scieee Science in your language
[en] (orig)
ORIGINAL RESEARCH ARTICLE
published: 11 March 2014
doi: 10.3389/fmicb.2014.00092
Quantitative and sensitive RNA based detection of Bacillus
spores
Ekaterina Osmekhina1, Antonina Shvetsova2, Maria Ruottinen1and Peter Neubauer1,3*
1Department of Process and Environmental Engineering and Biocenter Oulu, University of Oulu, Oulu, Finland
2Department of Biochemistry and Biocenter Oulu, University of Oulu, Oulu, Finland
3Laboratory of Bioprocess Engineering, Department of Biotechnology, Technische Universität Berlin, Berlin, Germany
Edited by:
Eric Altermann, AgResearch Ltd,
New Zealand
Reviewed by:
Grzegorz Wegrzyn, University of
Gdansk, Poland
Johannes Kabisch,
Ernst-Moritz-Arndt Universität
Greifswald, Germany
*Correspondence:
Peter Neubauer, Laboratory of
Bioprocess Engineering,
Department of Biotechnology,
Technische Universität Berlin,
Ackerstraße 76, D-13355 Berlin,
Germany
e-mail: peter[email protected]
The fast and reliable detection of bacterial spores is of great importance and still remains
a challenge. Here we describe a direct RNA-based diagnostic method for the specific
detection of viable bacterial spores which does not depends on an enzymatic amplification
step and therefore is directly appropriate for quantification. The procedure includes the
following steps: (i) heat activation of spores, (ii) germination and enrichment cultivation, (iii)
cell lysis, and (iv) analysis of 16S rRNA in crude cell lysates using a sandwich hybridization
assay. The sensitivity of the method is dependent on the cultivation time and the detection
limit; it is possible to detect 10 spores per ml when the RNA analysis is performed after 6 h
of enrichment cultivation. At spore concentrations above 106spores per ml the cultivation
time can be shortened to 30 min. Total analysis times are in the range of 2–8 h depending
on the spore concentration in samples. The developed procedure is optimized at the
example of Bacillus subtilis spores but should be applicable to other organisms. The new
method can easily be modified for other target RNAs and is suitable for specific detection
of spores from known groups of organisms.
Keywords: spore detection, Bacillus subtilis, RNA hybridization
INTRODUCTION
Detection of microorganisms in air is challenging due to the
very low amount of organisms that generally are collected in air
samples and the presence of organisms as dormant spores.
Various biosensors have been developed for the specific detec-
tion of harmful microbial spores in air samples (Gooding, 2006).
Most methods for the detection of Bacillus spores have been
designed for Bacillus anthracis, a causative factor for anthrax and
a potential biological threat agent (Edwards et al., 2006; Irenge
and Gala, 2012), in order to create sensors for biological warfare
agents. Being a causative agent, B. anthracis is difficult to work
with, and therefore the closely related species Bacillus subtilis and
B. cereus are often used in the development of detection strategies
(Arakawa et al., 2003; Stachowiak et al., 2007; Inami et al., 2009;
Cheng et al., 2011).
The primary strategies for detection of Bacillus spores include
polymerase chain reaction based techniques, immunoassays,
spectrometry, chromatography, and protein profiling (Table 1).
Recently also some autonomous pathogen detection systems for
aerosol collection, sample preparation and detection were devel-
oped (Hindson et al., 2005; Stachowiak et al., 2007; Regan et al.,
2008; Inami et al., 2009)(Table 1).
A number of direct methods are based on DNA or protein
detection and cannot distinguish between viable and dead spores.
Furthermore, most of them have low sensitivity or require an
amplification step such as PCR. RNA-based detection methods
have the advantage to specifically analyze only viable spores,
and RNAs, especially ribosomal RNAs (rRNAs), are populated
Abbreviations: SHA, sandwich hybridization assay.
in high amounts, making enzyme-based amplifications methods
indispensible. Thus it is reasonable to apply RNA detection after
the activation of RNA synthesis which takes place already after
approximately 10 min of germination (Keijser et al., 2007).
Sandwich hybridization assays (SHA) are suitable for a rapid
and quantitative RNA detection (Rautio et al., 2003). These
methods are based on the hybridization of a target RNA (or
denatured DNA) with two specific oligonucleotide probes. A cap-
ture probe is used to immobilize the target on a solid support,
such as magnetic microbeads, which provide a large surface area
for nucleic acid attachments (Walsh et al., 2001). This bind-
ing between the probes and the beads is usually performed by
interaction between biotin attached to the oligonucleotide probe
and streptavidin coated magnetic beads. The detection probe is
labeled with a marker molecule which generates a signal pro-
portional to the amount of target molecules. Oligonucleotide
probes required for this assay can be designed for almost any
RNA and can easily be modified for other targets. This means
that the developed detection system can be applied for different
organisms with just some small adaptations. Sandwich hybridiza-
tion is relatively sensitive (1016–1015 moles of a specific target
molecule) and can be performed with crude biological samples
without any RNA purification. The method has been successfully
applied for the detection of 16S rRNA from Legionella sp.inwater
samples (Leskelä et al., 2005), mycobacteria in soils (Nieminen
et al., 2006), Lactobacillus and Pediococcus in brewery yeast slur-
ries (Huhtamella et al., 2007), Salmonella in minced meat (Taskila
et al., 2011), Bacillus cereus DNA (Gabig-Ciminska et al., 2004)
and for monitoring dynamic changes of different mRNA species
in microbial processes (Rautio et al., 2003; Neubauer et al., 2007;
www.frontiersin.org March 2014 | Volume 5 | Article 92 |1
Osmekhina et al. RNA-based detection of Bacillus spores
Table 1 | Methods for detection of Bacillus spores.
Method Sensitivity Organisms Comments References
NUCLEIC ACID BASED METHODS
Real-time PCR 1 spore per 100 L of air B. anthracis Lee et al., 1999; Makino and
Cheun, 2003; Irenge et al., 2010;
Wielinga et al., 2011
Culture-based PCR 1–10 spores per analysis B. anthracis High-throughput Kane et al., 2009
NASBAacoupled with
biosensor
1–10 spores per analysis B. anthracis Analysis after 30 min of
germination
Baeumner et al., 2004
FISHb103spores per m3of air B. anthracis Weerasekara et al., 2013
ICANcDNA detection 104spores per analysis B. subtilis Does not contain a
germination step
Inami et al., 2009
Autonomous pathogen
detection system with
multiplexed PCR
B. anthracis
and others
Regan et al., 2008
RAZOR® EX Anthrax Air
Detection System
200 spores per analysis B. anthracis DNA extraction and
real-time PCR
Spaulding et al., 2012; Hadfield
et al., 2013
IMMUNOASSAYS
Colorimetric and
electrochemilumine-scence
immunoassay
30–100 spores per
analysis
B. anthracis Morel et al., 2012
ELISAdB. subtilis Zhou et al., 2002
On-chip ELISA 105spores per analysis B. subtilis Chemiluminescence method
combined with a biochip.
