Document [original]

ORIGINAL RESEARCH ARTICLE

published: 11 March 2014

doi: 10.3389/fmicb.2014.00092

Quantitative and sensitive RNA based detection of Bacillus

spores

Ekaterina Osmekhina1, Antonina Shvetsova2, Maria Ruottinen1and Peter Neubauer1,3*

1Department of Process and Environmental Engineering and Biocenter Oulu, University of Oulu, Oulu, Finland

2Department of Biochemistry and Biocenter Oulu, University of Oulu, Oulu, Finland

3Laboratory of Bioprocess Engineering, Department of Biotechnology, Technische Universität Berlin, Berlin, Germany

Edited by:

Eric Altermann, AgResearch Ltd,

New Zealand

Reviewed by:

Grzegorz Wegrzyn, University of

Gdansk, Poland

Johannes Kabisch,

Ernst-Moritz-Arndt Universität

Greifswald, Germany

*Correspondence:

Peter Neubauer, Laboratory of

Bioprocess Engineering,

Department of Biotechnology,

Technische Universität Berlin,

Ackerstraße 76, D-13355 Berlin,

Germany

e-mail: peter[email protected]

The fast and reliable detection of bacterial spores is of great importance and still remains

a challenge. Here we describe a direct RNA-based diagnostic method for the specific

detection of viable bacterial spores which does not depends on an enzymatic amplification

step and therefore is directly appropriate for quantification. The procedure includes the

following steps: (i) heat activation of spores, (ii) germination and enrichment cultivation, (iii)

cell lysis, and (iv) analysis of 16S rRNA in crude cell lysates using a sandwich hybridization

assay. The sensitivity of the method is dependent on the cultivation time and the detection

limit; it is possible to detect 10 spores per ml when the RNA analysis is performed after 6 h

of enrichment cultivation. At spore concentrations above 106spores per ml the cultivation

time can be shortened to 30 min. Total analysis times are in the range of 2–8 h depending

on the spore concentration in samples. The developed procedure is optimized at the

example of Bacillus subtilis spores but should be applicable to other organisms. The new

method can easily be modified for other target RNAs and is suitable for specific detection

of spores from known groups of organisms.

Keywords: spore detection, Bacillus subtilis, RNA hybridization

INTRODUCTION

Detection of microorganisms in air is challenging due to the

very low amount of organisms that generally are collected in air

samples and the presence of organisms as dormant spores.

Various biosensors have been developed for the specific detec-

tion of harmful microbial spores in air samples (Gooding, 2006).

Most methods for the detection of Bacillus spores have been

designed for Bacillus anthracis, a causative factor for anthrax and

a potential biological threat agent (Edwards et al., 2006; Irenge

and Gala, 2012), in order to create sensors for biological warfare

agents. Being a causative agent, B. anthracis is difficult to work

with, and therefore the closely related species Bacillus subtilis and

B. cereus are often used in the development of detection strategies

(Arakawa et al., 2003; Stachowiak et al., 2007; Inami et al., 2009;

Cheng et al., 2011).

The primary strategies for detection of Bacillus spores include

polymerase chain reaction based techniques, immunoassays,

spectrometry, chromatography, and protein profiling (Table 1).

Recently also some autonomous pathogen detection systems for

aerosol collection, sample preparation and detection were devel-

oped (Hindson et al., 2005; Stachowiak et al., 2007; Regan et al.,

2008; Inami et al., 2009)(Table 1).

A number of direct methods are based on DNA or protein

detection and cannot distinguish between viable and dead spores.

Furthermore, most of them have low sensitivity or require an

amplification step such as PCR. RNA-based detection methods

have the advantage to specifically analyze only viable spores,

and RNA’s, especially ribosomal RNAs (rRNAs), are populated

Abbreviations: SHA, sandwich hybridization assay.

in high amounts, making enzyme-based amplifications methods

indispensible. Thus it is reasonable to apply RNA detection after

the activation of RNA synthesis which takes place already after

approximately 10 min of germination (Keijser et al., 2007).

Sandwich hybridization assays (SHA) are suitable for a rapid

and quantitative RNA detection (Rautio et al., 2003). These

methods are based on the hybridization of a target RNA (or

denatured DNA) with two specific oligonucleotide probes. A cap-

ture probe is used to immobilize the target on a solid support,

such as magnetic microbeads, which provide a large surface area

for nucleic acid attachments (Walsh et al., 2001). This bind-

ing between the probes and the beads is usually performed by

interaction between biotin attached to the oligonucleotide probe

and streptavidin coated magnetic beads. The detection probe is

labeled with a marker molecule which generates a signal pro-

portional to the amount of target molecules. Oligonucleotide

probes required for this assay can be designed for almost any

RNA and can easily be modified for other targets. This means

that the developed detection system can be applied for different

organisms with just some small adaptations. Sandwich hybridiza-

tion is relatively sensitive (10−16–10−15 moles of a specific target

molecule) and can be performed with crude biological samples

without any RNA purification. The method has been successfully

applied for the detection of 16S rRNA from Legionella sp.inwater

samples (Leskelä et al., 2005), mycobacteria in soils (Nieminen

et al., 2006), Lactobacillus and Pediococcus in brewery yeast slur-

ries (Huhtamella et al., 2007), Salmonella in minced meat (Taskila

et al., 2011), Bacillus cereus DNA (Gabig-Ciminska et al., 2004)

and for monitoring dynamic changes of different mRNA species

in microbial processes (Rautio et al., 2003; Neubauer et al., 2007;

www.frontiersin.org March 2014 | Volume 5 | Article 92 |1

Osmekhina et al. RNA-based detection of Bacillus spores

Table 1 | Methods for detection of Bacillus spores.

Method Sensitivity Organisms Comments References

NUCLEIC ACID BASED METHODS

Real-time PCR 1 spore per 100 L of air B. anthracis Lee et al., 1999; Makino and

Cheun, 2003; Irenge et al., 2010;

Wielinga et al., 2011

Culture-based PCR 1–10 spores per analysis B. anthracis High-throughput Kane et al., 2009

NASBAacoupled with

biosensor

1–10 spores per analysis B. anthracis Analysis after 30 min of

germination

Baeumner et al., 2004

FISHb103spores per m3of air B. anthracis Weerasekara et al., 2013

ICANcDNA detection 104spores per analysis B. subtilis Does not contain a

germination step

Inami et al., 2009

Autonomous pathogen

detection system with

multiplexed PCR

B. anthracis

and others

Regan et al., 2008

RAZOR® EX Anthrax Air

Detection System

200 spores per analysis B. anthracis DNA extraction and

real-time PCR

Spaulding et al., 2012; Hadfield

et al., 2013

IMMUNOASSAYS

Colorimetric and

electrochemilumine-scence

immunoassay

30–100 spores per

analysis

B. anthracis Morel et al., 2012

ELISAdB. subtilis Zhou et al., 2002

On-chip ELISA 105spores per analysis B. subtilis Chemiluminescence method

combined with a biochip.

