cells
In order to identify differentially expressed genes responsible for the stable phenotype
of in vivo generated versus in vitro generated TH17 cells, we performed global gene
expression analysis to compare these two subsets.
Figure 13. In vivo generated TH17 cells have a stable phenotype for IL-17 re-
expression. CD4+CD62Llow cells from 6 months old DO11.10 mice were isolated and
either re-stimulated for A) direct analysis of cytokine expression or B) IL-17 secretion
assay. The IL-17+ and IL-17- cells were cultured without (stim) or with IL-23 and under
TH1- or TH2-polarizing conditions for 6 days. The cytokine expression was analyzed by
intracellular cytokine staining after re-stimulation with PMA/Ionomycin for 5 hours. Data
are representative of 3 experiments. C) mRNA of ex vivo isolated IL-17+ and IL-17-
cells (directly after FACS) and cells cultured for 6 days under the indicated conditions
was isolated after 2 h re-stimulation with PMA/ionomycin, reversely transcribed and
quantified by quantitative real-time PCR. Data are representative of 2 experiments.
Results
47
Naïve CD4+CD62L+ T cells from Balb/c mice were activated in vitro with splenic APC,
anti-CD3 and anti-CD28 antibody under conditions that induce functional differentiation
into TH17 cells, i.e. addition of TGFβ, IL-6, IL-23 and blocking antibodies specific for IL-
4 and IFNγ. IL-17 producing cells were isolated from TH17 cultures (IL-17+ in vitro) and
ex vivo from ex breeder Balb/c mice (IL-17+ ex vivo) using an IL-17 cytokine secretion
assay.
The transcriptional profiles of ex vivo isolated IL-17+ cells and in vitro generated IL-17+
cells were compared using high-density oligonucleotide microarrays. No genes
characteristic for other cell types such as residual APCs or CD8+ T lymphocytes were
detected. A total number of 769 genes were differentially expressed by a factor of ten
or more in in vivo generated versus in vitro generated TH17 cells (Figure 14).
To identify the molecular mechanism of how in vivo generated TH17 cells are refractory
to conversion by IL-12, we here compared expression of genes relevant for IL-12 and
IFNγ-signaling by TH17 cells generated in vitro, and CD4+ T cells isolated directly ex
vivo according to secretion of IL-17. Expression of the gene encoding the IL12Rβ2 was
up-regulated 2.5-fold in in vitro generated IL-17+ cells compared to ex vivo isolated IL-
17+ cells. Although the fold change was relatively low, analysis of IL12Rβ2 is of interest
as transcripts of IL12Rβ2 in cells generated in vivo were at the detection limit. Since
IL12Rβ2 plays a major role in TH1 differentiation and stabilization of the TH1 phenotype,
this gene was chosen for further analysis.
Figure 14. Genes differentially expressed in in vitro generated IL-17+ versus ex vivo
isolated IL-17+ cells. Naïve TH cells from Balb/c mice were activated in vitro with splenic APC
and OVA327-339 under TH17-polarizing conditions. IL-17-producing cells from in vitro cultures and
ex vivo from ex breeder Balb/c mice were isolated using an IL-17 secretion assay. The
transcriptional profiles of in vitro and in vivo generated IL-17-producing cells were compared
using Murine Genome 430A version 2 GeneChipTM arrays (Affymetrix). Each group included
triplicates of independent cultures/experiments. Genes were filtered according to the following
criteria: fold change >= 10; difference of mean signal intensities >= 200; p-value <= 0,05 The
microarrays were hybridized in the group of Dr. Thomas Häupl (ChariUniversity Medicine,
Department of Rheumatology, Berlin, Germany) and the relational data base for data analysis
was created by Joachim Grün, (DRFZ, Berlin, Germany).
Results
48
5.8 Expression of IL12Rβ2 and IFNγR2 in in vitro and in vivo
generated TH17 cells
The relative expression of the lineage-determining transcription factors for TH1 and
TH17 cells, T-bet and RORγt, respectively, the IFNγ receptor 2 (IFNγR2) and the
inducible IL12Rβ2 chain were analyzed by real-time PCR (Figure 15A). Expression of
RORγt in ex vivo isolated IL-17+ T cells was 3-fold higher as compared to in vitro
generated IL-17+ TH cells. IL12Rβ2 mRNA expression was close to the detection limit in
ex vivo isolated TH17 cells, confirming the results from the microarray. Increased T-bet
mRNA levels (3-fold) were detected in the ex vivo isolated IL-17+ TH cells compared to
in vitro generated IL-17+ TH cells (Figure 15A). Directly ex vivo isolated IL-17+ TH cells
expressed 5-fold less IL12Rβ2 transcripts than in vitro generated TH17 cells (Figure
15A). Allowing the cells to rest did not significantly increase IL12Rβ2 mRNA expression
of ex vivo isolated TH17 cells (data not shown). This suggests that the expression of the
Il12rβ2 chain in TH17 cells is down-regulated constitutively in vivo, and not transiently,
as a consequence of TCR activation. Ex vivo isolated IL-17+ TH cells stimulated with
IL-12 did not respond by Stat4 phosphorylation, demonstrating the absence of a
functional IL-12 receptor on these cells (Figure 15B). Ex vivo isolated IL-17+ TH cells
also do not respond to IL-12 by induction of IFNγ expression above the frequencies of
pre-existing double-producing cells (Figure13A). In vitro generated TH17 cells, on the
other hand, responded to IL-12 by phosphorylation of Stat4 in all cells (Figure 15B).
The Ifnγr2 gene was 3-4-fold higher expressed by TH17 cells, both in vivo and in vitro
generated, than in TH1 cells (data not shown). This is in accordance with previous
reports demonstrating up-regulation of Ifnγr expression by IL-6 (Sanceau et al., 1992)
and down-regulation of Ifnγr expression in TH1 cells in vitro (Pernis et al., 1995). In in
vitro generated and directly ex vivo isolated TH17 cells the IFNγ receptor is functional
since Stat1 phosphorylation was induced upon stimulation with IFNγ (Figure 15B),
while TH1 cells did not respond to IFNγ (data not shown).
These data show that, while in vitro generated TH17 cells have a functional IFNγ- and
IL-12 receptor, in vivo generated TH17 cells only have a functional receptor for IFNγ
and not IL-12, making them unreactive to IL-12 signaling.
Results
49
5.8.1 Most TH17 cells do not express IL12Rβ2 in vivo
It has been shown by Schulz et al. that IL12Rβ2 is down-regulated upon TCR
stimulation. So in order to correlate IL12Rβ2 expression with IL-17 expression, we
directly isolated splenic CD4+ T cells based on surface expression of IL12Rβ2
(IL12Rβ2high/low) (Figure 16A) and measured the expression of IL-17 intracellularly upon
reactivation. Within the IL12Rβ2- CD4+ T cells we could detect 0.66% IL-17 expressing
cells, while 0.18% of the IL12Rβ2+ TH cells expressed IL-17 (Figure 16B). These data
show that most TH17 cells do not express the IL12Rβ2 chain, which correlates with the
lack of Stat4 phosphorylation in TH17 cells as seen in Figure 15C.
Figure 15. In vivo generated TH17
cells express a functional IFNγR but
not IL12Rβ2. A) mRNA expression of
RORγt, IL12Rβ2, IFNγR2 and T-bet was
determined in IL-17+ cells isolated
directly ex vivo (ev) and from in vitro (iv)
induced TH17 cells and normalized to
the housekeeping gene HPRT. Data are
mean ± SD of 3 independent
experiments. B) IL-17+ cells isolated ex
vivo and generated in vitro were rested
for 2 days in the absence of IL-4, IFNγ
and IL-12. The cells were then
stimulated for 30 minutes with IL-12
prior to intracellular staining of
phosphorylated Stat4 (pStat4) or 15
minutes with IFNγ for staining of
phosphorylated Stat1 (pStat1). Cells
incubated with culture medium alone
served as negative control. Data are
representative of three independent
experiments.
Results
50
5.9 IL12Rβ2 in in vivo generated TH17 cells can be induced by
IFNγ signalling
IFNγ-induced activation of Stat1 induces T-bet and production of IFNγ in naïve T cells
(Afkarian et al., 2002; Schulz et al., 2009). However, culturing directly ex vivo isolated
TH17 cells in the presence of IFNγ was not sufficient to induce significant IFNγ
production despite induction of T-bet (Figure 17A and 17C). IL-12, as shown in Figure
13, did not lead to significant induction of IFNγ expression (Figure 17A), nor
responsiveness to IL-12 (Figure 17B) or up-regulation of T-bet expression (Figure
17C). This further confirms our data (Figure 15), as we could not detect any expression
of a functional IL-12 receptor in in vivo generated TH17 cells by culturing the cells in the
presence of IL-12.
However, in ex vivo isolated TH17 cells, IFNγ functionally restored responsiveness to
IL-12 (Figure 17B) as has been shown for TH1 and TH2 cells (Szabo et al., 1997).
When pre-stimulating the cells with IFNγ, IL-12 induced phosphorylation of Stat4 in
more than 50% of the cells (Figure 17B). All of the cells had uniformly up-regulated T-
bet expression, as determined by intracellular immunofluorescence staining (Figure
17C). Also under all tested conditions, RORγt remained highly up-regulated. Therefore,
due to the elevated expression of a functional IFNγ receptor, IFNγ signaling can induce
Figure 16. TH17 cells do not
express the IL12Rβ2 chain.
CD4+ T cells from spleen and
lymph nodes from ex breeder
Balb/c mice were isolated by
magnetic cell sorting. A) The cells
were stained for IL12Rβ2 and,
subsequently, IL12Rβ2high and
IL12Rβ2low CD4+ TH cells were
isolated by FACS sorting. Data are
representative of three
independent experiments. B) The
sorted IL12Rβ2high and IL12Rβ2low
CD4+ TH cells were stimulated with
PMA/ionomycin for 4 hours for
recall expression of cytokines. The
percentage of IL-17-producing
cells per spleen was determined
by intracellular cytokine staining.
Results
51
both expression of T-bet and IL12Rβ2. After the induction of IL12Rβ2, TH17 cells
become susceptible to IL-12 signaling, as detected by phosphorylation of Stat4.
Figure 17. IL12Rβ2 expression is induced in ex vivo isolated TH17 cells by IFNγ. A)
Ex vivo isolated IL-17+ cells were cultured in the absence of IFNγ and IL-12 or in the
presence of IFNγ or IL-12 only for 5 days and stained intracellularly for IFNγ and IL-17
expression. IL-4 was blocked under all conditions. Data are representative of five
independent experiments. B) Stat4 phosphorylation (pStat4) in response to IL-12 was
measured by intracellular staining in IL-17+ TH cells cultured under the indicated
conditions. Data are representative of three independent experiments. C) Intracellular
RORγt and T-bet expression was measured after 5 days in cell culture under the
indicated conditions. Data are representative of three independent experiments.
Results
52
5.10 In vivo generated TH17 become susceptible to IL-12
signaling through IFNγ and adopt a TH1/17 phenotype
To determine the impact of IL-12 signaling on in vivo generated TH17 cells, in which the
β2 chain of the IL-12 receptor had been up-regulated, we stimulated the IL-17-
producing T cells in the presence of IFNγ for 5 days and subsequently stimulated them
in the presence of IL-12 for another 5 days. While inducing expression of T-bet and
IFNγ in ex vivo isolated TH17 cells, combined IFNγ and IL-12 signaling did not suppress
expression of RORγt. All cells uniformly continued to express RORγt (Figure 18C).
Upon re-stimulation they also re-expressed IL-17. The frequencies of IL-17 producing
cells dropped from 75% (±10%) to 38% (±6%) as a result of the IL-12 treatment. In
total, 20% of the cells expressed only IL-17, 20% IL-17 and IFNγ and 30% only IFNγ
(Figure 18A). This corresponds to unbiased and random co-expression of both
cytokines, which is neither linked nor exclusive (Lohning et al., 2002).
Figure 18. Combined IFNγ- and IL-12-
signaling induces a TH1/TH17
phenotype. A) Directly ex vivo isolated
CD4+IL-17+ T cells were cultured for 5
days in the presence of IFNγ and then
re-stimulated in the presence of either
IFNγ or IL-12 for another 5 days.
Depicted is the intracellular staining for
IFNγ and IL-17 expression after each
culture. Data are representative of four
independent experiments. B+C) RORγt
and T-bet were stained intracellularly
following the second culture. Data are
representative of four independent
experiments.
Results
53
5.11 IL-17/IFNγ-producing TH cells co-express RORγt and T-bet
To analyze TH1/17 cells generated in vivo, we immunized C57Bl/6 wt mice with peptide
derived from myelin oligodendrocyte glycoprotein (MOG35-55) in complete Freund’s
adjuvant together with i.v. administration of pertussis toxin on days 0 and 2. On day 7
post-immunization, before onset of clinical symptoms of EAE (Figure 19A), we
assessed the expression of the cytokines IFNγ and IL-17 in splenic CD4+ TH cells.