Antibodies against surface
spore antigen were used
Stratis-Cullum et al., 2003
Luminex assay 103–104spores per ml B. anthracis Monoclonal antibodies
recog-nize
anthrose-containing
oligosaccharides on the
surface of B. anthracis
endospores
Tamborrini et al., 2010
Peptide-Function cantilever
arrays
105spores per ml for
analysis
B. subtilis 1 from 2400 spores was
captured
Dhayal et al., 2006; Campbell and
Mutharasan, 2007
Chip gel electrophoresis
protein profiling (CGE-PP)
16 particles per liter
100 cells per analysis
Any
(adapted for
E. coli and
B. subtilis)
Autonomous microfluidic
system
Pizarro et al., 2007; Stachowiak
et al., 2007
Multiplexed Immunoassay
with PCR Confirmation
49 spores per liter of air B. subtilis Autonomous Detection of
Aerosolized Biological Agents
McBride et al., 2003; Hindson
et al., 2004
OTHERS
Pyrolysis micromachined
differential mobility
spectrometry
103spores per analysis B. anthracis A microfabricated ion mobility
spectrometer in combination
with a pattern recognition and
classification algorithm
Krebs et al., 2006
Microcalorimetric
spectroscopy
100–1000 spores B. subtilis,
B. cereus
Arakawa et al., 2003
Laser induced breakdown
spectroscopy
single particles B. subtilis In combination with other
detection methods
Hybl et al., 2003, 2006
Mass-spectrometry 104–105spores B. anthracis In combination with other
detection methods
Lasch et al., 2009; Chenau et al.,
2011; Li et al., 2012
Raman scattering 104spores Not specific Based on detection of
dipicolinic acid
Cheng et al., 2011, 2012; Cowcher
et al., 2013
Optical microchip array
biosensor
5×107spores per ml B. anthracis
and others
Bhatta et al., 2011
aNASBA, Nucleic acid sequence based amplification.
bFISH, Fluorescence in situ hybridization.
cICAN, Isothermal and chimeric primer-initiated amplification of nucleic acids.
dELISA, Enzyme linked immunosorbent assay.
Frontiers in Microbiology | Microbiotechnology, Ecotoxicology and Bioremediation March2014|Volume5|Article92|2
Osmekhina et al. RNA-based detection of Bacillus spores
Soini et al., 2008; Thieme et al., 2008). The possibility to use
various markers makes the method applicable for different read-
out systems, such as fluorescence meters (Rautio et al., 2003),
chip-based fluorescent biosensors (Wang et al., 2013) or electrical
biochip readers (Gabig-Ciminska et al., 2004; Jürgen et al., 2005;
Elsholz et al., 2006; Pioch et al., 2008a,b). The SHA coupled with
capillary electrophoresis called TRAC (transcript analysis with aid
of affinity capture) was developed for multiplex transcript analy-
sis and is commercially available (Rautio et al., 2006, 2008; Rautio,
2010) (PlexPress Oy, Finland).
In the actual study a procedure was developed for detecting
bacterial spores, utilizing spore activation, enrichment cultiva-
tion and an RNA-based sandwich hybridization assay. In contrast
to most assays utilizing DNA and protein detection, the method
developed here is specific only for viable organisms since it is
based on RNA synthesis.
MATERIALS AND METHODS
SPORE PREPARATION
Bacillus subtilis spores were obtained from cells (B. subtilis 6051α,
kindly provided by Prof. Dr. Thomas Schweder, Ernst-Moritz-
Arndt University of Greifswald, Germany) cultured in Schaeffer’s
sporulation medium (8 g/l bacto-nutrient broth, 0.1% (w/v) KCl,
0.012% (w/v) MgSO4×7H20, 0.5 mM NaOH, 1 mM Ca(NO3)2,
0.01 mM MnCl2, 0.001 mM FeSO4)at37
C, 200 rpm for 4 days.
Cultures were carried out in 3-baffled 1 liter Erlenmeyer flasks
with a liquid volume of 100 ml. After harvesting and extensive
washing with water at 4C, spores were inspected by phase-
contrast microscopy to show that samples are free of vegetative
cells (<10%). Spores were lyophilized and stored at 4C. For
counting, the spores were diluted in 0.9% NaCl, activated at 70C
for 30 min and plated on nutrient agar plates (Difco, USA).
ACTIVATION AND GROWTH CONDITIONS
B. subtilis spores were diluted in 0.9% NaCl and activated by
temperature treatment at 70C for 30 min. Thereafter the sus-
pensions were transferred into 3-baffled 1 l Erlenmeyer flasks
containing 100 ml of a germination medium (20 g/l tryptone,
10 g/l yeast extract, 10 g/l NaCl and 0.5 mM L-alanine) (Moeller
et al., 2006). Cultures were carried out at 37C and 200 rpm on
a rotary shaker. Culture growth was monitored by measuring the
optical density at 600 nm (OD600, Ultrospec Pro 2100 UV/Visible
Spectrophotometer, GE Healthcare, Buckinghamshire, UK). The
corresponding colony forming units (cfu/ml) were determined by
plating on nutrient agar plates.
SAMPLE PREPARATION
1ml of the B. subtilis cultures were removed into pre-cooled
1.5 ml microreaction tubes containing 0.125 ×sample volume
of cold 95:5 ethanol:phenol (v/v) (Thieme et al., 2008). The cells
were collected by centrifugation (15,000 ×g, +4C, 5 min). The
pellets were suspended in 500 μlof1×TEN buffer (10 mM Tris-
HCl, 1 mM EDTA, 100 mM NaCl, pH 8.0) containing 1 μl/ml
RNAguar RNase inhibitor (Amersham Biosciences, New Jersey,
USA) and mixed by vortexing for 1 min. Then the cell suspen-
sions were transferred into 2 ml microcentrifuge tubes with a skirt
(Greiner Bio-One GmbH, Frickenhausen, Germany) containing
100 mg glass beads (BioSpec Products Inc., Bartlesville, OK, USA)
with a diameter of 0.1 mm. Cell disruption was performed with a
FastPrep® FP120 Cell Disrupter (Bio-101, Thermo Savant, USA)
at 4.5 m/s for 4 ×25 s. The vials were kept on ice for 1 min
between the disruption cycles. Cell homogenates were centrifuged
(20,000 ×g, +4C, 5 min) and supernatants were snap frozen in
liquid nitrogen.