Antibodies against surface

spore antigen were used

Stratis-Cullum et al., 2003

Luminex assay 103–104spores per ml B. anthracis Monoclonal antibodies

recog-nize

anthrose-containing

oligosaccharides on the

surface of B. anthracis

endospores

Tamborrini et al., 2010

Peptide-Function cantilever

arrays

105spores per ml for

analysis

B. subtilis 1 from 2400 spores was

captured

Dhayal et al., 2006; Campbell and

Mutharasan, 2007

Chip gel electrophoresis

protein profiling (CGE-PP)

16 particles per liter

100 cells per analysis

Any

(adapted for

E. coli and

B. subtilis)

Autonomous microfluidic

system

Pizarro et al., 2007; Stachowiak

et al., 2007

Multiplexed Immunoassay

with PCR Confirmation

49 spores per liter of air B. subtilis Autonomous Detection of

Aerosolized Biological Agents

McBride et al., 2003; Hindson

et al., 2004

OTHERS

Pyrolysis micromachined

differential mobility

spectrometry

103spores per analysis B. anthracis A microfabricated ion mobility

spectrometer in combination

with a pattern recognition and

classification algorithm

Krebs et al., 2006

Microcalorimetric

spectroscopy

100–1000 spores B. subtilis,

B. cereus

Arakawa et al., 2003

Laser induced breakdown

spectroscopy

single particles B. subtilis In combination with other

detection methods

Hybl et al., 2003, 2006

Mass-spectrometry 104–105spores B. anthracis In combination with other

detection methods

Lasch et al., 2009; Chenau et al.,

2011; Li et al., 2012

Raman scattering 104spores Not specific Based on detection of

dipicolinic acid

Cheng et al., 2011, 2012; Cowcher

et al., 2013

Optical microchip array

biosensor

5×107spores per ml B. anthracis

and others

Bhatta et al., 2011

aNASBA, Nucleic acid sequence based amplification.

bFISH, Fluorescence in situ hybridization.

cICAN, Isothermal and chimeric primer-initiated amplification of nucleic acids.

dELISA, Enzyme linked immunosorbent assay.

Frontiers in Microbiology | Microbiotechnology, Ecotoxicology and Bioremediation March2014|Volume5|Article92|2

Osmekhina et al. RNA-based detection of Bacillus spores

Soini et al., 2008; Thieme et al., 2008). The possibility to use

various markers makes the method applicable for different read-

out systems, such as fluorescence meters (Rautio et al., 2003),

chip-based fluorescent biosensors (Wang et al., 2013) or electrical

biochip readers (Gabig-Ciminska et al., 2004; Jürgen et al., 2005;

Elsholz et al., 2006; Pioch et al., 2008a,b). The SHA coupled with

capillary electrophoresis called TRAC (transcript analysis with aid

of affinity capture) was developed for multiplex transcript analy-

sis and is commercially available (Rautio et al., 2006, 2008; Rautio,

2010) (PlexPress Oy, Finland).

In the actual study a procedure was developed for detecting

bacterial spores, utilizing spore activation, enrichment cultiva-

tion and an RNA-based sandwich hybridization assay. In contrast

to most assays utilizing DNA and protein detection, the method

developed here is specific only for viable organisms since it is

based on RNA synthesis.

MATERIALS AND METHODS

SPORE PREPARATION

Bacillus subtilis spores were obtained from cells (B. subtilis 6051α,

kindly provided by Prof. Dr. Thomas Schweder, Ernst-Moritz-

Arndt University of Greifswald, Germany) cultured in Schaeffer’s

sporulation medium (8 g/l bacto-nutrient broth, 0.1% (w/v) KCl,

0.012% (w/v) MgSO4×7H20, 0.5 mM NaOH, 1 mM Ca(NO3)2,

0.01 mM MnCl2, 0.001 mM FeSO4)at37

◦C, 200 rpm for 4 days.

Cultures were carried out in 3-baffled 1 liter Erlenmeyer flasks

with a liquid volume of 100 ml. After harvesting and extensive

washing with water at 4◦C, spores were inspected by phase-

contrast microscopy to show that samples are free of vegetative

cells (<10%). Spores were lyophilized and stored at 4◦C. For

counting, the spores were diluted in 0.9% NaCl, activated at 70◦C

for 30 min and plated on nutrient agar plates (Difco, USA).

ACTIVATION AND GROWTH CONDITIONS

B. subtilis spores were diluted in 0.9% NaCl and activated by

temperature treatment at 70◦C for 30 min. Thereafter the sus-

pensions were transferred into 3-baffled 1 l Erlenmeyer flasks

containing 100 ml of a germination medium (20 g/l tryptone,

10 g/l yeast extract, 10 g/l NaCl and 0.5 mM L-alanine) (Moeller

et al., 2006). Cultures were carried out at 37◦C and 200 rpm on

a rotary shaker. Culture growth was monitored by measuring the

optical density at 600 nm (OD600, Ultrospec Pro 2100 UV/Visible

Spectrophotometer, GE Healthcare, Buckinghamshire, UK). The

corresponding colony forming units (cfu/ml) were determined by

plating on nutrient agar plates.

SAMPLE PREPARATION

1ml of the B. subtilis cultures were removed into pre-cooled

1.5 ml microreaction tubes containing 0.125 ×sample volume

of cold 95:5 ethanol:phenol (v/v) (Thieme et al., 2008). The cells

were collected by centrifugation (15,000 ×g, +4◦C, 5 min). The

pellets were suspended in 500 μlof1×TEN buffer (10 mM Tris-

HCl, 1 mM EDTA, 100 mM NaCl, pH 8.0) containing 1 μl/ml

RNAguard® RNase inhibitor (Amersham Biosciences, New Jersey,

USA) and mixed by vortexing for 1 min. Then the cell suspen-

sions were transferred into 2 ml microcentrifuge tubes with a skirt

(Greiner Bio-One GmbH, Frickenhausen, Germany) containing

100 mg glass beads (BioSpec Products Inc., Bartlesville, OK, USA)

with a diameter of 0.1 mm. Cell disruption was performed with a

FastPrep® FP120 Cell Disrupter (Bio-101, Thermo Savant, USA)

at 4.5 m/s for 4 ×25 s. The vials were kept on ice for 1 min

between the disruption cycles. Cell homogenates were centrifuged

(20,000 ×g, +4◦C, 5 min) and supernatants were snap frozen in

liquid nitrogen.