Controls were unimmunized wildtype mice. Following re-stimulation with PMA and
ionomycin, 3.29% of the splenic CD4+ TH cells expressed IFNγ only, while 1.54%
expressed IL-17 only. 0.38% of all splenic CD4+ TH cells co-expressed IL-17 and IFNγ
(Figure 19A). Among the PMA/Ionomycin stimulated CD4+ T cells of unimmunized mice
on the other hand, 2.25% expressed IFNγ, 0.09% IL-17 and 0.03% expressed both
IFNγ and IL-17 (Figure 19A). Using an IFNγ/IL-17 double secretion assay, we isolated
splenic TH cells expressing either IFNγ only, IL-17 only, or co-expressing IL-17 and
IFNγ (Figure 19B). TH cells expressing only IFNγ uniformly expressed elevated T-bet
levels geo mean= “geometric mean of fluorescence intensity” of 1152 compared to
negative control) while RORγt expression was almost undetectable. IL-17 only
expressing TH cells expressed high RORγt levels geo mean of 3387) and detectable
levels of T-bet (Δ geo mean of 518). TH cells expressing both IL-17 and IFNγ uniformly
expressed elevated levels of RORγt and T-bet (Δ geo mean of 2368 and 1138,
respectively) (Figure 19C). mRNA of IL-17+, IFNγ+ and IL17+IFNγ+ TH cells was
isolated, reversely transcribed and quantified by real time PCR. The expression of the
analyzed genes was normalized to the housekeeping gene HPRT. RORγt was
elevated in IL-17 single-positive and IL-17-IFNγ double-positive TH cells, whereas it
was hardly detectable in IFNγ single-positive TH cells. However, RORγt was slightly
reduced in the double-producing TH cells. RORα and IL23R were similarly expressed in
the three TH cell subsets, i.e. high expression in IL17+ cells, reduced expression in
double producing cells and low amount in IFNγ+ cells. Equally, as had been observed
on protein level, T-bet was highly expressed in IFNγ+ and IL-17+IFNγ+ TH cells, whereas
a low expression was detectable in IL-17+ cells. Relative mRNA expression of IL12Rβ2
was undetectable in IL-17+ TH cells, up-regulated in IFNγ+ cells and interestingly, highly
expressed in IL-17+IFNγ+ cells. In TH cells expressing IFNγ, expression of IFNγR2 was
low, but detectable, while being elevated in IL-17 single-positive TH cells.
Results
54
Results
55
Next, we analyzed the stability of TH1/17 cells. Therefore, TH1/17 cells were isolated
directly ex vivo by using an IL-17 and IFNγ secretion assay and then cultured without
the addition of any blocking antibodies and exogenous cytokines (neutral) for 5 or 10
days. Upon re-stimulation with PMA/ionomycin, 23±1% of the cells co-expressed IL-17
and IFNγ, 55±4% only IFNγ and 12±3% only IL-17 after 5 days (Figure 20A). The
relative distribution of cytokine producers was maintained at similar levels after day 10
(12±6% co-expressing IL-17 and IFNγ, 59±14% only IFNγ and 14±6% only IL-17)
(Figure 20B). T-bet expression was maintained uniformly during the 10 days of culture.
RORγt expression was also maintained, although to a lesser degree in some of the
cells, most of which corresponded to the IFNγ only producing cells (data not shown).
Therefore, TH1/17 cells generated in vivo maintain their phenotype, although to a lesser
degree compared to IL-17+ and IFNγ+ cells under the same conditions.
Figure 19. Ex vivo isolated murine TH1/17 cells co-express RORγt and T-bet A) EAE was
induced in C57Bl/6 mice and cytokine expression on day 7 after immunization was measured in
splenic CD4+ T cells after stimulating the cells with PMA/Ionomycin for 4 hours. The cells were
analyzed before any clinical score was measureable. Cytokine expression in CD4+ T cells from
unimmunized mice were also analyzed by FACS. B) IFNγ+IL-17-, IL-17+IFNγ- and IL-17+IFNγ+
CD4+ T cells were isolated combining the IL-17 and IFNγ secretion assay. C) RORγt and T-bet
were stained intracellularly in the different subsets. D) mRNA was isolated from IFNγ+IL-17-, IL-
17+IFNγ- and IL-17+IFNγ+ CD4+ T cells, reversely transcribed and gene expression was analyzed
by real-time PCR. Data are representative of three independent experiments.
Results
56
5.12 DNA methylation pattern of in vivo generated TH1, TH17
and TH1/17 cells
To further analyze the plasticity of TH1, TH17 and TH1/17 cells, DNA methylation in the
promoter regions of il17 and rorγt was examined in the three T cell subsets. DNA
methylation is normally associated with gene silencing. A chemical reaction of sodium
bisulfite with DNA converts unmethylated cytosines of CpG dinucleotides to uracil or
UpG. However, methylated cytosines will not be converted in this process and primers
for PCR are designed to overlap the CpG site of interest which allows one to determine
methylation status as methylated or unmethylated.
Figure 20. In vivo generated TH1/17 cells maintain their phenotype under neutral
conditions. A) IL-17+IFNγ+ CD4+ TH cells were stimulated with anti-CD3/anti-CD28
antibody/APC and cultured under neutral conditions (anti-IL-4, anti-IFNγ and anti-IL-12
antibody) for 5 days. The cells were re-stimulated with PMA/Ionomycin for 4 hours and
cytokine, T-bet and RORγt expression was measured by FACS. B) The cells from A) were
re-stimulated with anti-CD3/anti-CD28 antibody/APC and cultured under neutral conditions
(anti-IL-4, anti-IFNγ and anti-IL-12 antibody) for another 5 days. T-bet, RORγt and cytokine
expression was measured after re-stimulation with PMA/Ionomycin for 4 hours. Data are
representative of five independent experiments.
Results
57
C57Bl/6 mice were immunized with MOG35-55 peptide in complete Freund’s adjuvant
together with i.v. administration of pertussis toxin on days 0 and 2. 7 days after
immunization IFNγ+, IL-17+ and IL17+IFNγ+ T cells were isolated and genomic DNA
was purified. Unmethylated cytosines were converted into uracils using a bisulfite kit.
Regions of interest were determined based on a high degree of conservation between
mouse and human and a high density of CpGs (Figure 21 and 22). A CpG island is a
region with at least 200 bp and with a GC percentage that is greater than 50% and with
an observed/expected CpG ratio that is greater than 60%. No CpG islands are located
within the il17 locus as predicted by a CpG program (http://cpgislands.usc.edu/). A
region 5kb upstream of il17 was selected for further analysis as this has been shown to
be a binding site for RORγt and important for high transcription of il17 (IL-17-1).
Furthermore, the promoter region of il17 was analyzed (IL-17-2) (Figure 21).
Both RORγ and RORγt are encoded by rorc. RORγt shares a identical nucleotide
sequence with RORγ from exon 3 through the last exon. Both alternate RNA splicing
(He et al., 1998; Ortiz et al., 1995) and an alternative promoter (Winoto and Littman,
2002) have been suggested to be responsible for the generation of RORγt. Therefore,
we analyzed both sequences upstream of rorc as well as directly upstream of the first
RORγt specific exon. Three regions, 9 kb (RORγt-1), 1 kb (RORγt-2) upstream of rorc
as well as the potential promoter region of rorγt (RORγt-3) were analyzed as these
regions display a high density of CpGs (Figure 22). Due to the low frequencies of IL-
17+IFNγ+ TH cells and in order to increase uniformity of all measurements, the same
amount of DNA isolated from each TH cell subset from three experiments were pooled
for the analysis.
Figure 21. Genomic organization of the il17 gene. Genomic organization of il17 and the
region 10 kb upstream. The regions of interest are depicted above the alignment. The
exons are in blue and the conserved non-coding sequences (CNS) in pink.
Results
58
The regions of interest were amplified by nested PCR, inserted into the vector
pCR®2.1 by a ligation step and transformed into competent cells. 24 positive clones of
every TH cell subset from each region were picked and sequenced. The sequences
where then compared to the original sequence and methylated cytosines could hereby
be detected, as these were not converted into uracils during the bisulfite conversion
reaction.
The region 5kb upstream of il17 (IL-17-1) was completely demethylated in IL-17+ TH
cells, whereas more than 50% of the CpGs were methylated in IFNγ+ TH cells (Figure
23). In IL-17+IFNγ+ TH cells we detected some methylated CpGs.
FIgure 22. Genomic organization of the rorc gene. Genomic organization of rorc as well
as the region 10.3 kb upstream. RORγ and RORγt are both encoded within the rorc locus.
The regions of interest are depicted above the alignment. The exons are in blue and the
conserved non-coding sequences (CNS) in pink.
Results
59
The methylation pattern of the il17 promoter was similar as observed for the region 5
kb upstream. No cytosine methylation in IL-17+ TH cells, some in IL-17+IFNγ+ TH cells
and high CpG methylation in IFNγ+ TH cells (Figure 24). Therefore, methylation of
regions upstream of il17 seems to correlate with the lack of IL-17 expression, as in
IFNγ+ TH cells, whereas unmethylated regions correspond with active expression of IL-
17.
The CpG island 9 kb upstream of rorc was mostly unmethylated in IFNγ+ and IL-
17+IFNγ+ TH cells, whereas unexpectedly, in IL-17+ TH cells this region was strongly
methylated, even though these cells have a high expression of RORγt (Figure 25).
Figure 23. 5 kb region upstream of il17 (IL-17-1). 4 CpGs were analyzed in 18 clones of
each subset for cytosine methylation. Each box represents one CpG.
Figure 24. Promoter region upstream of il17 (IL-17-2). 4 CpGs were analyzed in
18 clones of each subset for methylation of cytosines.
IL-17+ TH cells
IL-17+IFNγ+
TH cells
IFNγ+ TH cells
IL-17+ TH cells
IL-17+IFNγ+
TH cells
IFNγ+ TH cells
Results
60
Figure 25. 9 kb region upstream of rorc (RORγt-1.) 48 CpGs were analyzed in 16 clones of
each subset for cytosine methylation.
IL-17+ TH cells
IL-17+IFNγ+
TH cells
IFNγ+ TH cells
Results
61
Potential transcription factor binding sites were analyzed for RORγt-1 by using
MatInspector (Genomatix software). 2 putative T-bet binding sites, as well as 7 CTCF
binding sites were detected (Figure 26). However, if these transcription factors are able
to bind in this region and whether CpG methylation has an impact on the ability to bind,
remains to be determined.
For the region 1 kb upstream of rorc methylated cytosines were highly enriched in all
tested TH cell subsets (Figure 27).
Interestingly, the region directly upstream of the first rorγt exon showed nearly no
methylation of CpGs in all of the tested TH cell subsets (Figure 28). As methylation is
associated with silencing of genes, this suggests a silenced RORγ on the one hand
and an active RORγt on the other.
Figure 27. 1 kb region upstream of rorc (RORγt-2). 11 CPGs were analyzed in 15 clones
of each subset for cytosine methylation.
IL-17+ TH cells
IL-17+IFNγ+
TH cells
IFNγ+ TH cells
Figure 26. Putative binding sites in the complete CPG island 9 kb upstream of rorc. 2
potential T-bet binding sites (dark green) and 7 CTCF binding sites (green) were detected using
MatInspector.
Results
62
Whereas DNA methylation of the regions upstream of il17 correlated with IL-17
expression, the rorc locus seems to be modified in a bivalent manner. A potential
regulatory element was identified 9 kb upstream of rorc, which has to be analyzed
further.
Figure 28. Potential promoter region upstream of rorγt (RORγt-3). 11 CPGs were
analyzed in 19 clones of each subset for cytosine methylation.
IL-17+ TH cells
IL-17+IFNγ+
TH cells
IFNγ+ TH cells
Discussion
63
6 Discussion
CD4+ T cells are critically involved in autoimmunity, allergy and asthma and the
concept of distinct TH cell lineages has provided a simple model for the
conceptualization of CD4+ cell differentiation. However, are the different TH cell subsets
really distinct lineages, and if they are, how stable or plastic are they? Commitment of
TH cells into distinct lineages during differentiation was proposed to involve stable
programs of gene expression correlating with epigenetic changes at the loci of cytokine
genes (Ansel et al., 2003; Bird et al., 1998; Murphy et al., 1996). Consistently, cytokine
genes were shown to be stably expressed even under conditions, which favor
differentiation of other effector lineages (Assenmacher et al., 1998; Lohning et al.,
2002; Murphy et al., 1996). However, many recent publications have challenged the
existing paradigm concerning stable, inconvertible committed TH cells lineages (Hegazy
et al., 2010; Zhou et al., 2008).
IL-17 expressing TH lymphocytes have been recognized as a separate lineage of TH
cell differentiation, distinct from the TH1 and TH2 lineages (Harrington et al., 2005; Park
et al., 2005). Stability and plasticity of the cytokine memory of TH17 memory effector
cells has been a matter of debate, especially in light of reports describing TH cells
expressing both IL-17 and IFNγ (Acosta-Rodriguez et al., 2007; Annunziato et al.,
2007; Infante-Duarte et al., 2000; Suryani and Sutton, 2007). Therefore, we
concentrated on the interconversion between TH17 and TH1 cells. We analyzed the
plasticity of TH17 cells by generating an IL-17 secretion assay in cooperation with
Miltenyi Biotec GmbH in order to isolate viable TH17 cells, either from in vitro cultures
or directly ex vivo.
Understanding the molecular mechanisms, which stabilize TH cell subsets and the
conditions allowing plasticity of these subsets, is of major importance for the
development of new therapies. Transfer of Tregs in some mice with autoimmunity has
been shown to ameliorate disease. Therefore, administration of human Tregs in
patients has been considered as a treatment for various human autoimmune diseases.