GENERATION OF THE DNA FOR THE IN VITRO 16S rRNA TRANSCRIPT
The target gene was amplified by PCR using a colony of B. subtilis
cells as a template and 10 pmol of the forward and reverse primers
(Weisburg et al., 1991)(Table 2).Theforwardprimercontained
at the 5–end the T7 promoter sequence CTA ATA CGA CTC ACT
ATA GGG. The PCR conditions were as follows: 3 min at 95C; 35
cycles of 15 s at 95C, 30 s at 50Cand1min45sat72
C; 10 min
at 72C and afterwards held at 4C. PCR products were analyzed
by agarose gel electrophoresis and purified with the QIAquick
PCR purification kit (Qiagen, Hilden, Germany). Purified PCR
products were quantified by absorbance measurement at 260 nm
(GeneQuant II, Viochrom Ltd., Cambridge, UK).
Target RNA was generated from the purified PCR prod-
uct by means of T7 RNA polymerase in vitro transcription
using the MAXIscript™ T7-kit (Ambion, Austin, TX, USA).
The quality of the in vitro transcribed RNA was checked by
the Agilent 2100 Bioanalyser and RNA 6000 Nano LabChip Kit
(Agilent Technologies, Waldbronn, Germany). RNA was quanti-
fied by absorbance measurement at 260 nm (NanoDrop ND 1000,
Thermo Fisher Scientific, USA).
OLIGONUCLEOTIDE PROBES
The oligonucleotide probes for B. subtilis 16S rRNA were designed
on the basis of general eubacterial probes with some modifi-
cations (Table 2). The oligonucleotide probes were purchased
from Oligomer Oy (Helsinki, Finland). The detection probe
was labeled with the DIG Oligonucleotide Tailing Kit (Roche
Diagnostics, Mannheim, Germany) according to the manufac-
turer’s instructions.
SANDWICH HYBRIDIZATION ASSAY
A quantitative sandwich hybridization assay (SHA) was used for
detecting 16S rRNA molecules. The procedure was performed as
described by Rautio et al. (2003) and Thieme et al. (2008) with
small modifications.
SHAs were carried out in 96-well bright U-shaped microplates
(Greiner-Bio-One GmbH, Frickenhausen, Germany) using a
Thermomixer Comfort (Eppendorf, Hamburg, Germany). The
target RNA was mixed with the 5 ×SSC hybridization buffer
(0.75 M sodium chloride, 0.075 M sodium citrate, pH 7.0), 20%
(v/v) deionized formamide, 3% (w/v) dextran sulphate, 0.2%
(v/v) TWEEN20, 0.02% (v/v) Ficoll, 0.02% (w/v) polyvinyl
pyrrolidone, 0.02% (w/v) bovine serum albumin, 1% (v/v) block-
ing reagent (Roche, Mannheim, Germany) in 100 mM maleic
acid with 150 mM NaCl (pH 7.5), 5 pmol biotin-labeled cap-
ture probe, 1 pmol DIG-labeled detection probe, and 1 pmol of
each helper probe in a total volume of 100 μl. The hybridization
reactions were performed in three parallels at 750 rpm and 50C
for 30 min. 15 μl of Streptavidin MagneSphere®Paramagnetic
www.frontiersin.org March 2014 | Volume 5 | Article 92 |3
Osmekhina et al. RNA-based detection of Bacillus spores
Table 2 | Sequences of the oligonucleotide probes used in sandwich hybridization for the detection of B. subtilis 16S rRNA and PCR primers.
Probe name Probe specification Probe sequence 5–3Location of probe Probe modification
Bsub16Scap Capture TGTCTCAGTCCCAGTGTGGa319–337 5-Biotin
Bsub16Sdet Detection CGTAGGAGTCTGGGCCGa338–354 3-Digoxigenin
Help1 Helper CCCCACTGCTGCCTCC 355–370
Help2 Helper CTGGTCATCCTCTCAGA 302–318
Fd-T7 Forward PCR primer (CTAATACGACTCACTATAGGG)
AGAGTTTGATCCTGGCTCAG
1029 5-T7 promoter
Rev Reverse PCR primer CGGCTACCTTGTTACGACTT 1502–1521
NCcap Negative control capture probe TGTGAACTTCCATCGGCTTGAGCC 5-Biotin
NCdet Negative control detection probe GATAGTCCCTCTAAGAAGCCATGTG 3-Digoxigenin
aNucleotides different to general eubacterial probes are underlined.
Particles (Promega, Madison, WI, USA) were washed as rec-
ommended by the manufacturer, and added to each well after
the hybridization reaction and incubated at 750 rpm and 50C
for 30 min. Subsequently, beads were washed three times with
120 μl of a washing buffer (1% SSC, 0.1% TWEEN20) at 25C
and 750 rpm for 2 min. During the washing step beads were
kept in the wells with a MagnaBot® 96 Magnetic Separation
Device (Promega, Madison, WI, USA). 100 μl of anti-DIG alka-
line phosphatase Fab-fragments (Roche Diagnostics, Mannheim,
Germany) were diluted with 1 ×SSC, 0.1% TWEEN20 to a
final concentration of 375 U/l, and applied to each well. The
96-well plate was incubated at 450 rpm and 25C for 30 min.
Unbound enzyme was removed by washing three times as
described above. Afterwards the whole solutions were trans-
ferred into new microplates and washed once more. Finally,
100 μl of 1 mM AttoPhos® fluorescent substrate (Promega,
Madison, WI, USA) was added to each well and the enzy-
matic reaction was performed at 37C and 750 rpm for 20 min.
90 μl of the contents of well were transferred into a Costar
black 96-well assay plate (Corning Inc., Corning, NY, USA) for
the fluorescence measurement with a Wallac Victor multilabel
counter (PerkinElmer Life Sciences, Turku, Finland) at an exci-
tation wavelength of 430 nm and an emission wavelength of
560 nm.
The detection limit was defined as 3 ×SD added to the back-
ground fluorescence. Detection limits were calculated separately
for each SHA and signals above it were considered as positive.
Capture and detection probes which are not complementary to
any RNA of B. subtilis (Table 2, NCcap and NCdet, respectively)
were used as a negative control for each sample to estimate the
background signal.