GENERATION OF THE DNA FOR THE IN VITRO 16S rRNA TRANSCRIPT

The target gene was amplified by PCR using a colony of B. subtilis

cells as a template and 10 pmol of the forward and reverse primers

(Weisburg et al., 1991)(Table 2).Theforwardprimercontained

at the 5–end the T7 promoter sequence CTA ATA CGA CTC ACT

ATA GGG. The PCR conditions were as follows: 3 min at 95◦C; 35

cycles of 15 s at 95◦C, 30 s at 50◦Cand1min45sat72

◦C; 10 min

at 72◦C and afterwards held at 4◦C. PCR products were analyzed

by agarose gel electrophoresis and purified with the QIAquick

PCR purification kit (Qiagen, Hilden, Germany). Purified PCR

products were quantified by absorbance measurement at 260 nm

(GeneQuant II, Viochrom Ltd., Cambridge, UK).

Target RNA was generated from the purified PCR prod-

uct by means of T7 RNA polymerase in vitro transcription

using the MAXIscript™ T7-kit (Ambion, Austin, TX, USA).

The quality of the in vitro transcribed RNA was checked by

the Agilent 2100 Bioanalyser and RNA 6000 Nano LabChip Kit

(Agilent Technologies, Waldbronn, Germany). RNA was quanti-

fied by absorbance measurement at 260 nm (NanoDrop ND 1000,

Thermo Fisher Scientific, USA).

OLIGONUCLEOTIDE PROBES

The oligonucleotide probes for B. subtilis 16S rRNA were designed

on the basis of general eubacterial probes with some modifi-

cations (Table 2). The oligonucleotide probes were purchased

from Oligomer Oy (Helsinki, Finland). The detection probe

was labeled with the DIG Oligonucleotide Tailing Kit (Roche

Diagnostics, Mannheim, Germany) according to the manufac-

turer’s instructions.

SANDWICH HYBRIDIZATION ASSAY

A quantitative sandwich hybridization assay (SHA) was used for

detecting 16S rRNA molecules. The procedure was performed as

described by Rautio et al. (2003) and Thieme et al. (2008) with

small modifications.

SHAs were carried out in 96-well bright U-shaped microplates

(Greiner-Bio-One GmbH, Frickenhausen, Germany) using a

Thermomixer Comfort (Eppendorf, Hamburg, Germany). The

target RNA was mixed with the 5 ×SSC hybridization buffer

(0.75 M sodium chloride, 0.075 M sodium citrate, pH 7.0), 20%

(v/v) deionized formamide, 3% (w/v) dextran sulphate, 0.2%

(v/v) TWEEN20, 0.02% (v/v) Ficoll, 0.02% (w/v) polyvinyl

pyrrolidone, 0.02% (w/v) bovine serum albumin, 1% (v/v) block-

ing reagent (Roche, Mannheim, Germany) in 100 mM maleic

acid with 150 mM NaCl (pH 7.5), 5 pmol biotin-labeled cap-

ture probe, 1 pmol DIG-labeled detection probe, and 1 pmol of

each helper probe in a total volume of 100 μl. The hybridization

reactions were performed in three parallels at 750 rpm and 50◦C

for 30 min. 15 μl of Streptavidin MagneSphere®Paramagnetic

www.frontiersin.org March 2014 | Volume 5 | Article 92 |3

Osmekhina et al. RNA-based detection of Bacillus spores

Table 2 | Sequences of the oligonucleotide probes used in sandwich hybridization for the detection of B. subtilis 16S rRNA and PCR primers.

Probe name Probe specification Probe sequence 5–3Location of probe Probe modification

Bsub16Scap Capture TGTCTCAGTCCCAGTGTGGa319–337 5-Biotin

Bsub16Sdet Detection CGTAGGAGTCTGGGCCGa338–354 3-Digoxigenin

Help1 Helper CCCCACTGCTGCCTCC 355–370

Help2 Helper CTGGTCATCCTCTCAGA 302–318

Fd-T7 Forward PCR primer (CTAATACGACTCACTATAGGG)

AGAGTTTGATCCTGGCTCAG

10–29 5-T7 promoter

Rev Reverse PCR primer CGGCTACCTTGTTACGACTT 1502–1521

NCcap Negative control capture probe TGTGAACTTCCATCGGCTTGAGCC 5-Biotin

NCdet Negative control detection probe GATAGTCCCTCTAAGAAGCCATGTG 3-Digoxigenin

aNucleotides different to general eubacterial probes are underlined.

Particles (Promega, Madison, WI, USA) were washed as rec-

ommended by the manufacturer, and added to each well after

the hybridization reaction and incubated at 750 rpm and 50◦C

for 30 min. Subsequently, beads were washed three times with

120 μl of a washing buffer (1% SSC, 0.1% TWEEN20) at 25◦C

and 750 rpm for 2 min. During the washing step beads were

kept in the wells with a MagnaBot® 96 Magnetic Separation

Device (Promega, Madison, WI, USA). 100 μl of anti-DIG alka-

line phosphatase Fab-fragments (Roche Diagnostics, Mannheim,

Germany) were diluted with 1 ×SSC, 0.1% TWEEN20 to a

final concentration of 375 U/l, and applied to each well. The

96-well plate was incubated at 450 rpm and 25◦C for 30 min.

Unbound enzyme was removed by washing three times as

described above. Afterwards the whole solutions were trans-

ferred into new microplates and washed once more. Finally,

100 μl of 1 mM AttoPhos® fluorescent substrate (Promega,

Madison, WI, USA) was added to each well and the enzy-

matic reaction was performed at 37◦C and 750 rpm for 20 min.

90 μl of the contents of well were transferred into a Costar

black 96-well assay plate (Corning Inc., Corning, NY, USA) for

the fluorescence measurement with a Wallac Victor multilabel

counter (PerkinElmer Life Sciences, Turku, Finland) at an exci-

tation wavelength of 430 nm and an emission wavelength of

560 nm.