In a series of studies investigating the behavior of Tregs in the intestine however, it was
shown that Treg cells have the propensity to differentiate into pro-inflammatory TH17
cells (Xu et al., 2007). This could have disastrous consequences, if this was the case
during treatment of an autoimmune disease. Thus, gaining more knowledge on the
Discussion
64
stability and plasticity of TH cell subsets might revise our approaches for treating such
diseases.
6.1 TH1 and TH2 cells cannot cross-differentiate into TH17 cells
Almost a quarter of a century ago, it was recognized that cytokine production by TH
cells was not stochastic, but could rather be divided into two subsets, TH1 and TH2 cells
producing IFNγ and IL-4, respectively (Mosmann et al., 1986). Stable cytokine
production was only observed after a set number of cell divisions under polarizing
conditions, which was interpreted as a requirement for establishing a stable
transcriptional program (Bird et al., 1998; Grogan et al., 2001). Also, the requirement
for specific master transcription factors, T-bet for TH1 and Gata3 for TH2 cells, further
supported the lineage model. Richter et al. showed that the initial S phase of T cell
activation is required for the instruction of TH cells to express IL-4 or IL-10 upon re-
stimulation (Richter et al., 1999). This observation points to a decisive role of
epigenetic modifications of cytokine genes as a molecular correlate of the memory to
express particular cytokines. For the cytokine memory of TH1 and TH2 cells molecular
mechanisms have been described which prevent the differentiation of TH1 into TH2
cells and vice versa. The commitment to the TH1 cell lineage is associated with the
expression of the β2 chain of the IL-12 receptor complex, thereby conferring
responsiveness to IL-12. Induction of IL12Rβ2 is dependent on T-bet induction through
IFNγ and Stat1 signaling (Afkarian et al., 2002; Mullen et al., 2001; Schulz et al., 2009).
IL-4 has been shown to repress IL-12 signaling through inhibition of IL12Rβ2
expression, thereby antagonizing TH1 differentiation (Szabo et al., 1997). Furthermore,
Gata3 has been shown to down-regulate Stat4 expression and thereby stabilizing the
TH2 phenotype (Usui et al., 2003). TH1 cytokines on the other hand, repress TH2
differentiation through a feed-forward mechanism. IFNγ induces T-bet, which
subsequently induces expression of Runx3. T-bet then cooperates with Runx3 to
further promote IFNγ production, while at the same time silencing the il4 gene in TH1
cells through binding to the ifnγ promoter and the il4 silencer, respectively (Ansel et al.,
2004; Djuretic et al., 2007; Naoe et al., 2007). However, cross-regulation during TH1
and TH2 differentiation has been demonstrated in several studies. In a recent study,
Gata3+T-bet+ and IL-4+IFNγ+ TH cells were described in vivo (Hegazy et al., 2010).
Gata3+ TH2 cells could be re-programmed by type I and type II interferons plus IL-12 in
vitro. This lineage re-programming was T-bet-dependent and resulted in TH cells co-
expressing Gata3 and T-bet and producing both IFNγ and IL-4. These cells were stably
maintained in vivo for months, suggesting lineage-like properties.
Discussion
65
To what extent TH1 and TH2 cells are refractory to TH17 inducing signals was not clear
so far. We show here that in vitro generated TH1 and TH2 cells cannot convert into TH17
cells by the bona fide TH17 instructive signals TGFβ, IL-6, and IL-23, simultaneously
blocking IL-4 and IFNγ. Interestingly TH1 cells polarized under TH17 conditions up-
regulate RORα and ROt 2- and 6-fold on mRNA level, respectively. However, this
up-regulation of TH17 lineage master transcription factors is apparently not sufficient for
the induction of IL-17 expression in such TH1 cells. This may be due to even further up-
regulation of T-bet in TH1 cells under TH17 polarizing conditions, as T-bet has been
described as a negative regulator of TH17 differentiation (Gocke et al., 2007; Mathur et
al., 2006). In TH2 cells, Gata3 is down-regulated 2-3-fold and RORγt up-regulated 4-
fold upon re-stimulation in a TH17 inducing cytokine milieu. Expression of IL-23
receptor and RORα was not up-regulated. It has been shown that ectopic expression of
RORγt in combination with RORα in TH1 and TH2 cells can lead to expression of IL-17
(Martinez et al., 2008). However, in those experiments RORγt and RORα were
expressed in TH cells that may have been not fully committed to the TH1 or TH2 lineage.
Another possibility is that the concentration of RORγt and RORα achieved under these
conditions is too low compared to cells in which these transcription factors are over-
expressed. Accordingly, higher expression of RORγt and RORα might “overrun” the
negative effects T-bet has on TH17 differentiation.
As IFNγ has been shown to exhibit negative effects on TH17 differentiation and thus,
could inhibit the conversion of TH1 to TH17 cells, we generated TH1 cells in vitro from
IFNγR deficient mice and cultured them under TH17-inducing conditions (Harrington et
al., 2005). As there was only minor expression of IL-17 in TH1 cells from IFNγR
deficient mice compared to wt TH1 cells, we concluded that IFNγ signaling is not
responsible for the lack of IL-17 induction in TH1 cells under TH17 conditions.
Suryani et al. have suggested that IL-17/IFNγ co-expressing cells are derived from TH1
cells gaining the ability to express IL-17 (Suryani and Sutton, 2007). While we do not
exclude this option here, the conversion of TH1 cells into TH1/17 cells must require
signals different from the canonical TH17 differentiation signals TGFβ and IL-6. Neither
in vitro generated TH1 cells, nor ex vivo isolated TH1 cells, as was show here, can be
induced to express IL-17 by combined action of TGFβ, IL-6 and IL-23. Although T-bet
was slightly reduced in in vivo generated TH1 cells under TH17 inducing conditions, we
could not detect any up-regulation of RORγt and also no induction of IL-17. Down-
regulation of T-bet by TGFβ has been described in several publications (Lin et al.,
2005; Yang et al., 2008c). For instance, TGFβ can prevent the development of
autoimmune disease by restraining the development of autoreactive TH1 cells. TGFβ
Discussion
66
was shown to inhibit TH1 development in part by suppressing the expression of T-bet,
but exactly how TGFβ suppresses T-bet is incompletely understood. Furthermore,
upon adoptive transfer, TH1 cells are not converted into TH1/17 cells in vivo (Lim et al.,
2008). Interestingly, as was recently published, in the absence of T-bet, IFNγ
production and TH1 differentiation are susceptible to inhibition by IL-6 and TGFβ (Yang
et al., 2008c). As a result, TH17 development is strongly favored, the threshold for
TGFβ requirement is lowered and IL-6 drives TH17 differentiation, illustrating an
important role for T-bet in directing T cell differentiation to TH1 vs TH17.
From our experiments and observations from other groups we conclude that TH1 cells
are especially averse to TH17 inducing signals and that TH cells producing both IL-17
and IFNγ probably are not generated from TH1 cells. However, to what extent TH1 cells
maintain their phenotype in vivo during immune reactions favoring TH17 differentiation
has not been sufficiently investigated so far.
6.2 In vivo generated TH17 cells are refractory to TH1- and TH2-
inducing signals
Next, we wanted to analyze the stability and plasticity of the TH17 phenotype. It had
already been shown that both IFNγ and IL-4 could inhibit the induction of IL-17 under
TH17 inducing conditions (Harrington et al., 2005), but it was still not clear how already
established TH17 cells react to TH1 or TH2 inducing conditions. Since TH17 cells
induced in vitro were heterogeneous with respect to IL-17 expression, it was necessary
to develop an IL-17 secretion assay allowing the isolation and analysis of IL-17
expression on the single cell level. This assay was used to analyze the memory of
TH17 cells for re-expression of IL-17 in TH17 cells generated in vitro as well as in vivo.
Isolated IL-17-expressing cells generated in vitro by activation of naïve TH cells in the
presence of TGFβ, IL-6 and IL-23 with concomitant blockade of IFand IL-4, failed to
re-express IL-17 upon later reactivation, if the original inducing signals were lacking, or
if IFNγ and IL-4 were not neutralized. Isolated IL-17+ or IL-17- TH cells showed the
same proliferation and survival during re-culture. We could therefore exclude the
possibility that contaminating cells were outgrowing IL-17+ cells and thereby give the
false impression that a subpopulation was responsible for the observed loss of IL-17+
cells. As it has been shown that the plasticity of TH1 and TH2 cells is dependent on
their differentiation state, we analyzed TH17 cells that had been primed once (6d) or
three times (18d) (Murphy et al., 1996). IL-17+ TH cells, even after three weeks of
repeated instruction for IL-17 expression could still be converted into IFNγ-expressing
TH1 cells with IL-12 or into IL-4-expressing TH2 cells with IL-4. As TH17 cells are readily
Discussion
67
converted into TH1 cells, we analyzed the role of T-bet, the TH1 master transcription
factor, by using T-bet KO mice. IL-17+ T-bet- TH cells were stable when stimulated with
IFNγ only, IL-12 only or both cytokines. This indicates that T-bet is responsible for the
conversion of TH17 into TH1 cells. Since both IFNγ and IL-12 signaling had no impact
on IL-17 re-expression, we conclude that in the absence of T-bet, Stat4 and Stat1
cannot inhibit IL-17 expression. The molecular mechanism, by which T-bet inhibits IL-
17 expression is not clear and has to be analyzed further.
In contrast to in vitro generated TH17 cells, IL-17 expressing TH cells isolated ex vivo
maintained a memory for IL-17 expression in vitro, even in the presence of IL-12 or IL-
4. These results indicate that there may be epigenetic differences between in vitro and
in vivo generated TH17 cells.
These results also suggest that the currently available in vitro protocols for the
induction of IL-17 expression in naïve TH cells lack signals for the induction of a stable
cytokine memory for IL-17 re-expression. Identification of in vitro culture conditions that
mimic in vivo environments would be of great aid to further dissect the signaling
pathways and the transcriptional regulatory networks of TH cell differentiation. Although
IL-17 expression was induced efficiently in vitro by TGFβ, IL-6, IL-23 and anti-IFNγ and
anti-IL-4, incomplete blocking of IFNγ or IL-4 during subsequent re-stimulation and
culture led to the loss of IL-17 re-expression in cells which once had expressed IL-17.
In consistence with this result, both IFNγ and IL-4 had been described as negative
regulators of IL-17 expression (Harrington et al., 2005; Park et al., 2005). Expression of
both RORγt and RORα was down-regulated in in vitro generated TH17 cells under
conditions where the cells did not re-express IL-17 and in particular under TH1- or TH2-
polarizing conditions. Unlike the memory for IL-10 expression in TH2 cells, requiring
multiple rounds of stimulation by IL-4 for stability (Chang et al., 2007; Lohning et al.,
2003), repeated in vitro stimulation in the presence of TGFβ, IL-6 and IL-23 did not
lead to a stable commitment for IL-17 expression. The cells were still plastic and
responded to the presence of IL-12 or IL-4 with differentiation into IFNγ-expressing TH1
or into IL-4-expressing TH2 cells, respectively. Expression of IL-17F in the in vitro
generated as well as in the ex vivo isolated TH17 cells did not correlate with the re-
expression of IL-17 after re-culture. IL-17F is highly homologous to IL-17 and the il17f
gene neighbors the il17 gene (Starnes et al., 2001), suggesting a coordinated
expression. While being highly expressed initially in cells sorted for IL-17 expression,
IL-17F expression was only maintained in the presence of TGFβ and IL-6. Interestingly,
IL-17F expression was also not stable in ex vivo isolated IL-17 expressing cells, either
indicating that the memory for IL-17F re-expression is conditional and depends on
Discussion
68
different or additional signals than that for IL-17 re-expression, or that maintained
RORγt and RORα expression may be required (Martinez et al., 2008), but may not be
sufficient for IL-17F expression. This observation was confirmed by a study showing
that TGFβ is the critical cytokine for IL-17F expression (Lee et al., 2009). However,
whether TG-signaling through Smads is directly or indirectly contributing to the
maintenance of IL-17F is not known.
Recent publications have shown that TH17 cells transferred into immunodeficient mice
are also plastic and convert to TH1 cells (Lee et al., 2009). The same was observed
when BDC2.5 CD4+ T cells were polarized into TH17 cells and subsequently adoptively
transferred into NOD-SCID mice (Bending et al., 2009). Here the TH17 cells caused β-
cell destruction and diabetes, but were also converted into TH1 cells. However, these in
vivo studies involved transferring cells into lymphopenic hosts, in which homeostatic
proliferation may influence the stability of TH differentiation. Interestingly, in a recent
publication the phenotype of in vitro generated TH17 cells adoptively transferred into
normal mice was maintained, even in the absence of antigen and inflammation
(Nurieva et al., 2009). It remains to be shown which factors contribute in vivo to
maintain IL-17 expression, as well as identifying how in vivo generated TH17 cells are
able to resist conversion into TH1 cells.
Here, we have demonstrated that IL-17 expressing cells generated in vitro are not
functionally imprinted for IL-17 re-expression. Their re-expression of IL-17 depends on
the continued presence of the canonical TH17-inducing signals. The conversion of in
vitro generated IL-17-expressing TH17 cells into IFNγ-expressing TH1 cells is T-bet-
dependent. IL-17 expressing TH cells generated in vivo on the other hand, are a stable
lineage of effector memory cells, distinct from TH1 and TH2 cells, and functionally
imprinted for re-expression of IL-17 upon TCR stimulation, even in the presence of TH1
or TH2 inducing conditions.