RESULTS
The aim of this study was the development of a diagnostic method
for the detection of bacterial spores at the example of Bacillus sub-
tilis spores. The sequence of the procedure is shown in Figure 1A.
First, the spores are activated by a heat treatment (30 min, 70C)
and following transfer into germination medium (Keijser et al.,
2007). The duration of the enrichment cultivation was varied
depending on the initial amount of spores. After the incubation
phase collected samples were disrupted and the supernatant was
utilized for the quantification of the 16S ribosomal RNA directly
from the cell broth by the use of a sandwich hybridization assay
without any further purification.
RNA-based detection of spores is feasible only after the acti-
vation of RNA synthesis, that takes place during the spore ger-
mination. In order to activate B. subtilis spores and initiate the
germination process, dormant spores were exposed to heat (70C
for 30 min) and afterwards cultured in the germination medium
at 37C. Cell germination and growth were monitored by mea-
suring the OD600 (Figure 1B). An increase of the cell density after
1 h of cultivation indicated that the germination and outgrowth
were completed and proliferation began.
For this feasibility study oligonucleotide probes for the detec-
tion of B. subtilis 16S rRNA with SHA were designed on the basis
of general eubacterial probes with some modifications to detect
the sequences specific for B. subtilis (Table 2). The probes were
tested using an in vitro transcribed fragment of B. subtilis 16S
rRNA as target molecule, which also is applied as a quantitative
standard. 6 ×107(0.1 fmol) target molecules in the hybridization
solution gave a signal that was significantly above the detection
limit. The reaction was linear over a range of nearly 3 orders of
magnitude up to approximately 3 ×1010 i.e., 50 fmol of target
molecules (Figure 1C).
In order to determine the detection limit and the range of the
SHA for crude cell extracts, different dilutions of B. subtilis cell
extracts were analyzed with the sandwich hybridization assay. The
cells were collected at the end of the exponential growth phase
(OD600 =1.4), disrupted, and 2.7×102to 5.4×106cells were
used as targets for a dilution curve (Figure 1D). The detection
limit was about 1.5×103cells per assay for exponentially grow-
ing B. subtilis cells (7.5×104cells per ml of culture medium). The
calculated amount of 16S rRNA was 4.8 (±0.6) ×104molecules
per cell at this growth phase. Consequently, the detection limit
in crude cell extracts corresponded to about 7.2×10716S rRNA
molecules. The linear range of the assay was between 103and 106
cells in a hybridization solution.
In order to establish the analysis of cells from enrichment
cultures the germination medium was inoculated with 105–108
activated B. subtilis spores per mL. After 30 min of cultivation
(before the first proliferation), the cells were disrupted and ana-
lyzed with SHA (Figure 1E). It was possible to detect about 20,000
cells per assay (106cells per ml of culture medium). This number
of cells corresponds to approximately 10816S rRNA molecules.
Frontiers in Microbiology | Microbiotechnology, Ecotoxicology and Bioremediation March2014|Volume5|Article92|4
Osmekhina et al. RNA-based detection of Bacillus spores
FIGURE 1 | Spore detection using a sandwich hybridization assay.
(A) Principle of airborne spore detection using a sandwich hybridization assay.
Spores collected from air are activated and cultivated in a germination medium.
The first sample for analysis can be collected after approximately 30 min of
germination. If the amount of spores is too low to be detected at this step, the
incubation can be continued to allow a multiplication of the cells. (B)AGrowth
curve of B. subtilis cells. After heat activation (70C for 30 min) B. subtilis
spores were inoculated into a germination medium to a final concentration of
106spores/ml. (C) Standard curve for the B. subtilis 16S rRNA sandwich
hybridization assay. (D) SHA dilution curve for B. subtilis 16S rRNA. The dilutions
of the crude extracts of B. subtilis cells collected at the exponential growth
phase (OD600 =1.4) were used as a target. The corresponding numbers of 16S
rRNA molecules were calculated according to the standard curve of in vitro
transcribed 16SrRNA at 260 nm. (E) 16S rRNA measured with SHA in B. subtilis
spores after their activation and germination for 30 min. Corresponding
numbers of 16S rRNA molecules were calculated according to the standard
curve (Figure 1C). The error bars show the ±SD of three parallel experiments
and the detection limit is shown as a dashed horizontal line.
According to the measurements at this stage of germination one
B. subtilis cell contained 5.6 (±0.9) ×10316S rRNA molecules.
Next, the sensitivity of the method including activation,
enrichment cultivation, and 16S rRNA analysis of B. subtilis
spores was studied. Therefore the germination medium was
inoculated with 101–105activated B. subtilis spores per ml.
Germination and growth of the cells were monitored by mea-
suring the OD600(Figure 2A). The cells were collected, disrupted
and analyzed with SHA using the probes against the16S rRNA
(Figure 2B). Detectable signals were observed after 110, 140, 245,
340, and 370 min of cultivation for the samples with initial num-
ber of 105,10
4,10
3,10
2,and10
1spores per ml of culture medium,
respectively.
Since the SHA sensitivity depends on the number of target
RNA molecules in one cell, the amount of 16S rRNA was mea-
sured for different growth phases of B. subtilis cells (Figure 3).
As it was shown earlier one B. subtilis cell contained 5.6 (±0.9)
×10316S rRNA molecules already after 30 min of germination.
At the early exponential growth phase the amount of 16S rRNA
molecules per cell was maximal (about 9 ×104rRNA molecules
per cell for an OD600 of 0.27) and the 16S rRNA content decreased
in later growth stages. Therefore the analysis is most sensitive if
the OD600 is approximately 0.3.
DISCUSSION
Detection of microorganisms in bioaerosols is an important issue
in determining bio-warfare agents during biological attacks and
for the monitoring of indoor air quality. A fast and sensitive
method for the detection of bacterial spores was developed in
this study. The procedure includes activation of spores, their ger-
mination, enrichment cultivation and RNA detection using a
sandwich hybridization assay, thus only viable spores are detected,
which is advantageous over standard detection methods as listed
in Table 1. There are no sensitivity limitations as the method is
adaptable by the enrichment cultivation time. The RNA analysis
can be performed directly with crude cell extracts avoiding labo-
rious RNA purification. The method was developed for B. subtilis,
a model organism capable of spore formation and quite abundant
in aerosols.