The detection limit was defined as 3 ×SD added to the back-

ground fluorescence. Detection limits were calculated separately

for each SHA and signals above it were considered as positive.

Capture and detection probes which are not complementary to

any RNA of B. subtilis (Table 2, NCcap and NCdet, respectively)

were used as a negative control for each sample to estimate the

background signal.

RESULTS

The aim of this study was the development of a diagnostic method

for the detection of bacterial spores at the example of Bacillus sub-

tilis spores. The sequence of the procedure is shown in Figure 1A.

First, the spores are activated by a heat treatment (30 min, 70◦C)

and following transfer into germination medium (Keijser et al.,

2007). The duration of the enrichment cultivation was varied

depending on the initial amount of spores. After the incubation

phase collected samples were disrupted and the supernatant was

utilized for the quantification of the 16S ribosomal RNA directly

from the cell broth by the use of a sandwich hybridization assay

without any further purification.

RNA-based detection of spores is feasible only after the acti-

vation of RNA synthesis, that takes place during the spore ger-

mination. In order to activate B. subtilis spores and initiate the

germination process, dormant spores were exposed to heat (70◦C

for 30 min) and afterwards cultured in the germination medium

at 37◦C. Cell germination and growth were monitored by mea-

suring the OD600 (Figure 1B). An increase of the cell density after

1 h of cultivation indicated that the germination and outgrowth

were completed and proliferation began.

For this feasibility study oligonucleotide probes for the detec-

tion of B. subtilis 16S rRNA with SHA were designed on the basis

of general eubacterial probes with some modifications to detect

the sequences specific for B. subtilis (Table 2). The probes were

tested using an in vitro transcribed fragment of B. subtilis 16S

rRNA as target molecule, which also is applied as a quantitative

standard. 6 ×107(0.1 fmol) target molecules in the hybridization

solution gave a signal that was significantly above the detection

limit. The reaction was linear over a range of nearly 3 orders of

magnitude up to approximately 3 ×1010 i.e., 50 fmol of target

molecules (Figure 1C).

In order to determine the detection limit and the range of the

SHA for crude cell extracts, different dilutions of B. subtilis cell

extracts were analyzed with the sandwich hybridization assay. The

cells were collected at the end of the exponential growth phase

(OD600 =1.4), disrupted, and 2.7×102to 5.4×106cells were

used as targets for a dilution curve (Figure 1D). The detection

limit was about 1.5×103cells per assay for exponentially grow-

ing B. subtilis cells (7.5×104cells per ml of culture medium). The

calculated amount of 16S rRNA was 4.8 (±0.6) ×104molecules

per cell at this growth phase. Consequently, the detection limit

in crude cell extracts corresponded to about 7.2×10716S rRNA

molecules. The linear range of the assay was between 103and 106

cells in a hybridization solution.

In order to establish the analysis of cells from enrichment

cultures the germination medium was inoculated with 105–108

activated B. subtilis spores per mL. After 30 min of cultivation

(before the first proliferation), the cells were disrupted and ana-

lyzed with SHA (Figure 1E). It was possible to detect about 20,000

cells per assay (106cells per ml of culture medium). This number

of cells corresponds to approximately 10816S rRNA molecules.

Frontiers in Microbiology | Microbiotechnology, Ecotoxicology and Bioremediation March2014|Volume5|Article92|4

Osmekhina et al. RNA-based detection of Bacillus spores

FIGURE 1 | Spore detection using a sandwich hybridization assay.

(A) Principle of airborne spore detection using a sandwich hybridization assay.

Spores collected from air are activated and cultivated in a germination medium.

The first sample for analysis can be collected after approximately 30 min of

germination. If the amount of spores is too low to be detected at this step, the

incubation can be continued to allow a multiplication of the cells. (B)AGrowth

curve of B. subtilis cells. After heat activation (70◦C for 30 min) B. subtilis

spores were inoculated into a germination medium to a final concentration of

106spores/ml. (C) Standard curve for the B. subtilis 16S rRNA sandwich

hybridization assay. (D) SHA dilution curve for B. subtilis 16S rRNA. The dilutions

of the crude extracts of B. subtilis cells collected at the exponential growth

phase (OD600 =1.4) were used as a target. The corresponding numbers of 16S

rRNA molecules were calculated according to the standard curve of in vitro

transcribed 16SrRNA at 260 nm. (E) 16S rRNA measured with SHA in B. subtilis

spores after their activation and germination for 30 min. Corresponding

numbers of 16S rRNA molecules were calculated according to the standard

curve (Figure 1C). The error bars show the ±SD of three parallel experiments

and the detection limit is shown as a dashed horizontal line.

According to the measurements at this stage of germination one

B. subtilis cell contained 5.6 (±0.9) ×10316S rRNA molecules.

Next, the sensitivity of the method including activation,

enrichment cultivation, and 16S rRNA analysis of B. subtilis

spores was studied. Therefore the germination medium was

inoculated with 101–105activated B. subtilis spores per ml.

Germination and growth of the cells were monitored by mea-

suring the OD600(Figure 2A). The cells were collected, disrupted

and analyzed with SHA using the probes against the16S rRNA

(Figure 2B). Detectable signals were observed after 110, 140, 245,

340, and 370 min of cultivation for the samples with initial num-

ber of 105,10

4,10

3,10

2,and10

1spores per ml of culture medium,

respectively.

Since the SHA sensitivity depends on the number of target

RNA molecules in one cell, the amount of 16S rRNA was mea-

sured for different growth phases of B. subtilis cells (Figure 3).

As it was shown earlier one B. subtilis cell contained 5.6 (±0.9)

×10316S rRNA molecules already after 30 min of germination.

At the early exponential growth phase the amount of 16S rRNA

molecules per cell was maximal (about 9 ×104rRNA molecules

per cell for an OD600 of 0.27) and the 16S rRNA content decreased

in later growth stages. Therefore the analysis is most sensitive if

the OD600 is approximately 0.3.

DISCUSSION

Detection of microorganisms in bioaerosols is an important issue

in determining bio-warfare agents during biological attacks and

for the monitoring of indoor air quality. A fast and sensitive

method for the detection of bacterial spores was developed in

this study. The procedure includes activation of spores, their ger-

mination, enrichment cultivation and RNA detection using a

sandwich hybridization assay, thus only viable spores are detected,

which is advantageous over standard detection methods as listed

in Table 1. There are no sensitivity limitations as the method is

adaptable by the enrichment cultivation time. The RNA analysis

can be performed directly with crude cell extracts avoiding labo-

rious RNA purification. The method was developed for B. subtilis,

a model organism capable of spore formation and quite abundant

in aerosols.