6.3 TH1/17 cells are induced from TH17 cells by subsequent
IFNγ- and IL-12- signaling
To determine which factors contribute to the stability of in vivo vs in vitro generated
TH17 cells, we compared expression of genes relevant for IL-12- and IFNγ-signaling in
a global gene expression analysis. We decided to concentrate on genes crucial for TH1
differentiation as TH cells producing both IL-17 and IFNγ have been described in vivo in
several autoimmune diseases in both mice and humans (Aarvak et al., 2000;
Annunziato et al., 2007; Infante-Duarte et al., 2000). Expression of the gene encoding
IL12Rβ2 was 2.5-fold up-regulated in in vitro compared to in vivo generated IL-17+ TH
Discussion
69
cells. This observation was further confirmed by real-time PCR. Expression of T-bet
and RORγt were higher in ex vivo isolated TH17 cells, whereas IFNγR2 was slightly
increased in in vitro generated TH17 cells. Both subsets responded to IFNγ signaling by
induction of Stat1 phosphorylation, pointing to expression of a functional IFNγ receptor.
Although differential expression of IL23R and IL12Rβ2 has been thought to distinguish
TH17 and TH1 developmental programs, we found that whereas IL12Rβ2 expression is
diminished in TH17 cells, it remains fully functional in in vitro generated TH17 cells.
Correspondingly, in vivo generated TH17 cells were refractory to IL-12 signaling. The
lack of IL12Rβ2 on ex vivo isolated TH17 cells was further confirmed by surface
staining. Therefore, in vivo generated TH17 cells are refractory to TH1-inducing signals
because these cells cannot respond to IL-12-signaling due to down-regulation of
IL12Rβ2. However, they still expressed the IFNγ receptor and responded to IFNγ
signaling. IFNγ signaling induced the expression of T-bet and of the IL12Rβ2 chain in
naïve TH cells (Afkarian et al., 2002; Mullen et al., 2001; Schulz et al., 2009). Schulz et
al. showed that IFNγ induced initial T-bet expression, whereas IL12Rβ2 was repressed
by TCR signaling. After termination of TCR signaling, IL12Rβ2 expression was up-
regulated by T-bet and subsequent IL-12 signaling was essential for maintenance of T-
bet expression. This late expression of T-bet, together with the up-regulation of the
transcription factors Runx3 and Hlx was required to imprint the TH cell for IFNγ re-
expression (Schulz et al., 2009). When ex vivo isolated IL-17+ TH cells were cultured in
the presence of IFNγ, a functional IL-12 receptor as well as T-bet was induced. RORγt
was neither affected by IFNγ- nor by IL-12-signaling. Sequential activation of in vivo
generated TH17 cells with IFNγ and IL-12, however, induced further up-regulation and
maintenance of T-bet expression. Expression of IFNγ was induced as well, and the Ifnγ
gene was imprinted for re-expression. No expression of IL12Rβ2 and high expression
of IFNγR2 are typical features of naïve CD4+ T cells (Groux et al., 1997; Tau et al.,
2000). Thus, in vivo generated TH17 cells behave like naïve TH cells (Schulz et al.,
2009), except that they maintain also their enhanced expression of RORγt and
expression of IL-17.
Taken together, we here provide a molecular mechanism for the generation of a
distinct TH cell population characterized by the additive phenotypes of TH1 and TH17
cells, the TH1/17 cells. TH1/17 cells are characterized by the co-expression of the
cytokines IFNγ and IL-17 and the lineage-defining and -determining transcription
factors T-bet and RORγt. TH1/17 cells develop from TH17 cells upon synergistic action
of IFNγ, required for the up-regulation of the IL12Rβ2 chain, and IL-12. IL12Rβ2
signaling is crucial for stable imprinting of TH1 cells (Schulz et al., 2009). It remains to
Discussion
70
be shown how expression of the IL12Rβ2 chain is down-regulated in TH17 cells in vivo.
Evidence has been provided that IL-17 itself directly (Toh et al., 2009) or indirectly, by
inducing antigen-presenting cells to release as yet unidentified factors (Nakae et al.,
2007), down-regulates IL12Rβ2 chain expression in activated TH cells.
In order to analyze TH1/17 cells generated in vivo, we isolated IL-17+IFNγ+ TH cells ex
vivo from mice immunized with MOG peptide. IL-17+ and IL-17+IFNγ+ TH cells are
induced upon immunization in the spleen of these mice and can be readily isolated. As
expected, IFNγ+ TH cells expressed high amounts of T-bet and no RORγt, IL-17+ TH
cells expressed high amounts of RORγt and slightly increased levels of T-bet, whereas
IL-17+IFNγ+ TH cells expressed high amounts of both T-bet and RORγt. This was
confirmed on mRNA level by real-time PCR. RORα was up-regulated in both subsets
producing IL-17 and low expression was detectable in IFNγ+ TH cells. Interestingly, the
IL-23 receptor was strongly down-regulated in IL-17+IFNγ+ compared to IL-17+ TH cells,
whereas it was not detectable in IFNγ+ TH cells. The IL-23 receptor has been shown to
be up-regulated by IL-6-signaling and RORγt and down-regulated by T-bet (Gocke et
al., 2007; Maggi et al., 2010; Yang et al., 2007). As TH1/17 cells have a high expression
of both T-bet and RORγt, it implies that the elevating effect for IL-17 expression by
RORγt can overrule the inhibitory effect of T-bet, as these cells are still able to produce
IL-17. IL12Rβ2 was undetectable in IL-17+ TH cells, but highly up-regulated in IL-
17+IFNγ+ and IFNγ+ TH cells. IFNγR2 was up-regulated in IL-17+ TH cells, but only low
expression was detectable in TH cells producing IFNγ. Consequently, down-regulation
of IL23R with simultaneous up-regulation of IL12Rβ2 in IL-17+IFNγ+ TH cells could lead
to “preferential” skewing towards a TH1 phenotype of these cells. Nevertheless, IL-
17+IFNγ+ TH cells are characterized by expression of cytokines and transcription factors
known to be hallmarks of both TH17 and TH1 cells.
Next we analyzed the stability of IL-17+IFNγ+ TH cells by culturing these cells under
neutral conditions. Although IL-17 expression was strongly down- and IFNγ up-
regulated within 2 rounds of stimulation, expression of T-bet and RORγt remained
stable. RORγt was however, slightly down-regulated. Simultaneous expression of T-bet
and RORγt appears to be a stable feature in TH1/17 cells. Re-expression for IL-17 on
the other hand is less faithful in these cells. To what extent TH1/17 cells are still able to
convert back into TH17 cells or if these cells are preferentially inclined towards a TH1
phenotype, as indicated here, has not been investigated so far.
Discussion
71
6.4 DNA methylation of TH17, TH1/17 and TH1 cells
In several publications silencing of the il4 gene in TH1 or the ifnγ gene in TH2 cells has
been demonstrated (Grogan et al., 2001; Jones and Chen, 2006). The methylation of
single CpG sites in cytokine gene promoters has been shown to silence gene
expression by preventing binding for TCR responsive transcription factors (Jones and
Chen, 2006; Murayama et al., 2006). So far, the regulatory mechanisms and epigenetic
processes that control TH17 cell differentiation have only been partially characterized.
In the 8 described conserved non-coding sequences as well as in the promoter of il17,
permissive H3 acetylation is induced in naïve CD4+ T cells that are cultured under TH17
polarizing conditions compared to TH1 or TH2 conditions (Akimzhanov et al., 2007). As
we could not find any CpG islands in these conserved non-coding sequences, we
analyzed a region which has been reported as a RORγt-dependent enhancer located 5
kb upstream of the il17 transcriptional start site (IL-17-1) (Zhang et al., 2008) and the
proximal promoter of il17 (IL-17-2). These regions contained several CpGs that were
analyzed for methylation. The methylation upstream of il17 corresponded with
expression of IL-17, that is, the regions upstream of il17 were completely unmethylated
in IL-17+, somewhat methylated in IL-17+IFNγ+ and strongly methylated in IFNγ+ TH
cells. However, if methylation of the 5 kb-upstream region is blocking the binding of
RORγt and thereby the production of IL-17, remains to be shown.
RORγ and RORγt are both encoded by rorc. RORγt shares an identical nucleotide
sequence with RORγ from exon 3 through the last exon. Winoto and Littman et al.
suggested an alternative promoter, whereas Ortiz et al. proposed alternate splicing to
be responsible for the generation of RORγt (He et al., 1998; Ortiz et al., 1995; Winoto
and Littman, 2002). The putative promoter region of the rorγt gene was unmethylated
in all three subsets, whereas the region 1 kb upstream of rorc was characterized by a
high quantity of methylated CpGs. This could support the model of an alternative
promoter, instead of alternative splicing as was proposed by Ortiz et al. The methylated
region 1kb upstream of rorc could be the reason why RORγ is silenced in all TH cell
subsets, as RORγ is highly expressed only in thymus, kidney, liver, muscle, brown fat,
but not in cells of the immune system (Hirose et al., 1994; Jetten, 2009; Kurebayashi et
al., 2000). It would be interesting to test if this region is unmethylated in cells known to
express RORγ.
Interestingly, whereas the CpG island 9 kb upstream of rorc in IL-17+IFNγ+ and IFNγ+
TH cells was only partially unmethylated, this region displayed a distinct pattern of
Discussion
72
highly methylated CpGs in IL-17+ TH cells. This was surprising as IL-17+ TH cells highly
express RORγt. Assuming this region plays a role in the regulation of RORγt, there
could be several explanations for why a region upstream of a gene known to be
expressed by the same cell is methylated. One possibility is through methylation of this
region transcriptional repressors are unable to bind and therefore cannot suppress
rorc/rorγt transcription. Interestingly, in this region, seven potential binding sites for
CCCTC-binding factor (CTCF) were found. The 11-zinc finger protein CTCF is an
ubiquitously expressed and highly conserved transcriptional regulator implicated in
many key processes within the nucleus, including promoter activation and repression
(Ohlsson et al., 2001). CTCF has been shown to bind in the vicinity of insulators,
elements that affect gene expression by preventing the spread of heterochromatin, and
to inhibit inappropriate interactions between regulatory elements on adjacent chromatin
domains, thus acting as an enhancer blocker (Bell et al., 1999; Wallace and Felsenfeld,
2007). It has been shown that CTCF preferentially associates with unmethylated CpG
dinucleotides (Kanduri et al., 2000; Ling et al., 2006). As the analyzed region is strongly
methylated in IL-17+ TH cells, it would be possible that CTCF is therefore unable to bind
and consequently, cannot block potential enhancer elements further upstream. Since
this region is mostly unmethylated in IL-17+IFNγ+ and TH cells, CTCF would possibly be
able to bind, thereby inhibiting an enhancer. This could explain the lower expression of
RORγt in these cells.
Furthermore, two potential T-bet binding sites were found in this region. High
methylation could affect the binding to its motif; thereby T-bet would be unable to
perform potential negative effects on rorc/rorγt transcription. This could also explain the
difference of stability observed between IL-17+ and IL-17+IFNγ+ TH cells as well as the
lower expression of RORγt in IL17+IFNγ+ TH cells.
Whether T-bet or CTCF are principally able to bind in this region would have to be
tested in chromatin immunoprecipitation experiments.
Interestingly, it has been shown that whereas histones in the tbx21 locus are modified
in a bivalent manner in TH cells subsets, rorc and il17 are repressed in TH1 cells (Wei et
al., 2009). In contrast to histone modifications providing labile transcriptional
repression, DNA methylation is a highly stable silencing mark that is not easily
reversed. It was suggested, in consideration of the bivalent modifications in the tbx21
locus, that it would be possible to convert TH17 cells into a TH1 cells. As both rorc and
il17 were shown to have repressive marks in TH1 cells, it was proposed that it would be
more difficult to induce a TH17 phenotype in established TH1 cells. For both hypotheses
Discussion
73
evidence has been provided here. We could not find any TH1 specific DNA methylation
pattern in the rorc locus, however. Although DNA methylation and histone modification
are carried out by different chemical reactions and require different sets of enzymes, a
biological relationship between the two systems has been shown. It has been
described that DNA methylation and specific histone modifications might influence
each other (Cedar and Bergman, 2009). The relationship has been suggested to work
in both directions: histone methylation can help to direct DNA methylation patterns, and
DNA methylation might serve as a template for some histone modifications after DNA
replication. However, the presence of histone methylation at H3K9 or H3K27 does not
always lead to de novo methylation and vice versa. Our results are therefore not
necessarily in conflict with their data (Wei et al., 2009). Furthermore, whereas we
analyzed TH cell subsets isolated ex vivo, they used in vitro generated TH cells for the
analysis. This could further explain the discrepancy observed between our
experiments.
6.5 Conclusion and Perspective
What significance do TH1/17 cells have? The physiological advantage of TH1/17 cells
over TH1 and TH17 cells could be their combined effector repertoire on the single cell
level, co-expressing IFNγ and IL-17, but also chemokine receptors of both TH1 and
TH17 cells (Lim et al., 2008), i.e. CCR2, CCR5 and CXCR3 of TH1 and CCR4 and
CCR6 of TH17 cells, allowing them to deliver their cytokines at non-canonical locations.