Since spores only contain low amounts of RNA molecules,
the idea of this study was to initiate RNA synthesis to increase
the detection system sensitivity. At first, the spores are acti-
vated at 70C for 30 min and placed into a medium contain-
ing L-alanine as a germination factor. During germination and
outgrowth the activated spores synthesize RNA, proteins, and
ATP. Chromosomal replication is initiated after 0.5 h (Garrick-
Silversmith and Torriani, 1973) and the first cell division takes
www.frontiersin.org March 2014 | Volume 5 | Article 92 |5
Osmekhina et al. RNA-based detection of Bacillus spores
FIGURE 2 | Sensitivity of the B. subtilis spore detection method.
(A) Growth curves of B. subtilis cells after spore activation. The initial
number of the spores was 101–105spores per ml of germination medium.
(B) Detection of B. subtilis 16S rRNA by sandwich hybridization after
enrichment cultivation. The error bars show ±SD of three independent
cultivations and measurements.
FIGURE 3 | Level of 16S rRNA molecules per cell (gray bars) in different
growth phases of B. subtilis.Quantity of RNA was measured with SHA.
The growth was followed by measuring the optical density at 600 nm ()
and the specific growth rate was calculated (black line). The dashed line
shows fitting of the OD curve.
place after approximately 70 min (Keijser et al., 2007). Depending
on the initial amount of spores, cells are disrupted either directly
after the germination or after the enrichment cultivation required
for the accumulation of necessary amount of RNA molecules. The
presentedmethodallowstheuseofcrudecellslysatesassample
material for the RNA detection, and no further RNA purification
is needed (Rautio et al., 2003; Thieme et al., 2008). We believe that
this is a strong advantage for using the sandwich hybridization
assay for the RNA detection compared to reverse transcriptase real
time PCR.
The assay is based on the hybridization event of the target RNA
with two oligonucleotide probes. Alkaline phosphatase attached
to one of the probes generates a fluorescent signal used for quan-
tification. The SHA has a potential to be automated, e.g., by the
use of an electrical chip reader (Gabig-Ciminska et al., 2004).
After the activation the spores germinated very quickly. The
first increase of the OD600 was noticed already after 1 h for the cul-
tures with an initial amount of 106spores per ml. The detectable
SHA signal for these cultures was observed after 0.5 h of ger-
mination. Since the RNA synthesis in germinating B. subtilis
spores starts within about 5 min after spore activation (Matsuda
and Kameyama, 1986), the cells have accumulated a detectable
amount of RNA molecules already after 30 min. Furthermore,
at this moment the spore core is rehydrated making cells more
accessible to disruption (Sloma and Smith, 1979; Moeller et al.,
2006).
The sensitivity of the developed method is not limited due to
enrichment cultivation for which the time can be adapted. Very
low initial spore amounts in the sample could be detected after
about 5 h of enrichment cultivation. Consequently, the maximum
duration of the assay for a very low amount of spores including
spore activation, enrichment cultivation, and detection with the
SHA is about 8 h. The detection limit of the SHA was estimated
as 6 ×107target molecules, which in case of using rRNA as a tar-
get corresponds to about 103–104cells in a sample depending on
their growth stage.
By the use of in vitro synthesized RNA probes as a standard
with the SHA it was possible to estimate the amount of 16S
rRNA molecules per cell. As expected, the number of molecules
increased during the germination and the outgrowth, reached the
maximum at the beginning of the exponential phase of growth,
and then slowly decreased. After 0.5 h of germination one cell
contained approximately 5.6 (±0.9) ×10316S rRNA molecules.
Exponentially growing cells contained about 9 ×10416S rRNA
molecules. These numbers correlate well with the known amount
of ribosomes in Escherichia coli cells, that is 6700–71,000 depend-
ing on the specific growth rate (Bremer and Dennis, 1996).
The 16S rRNA oligonucleotide probes used in this study
are capable of detecting most bacteria and are relevant only
for method development. Specific probes for the SHA can be
designed for almost any organism or groups of organisms if the
gene sequence is available. Furthermore, it would be possible to
apply the procedure for the analysis of mRNAs and their dynam-
ics during germination. However, due to numerical advantage of
ribosomes compared to a specific mRNA species, the method sen-
sitivity would be lower when mRNA is used as a target for the SHA
instead of rRNA and additionally the analytical error eventually
would be higher due to the low stability of mRNA molecules. For
selecting target mRNAs for specific identification of B. subtilis a
transcription profile of germinated spores (Keijser et al., 2007)
and the most abundant proteins of growing Bacillus cells have to
Frontiers in Microbiology | Microbiotechnology, Ecotoxicology and Bioremediation March2014|Volume5|Article92|6
Osmekhina et al. RNA-based detection of Bacillus spores
be reviewed. Protein abundance during the exponential growth
of Bacillus subtilis has been studied in great detail (Büttner et al.,
2001; Eymann et al., 2004). The most abundant proteins in B.
subtilis cytosolic extracts perform mainly housekeeping functions
as components of the translational apparatus (e.g., translation
elongation factors, ribosomal proteins), the glycolytic pathways,
the tricarboxylic acid cycle, the metabolism of amino and nucleic
acids, and protein quality control (e.g., chaperons). The mRNAs
of these proteins can be used as a target for the specific detection
of B. subtilis spores using the presented method.
ACKNOWLEDGMENTS
Dr. Pekka Belt, Dr. Janne Härkönen, and Dr. Matti Möttönen are
acknowledged for critical editing of this manuscript. This study
was supported by the Finnish Funding Agency for Technology
and Innovation (TEKES) project ENRICH (40254/07).
REFERENCES
Arakawa, E. T., Lavrik, N. V., Rajic, S., and Datskos, P. G. (2003). Detection
and differentiation of biological species using microcalorimetric spectroscopy.
Ultramicroscopy 97, 459–465. doi: 10.1016/S0304-3991(03)00074-3
Baeumner, A. J., Leonard, B., McElwee, J., and Montagna, R. A. (2004). A rapid
biosensor for viable B. anthracis spores. Anal. Bioanal. Chem. 380, 15–23. doi:
10.1007/s00216-004-2726-7
Bhatta, D., Michel, A. A., Marti Villalba, M., Emmerson, G. D., Sparrow, I. L.
G., Perkins, E. A., et al. (2011). Optical microchip array biosensor for multi-
plexed detection of bio-hazardous agents. Biosens. Bioelectron. 30, 78–86. doi:
10.1016/j.bios.2011.08.031
Bremer, H., and Dennis, P. P. (1996). “Modulation of chemical composition and
other parameters of the cell by growth rate, in Escherichia coli and Salmonella
typhimurium Cellular and Molecular Biology, ed F. C. Neidhardt (Washington,
DC: American Society of Microbiology), 1553–1569.