Since spores only contain low amounts of RNA molecules,

the idea of this study was to initiate RNA synthesis to increase

the detection system sensitivity. At first, the spores are acti-

vated at 70◦C for 30 min and placed into a medium contain-

ing L-alanine as a germination factor. During germination and

outgrowth the activated spores synthesize RNA, proteins, and

ATP. Chromosomal replication is initiated after 0.5 h (Garrick-

Silversmith and Torriani, 1973) and the first cell division takes

www.frontiersin.org March 2014 | Volume 5 | Article 92 |5

Osmekhina et al. RNA-based detection of Bacillus spores

FIGURE 2 | Sensitivity of the B. subtilis spore detection method.

(A) Growth curves of B. subtilis cells after spore activation. The initial

number of the spores was 101–105spores per ml of germination medium.

(B) Detection of B. subtilis 16S rRNA by sandwich hybridization after

enrichment cultivation. The error bars show ±SD of three independent

cultivations and measurements.

FIGURE 3 | Level of 16S rRNA molecules per cell (gray bars) in different

growth phases of B. subtilis.Quantity of RNA was measured with SHA.

The growth was followed by measuring the optical density at 600 nm (◦)

and the specific growth rate was calculated (black line). The dashed line

shows fitting of the OD curve.

place after approximately 70 min (Keijser et al., 2007). Depending

on the initial amount of spores, cells are disrupted either directly

after the germination or after the enrichment cultivation required

for the accumulation of necessary amount of RNA molecules. The

presentedmethodallowstheuseofcrudecellslysatesassample

material for the RNA detection, and no further RNA purification

is needed (Rautio et al., 2003; Thieme et al., 2008). We believe that

this is a strong advantage for using the sandwich hybridization

assay for the RNA detection compared to reverse transcriptase real

time PCR.

The assay is based on the hybridization event of the target RNA

with two oligonucleotide probes. Alkaline phosphatase attached

to one of the probes generates a fluorescent signal used for quan-

tification. The SHA has a potential to be automated, e.g., by the

use of an electrical chip reader (Gabig-Ciminska et al., 2004).

After the activation the spores germinated very quickly. The

first increase of the OD600 was noticed already after 1 h for the cul-

tures with an initial amount of 106spores per ml. The detectable

SHA signal for these cultures was observed after 0.5 h of ger-

mination. Since the RNA synthesis in germinating B. subtilis

spores starts within about 5 min after spore activation (Matsuda

and Kameyama, 1986), the cells have accumulated a detectable

amount of RNA molecules already after 30 min. Furthermore,

at this moment the spore core is rehydrated making cells more

accessible to disruption (Sloma and Smith, 1979; Moeller et al.,

2006).

The sensitivity of the developed method is not limited due to

enrichment cultivation for which the time can be adapted. Very

low initial spore amounts in the sample could be detected after

about 5 h of enrichment cultivation. Consequently, the maximum

duration of the assay for a very low amount of spores including

spore activation, enrichment cultivation, and detection with the

SHA is about 8 h. The detection limit of the SHA was estimated

as 6 ×107target molecules, which in case of using rRNA as a tar-

get corresponds to about 103–104cells in a sample depending on

their growth stage.

By the use of in vitro synthesized RNA probes as a standard

with the SHA it was possible to estimate the amount of 16S

rRNA molecules per cell. As expected, the number of molecules

increased during the germination and the outgrowth, reached the

maximum at the beginning of the exponential phase of growth,

and then slowly decreased. After 0.5 h of germination one cell

contained approximately 5.6 (±0.9) ×10316S rRNA molecules.

Exponentially growing cells contained about 9 ×10416S rRNA

molecules. These numbers correlate well with the known amount

of ribosomes in Escherichia coli cells, that is 6700–71,000 depend-

ing on the specific growth rate (Bremer and Dennis, 1996).

The 16S rRNA oligonucleotide probes used in this study

are capable of detecting most bacteria and are relevant only

for method development. Specific probes for the SHA can be

designed for almost any organism or groups of organisms if the

gene sequence is available. Furthermore, it would be possible to

apply the procedure for the analysis of mRNAs and their dynam-

ics during germination. However, due to numerical advantage of

ribosomes compared to a specific mRNA species, the method sen-

sitivity would be lower when mRNA is used as a target for the SHA

instead of rRNA and additionally the analytical error eventually

would be higher due to the low stability of mRNA molecules. For

selecting target mRNAs for specific identification of B. subtilis a

transcription profile of germinated spores (Keijser et al., 2007)

and the most abundant proteins of growing Bacillus cells have to

Frontiers in Microbiology | Microbiotechnology, Ecotoxicology and Bioremediation March2014|Volume5|Article92|6

Osmekhina et al. RNA-based detection of Bacillus spores

be reviewed. Protein abundance during the exponential growth

of Bacillus subtilis has been studied in great detail (Büttner et al.,

2001; Eymann et al., 2004). The most abundant proteins in B.

subtilis cytosolic extracts perform mainly housekeeping functions

as components of the translational apparatus (e.g., translation

elongation factors, ribosomal proteins), the glycolytic pathways,

the tricarboxylic acid cycle, the metabolism of amino and nucleic

acids, and protein quality control (e.g., chaperons). The mRNAs

of these proteins can be used as a target for the specific detection

of B. subtilis spores using the presented method.

ACKNOWLEDGMENTS

Dr. Pekka Belt, Dr. Janne Härkönen, and Dr. Matti Möttönen are

acknowledged for critical editing of this manuscript. This study

was supported by the Finnish Funding Agency for Technology

and Innovation (TEKES) project ENRICH (40254/07).

REFERENCES

Arakawa, E. T., Lavrik, N. V., Rajic, S., and Datskos, P. G. (2003). Detection

and differentiation of biological species using microcalorimetric spectroscopy.

Ultramicroscopy 97, 459–465. doi: 10.1016/S0304-3991(03)00074-3

Baeumner, A. J., Leonard, B., McElwee, J., and Montagna, R. A. (2004). A rapid

biosensor for viable B. anthracis spores. Anal. Bioanal. Chem. 380, 15–23. doi:

10.1007/s00216-004-2726-7

Bhatta, D., Michel, A. A., Marti Villalba, M., Emmerson, G. D., Sparrow, I. L.