E.g. TH1/17 cells could deliver IL-17 into inflamed tissue, attracted by the CXCR3
ligands CXCL9, 10 or 11 (Janke et al., 2010). In consistence with this assumption it
was suggested that TH1/17 cells have an advantage over TH17 and TH1 cells in
crossing the blood-brain barrier (BBB) and in accessing the central nervous system
(Kebir et al., 2009). Evidence has been provided that IFNγ up-regulates the expression
of ICAM-1 on the surface of BBB-endothelial cells, which is an important adhesion
molecule that controls TH17 lymphocyte migration across the BBB. As TH1/17 cells
express IFNγ and possess a TH17 phenotype, this might positively affect the capacity
of these cells to enter the central nervous system.
What implications do plastic/mixed TH cell subsets have for classification of TH cells
subsets? This work and other reports have shown that differentiated effector TH cells
have are a lot more flexible than previously thought (Hegazy et al., 2010; Lee et al.,
2009; Lexberg et al., 2008; Xu et al., 2007). Hegazy et al. for instance described that
stably committed Gata3+ TH2 cells could adopt a Gata3+ T-bet+ and IL-4+IFNγ+ "TH2+1"
phenotype that was maintained in vivo for months. The emergence of an increasing
Discussion
74
number of new TH cell subsets as well as TH cells displaying a mixed phenotype has
raised the question to what extent the classification of TH cell subsets based on the
selective expression of cytokines is reasonable. TH cell lineages express lineage-
defining transcription factors, but as has been shown, transcription factor expression
can be dynamic and a particular subset, such as TH1/17 cells can express more than
one master regulator. In addition, the expression of a master transcription factor can be
lost or induced in committed TH cells. Therefore, it might be more accurate to view
cytokine-producing subsets in probabilistic terms. Certain factors increase the
probability of stably producing a certain cytokine, such as expression/suppression of
receptors, expression of transcription factors, as well as epigenetic modifications. All
these factors have to be taken into account when predicting whether a TH cell will
behave as a differentiated cell. Another factor worth considering is the level and ratio of
transcription factors in TH cells. Recently, it has been shown that RORγt is inhibited by
Stat4 and T-bet during IL-12-signaling, and that constitutive expression of RORγt has
an essential role in maintenance of the il17 locus (Mukasa et al., 2010). Hence,
enforced RORγt expression strongly inhibited IL-12-induced down-regulation of IL-17
through a mechanism which blunted Stat4 activation and induction of T-bet expression.
Therefore, rather than viewing transcription factor expression as an “all or none”
proposition, it may be more appropriate to consider that a range of TH cells exist with
varying ratios of different transcription factors and hence graded properties.
The plasticity and unstable phenotype of different TH cell subsets, for instance of TH17
cells, will have important biological implications for designing therapeutic regimens to
combat infections and control autoimmunity. Future experiments will have to clarify how
pronounced the plasticity of TH cell subsets is in vivo and how relevant this is for the
regulation of immune responses.
References
75
7 References
Aarvak, T., Chabaud, M., Thoen, J., Miossec, P., and Natvig, J.B. (2000). Changes in
the Th1 or Th2 cytokine dominance in the synovium of rheumatoid arthritis (RA): a
kinetic study of the Th subsets in one unusual RA patient. Rheumatology (Oxford) 39,
513-522.
Acosta-Rodriguez, E.V., Napolitani, G., Lanzavecchia, A., and Sallusto, F. (2007).
Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the
differentiation of interleukin 17-producing human T helper cells. Nat Immunol 8, 942-
949.
Afkarian, M., Sedy, J.R., Yang, J., Jacobson, N.G., Cereb, N., Yang, S.Y., Murphy,
T.L., and Murphy, K.M. (2002). T-bet is a STAT1-induced regulator of IL-12R
expression in naive CD4+ T cells. Nat Immunol 3, 549-557.
Agarwal, S., Misra, R., and Aggarwal, A. (2008). Interleukin 17 levels are increased in
juvenile idiopathic arthritis synovial fluid and induce synovial fibroblasts to produce
proinflammatory cytokines and matrix metalloproteinases. J Rheumatol 35, 515-519.
Aggarwal, S., and Gurney, A.L. (2002). IL-17: prototype member of an emerging
cytokine family. J Leukoc Biol 71, 1-8.
Agrawal, A., Dillon, S., Denning, T.L., and Pulendran, B. (2006). ERK1-/- mice exhibit
Th1 cell polarization and increased susceptibility to experimental autoimmune
encephalomyelitis. J Immunol 176, 5788-5796.
Akimzhanov, A.M., Yang, X.O., and Dong, C. (2007). Chromatin remodeling of
interleukin-17 (IL-17)-IL-17F cytokine gene locus during inflammatory helper T cell
differentiation. J Biol Chem 282, 5969-5972.
Annunziato, F., Cosmi, L., Santarlasci, V., Maggi, L., Liotta, F., Mazzinghi, B., Parente,
E., Fili, L., Ferri, S., Frosali, F., et al. (2007). Phenotypic and functional features of
human Th17 cells. J Exp Med 204, 1849-1861.
Ansel, K.M., Greenwald, R.J., Agarwal, S., Bassing, C.H., Monticelli, S., Interlandi, J.,
Djuretic, I.M., Lee, D.U., Sharpe, A.H., Alt, F.W., et al. (2004). Deletion of a conserved
Il4 silencer impairs T helper type 1-mediated immunity. Nat Immunol 5, 1251-1259.
Ansel, K.M., Lee, D.U., and Rao, A. (2003). An epigenetic view of helper T cell
differentiation. Nat Immunol 4, 616-623.
Assenmacher, M., Lohning, M., Scheffold, A., Richter, A., Miltenyi, S., Schmitz, J., and
Radbruch, A. (1998). Commitment of individual Th1-like lymphocytes to expression of
IFN-gamma versus IL-4 and IL-10: selective induction of IL-10 by sequential stimulation
of naive Th cells with IL-12 and IL-4. J Immunol 161, 2825-2832.
Awane, M., Andres, P.G., Li, D.J., and Reinecker, H.C. (1999). NF-kappa B-inducing
kinase is a common mediator of IL-17-, TNF-alpha-, and IL-1 beta-induced chemokine
promoter activation in intestinal epithelial cells. J Immunol 162, 5337-5344.
Axtell, R.C., de Jong, B.A., Boniface, K., van der Voort, L.F., Bhat, R., De Sarno, P.,
Naves, R., Han, M., Zhong, F., Castellanos, J.G., et al. (2010). T helper type 1 and 17
cells determine efficacy of interferon-beta in multiple sclerosis and experimental
encephalomyelitis. Nat Med 16, 406-412.
Ballas, Z.K. (1984). The use of 5-azacytidine to establish constitutive interleukin 2-
producing clones of the EL4 thymoma. J Immunol 133, 7-9.
Batten, M., Li, J., Yi, S., Kljavin, N.M., Danilenko, D.M., Lucas, S., Lee, J., de Sauvage,
F.J., and Ghilardi, N. (2006). Interleukin 27 limits autoimmune encephalomyelitis by
suppressing the development of interleukin 17-producing T cells. Nat Immunol 7, 929-
936.
Bell, A.C., West, A.G., and Felsenfeld, G. (1999). The protein CTCF is required for the
enhancer blocking activity of vertebrate insulators. Cell 98, 387-396.
References
76
Bending, D., De La Pena, H., Veldhoen, M., Phillips, J.M., Uyttenhove, C., Stockinger,
B., and Cooke, A. (2009). Highly purified Th17 cells from BDC2.5NOD mice convert
into Th1-like cells in NOD/SCID recipient mice. J Clin Invest.
Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T.B., Oukka, M., Weiner, H.L., and
Kuchroo, V.K. (2006). Reciprocal developmental pathways for the generation of
pathogenic effector TH17 and regulatory T cells. Nature 441, 235-238.
Bettelli, E., Sullivan, B., Szabo, S.J., Sobel, R.A., Glimcher, L.H., and Kuchroo, V.K.
(2004). Loss of T-bet, but not STAT1, prevents the development of experimental
autoimmune encephalomyelitis. J Exp Med 200, 79-87.
Bird, J.J., Brown, D.R., Mullen, A.C., Moskowitz, N.H., Mahowald, M.A., Sider, J.R.,
Gajewski, T.F., Wang, C.R., and Reiner, S.L. (1998). Helper T cell differentiation is
controlled by the cell cycle. Immunity 9, 229-237.
Bock, C., Reither, S., Mikeska, T., Paulsen, M., Walter, J., and Lengauer, T. (2005).
BiQ Analyzer: visualization and quality control for DNA methylation data from bisulfite
sequencing. Bioinformatics 21, 4067-4068.
Brustle, A., Heink, S., Huber, M., Rosenplanter, C., Stadelmann, C., Yu, P., Arpaia, E.,
Mak, T.W., Kamradt, T., and Lohoff, M. (2007). The development of inflammatory T(H)-
17 cells requires interferon-regulatory factor 4. Nature immunology 8, 958-966.
Bush, K.A., Farmer, K.M., Walker, J.S., and Kirkham, B.W. (2002). Reduction of joint
inflammation and bone erosion in rat adjuvant arthritis by treatment with interleukin-17
receptor IgG1 Fc fusion protein. Arthritis Rheum 46, 802-805.
Butti, E., Bergami, A., Recchia, A., Brambilla, E., Del Carro, U., Amadio, S., Cattalini,
A., Esposito, M., Stornaiuolo, A., Comi, G., et al. (2008). IL4 gene delivery to the CNS
recruits regulatory T cells and induces clinical recovery in mouse models of multiple
sclerosis. Gene Ther 15, 504-515.
Cedar, H., and Bergman, Y. (2009). Linking DNA methylation and histone modification:
patterns and paradigms. Nat Rev Genet 10, 295-304.
Chabaud, M., Garnero, P., Dayer, J.M., Guerne, P.A., Fossiez, F., and Miossec, P.
(2000). Contribution of interleukin 17 to synovium matrix destruction in rheumatoid
arthritis. Cytokine 12, 1092-1099.
Chang, H.D., Helbig, C., Tykocinski, L., Kreher, S., Koeck, J., Niesner, U., and
Radbruch, A. (2007). Expression of IL-10 in Th memory lymphocytes is conditional on
IL-12 or IL-4, unless the IL-10 gene is imprinted by GATA-3. Eur J Immunol 37, 807-
817.
Cua, D.J., Sherlock, J., Chen, Y., Murphy, C.A., Joyce, B., Seymour, B., Lucian, L., To,
W., Kwan, S., Churakova, T., et al. (2003). Interleukin-23 rather than interleukin-12 is
the critical cytokine for autoimmune inflammation of the brain. Nature 421, 744-748.
Diveu, C., McGeachy, M.J., Boniface, K., Stumhofer, J.S., Sathe, M., Joyce-Shaikh, B.,
Chen, Y., Tato, C.M., McClanahan, T.K., de Waal Malefyt, R., et al. (2009). IL-27
blocks RORc expression to inhibit lineage commitment of Th17 cells. J Immunol 182,
5748-5756.
Djuretic, I.M., Levanon, D., Negreanu, V., Groner, Y., Rao, A., and Ansel, K.M. (2007).
Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T
helper type 1 cells. Nat Immunol 8, 145-153.
Ferber, I.A., Brocke, S., Taylor-Edwards, C., Ridgway, W., Dinisco, C., Steinman, L.,
Dalton, D., and Fathman, C.G. (1996). Mice with a disrupted IFN-gamma gene are
susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J
Immunol 156, 5-7.
Ferretti, S., Bonneau, O., Dubois, G.R., Jones, C.E., and Trifilieff, A. (2003). IL-17,
produced by lymphocytes and neutrophils, is necessary for lipopolysaccharide-induced
airway neutrophilia: IL-15 as a possible trigger. J Immunol 170, 2106-2112.
Fitzgerald, D.C., Ciric, B., Touil, T., Harle, H., Grammatikopolou, J., Das Sarma, J.,
Gran, B., Zhang, G.X., and Rostami, A. (2007). Suppressive effect of IL-27 on
encephalitogenic Th17 cells and the effector phase of experimental autoimmune
encephalomyelitis. J Immunol 179, 3268-3275.
References
77
Fossiez, F., Djossou, O., Chomarat, P., Flores-Romo, L., Ait-Yahia, S., Maat, C., Pin,
J.J., Garrone, P., Garcia, E., Saeland, S., et al. (1996). T cell interleukin-17 induces
stromal cells to produce proinflammatory and hematopoietic cytokines. J Exp Med 183,
2593-2603.
Gocke, A.R., Cravens, P.D., Ben, L.H., Hussain, R.Z., Northrop, S.C., Racke, M.K.,
and Lovett-Racke, A.E. (2007). T-bet regulates the fate of Th1 and Th17 lymphocytes
in autoimmunity. J Immunol 178, 1341-1348.
Gonzalez-Garcia, I., Zhao, Y., Ju, S., Gu, Q., Liu, L., Kolls, J.K., and Lu, B. (2009). IL-
17 signaling-independent central nervous system autoimmunity is negatively regulated
by TGF-beta. J Immunol 182, 2665-2671.
Gorham, J.D., Guler, M.L., Fenoglio, D., Gubler, U., and Murphy, K.M. (1998). Low
dose TGF-beta attenuates IL-12 responsiveness in murine Th cells. J Immunol 161,
1664-1670.