Büttner, K., Bernhardt, J., Scharf, C., Schmid, R., Mäder, U., Eymann, C.,
et al. (2001). A comprehensive two-dimensional map of cytosolic pro-
teins of Bacillus subtilis.Electrophoresis 22, 2908–2935. doi: 10.1002/1522-
2683(200108)22:14<2908::AID-ELPS2908>3.0.CO;2-M
Campbell, G. A., and Mutharasan, R. (2007). Method of measuring Bacillus
anthracis spores in the presence of copious amounts of Bacillus thuringiensis
and Bacillus cereus.Anal. Chem. 79, 1145–1152. doi: 10.1021/ac060982b
Chenau, J., Fenaille, F., Ezan, E., Morel, N., Lamourette, P., Goossens, P. L., et al.
(2011). Sensitive detection of Bacillus anthracis spores by immunocapture and
liquid chromatography-tandem mass spectrometry. Anal. Chem. 83, 8675–8682.
doi: 10.1021/ac2020992
Cheng,H.W.,Chen,Y.Y.,Lin,X.X.,Huan,S.Y.,Wu,H.L.,Shen,G.L.,etal.
(2011). Surface-enhanced Raman spectroscopic detection of Bacillus subtilis
spores using gold nanoparticle based substrates. Anal. Chim. Acta 707, 155–163.
doi: 10.1016/j.aca.2011.09.007
Cheng, H. W., Huan, S. Y., and Yu, R. Q. (2012). Nanoparticle-based substrates for
surface-enhanced Raman scattering detection of bacterial spores. Analyst 137,
3601–3608. doi: 10.1039/c2an35448a
Cowcher, D. P., Xu, Y., and Goodacre, R. (2013). Portable, quantitative detection of
Bacillus bacterial spores using surface-enhanced Raman scattering. Anal. Chem.
85, 3297–3302. doi: 10.1021/ac303657k
Dhayal, B., Henne, W. A., Doorneweerd, D. D., Reifenberger, R. G., and Low,
P. S. (2006). Detection of Bacillus subtilis spores using peptide-functionalized
cantilever arrays. J. Am. Chem. Soc. 128, 3716–3721. doi: 10.1021/ja0570887
Edwards, K. A., Clancy, H. A., and Baeumner, A. J. (2006). Bacillus anthracis:
toxicology, epidemiology and current rapid-detection methods. Anal. Bioanal.
Chem. 384, 73–84. doi: 10.1007/s00216-005-0090-x
Elsholz, B., Worl, R., Blohm, L., Albers, J., Feucht, H., Grunwald, T., et al. (2006).
Automated detection and quantitation of bacterial RNA by using electrical
microarrays. Anal. Chem. 78, 4794–4802. doi: 10.1021/ac0600914
Eymann, C., Dreisbach, A., Albrecht, D., Bernhardt, J., Becher, D., Gentner, S.,
et al. (2004). A comprehensive proteome map of growing Bacillus subtilis cells.
Proteomics 4, 2849–2876. doi: 10.1002/pmic.200400907
Gabig-Ciminska, M., Holmgren, A., Andresen, H., Bundvig, B. K., Wümpelmann,
M., Albers, J., et al. (2004). Electric chips for rapid detection and quantifi-
cation of nucleic acids. Biosens. Bioelectron. 19, 537–546. doi: 10.1016/S0956-
5663(03)00273-2
Garrick-Silversmith, L., and Torriani, A. (1973). Macromolecular syntheses during
germination and outgrowth of Bacillus subtilis spores. J. Bacteriol. 114, 507–516.
Gooding, J. J. (2006). Biosensor technology for detecting biological warfare
agents: recent progress and future trends. Anal. Chim. Acta 559, 137–151. doi:
10.1016/j.aca.2005.12.020
Hadfield, T., Ryan, V., Spaulding, U. K., Clemens, K. M., Ota, I. M., and Brunelle,
S. L. (2013). RAZOR EX Anthrax Air Detection System for detection of Bacillus
anthracis spores from aerosol collection samples: collaborative study. J. AOAC
Int. 96, 392–398. doi: 10.5740/jaoacint.CS2012-06
Hindson, B. J., Brown, S. B., Marshall, G. D., McBride, M. T., Makarewicz, A. J.,
Gutierrez, D. M., et al. (2004). Development of an automated sample prepara-
tion module for environmental monitoring of biowarfare agents. Anal. Chem.
76, 3492–3497. doi: 10.1021/ac035365r
Hindson, B. J., McBride, M. T., Makarewicz, A. J., Henderer, B. D., Setlur, U.
S., Smith, S. M., et al. (2005). Autonomous detection of aerosolized bio-
logical agents by multiplexed immunoassay with polymerase chain reaction
confirmation. Anal. Chem. 77, 284–289. doi: 10.1021/ac0489014
Huhtamella, S., Leinonen, M., Nieminen, T., Fahnert, B., Myllykoski, L.,
Breitenstein, A., et al. (2007). RNA-based sandwich hybridisation method for
detection of lactic acid bacteria in brewery samples. J. Microbiol. Methods 68,
543–553. doi: 10.1016/j.mimet.2006.10.009
Hybl, J. D., Lithgow, G. A., and Buckley, S. G. (2003). Laser-induced breakdown
spectroscopy detection and classification of biological aerosols. Appl. Spectrosc.
57, 1207–1215. doi: 10.1366/000370203769699054
Hybl, J. D., Tysk, S. M., Berry, S. R., and Jordan, M. P. (2006). Laser-
induced fluorescence-cued, laser-induced breakdown spectroscopy biological-
agent detection. Appl. Opt. 45, 8806–8814. doi: 10.1364/AO.45.008806
Inami, H., Tsuge, K., Matsuzawa, M., Sasaki, Y., Togashi, S., Komano, A., et al.
(2009). Semi-automated bacterial spore detection system with micro-fluidic
chips for aerosol collection, spore treatment and ICAN DNA detection. Biosens.
Bioelectron. 24, 3299–3305. doi: 10.1016/j.bios.2009.04.025
Irenge, L. M., Durant, J. F., Tomaso, H., Pilo, P., Olsen, J. S., Ramisse, V., et al.
(2010). Development and validation of a real-time quantitative PCR assay
for rapid identification of Bacillus anthracis in environmental samples. Appl.