G., Perkins, E. A., et al. (2011). Optical microchip array biosensor for multi-

plexed detection of bio-hazardous agents. Biosens. Bioelectron. 30, 78–86. doi:

10.1016/j.bios.2011.08.031

Bremer, H., and Dennis, P. P. (1996). “Modulation of chemical composition and

other parameters of the cell by growth rate,” in Escherichia coli and Salmonella

typhimurium Cellular and Molecular Biology, ed F. C. Neidhardt (Washington,

DC: American Society of Microbiology), 1553–1569.

Büttner, K., Bernhardt, J., Scharf, C., Schmid, R., Mäder, U., Eymann, C.,

et al. (2001). A comprehensive two-dimensional map of cytosolic pro-

teins of Bacillus subtilis.Electrophoresis 22, 2908–2935. doi: 10.1002/1522-

2683(200108)22:14<2908::AID-ELPS2908>3.0.CO;2-M

Campbell, G. A., and Mutharasan, R. (2007). Method of measuring Bacillus

anthracis spores in the presence of copious amounts of Bacillus thuringiensis

and Bacillus cereus.Anal. Chem. 79, 1145–1152. doi: 10.1021/ac060982b

Chenau, J., Fenaille, F., Ezan, E., Morel, N., Lamourette, P., Goossens, P. L., et al.

(2011). Sensitive detection of Bacillus anthracis spores by immunocapture and

liquid chromatography-tandem mass spectrometry. Anal. Chem. 83, 8675–8682.

doi: 10.1021/ac2020992

Cheng,H.W.,Chen,Y.Y.,Lin,X.X.,Huan,S.Y.,Wu,H.L.,Shen,G.L.,etal.

(2011). Surface-enhanced Raman spectroscopic detection of Bacillus subtilis

spores using gold nanoparticle based substrates. Anal. Chim. Acta 707, 155–163.

doi: 10.1016/j.aca.2011.09.007

Cheng, H. W., Huan, S. Y., and Yu, R. Q. (2012). Nanoparticle-based substrates for

surface-enhanced Raman scattering detection of bacterial spores. Analyst 137,

3601–3608. doi: 10.1039/c2an35448a

Cowcher, D. P., Xu, Y., and Goodacre, R. (2013). Portable, quantitative detection of

Bacillus bacterial spores using surface-enhanced Raman scattering. Anal. Chem.

85, 3297–3302. doi: 10.1021/ac303657k

Dhayal, B., Henne, W. A., Doorneweerd, D. D., Reifenberger, R. G., and Low,

P. S. (2006). Detection of Bacillus subtilis spores using peptide-functionalized

cantilever arrays. J. Am. Chem. Soc. 128, 3716–3721. doi: 10.1021/ja0570887

Edwards, K. A., Clancy, H. A., and Baeumner, A. J. (2006). Bacillus anthracis:

toxicology, epidemiology and current rapid-detection methods. Anal. Bioanal.

Chem. 384, 73–84. doi: 10.1007/s00216-005-0090-x

Elsholz, B., Worl, R., Blohm, L., Albers, J., Feucht, H., Grunwald, T., et al. (2006).

Automated detection and quantitation of bacterial RNA by using electrical

microarrays. Anal. Chem. 78, 4794–4802. doi: 10.1021/ac0600914

Eymann, C., Dreisbach, A., Albrecht, D., Bernhardt, J., Becher, D., Gentner, S.,

et al. (2004). A comprehensive proteome map of growing Bacillus subtilis cells.

Proteomics 4, 2849–2876. doi: 10.1002/pmic.200400907

Gabig-Ciminska, M., Holmgren, A., Andresen, H., Bundvig, B. K., Wümpelmann,

M., Albers, J., et al. (2004). Electric chips for rapid detection and quantifi-

cation of nucleic acids. Biosens. Bioelectron. 19, 537–546. doi: 10.1016/S0956-

5663(03)00273-2

Garrick-Silversmith, L., and Torriani, A. (1973). Macromolecular syntheses during

germination and outgrowth of Bacillus subtilis spores. J. Bacteriol. 114, 507–516.

Gooding, J. J. (2006). Biosensor technology for detecting biological warfare

agents: recent progress and future trends. Anal. Chim. Acta 559, 137–151. doi:

10.1016/j.aca.2005.12.020

Hadfield, T., Ryan, V., Spaulding, U. K., Clemens, K. M., Ota, I. M., and Brunelle,

S. L. (2013). RAZOR EX Anthrax Air Detection System for detection of Bacillus

anthracis spores from aerosol collection samples: collaborative study. J. AOAC

Int. 96, 392–398. doi: 10.5740/jaoacint.CS2012-06

Hindson, B. J., Brown, S. B., Marshall, G. D., McBride, M. T., Makarewicz, A. J.,

Gutierrez, D. M., et al. (2004). Development of an automated sample prepara-

tion module for environmental monitoring of biowarfare agents. Anal. Chem.

76, 3492–3497. doi: 10.1021/ac035365r

Hindson, B. J., McBride, M. T., Makarewicz, A. J., Henderer, B. D., Setlur, U.

S., Smith, S. M., et al. (2005). Autonomous detection of aerosolized bio-

logical agents by multiplexed immunoassay with polymerase chain reaction

confirmation. Anal. Chem. 77, 284–289. doi: 10.1021/ac0489014

Huhtamella, S., Leinonen, M., Nieminen, T., Fahnert, B., Myllykoski, L.,

Breitenstein, A., et al. (2007). RNA-based sandwich hybridisation method for

detection of lactic acid bacteria in brewery samples. J. Microbiol. Methods 68,

543–553. doi: 10.1016/j.mimet.2006.10.009

Hybl, J. D., Lithgow, G. A., and Buckley, S. G. (2003). Laser-induced breakdown

spectroscopy detection and classification of biological aerosols. Appl. Spectrosc.

57, 1207–1215. doi: 10.1366/000370203769699054

Hybl, J. D., Tysk, S. M., Berry, S. R., and Jordan, M. P. (2006). Laser-

induced fluorescence-cued, laser-induced breakdown spectroscopy biological-

agent detection. Appl. Opt. 45, 8806–8814. doi: 10.1364/AO.45.008806

Inami, H., Tsuge, K., Matsuzawa, M., Sasaki, Y., Togashi, S., Komano, A., et al.