Gran, B., Zhang, G.X., Yu, S., Li, J., Chen, X.H., Ventura, E.S., Kamoun, M., and
Rostami, A. (2002). IL-12p35-deficient mice are susceptible to experimental
autoimmune encephalomyelitis: evidence for redundancy in the IL-12 system in the
induction of central nervous system autoimmune demyelination. J Immunol 169, 7104-
7110.
Grogan, J.L., Mohrs, M., Harmon, B., Lacy, D.A., Sedat, J.W., and Locksley, R.M.
(2001). Early transcription and silencing of cytokine genes underlie polarization of T
helper cell subsets. Immunity 14, 205-215.
Groux, H., Sornasse, T., Cottrez, F., de Vries, J.E., Coffman, R.L., Roncarolo, M.G.,
and Yssel, H. (1997). Induction of human T helper cell type 1 differentiation results in
loss of IFN-gamma receptor beta-chain expression. J Immunol 158, 5627-5631.
Gyulveszi, G., Haak, S., and Becher, B. (2009). IL-23-driven encephalo-tropism and
Th17 polarization during CNS-inflammation in vivo. Eur J Immunol 39, 1864-1869.
Harrington, L.E., Hatton, R.D., Mangan, P.R., Turner, H., Murphy, T.L., Murphy, K.M.,
and Weaver, C.T. (2005). Interleukin 17-producing CD4+ effector T cells develop via a
lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol 6, 1123-1132.
He, D., Wu, L., Kim, H.K., Li, H., Elmets, C.A., and Xu, H. (2006). CD8+ IL-17-
producing T cells are important in effector functions for the elicitation of contact
hypersensitivity responses. J Immunol 177, 6852-6858.
He, Y.W., Deftos, M.L., Ojala, E.W., and Bevan, M.J. (1998). RORgamma t, a novel
isoform of an orphan receptor, negatively regulates Fas ligand expression and IL-2
production in T cells. Immunity 9, 797-806.
Hegazy, A.N., Peine, M., Helmstetter, C., Panse, I., Frohlich, A., Bergthaler, A., Flatz,
L., Pinschewer, D.D., Radbruch, A., and Lohning, M. (2010). Interferons Direct Th2 Cell
Reprogramming to Generate a Stable GATA-3(+)T-bet(+) Cell Subset with Combined
Th2 and Th1 Cell Functions. Immunity.
Hirose, T., Smith, R.J., and Jetten, A.M. (1994). ROR gamma: the third member of
ROR/RZR orphan receptor subfamily that is highly expressed in skeletal muscle.
Biochem Biophys Res Commun 205, 1976-1983.
Huang, F., Kao, C.Y., Wachi, S., Thai, P., Ryu, J., and Wu, R. (2007). Requirement for
both JAK-mediated PI3K signaling and ACT1/TRAF6/TAK1-dependent NF-kappaB
activation by IL-17A in enhancing cytokine expression in human airway epithelial cells.
J Immunol 179, 6504-6513.
Hymowitz, S.G., Filvaroff, E.H., Yin, J.P., Lee, J., Cai, L., Risser, P., Maruoka, M., Mao,
W., Foster, J., Kelley, R.F., et al. (2001). IL-17s adopt a cystine knot fold: structure and
activity of a novel cytokine, IL-17F, and implications for receptor binding. EMBO J 20,
5332-5341.
Infante-Duarte, C., Horton, H.F., Byrne, M.C., and Kamradt, T. (2000). Microbial
lipopeptides induce the production of IL-17 in Th cells. J Immunol 165, 6107-6115.
Inoue, D., Numasaki, M., Watanabe, M., Kubo, H., Sasaki, T., Yasuda, H., Yamaya, M.,
and Sasaki, H. (2006). IL-17A promotes the growth of airway epithelial cells through
ERK-dependent signaling pathway. Biochem Biophys Res Commun 347, 852-858.
References
78
Ivanov, II, McKenzie, B.S., Zhou, L., Tadokoro, C.E., Lepelley, A., Lafaille, J.J., Cua,
D.J., and Littman, D.R. (2006). The orphan nuclear receptor RORgammat directs the
differentiation program of proinflammatory IL-17+ T helper cells. Cell 126, 1121-1133.
Jager, A., Dardalhon, V., Sobel, R.A., Bettelli, E., and Kuchroo, V.K. (2009). Th1, Th17,
and Th9 effector cells induce experimental autoimmune encephalomyelitis with
different pathological phenotypes. J Immunol 183, 7169-7177.
Janke, M., Peine, M., Nass, A., Morawietz, L., Hamann, A., and Scheffold, A. (2010). In
vitro-induced Th17 cells fail to induce inflammation in vivo and show an impaired
migration into inflamed sites. Eur J Immunol.
Jetten, A.M. (2009). Retinoid-related orphan receptors (RORs): critical roles in
development, immunity, circadian rhythm, and cellular metabolism. Nucl Recept Signal
7, e003.
Jones, B., and Chen, J. (2006). Inhibition of IFN-gamma transcription by site-specific
methylation during T helper cell development. EMBO J 25, 2443-2452.
Jovanovic, D.V., Di Battista, J.A., Martel-Pelletier, J., Jolicoeur, F.C., He, Y., Zhang, M.,
Mineau, F., and Pelletier, J.P. (1998). IL-17 stimulates the production and expression
of proinflammatory cytokines, IL-beta and TNF-alpha, by human macrophages. J
Immunol 160, 3513-3521.
Kanduri, C., Pant, V., Loukinov, D., Pugacheva, E., Qi, C.F., Wolffe, A., Ohlsson, R.,
and Lobanenkov, V.V. (2000). Functional association of CTCF with the insulator
upstream of the H19 gene is parent of origin-specific and methylation-sensitive. Curr
Biol 10, 853-856.
Kang, Z., Altuntas, C.Z., Gulen, M.F., Liu, C., Giltiay, N., Qin, H., Liu, L., Qian, W.,
Ransohoff, R.M., Bergmann, C., et al. (2010). Astrocyte-restricted ablation of
interleukin-17-induced Act1-mediated signaling ameliorates autoimmune
encephalomyelitis. Immunity 32, 414-425.
Kao, C.Y., Chen, Y., Thai, P., Wachi, S., Huang, F., Kim, C., Harper, R.W., and Wu, R.
(2004). IL-17 markedly up-regulates beta-defensin-2 expression in human airway
epithelium via JAK and NF-kappaB signaling pathways. J Immunol 173, 3482-3491.
Kawaguchi, M., Adachi, M., Oda, N., Kokubu, F., and Huang, S.K. (2004). IL-17
cytokine family. J Allergy Clin Immunol 114, 1265-1273; quiz 1274.
Kawaguchi, M., Kokubu, F., Kuga, H., Matsukura, S., Hoshino, H., Ieki, K., Imai, T.,
Adachi, M., and Huang, S.K. (2001). Modulation of bronchial epithelial cells by IL-17. J
Allergy Clin Immunol 108, 804-809.
Kawaguchi, M., Kokubu, F., Matsukura, S., Ieki, K., Odaka, M., Watanabe, S., Suzuki,
S., Adachi, M., and Huang, S.K. (2003). Induction of C-X-C chemokines, growth-related
oncogene alpha expression, and epithelial cell-derived neutrophil-activating protein-78
by ML-1 (interleukin-17F) involves activation of Raf1-mitogen-activated protein kinase
kinase-extracellular signal-regulated kinase 1/2 pathway. J Pharmacol Exp Ther 307,
1213-1220.
Kawaguchi, M., Onuchic, L.F., and Huang, S.K. (2002). Activation of extracellular
signal-regulated kinase (ERK)1/2, but not p38 and c-Jun N-terminal kinase, is involved
in signaling of a novel cytokine, ML-1. J Biol Chem 277, 15229-15232.
Kebir, H., Ifergan, I., Alvarez, J.I., Bernard, M., Poirier, J., Arbour, N., Duquette, P., and
Prat, A. (2009). Preferential recruitment of interferon-gamma-expressing T H 17 cells in
multiple sclerosis. Ann Neurol 66, 390-402.
Kleinschek, M.A., Owyang, A.M., Joyce-Shaikh, B., Langrish, C.L., Chen, Y., Gorman,
D.M., Blumenschein, W.M., McClanahan, T., Brombacher, F., Hurst, S.D., et al. (2007).
IL-25 regulates Th17 function in autoimmune inflammation. J Exp Med 204, 161-170.
Koenders, M.I., Kolls, J.K., Oppers-Walgreen, B., van den Bersselaar, L., Joosten,
L.A., Schurr, J.R., Schwarzenberger, P., van den Berg, W.B., and Lubberts, E. (2005).
Interleukin-17 receptor deficiency results in impaired synovial expression of interleukin-
1 and matrix metalloproteinases 3, 9, and 13 and prevents cartilage destruction during
chronic reactivated streptococcal cell wall-induced arthritis. Arthritis Rheum 52, 3239-
3247.
References
79
Kolls, J.K., and Linden, A. (2004). Interleukin-17 family members and inflammation.
Immunity 21, 467-476.
Komiyama, Y., Nakae, S., Matsuki, T., Nambu, A., Ishigame, H., Kakuta, S., Sudo, K.,
and Iwakura, Y. (2006). IL-17 plays an important role in the development of
experimental autoimmune encephalomyelitis. J Immunol 177, 566-573.
Krakowski, M., and Owens, T. (1996). Interferon-gamma confers resistance to
experimental allergic encephalomyelitis. Eur J Immunol 26, 1641-1646.
Kroenke, M.A., Carlson, T.J., Andjelkovic, A.V., and Segal, B.M. (2008). IL-12- and IL-
23-modulated T cells induce distinct types of EAE based on histology, CNS chemokine
profile, and response to cytokine inhibition. J Exp Med 205, 1535-1541.
Kurata, H., Lee, H.J., O'Garra, A., and Arai, N. (1999). Ectopic expression of activated
Stat6 induces the expression of Th2-specific cytokines and transcription factors in
developing Th1 cells. Immunity 11, 677-688.
Kurebayashi, S., Ueda, E., Sakaue, M., Patel, D.D., Medvedev, A., Zhang, F., and
Jetten, A.M. (2000). Retinoid-related orphan receptor gamma (RORgamma) is
essential for lymphoid organogenesis and controls apoptosis during thymopoiesis. Proc
Natl Acad Sci U S A 97, 10132-10137.
Lee, Y.K., Turner, H., Maynard, C.L., Oliver, J.R., Chen, D., Elson, C.O., and Weaver,
C.T. (2009). Late developmental plasticity in the T helper 17 lineage. Immunity 30, 92-
107.
Lees, J.R., Golumbek, P.T., Sim, J., Dorsey, D., and Russell, J.H. (2008a). Regional
CNS responses to IFN-gamma determine lesion localization patterns during EAE
pathogenesis. J Exp Med 205, 2633-2642.
Lees, J.R., Iwakura, Y., and Russell, J.H. (2008b). Host T cells are the main producers
of IL-17 within the central nervous system during initiation of experimental autoimmune
encephalomyelitis induced by adoptive transfer of Th1 cell lines. J Immunol 180, 8066-
8072.
Lexberg, M.H., Taubner, A., Forster, A., Albrecht, I., Richter, A., Kamradt, T.,
Radbruch, A., and Chang, H.D. (2008). Th memory for interleukin-17 expression is
stable in vivo. Eur J Immunol 38, 2654-2664.
Liang, S.C., Tan, X.Y., Luxenberg, D.P., Karim, R., Dunussi-Joannopoulos, K., Collins,
M., and Fouser, L.A. (2006). Interleukin (IL)-22 and IL-17 are coexpressed by Th17
cells and cooperatively enhance expression of antimicrobial peptides. J Exp Med 203,
2271-2279.
Lim, H.W., Lee, J., Hillsamer, P., and Kim, C.H. (2008). Human Th17 cells share major
trafficking receptors with both polarized effector T cells and FOXP3+ regulatory T cells.
Journal of immunology (Baltimore, Md 180, 122-129.
Lin, J.T., Martin, S.L., Xia, L., and Gorham, J.D. (2005). TGF-beta 1 uses distinct
mechanisms to inhibit IFN-gamma expression in CD4+ T cells at priming and at recall:
differential involvement of Stat4 and T-bet. J Immunol 174, 5950-5958.
Ling, J.Q., Li, T., Hu, J.F., Vu, T.H., Chen, H.L., Qiu, X.W., Cherry, A.M., and Hoffman,
A.R. (2006). CTCF mediates interchromosomal colocalization between Igf2/H19 and
Wsb1/Nf1. Science 312, 269-272.
Liu, S.J., Tsai, J.P., Shen, C.R., Sher, Y.P., Hsieh, C.L., Yeh, Y.C., Chou, A.H., Chang,
S.R., Hsiao, K.N., Yu, F.W., et al. (2007). Induction of a distinct CD8 Tnc17 subset by
transforming growth factor-beta and interleukin-6. J Leukoc Biol 82, 354-360.
Lockhart, E., Green, A.M., and Flynn, J.L. (2006). IL-17 production is dominated by
gammadelta T cells rather than CD4 T cells during Mycobacterium tuberculosis
infection. J Immunol 177, 4662-4669.
Lohning, M., Richter, A., and Radbruch, A. (2002). Cytokine memory of T helper
lymphocytes. Advances in immunology 80, 115-181.