Microbiol. Biotechnol. 88, 1179–1192. doi: 10.1007/s00253-010-2848-0
Irenge, L. M., and Gala, J. L. (2012). Rapid detection methods for Bacillus anthracis
in environmental samples: a review. Appl. Microbiol. Biotechnol. 93, 1411–1422.
doi: 10.1007/s00253-011-3845-7
Jürgen, B., Pioch, D., Hoi, L. T., Albers, J., Hintsche, R., and Schweder, T. (2005).
At-line monitoring of bioprocess-relevant marker genes using an electric DNA-
chip. J. Biotechnol. 118:S36. doi: 10.1002/bit.20578
Kane, S. R., Létant, S. E., Murphy, G. A., Alfaro, T. M., Krauter, P. W., Mahnke, R.,
et al. (2009). Rapid, high-throughput, culture-based PCR methods to analyze
samples for viable spores of Bacillus anthracis and its surrogates. J. Microbiol.
Methods 76, 278–284. doi: 10.1016/j.mimet.2008.12.005
Keijser, B. J., Ter Beek, A., Rauwerda, H., Schuren, F., Montijn, R., van der
Spek, H., et al. (2007). Analysis of temporal gene expression during Bacillus
subtilis spore germination and outgrowth. J. Bacteriol. 189, 3624–3634. doi:
10.1128/JB.01736-06
Krebs, M. D., Mansfield, B., Yip, P., Cohen, S. J., Sonenshein, A. L., Hitt, B. A., et al.
(2006). Novel technology for rapid species-specific detection of Bacillus spores.
Biomol. Eng. 23, 119–127. doi: 10.1016/j.bioeng.2005.12.003
Lasch, P., Beyer, W., Nattermann, H., Stämmler, M., Siegbrecht, E., Grunow,
R., et al. (2009). Identification of Bacillus anthracis by using matrix-assisted
laser desorption ionization-time of flight mass spectrometry and artificial
neural networks. Appl. Environ. Microbiol. 75, 7229–7242. doi: 10.1128/AEM.
00857-09
Lee, M. A., Brightwell, G., Leslie, D., Bird, H., and Hamilton, A. (1999). Fluorescent
detection techniques for real-time multiplex strand specific detection of Bacillus
anthracis using rapid PCR. J. Appl. Microbiol. 87, 218–223. doi: 10.1046/j.1365-
2672.1999.00908.x
Leskelä, T., Tilsala-Timisjärvi, A., Kusnetsov, J., Neubauer, P., and Breitenstein,
A. (2005). Sensitive genus-specific detection of Legionella by a 16S rRNA
based sandwich hybridization assay. J. Microbiol. Methods 62, 167–179. doi:
10.1016/j.mimet.2005.02.008
www.frontiersin.org March 2014 | Volume 5 | Article 92 |7
Osmekhina et al. RNA-based detection of Bacillus spores
Li, D., Truong, T. V., Bills, T. M., Holt, B. C., VanDerwerken, D. N., Williams, J.
R., et al. (2012). GC/MS method for positive detection of Bacillus anthracis
endospores. Anal. Chem. 84, 1637–1644. doi: 10.1021/ac202606x
Makino, S., and Cheun, H. (2003). Application of the real-time PCR for the
detection of airborne microbial pathogens in reference to the anthrax spores.
J. Microbiol. Methods 53, 141–147. doi: 10.1016/S0167-7012(03)00019-8
Matsuda, M., and Kameyama, T. (1986). Fractionation of ribonucleic-acid tran-
scripts synthesized during spore germination in Bacillus subtilis.J. Basic
Microbiol. 26, 91–99. doi: 10.1002/jobm.3620260209
McBride, M. T., Masquelier, D., Hindson, B. J., Makarewicz, A. J., Brown, S., Burris,
K., et al. (2003). Autonomous detection of aerosolized Bacillus anthracis and
Yersinia pestis.Anal. Chem. 75, 5293–5299. doi: 10.1021/ac034722v
Moeller, R., Horneck, G., Rettberg, P., Mollenkopf, H. J., Stackebrandt, E., and
Nicholson, W. L. (2006). A method for extracting RNA from dormant and ger-
minating Bacillus subtilis strain 168 endospores. Curr. Microbiol. 53, 227–231.
doi: 10.1007/s00284-006-0099-1
Morel, N., Volland, H., Dano, J., Lamourette, P., Sylvestre, P., Mock, M., et al.
(2012). Fast and sensitive detection of Bacillus anthracis spores by immunoassay.
Appl. Environ. Microbiol. 78, 6491–6498. doi: 10.1128/AEM.01282-12
Neubauer, A., Soini, J., Bollok, M., Zenker, M., Sandqvist, J., Myllyharju,
J., et al. (2007). Fermentation process for tetrameric human collagen
prolyl 4-hydroxylase in Escherichia coli: improvement by gene optimi-
sation of the PDI/beta subunit and repeated addition of the inducer
anhydrotetracycline. J. Biotechnol. 128, 308–321. doi: 10.1016/j.jbiotec.2006.
10.017
Nieminen, T., Pakarinen, J., Tsitko, I., Salkinoja-Salonen, M., Breitenstein, A., Ali-
Vehmas, T., et al. (2006). 16S rRNA targeted sandwich hybridization method for
direct quantification of mycobacteria in soils. J. Microbiol. Methods 67, 44–55.
doi: 10.1016/j.mimet.2006.02.015
Pioch, D., Jürgen, B., Evers, S., Maurer, K. H., Hecker, M., and Schweder, T. (2008a).
Improved sandwich-hybridization assay for an electrical DNA-chip-based mon-
itoring of bioprocess-relevant marker genes. Appl. Microbiol. Biotechnol. 78,
719–728. doi: 10.1007/s00253-008-1347-z
Pioch, D., Schweder, T., and Jürgen, B. (2008b). Novel developments for improved
detection of specific mRNAs by DNA chips. Appl. Microbiol. Biotechnol. 80,
953–963. doi: 10.1007/s00253-008-1680-2
Pizarro, S. A., Lane, P., Lane, T. W., Cruz, E., Haroldsen, B., and VanderNoot,
V. A. (2007). Bacterial characterization using protein profiling in a microchip
separations platform. Electrophoresis 28, 4697–4704. doi: 10.1002/elps.
200700005
Rautio, J., Barken, K. B., Lahdenperä, J., Breitenstein, A., Molin, S., and Neubauer,
P. (2003). Sandwich hybridisation assay for quantitative detection of yeast RNAs
in crude cell lysates. Microb. Cell Fact. 2, 4. doi: 10.1186/1475-2859-2-4
Rautio, J. J. (2010). Multiplex gene expression analysis by TRAC in fungal cultures.