(2009). Semi-automated bacterial spore detection system with micro-fluidic

chips for aerosol collection, spore treatment and ICAN DNA detection. Biosens.

Bioelectron. 24, 3299–3305. doi: 10.1016/j.bios.2009.04.025

Irenge, L. M., Durant, J. F., Tomaso, H., Pilo, P., Olsen, J. S., Ramisse, V., et al.

(2010). Development and validation of a real-time quantitative PCR assay

for rapid identification of Bacillus anthracis in environmental samples. Appl.

Microbiol. Biotechnol. 88, 1179–1192. doi: 10.1007/s00253-010-2848-0

Irenge, L. M., and Gala, J. L. (2012). Rapid detection methods for Bacillus anthracis

in environmental samples: a review. Appl. Microbiol. Biotechnol. 93, 1411–1422.

doi: 10.1007/s00253-011-3845-7

Jürgen, B., Pioch, D., Hoi, L. T., Albers, J., Hintsche, R., and Schweder, T. (2005).

At-line monitoring of bioprocess-relevant marker genes using an electric DNA-

chip. J. Biotechnol. 118:S36. doi: 10.1002/bit.20578

Kane, S. R., Létant, S. E., Murphy, G. A., Alfaro, T. M., Krauter, P. W., Mahnke, R.,

et al. (2009). Rapid, high-throughput, culture-based PCR methods to analyze

samples for viable spores of Bacillus anthracis and its surrogates. J. Microbiol.

Methods 76, 278–284. doi: 10.1016/j.mimet.2008.12.005

Keijser, B. J., Ter Beek, A., Rauwerda, H., Schuren, F., Montijn, R., van der

Spek, H., et al. (2007). Analysis of temporal gene expression during Bacillus

subtilis spore germination and outgrowth. J. Bacteriol. 189, 3624–3634. doi:

10.1128/JB.01736-06

Krebs, M. D., Mansfield, B., Yip, P., Cohen, S. J., Sonenshein, A. L., Hitt, B. A., et al.

(2006). Novel technology for rapid species-specific detection of Bacillus spores.

Biomol. Eng. 23, 119–127. doi: 10.1016/j.bioeng.2005.12.003

Lasch, P., Beyer, W., Nattermann, H., Stämmler, M., Siegbrecht, E., Grunow,

R., et al. (2009). Identification of Bacillus anthracis by using matrix-assisted

laser desorption ionization-time of flight mass spectrometry and artificial

neural networks. Appl. Environ. Microbiol. 75, 7229–7242. doi: 10.1128/AEM.

00857-09

Lee, M. A., Brightwell, G., Leslie, D., Bird, H., and Hamilton, A. (1999). Fluorescent

detection techniques for real-time multiplex strand specific detection of Bacillus

anthracis using rapid PCR. J. Appl. Microbiol. 87, 218–223. doi: 10.1046/j.1365-

2672.1999.00908.x

Leskelä, T., Tilsala-Timisjärvi, A., Kusnetsov, J., Neubauer, P., and Breitenstein,

A. (2005). Sensitive genus-specific detection of Legionella by a 16S rRNA

based sandwich hybridization assay. J. Microbiol. Methods 62, 167–179. doi:

10.1016/j.mimet.2005.02.008

www.frontiersin.org March 2014 | Volume 5 | Article 92 |7

Osmekhina et al. RNA-based detection of Bacillus spores

Li, D., Truong, T. V., Bills, T. M., Holt, B. C., VanDerwerken, D. N., Williams, J.

R., et al. (2012). GC/MS method for positive detection of Bacillus anthracis

endospores. Anal. Chem. 84, 1637–1644. doi: 10.1021/ac202606x

Makino, S., and Cheun, H. (2003). Application of the real-time PCR for the

detection of airborne microbial pathogens in reference to the anthrax spores.

J. Microbiol. Methods 53, 141–147. doi: 10.1016/S0167-7012(03)00019-8

Matsuda, M., and Kameyama, T. (1986). Fractionation of ribonucleic-acid tran-

scripts synthesized during spore germination in Bacillus subtilis.J. Basic

Microbiol. 26, 91–99. doi: 10.1002/jobm.3620260209

McBride, M. T., Masquelier, D., Hindson, B. J., Makarewicz, A. J., Brown, S., Burris,

K., et al. (2003). Autonomous detection of aerosolized Bacillus anthracis and

Yersinia pestis.Anal. Chem. 75, 5293–5299. doi: 10.1021/ac034722v

Moeller, R., Horneck, G., Rettberg, P., Mollenkopf, H. J., Stackebrandt, E., and

Nicholson, W. L. (2006). A method for extracting RNA from dormant and ger-

minating Bacillus subtilis strain 168 endospores. Curr. Microbiol. 53, 227–231.

doi: 10.1007/s00284-006-0099-1

Morel, N., Volland, H., Dano, J., Lamourette, P., Sylvestre, P., Mock, M., et al.

(2012). Fast and sensitive detection of Bacillus anthracis spores by immunoassay.

Appl. Environ. Microbiol. 78, 6491–6498. doi: 10.1128/AEM.01282-12

Neubauer, A., Soini, J., Bollok, M., Zenker, M., Sandqvist, J., Myllyharju,

J., et al. (2007). Fermentation process for tetrameric human collagen

prolyl 4-hydroxylase in Escherichia coli: improvement by gene optimi-

sation of the PDI/beta subunit and repeated addition of the inducer

anhydrotetracycline. J. Biotechnol. 128, 308–321. doi: 10.1016/j.jbiotec.2006.

10.017

Nieminen, T., Pakarinen, J., Tsitko, I., Salkinoja-Salonen, M., Breitenstein, A., Ali-

Vehmas, T., et al. (2006). 16S rRNA targeted sandwich hybridization method for

direct quantification of mycobacteria in soils. J. Microbiol. Methods 67, 44–55.

doi: 10.1016/j.mimet.2006.02.015

Pioch, D., Jürgen, B., Evers, S., Maurer, K. H., Hecker, M., and Schweder, T. (2008a).