Lohning, M., Richter, A., Stamm, T., Hu-Li, J., Assenmacher, M., Paul, W.E., and
Radbruch, A. (2003). Establishment of memory for IL-10 expression in developing T
helper 2 cells requires repetitive IL-4 costimulation and does not impair proliferation.
Proc Natl Acad Sci U S A 100, 12307-12312.
References
80
Lubberts, E., Joosten, L.A., Oppers, B., van den Bersselaar, L., Coenen-de Roo, C.J.,
Kolls, J.K., Schwarzenberger, P., van de Loo, F.A., and van den Berg, W.B. (2001). IL-
1-independent role of IL-17 in synovial inflammation and joint destruction during
collagen-induced arthritis. J Immunol 167, 1004-1013.
Lubberts, E., Koenders, M.I., Oppers-Walgreen, B., van den Bersselaar, L., Coenen-de
Roo, C.J., Joosten, L.A., and van den Berg, W.B. (2004). Treatment with a neutralizing
anti-murine interleukin-17 antibody after the onset of collagen-induced arthritis reduces
joint inflammation, cartilage destruction, and bone erosion. Arthritis Rheum 50, 650-
659.
Lucas, S., Ghilardi, N., Li, J., and de Sauvage, F.J. (2003). IL-27 regulates IL-12
responsiveness of naive CD4+ T cells through Stat1-dependent and -independent
mechanisms. Proc Natl Acad Sci U S A 100, 15047-15052.
Maggi, L., Santarlasci, V., Capone, M., Peired, A., Frosali, F., Crome, S.Q., Querci, V.,
Fambrini, M., Liotta, F., Levings, M., et al. (2010). CD161 is a marker of all human IL-
17-producing T-cell subsets and is induced by RORC. Eur J Immunol.
Martinez, G.J., Nurieva, R.I., Yang, X.O., and Dong, C. (2008). Regulation and function
of proinflammatory TH17 cells. Ann N Y Acad Sci 1143, 188-211.
Mathur, A.N., Chang, H.C., Zisoulis, D.G., Kapur, R., Belladonna, M.L., Kansas, G.S.,
and Kaplan, M.H. (2006). T-bet is a critical determinant in the instability of the IL-17-
secreting T-helper phenotype. Blood 108, 1595-1601.
McFarland, H.F., and Martin, R. (2007). Multiple sclerosis: a complicated picture of
autoimmunity. Nat Immunol 8, 913-919.
Molet, S., Hamid, Q., Davoine, F., Nutku, E., Taha, R., Page, N., Olivenstein, R., Elias,
J., and Chakir, J. (2001). IL-17 is increased in asthmatic airways and induces human
bronchial fibroblasts to produce cytokines. J Allergy Clin Immunol 108, 430-438.
Mosmann, T.R., Cherwinski, H., Bond, M.W., Giedlin, M.A., and Coffman, R.L. (1986).
Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine
activities and secreted proteins. J Immunol 136, 2348-2357.
Mosmann, T.R., and Coffman, R.L. (1989). TH1 and TH2 cells: different patterns of
lymphokine secretion lead to different functional properties. Annu Rev Immunol 7, 145-
173.
Mukasa, R., Balasubramani, A., Lee, Y.K., Whitley, S.K., Weaver, B.T., Shibata, Y.,
Crawford, G.E., Hatton, R.D., and Weaver, C.T. (2010). Epigenetic instability of
cytokine and transcription factor gene loci underlies plasticity of the T helper 17 cell
lineage. Immunity 32, 616-627.
Mullen, A.C., High, F.A., Hutchins, A.S., Lee, H.W., Villarino, A.V., Livingston, D.M.,
Kung, A.L., Cereb, N., Yao, T.P., Yang, S.Y., et al. (2001). Role of T-bet in commitment
of TH1 cells before IL-12-dependent selection. Science 292, 1907-1910.
Murayama, A., Sakura, K., Nakama, M., Yasuzawa-Tanaka, K., Fujita, E., Tateishi, Y.,
Wang, Y., Ushijima, T., Baba, T., Shibuya, K., et al. (2006). A specific CpG site
demethylation in the human interleukin 2 gene promoter is an epigenetic memory.
EMBO J 25, 1081-1092.
Murphy, E., Shibuya, K., Hosken, N., Openshaw, P., Maino, V., Davis, K., Murphy, K.,
and O'Garra, A. (1996). Reversibility of T helper 1 and 2 populations is lost after long-
term stimulation. J Exp Med 183, 901-913.
Nakae, S., Iwakura, Y., Suto, H., and Galli, S.J. (2007). Phenotypic differences
between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL-17.
J Leukoc Biol 81, 1258-1268.
Nakae, S., Nambu, A., Sudo, K., and Iwakura, Y. (2003). Suppression of immune
induction of collagen-induced arthritis in IL-17-deficient mice. J Immunol 171, 6173-
6177.
Naoe, Y., Setoguchi, R., Akiyama, K., Muroi, S., Kuroda, M., Hatam, F., Littman, D.R.,
and Taniuchi, I. (2007). Repression of interleukin-4 in T helper type 1 cells by Runx/Cbf
beta binding to the Il4 silencer. J Exp Med 204, 1749-1755.
References
81
Nogai, A., Siffrin, V., Bonhagen, K., Pfueller, C.F., Hohnstein, T., Volkmer-Engert, R.,
Bruck, W., Stadelmann, C., and Kamradt, T. (2005). Lipopolysaccharide injection
induces relapses of experimental autoimmune encephalomyelitis in nontransgenic mice
via bystander activation of autoreactive CD4+ cells. J Immunol 175, 959-966.
Numasaki, M., Tomioka, Y., Takahashi, H., and Sasaki, H. (2004). IL-17 and IL-17F
modulate GM-CSF production by lung microvascular endothelial cells stimulated with
IL-1beta and/or TNF-alpha. Immunol Lett 95, 175-184.
Nurieva, R., Yang, X.O., Chung, Y., and Dong, C. (2009). Cutting edge: in vitro
generated Th17 cells maintain their cytokine expression program in normal but not
lymphopenic hosts. J Immunol 182, 2565-2568.
Ohlsson, R., Renkawitz, R., and Lobanenkov, V. (2001). CTCF is a uniquely versatile
transcription regulator linked to epigenetics and disease. Trends Genet 17, 520-527.
Oppmann, B., Lesley, R., Blom, B., Timans, J.C., Xu, Y., Hunte, B., Vega, F., Yu, N.,
Wang, J., Singh, K., et al. (2000). Novel p19 protein engages IL-12p40 to form a
cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity
13, 715-725.
Ortiz, M.A., Piedrafita, F.J., Pfahl, M., and Maki, R. (1995). TOR: a new orphan
receptor expressed in the thymus that can modulate retinoid and thyroid hormone
signals. Mol Endocrinol 9, 1679-1691.
Ouyang, W., Löhning, M., Gao, Z., Assenmacher, M., Ranganath, S., Radbruch, A.,
and Murphy, K.M. (2000). Stat6-independent GATA-3 autoactivation directs IL-4-
independent Th2 development and commitment. Immunity 12, 27-37.
Park, H., Li, Z., Yang, X.O., Chang, S.H., Nurieva, R., Wang, Y.H., Wang, Y., Hood, L.,
Zhu, Z., Tian, Q., et al. (2005). A distinct lineage of CD4 T cells regulates tissue
inflammation by producing interleukin 17. Nat Immunol 6, 1133-1141.
Pernis, A., Gupta, S., Gollob, K.J., Garfein, E., Coffman, R.L., Schindler, C., and
Rothman, P. (1995). Lack of interferon gamma receptor beta chain and the prevention
of interferon gamma signaling in TH1 cells. Science 269, 245-247.
Prause, O., Bozinovski, S., Anderson, G.P., and Linden, A. (2004). Increased matrix
metalloproteinase-9 concentration and activity after stimulation with interleukin-17 in
mouse airways. Thorax 59, 313-317.
Qian, Y., Liu, C., Hartupee, J., Altuntas, C.Z., Gulen, M.F., Jane-Wit, D., Xiao, J., Lu,
Y., Giltiay, N., Liu, J., et al. (2007). The adaptor Act1 is required for interleukin 17-
dependent signaling associated with autoimmune and inflammatory disease. Nat
Immunol 8, 247-256.
Quandt, K., Frech, K., Karas, H., Wingender, E., and Werner, T. (1995). MatInd and
MatInspector: new fast and versatile tools for detection of consensus matches in
nucleotide sequence data. Nucleic Acids Res 23, 4878-4884.
Ramirez, F., and Mason, D. (2000). Induction of resistance to active experimental
allergic encephalomyelitis by myelin basic protein-specific Th2 cell lines generated in
the presence of glucocorticoids and IL-4. Eur J Immunol 30, 747-758.
Reboldi, A., Coisne, C., Baumjohann, D., Benvenuto, F., Bottinelli, D., Lira, S., Uccelli,
A., Lanzavecchia, A., Engelhardt, B., and Sallusto, F. (2009). C-C chemokine receptor
6-regulated entry of TH-17 cells into the CNS through the choroid plexus is required for
the initiation of EAE. Nat Immunol 10, 514-523.
Richter, A., Löhning, M., and Radbruch, A. (1999). Instruction for cytokine expression
in T helper lymphocytes in relation to proliferation and cell cycle progression. J Exp
Med 190, 1439-1450.
Rouvier, E., Luciani, M.F., Mattei, M.G., Denizot, F., and Golstein, P. (1993). CTLA-8,
cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences,
and homologous to a herpesvirus saimiri gene. J Immunol 150, 5445-5456.
Sallusto, F., Lenig, D., Förster, R., Lipp, M., and Lanzavecchia, A. (1999). Two subsets
of memory T lymphocytes with distinct homing potentials and effector functions. Nature
401, 708-712.
References
82
Sanceau, J., Merlin, G., and Wietzerbin, J. (1992). Tumor necrosis factor-alpha and IL-
6 up-regulate IFN-gamma receptor gene expression in human monocytic THP-1 cells
by transcriptional and post-transcriptional mechanisms. Journal of immunology
(Baltimore, Md 149, 1671-1675.
Schulz, E.G., Mariani, L., Radbruch, A., and Hofer, T. (2009). Sequential polarization
and imprinting of type 1 T helper lymphocytes by interferon-gamma and interleukin-12.
Immunity 30, 673-683.
Sospedra, M., and Martin, R. (2005). Immunology of multiple sclerosis. Annu Rev
Immunol 23, 683-747.
Starnes, T., Robertson, M.J., Sledge, G., Kelich, S., Nakshatri, H., Broxmeyer, H.E.,
and Hromas, R. (2001). Cutting edge: IL-17F, a novel cytokine selectively expressed in
activated T cells and monocytes, regulates angiogenesis and endothelial cell cytokine
production. J Immunol 167, 4137-4140.
Steinman, L. (2001). Blockade of gamma interferon might be beneficial in MS. Mult
Scler 7, 275-276.
Stumhofer, J.S., Silver, J.S., Laurence, A., Porrett, P.M., Harris, T.H., Turka, L.A.,
Ernst, M., Saris, C.J., O'Shea, J.J., and Hunter, C.A. (2007). Interleukins 27 and 6
induce STAT3-mediated T cell production of interleukin 10. Nat Immunol 8, 1363-1371.
Suryani, S., and Sutton, I. (2007). An interferon-gamma-producing Th1 subset is the
major source of IL-17 in experimental autoimmune encephalitis. Journal of
neuroimmunology 183, 96-103.
Szabo, S.J., Dighe, A.S., Gubler, U., and Murphy, K.M. (1997). Regulation of the
interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Th1) and Th2
cells. J Exp Med 185, 817-824.
Takeda, A., Hamano, S., Yamanaka, A., Hanada, T., Ishibashi, T., Mak, T.W.,
Yoshimura, A., and Yoshida, H. (2003). Cutting edge: role of IL-27/WSX-1 signaling for
induction of T-bet through activation of STAT1 during initial Th1 commitment. J
Immunol 170, 4886-4890.
Tau, G.Z., von der Weid, T., Lu, B., Cowan, S., Kvatyuk, M., Pernis, A., Cattoretti, G.,
Braunstein, N.S., Coffman, R.L., and Rothman, P.B. (2000). Interferon gamma
signaling alters the function of T helper type 1 cells. J Exp Med 192, 977-986.
Toh, M.-L., Kawashima, M., Zrioual, S., Hot, A., Miossec, P., and Miossec, P. (2009).
IL-17 inhibits human Th1 differentiation through IL-12R[beta]2 downregulation.
Cytokine 48, 226.
Trajkovic, V., Stosic-Grujicic, S., Samardzic, T., Markovic, M., Miljkovic, D., Ramic, Z.,
and Mostarica Stojkovic, M. (2001). Interleukin-17 stimulates inducible nitric oxide
synthase activation in rodent astrocytes. J Neuroimmunol 119, 183-191.
Usui, T., Nishikomori, R., Kitani, A., and Strober, W. (2003). GATA-3 suppresses Th1
development by downregulation of Stat4 and not through effects on IL-12Rbeta2 chain
or T-bet. Immunity 18, 415-428.
Veldhoen, M., Hocking, R.J., Atkins, C.J., Locksley, R.M., and Stockinger, B. (2006).
TGFbeta in the context of an inflammatory cytokine milieu supports de novo
differentiation of IL-17-producing T cells. Immunity 24, 179-189.
Wallace, J.A., and Felsenfeld, G. (2007). We gather together: insulators and genome
organization. Curr Opin Genet Dev 17, 400-407.