Methods Mol. Biol. 638, 165–173. doi: 10.1007/978-1-60761-611-5_12
Rautio, J. J., Kataja, K., Satokani, R., Penttilä, M., Söderlund, H., and Saloheimo, M.
(2006). Rapid and multiplexed transcript analysis of microbial cultures using
capillary electophoresis-detectable oligonucleotide probe pools. J. Microbiol.
Methods 65, 404–416. doi: 10.1016/j.mimet.2005.08.010
Rautio, J. J., Satokari, R., Vehmaan-Kreula, P., Serkkola, E., and Söderlund, H.
(2008). TRAC in high-content gene expression analysis: applications in micro-
bial population studies, process biotechnology and biomedical research. Expert
Rev. Mol. Diagn. 8, 379–385. doi: 10.1586/14737159.8.4.379
Regan, J. F., Makarewicz, A. J., Hindson, B. J., Metz, T. R., Gutierrez, D. M., Corzett,
T. H., et al. (2008). Environmental monitoring for biological threat agents using
the autonomous pathogen detection system with multiplexed polymerase chain
reaction. Anal. Chem. 80, 7422–7429. doi: 10.1021/ac801125x
Sloma, A., and Smith, I. (1979). RNA synthesis during spore germination in Bacillus
subtilis.Mol. Gen. Genet. 175, 113–120. doi: 10.1007/BF00425526
Soini J., Falschlehner C., Liedert C., Bernhard J., Vuoristo J., and Neubauer, P.
(2008). Norvaline is accumulated after a down-shift of oxygen in Escherichia
coli W3110. Microb.CellFact.7:30. doi: 10.1186/1475-2859-7-30
Spaulding, U. K., Christensen, C. J., Crisp, R. J., Vaughn, M. B., Trauscht, R. C.,
Gardner, J. R., et al. (2012). RAZOR EX anthrax air detection system. J. AOAC
Int. 95, 860–891. doi: 10.5740/jaoacint.11-521
Stachowiak, J. C., Shugard, E. E., Mosier, B. P., Renzi, R. F., Caton, P. F., Ferko, S. M.,
et al. (2007). Autonomous microfluidic sample preparation system for protein
profile-based detection of aerosolized bacterial cells and spores. Anal. Chem. 79,
5763–5770. doi: 10.1021/ac070567z
Stratis-Cullum, D. N., Griffin, G. D., Mobley, J., Vass, A. A., and Vo-Dinh, T. (2003).
A miniature biochip system for detection of aerosolized Bacillus globigii spores.
Anal. Chem. 75, 275–280. doi: 10.1021/ac026068+
Tamborrini, M., Holzer, M., Seeberger, P. H., Schürch, N., and Pluschke, G. (2010).
Anthrax spore detection by a luminex assay based on monoclonal antibodies
that recognize anthrose-containing oligosaccharides. Clin. Vaccine Immunol. 17,
1446–1451. doi: 10.1128/CVI.00205-10
Taskila, S., Osmekhina, E., Tuomola, M., Ruuska, J., and Neubauer, P. (2011).
Modification of buffered peptone water for improved recovery of heat-injured
Salmonella Typhimurium. J. Food Sci. 76, M157–M162. doi: 10.1111/j.1750-
3841.2010.02050.x
Thieme, D., Neubauer, P., Nies, D. H., and Grass, G. (2008). Sandwich hybridization
assay for sensitive detection of dynamic changes in mRNA transcript levels in
crude Escherichia coli cell extracts in response to copper ions. Appl. Environ.
Microbiol. 74, 7463–7470. doi: 10.1128/AEM.01370-08
Walsh, M. K., Wang, X., and Weimer, B. C. (2001). Optimizing the immobiliza-
tion of single-stranded DNA onto glass beads. J. Biochem. Biophys. Methods 47,
221–231. doi: 10.1016/S0165-022X(00)00146-9
Wang, Z., Fan, Y., Chen, J., Guo, Y., Wu, W., He, Y., et al. (2013). A micro-fluidic
chip-based fluorescent biosensor for the sensitive and specific detection of label-
free single-base mismatch via magnetic beads-based “sandwich hybridization
strategy. Electrophoresis 34, 2177–2184. doi: 10.1002/elps.201300131
Weerasekara, M. L., Ryuda, N., Miyamoto, H., Okumura, T., Ueno, D., Inoue,
K., et al. (2013). Double-color fluorescence in situ hybridization (FISH) for
the detection of Bacillus anthracis spores in environmental samples with
a novel permeabilization protocol. J. Microbiol. Methods 93, 177–184. doi:
10.1016/j.mimet.2013.03.007
Weisburg, W. G., Barns, S. M., Pelletier, D. A., and Lane, D. J. (1991). 16S Ribosomal
DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703.
Wielinga, P. R., Hamidjaja, R. A., Agren, J., Knutsson, R., Segerman, B., Fricker, M.,
et al. (2011). A multiplex real-time PCR for identifying and differentiating B.
anthracis virulent types. Int. J. Food Microbiol. 145 (Suppl. 1), S137–S144. doi:
10.1016/j.ijfoodmicro.2010.07.039
Zhou, B., Wirsching, P., and Janda, K. D. (2002). Human antibodies against spores
of the genus Bacillus: a model study for detection of and protection against
anthrax and the bioterrorist threat. Proc. Natl. Acad. Sci. U.S.A. 99, 5241–5246.
doi: 10.1073/pnas.082121599
Conflict of Interest Statement: The authors declare that the research was con-
ducted in the absence of any commercial or financial relationships that could be
construed as a potential conflict of interest.
Received: 21 January 2014; accepted: 19 February 2014; published online: 11 March
2014.
Citation: Osmekhina E, Shvetsova A, Ruottinen M and Neubauer P (2014)
Quantitative and sensitive RNA based detection of Bacillus spores. Front. Microbiol.
5:92. doi: 10.3389/fmicb.2014.00092
This article was submitted to Microbiotechnology, Ecotoxicology and Bioremediation,
a section of the journal Frontiers in Microbiology.
Copyright © 2014 Osmekhina, Shvetsova, Ruottinen and Neubauer. This is an open-
access article distributed under the terms of the Creative Commons Attribution License
(CC BY). The use, distribution or reproduction in other forums is permitted, provided
the original author(s) or licensor are credited and that the original publication in this
journal is cited, in accordance with accepted academic practice. No use, distribution or
reproduction is permitted which does not comply with these terms.
Frontiers in Microbiology | Microbiotechnology, Ecotoxicology and Bioremediation March2014|Volume5|Article92|8