Wei, G., Wei, L., Zhu, J., Zang, C., Hu-Li, J., Yao, Z., Cui, K., Kanno, Y., Roh, T.Y.,
Watford, W.T., et al. (2009). Global mapping of H3K4me3 and H3K27me3 reveals
specificity and plasticity in lineage fate determination of differentiating CD4+ T cells.
Immunity 30, 155-167.
Wei, L., Laurence, A., Elias, K.M., and O'Shea, J.J. (2007). IL-21 is produced by Th17
cells and drives IL-17 production in a STAT3-dependent manner. J Biol Chem 282,
34605-34610.
Winoto, A., and Littman, D.R. (2002). Nuclear hormone receptors in T lymphocytes.
Cell 109 Suppl, S57-66.
References
83
Xu, L., Kitani, A., Fuss, I., and Strober, W. (2007). Cutting edge: regulatory T cells
induce CD4+CD25-Foxp3- T cells or are self-induced to become Th17 cells in the
absence of exogenous TGF-beta. J Immunol 178, 6725-6729.
Yamazaki, T., Yang, X.O., Chung, Y., Fukunaga, A., Nurieva, R., Pappu, B., Martin-
Orozco, N., Kang, H.S., Ma, L., Panopoulos, A.D., et al. (2008). CCR6 regulates the
migration of inflammatory and regulatory T cells. J Immunol 181, 8391-8401.
Yang, X.O., Chang, S.H., Park, H., Nurieva, R., Shah, B., Acero, L., Wang, Y.H.,
Schluns, K.S., Broaddus, R.R., Zhu, Z., et al. (2008a). Regulation of inflammatory
responses by IL-17F. J Exp Med 205, 1063-1075.
Yang, X.O., Panopoulos, A.D., Nurieva, R., Chang, S.H., Wang, D., Watowich, S.S.,
and Dong, C. (2007). STAT3 regulates cytokine-mediated generation of inflammatory
helper T cells. J Biol Chem 282, 9358-9363.
Yang, X.O., Pappu, B.P., Nurieva, R., Akimzhanov, A., Kang, H.S., Chung, Y., Ma, L.,
Shah, B., Panopoulos, A.D., Schluns, K.S., et al. (2008b). T helper 17 lineage
differentiation is programmed by orphan nuclear receptors ROR alpha and ROR
gamma. Immunity 28, 29-39.
Yang, Y., Weiner, J., Liu, Y., Smith, A.J., Huss, D.J., Winger, R., Peng, H., Cravens,
P.D., Racke, M.K., and Lovett-Racke, A.E. (2009). T-bet is essential for
encephalitogenicity of both Th1 and Th17 cells. J Exp Med 206, 1549-1564.
Yang, Y., Xu, J., Niu, Y., Bromberg, J.S., and Ding, Y. (2008c). T-bet and
eomesodermin play critical roles in directing T cell differentiation to Th1 versus Th17. J
Immunol 181, 8700-8710.
Young, H.A., Ghosh, P., Ye, J., Lederer, J., Lichtman, A., Gerard, J.R., Penix, L.,
Wilson, C.B., Melvin, A.J., McGurn, M.E., et al. (1994). Differentiation of the T helper
phenotypes by analysis of the methylation state of the IFN-gamma gene. J Immunol
153, 3603-3610.
Zhang, F., Meng, G., and Strober, W. (2008). Interactions among the transcription
factors Runx1, RORgammat and Foxp3 regulate the differentiation of interleukin 17-
producing T cells. Nat Immunol 9, 1297-1306.
Zhang, G.X., Yu, S., Gran, B., Li, J., Siglienti, I., Chen, X., Calida, D., Ventura, E.,
Kamoun, M., and Rostami, A. (2003). Role of IL-12 receptor beta 1 in regulation of T
cell response by APC in experimental autoimmune encephalomyelitis. J Immunol 171,
4485-4492.
Zheng, W., and Flavell, R.A. (1997). The transcription factor GATA-3 is necessary and
sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89, 587-596.
Zhou, L., Ivanov, II, Spolski, R., Min, R., Shenderov, K., Egawa, T., Levy, D.E.,
Leonard, W.J., and Littman, D.R. (2007). IL-6 programs T(H)-17 cell differentiation by
promoting sequential engagement of the IL-21 and IL-23 pathways. Nat Immunol 8,
967-974.
Zhou, L., Lopes, J.E., Chong, M.M., Ivanov, II, Min, R., Victora, G.D., Shen, Y., Du, J.,
Rubtsov, Y.P., Rudensky, A.Y., et al. (2008). TGF-beta-induced Foxp3 inhibits T(H)17
cell differentiation by antagonizing RORgammat function. Nature 453, 236-240.
Danksagung
84
8 Danksagung
An dieser Stelle möchte ich mich zuerst bei Prof. Dr. Andreas Radbruch für die
Möglichkeit in seiner Gruppe zu arbeiten, die wertvollen Diskussionen und für den
Freiraum, das Projekt zu entwickeln, bedanken.
Prof. Dr. Roland Lauster danke ich für die Betreuung und Begutachtung meiner Arbeit.
Ein großer Dank auch an Dr. Joachim Grün, der bei der Analyse der Microarray-
Experimente geholfen hat.
Vielen Dank auch an Miltenyi Biotec und an Dr. Anne Richter und Anna Förster für die
sehr gute Zusammenarbeit. Ebenfalls möchte ich mich bei Prof. Dr. Thomas Kamradt
und Annegret Taubner für die gute Kooperation und die vielen Diskussionen bedanken.
Inka Albrecht und Astrid Menning, bei Euch bedanke ich für die Freundschaft,
Unterstützung, Katzensitting, sowie alles andere wofür ich hier leider viel zu wenig
Platz habe.
Ganz besonders möchte ich mich beim B-Club bedanken, ohne euch wäre es nur halb
so schön gewesen. Danke auch an Hyun-Dong Chang für seine Unterstützung. Des
weiteren möchte ich mich bei vielen Mitarbeitern des DRFZ bedanken, die entweder
direkt bei dieser Arbeit geholfen oder bei Freizeitaktivitäten die Zeit verschönert haben:
Sandra Zehentmeier, Claudia Brandt, Matthias Sieber, Kerstin Westendorf, René
Riedel, Balint Szilagyi, Uwe Niesner, Hanna Bendfeldt, Stefan Frischbutter, Marko
Janke, Sascha Rutz, Mark Rosowski, Luzi Reiners-Schramm, Reyk Horland, Barbara
Häringer, Inga Lepenies, Micha Peine, Caroline Helmstetter, Anja Fröhlich, Martin
Szyska, Nico Andreas, Ulrik Stervbo, Koji Tokoyoda und Marion Rudolph.
Ohne Euch alle wäre das Projekt nicht so weit gekommen, vor allem aber habt Ihr die
Zeit während und nach der Arbeit um so Vieles bereichert.
Auch allen anderen am DRFZ danke ich für die tolle Arbeitsatmosphäre, die kreativen
und hilfreichen Diskussionen sowie die technische oder logistische Unterstützung.
Ein Riesendank auch an Carsten Spannagel, der mich während der gesamten Zeit
aufgebaut und unterstützt hat und meine Tiefs ertragen hat.
Erklärung
85
9 Erklärung
Ich erkläre an Eides Statt, dass die vorliegende Dissertation in allen Teilen von mir
selbstständig angefertigt wurde und die benutzten Hilfsmittel vollständig angegeben
worden sind.
Teile der Dissertation wurden im European Journal of Immunology in 2008
veröffentlicht (siehe Schriftenverzeichnis).
Weiter erkläre ich, dass ich nicht schon anderweitig einmal die Promotionsabsicht
angemeldet oder ein Promotionseröffnungsverfahren beantragt habe.
Die Bestimmungen der Promotionsordnung sind mir bekannt.
----------------------------------------------------------------------------------------
Datum, Ort, Unterschrift
Curriculum vitae
86
10 Curriculum vitae
Personal Data:
Name: Maria Helen Lexberg
Born: 18.02.1981 in Gothenburg, Sweden
Address: Schönhauser Allee 70b, 10437 Berlin
Phone (work):+493028460667
Email (work): lexberg@drfz.de
Nationality: norwegian
Education:
1987-1991 Oemberg elementary school, Mülheim a d. Ruhr, Germany
1991-1992 Karl-Ziegler secondary school, Mülheim a d. Ruhr, Germany
1992-1996 Raaholt secondary school, Raaholt, Norway
1996-1997 Jessheim secondary school, Jessheim, Norway
1997-1999 Lillestroem secondary school, Lillestroem, Norway
International Baccalaureate Certificate
1999-2006 Technical University Berlin, Germany. Study course: Medical
Biotechnology. Certificate: Dipl. Ing.
Curriculum vitae
87
2004-2005 Diploma Thesis in the group of Dr. Ria Baumgrass at the Deutschen
Rheuma-Forschungszentrum Berlin (DRFZ). Topic: Investigation of the
molecular mechanisms in the TGFß-mediated induction of regulatory T
cells.
2006-2010 PhD Thesis in the group of Prof. Dr. Andreas Radbruch at the
Deutschen Rheuma-Forschungszentrum Berlin (DRFZ). Topic: Stability
and plasticity of IL-17 expression in Th17 cells“
Scientific presentations
The Cytokine memory of IL-17 producing T cells. 11th German Meeting on Th1/Th2
research, Marburg, Germany. 18./19.06.2008
In vivo generated Th17 cells have a stable memory for IL-17 expression. Joint annual
meeting of the Austrian and the German societies for immunology (ÖGAI and DGFI),
Wien, Austria. 03.-06.09.2008
In vivo generated Th17 cells have a stable memory for IL-17 expression. European
Workshop for Rheumatology (EWRR), Warsaw, Poland. 26.-28.02.2009
Conversion of in vivo generated Th17 cells into Th1/17 cells requires upregulation of
the IL12Rβ2 chain by IFN-γ. 2nd European congress of Immunology (ECI), Berlin,
Germany. 13.-16.09.2009
Conversion of in vivo generated Th17 cells into Th1/17 cells requires upregulation of
the IL12Rβ2 chain by IFN-γ. Deutschen Gesellschaft für Rheumatologie (German
society for rheumatology), Köln, Germany. 23.-26.09.2009
Publications
Mariani L, Schulz E, Lexberg MH, Helmstetter C, Radbruch A, Löhning M,
Höfer T. Short-term Memory in Gene Induction Reveals the Regulatory
Principle behind Stochastic IL-4 Expression. Molecular Systems Biology.
2010 Apr 13;6:359
Curriculum vitae
88
Lexberg MH, Taubner A, Förster A, Albrecht I, Richter A, Kamradt T, Radbruch
A, Chang HD. Th memory for interleukin-17 expression is stable in vivo.
Eur J Immunol. 2008 Oct;38(10):2654-64.
Niesner U, Albrecht I, Janke M, Doebis C, Loddenkemper C, Lexberg MH,
Eulenburg K, Kreher S, Koeck J, Baumgrass R, Bonhagen K, Kamradt T,
Enghard P, Humrich JY, Rutz S, Schulze-Topphoff U, Aktas O, Bartfeld S,
Radbruch H, Hegazy AN, Löhning M, Baumgart DC, Duchmann R, Rudwaleit
M, Häupl T, Gitelman I, Krenn V, Gruen J, Sieper J, Zeitz M, Wiedenmann B,
Zipp F, Hamann A, Janitz M, Scheffold A, Burmester GR, Chang HD, Radbruch
A. Autoregulation of Th1-mediated inflammation by twist. J Exp Med. 2008
Aug 4;205(8):1889-901.
Miscellaneous
PhD scholarship Miltenyi Biotec GmbH (2009-2010)
Internship in the group of Prof. Dr. Shimon Sakaguchi, University of Kyoto, Japan (4
months, June-October 2005)
Research assistant, Robert Koch Institute, Group of Dr. Brunhilde Schweiger (National
Reference Center Influenza) July 2001-January 2002
Schriftenverzeichnis
89
11 Schriftenverzeichnis
Niesner U, Albrecht I, Janke M, Doebis C, Loddenkemper C, Lexberg MH, Eulenburg
K, Kreher S, Koeck J, Baumgrass R, Bonhagen K, Kamradt T, Enghard P, Humrich JY,
Rutz S, Schulze-Topphoff U, Aktas O, Bartfeld S, Radbruch H, Hegazy AN, Löhning M,
Baumgart DC, Duchmann R, Rudwaleit M, upl T, Gitelman I, Krenn V, Gruen J,
Sieper J, Zeitz M, Wiedenmann B, Zipp F, Hamann A, Janitz M, Scheffold A,
Burmester GR, Chang HD, Radbruch A. Autoregulation of Th1-mediated
inflammation by twist. J Exp Med. 2008 Aug 4;205(8):1889-901.
Lexberg MH, Taubner A, Förster A, Albrecht I, Richter A, Kamradt T, Radbruch A,
Chang HD. Th memory for interleukin-17 expression is stable in vivo. Eur J
Immunol. 2008 Oct;38(10):2654-64.
Mariani L, Schulz E, Lexberg MH, Helmstetter C, Radbruch A, Löhning M, Höfer T.
Short-term Memory in Gene Induction Reveals the Regulatory Principle behind
Stochastic IL-4 Expression. Molecular Systems Biology. 2010 Apr 13;6:359