Improved sandwich-hybridization assay for an electrical DNA-chip-based mon-

itoring of bioprocess-relevant marker genes. Appl. Microbiol. Biotechnol. 78,

719–728. doi: 10.1007/s00253-008-1347-z

Pioch, D., Schweder, T., and Jürgen, B. (2008b). Novel developments for improved

detection of specific mRNAs by DNA chips. Appl. Microbiol. Biotechnol. 80,

953–963. doi: 10.1007/s00253-008-1680-2

Pizarro, S. A., Lane, P., Lane, T. W., Cruz, E., Haroldsen, B., and VanderNoot,

V. A. (2007). Bacterial characterization using protein profiling in a microchip

separations platform. Electrophoresis 28, 4697–4704. doi: 10.1002/elps.

200700005

Rautio, J., Barken, K. B., Lahdenperä, J., Breitenstein, A., Molin, S., and Neubauer,

P. (2003). Sandwich hybridisation assay for quantitative detection of yeast RNAs

in crude cell lysates. Microb. Cell Fact. 2, 4. doi: 10.1186/1475-2859-2-4

Rautio, J. J. (2010). Multiplex gene expression analysis by TRAC in fungal cultures.

Methods Mol. Biol. 638, 165–173. doi: 10.1007/978-1-60761-611-5_12

Rautio, J. J., Kataja, K., Satokani, R., Penttilä, M., Söderlund, H., and Saloheimo, M.

(2006). Rapid and multiplexed transcript analysis of microbial cultures using

capillary electophoresis-detectable oligonucleotide probe pools. J. Microbiol.

Methods 65, 404–416. doi: 10.1016/j.mimet.2005.08.010

Rautio, J. J., Satokari, R., Vehmaan-Kreula, P., Serkkola, E., and Söderlund, H.

(2008). TRAC in high-content gene expression analysis: applications in micro-

bial population studies, process biotechnology and biomedical research. Expert

Rev. Mol. Diagn. 8, 379–385. doi: 10.1586/14737159.8.4.379

Regan, J. F., Makarewicz, A. J., Hindson, B. J., Metz, T. R., Gutierrez, D. M., Corzett,

T. H., et al. (2008). Environmental monitoring for biological threat agents using

the autonomous pathogen detection system with multiplexed polymerase chain

reaction. Anal. Chem. 80, 7422–7429. doi: 10.1021/ac801125x

Sloma, A., and Smith, I. (1979). RNA synthesis during spore germination in Bacillus

subtilis.Mol. Gen. Genet. 175, 113–120. doi: 10.1007/BF00425526

Soini J., Falschlehner C., Liedert C., Bernhard J., Vuoristo J., and Neubauer, P.

(2008). Norvaline is accumulated after a down-shift of oxygen in Escherichia

coli W3110. Microb.CellFact.7:30. doi: 10.1186/1475-2859-7-30

Spaulding, U. K., Christensen, C. J., Crisp, R. J., Vaughn, M. B., Trauscht, R. C.,

Gardner, J. R., et al. (2012). RAZOR EX anthrax air detection system. J. AOAC

Int. 95, 860–891. doi: 10.5740/jaoacint.11-521

Stachowiak, J. C., Shugard, E. E., Mosier, B. P., Renzi, R. F., Caton, P. F., Ferko, S. M.,

et al. (2007). Autonomous microfluidic sample preparation system for protein

profile-based detection of aerosolized bacterial cells and spores. Anal. Chem. 79,

5763–5770. doi: 10.1021/ac070567z

Stratis-Cullum, D. N., Griffin, G. D., Mobley, J., Vass, A. A., and Vo-Dinh, T. (2003).

A miniature biochip system for detection of aerosolized Bacillus globigii spores.

Anal. Chem. 75, 275–280. doi: 10.1021/ac026068+

Tamborrini, M., Holzer, M., Seeberger, P. H., Schürch, N., and Pluschke, G. (2010).

Anthrax spore detection by a luminex assay based on monoclonal antibodies

that recognize anthrose-containing oligosaccharides. Clin. Vaccine Immunol. 17,

1446–1451. doi: 10.1128/CVI.00205-10

Taskila, S., Osmekhina, E., Tuomola, M., Ruuska, J., and Neubauer, P. (2011).

Modification of buffered peptone water for improved recovery of heat-injured

Salmonella Typhimurium. J. Food Sci. 76, M157–M162. doi: 10.1111/j.1750-

3841.2010.02050.x

Thieme, D., Neubauer, P., Nies, D. H., and Grass, G. (2008). Sandwich hybridization

assay for sensitive detection of dynamic changes in mRNA transcript levels in

crude Escherichia coli cell extracts in response to copper ions. Appl. Environ.

Microbiol. 74, 7463–7470. doi: 10.1128/AEM.01370-08

Walsh, M. K., Wang, X., and Weimer, B. C. (2001). Optimizing the immobiliza-

tion of single-stranded DNA onto glass beads. J. Biochem. Biophys. Methods 47,

221–231. doi: 10.1016/S0165-022X(00)00146-9

Wang, Z., Fan, Y., Chen, J., Guo, Y., Wu, W., He, Y., et al. (2013). A micro-fluidic

chip-based fluorescent biosensor for the sensitive and specific detection of label-

free single-base mismatch via magnetic beads-based “sandwich” hybridization

strategy. Electrophoresis 34, 2177–2184. doi: 10.1002/elps.201300131

Weerasekara, M. L., Ryuda, N., Miyamoto, H., Okumura, T., Ueno, D., Inoue,

K., et al. (2013). Double-color fluorescence in situ hybridization (FISH) for

the detection of Bacillus anthracis spores in environmental samples with

a novel permeabilization protocol. J. Microbiol. Methods 93, 177–184. doi:

10.1016/j.mimet.2013.03.007

Weisburg, W. G., Barns, S. M., Pelletier, D. A., and Lane, D. J. (1991). 16S Ribosomal

DNA amplification for phylogenetic study. J. Bacteriol. 173, 697–703.

Wielinga, P. R., Hamidjaja, R. A., Agren, J., Knutsson, R., Segerman, B., Fricker, M.,

et al. (2011). A multiplex real-time PCR for identifying and differentiating B.

anthracis virulent types. Int. J. Food Microbiol. 145 (Suppl. 1), S137–S144. doi:

10.1016/j.ijfoodmicro.2010.07.039

Zhou, B., Wirsching, P., and Janda, K. D. (2002). Human antibodies against spores

of the genus Bacillus: a model study for detection of and protection against

anthrax and the bioterrorist threat. Proc. Natl. Acad. Sci. U.S.A. 99, 5241–5246.

doi: 10.1073/pnas.082121599

Conflict of Interest Statement: The authors declare that the research was con-

ducted in the absence of any commercial or financial relationships that could be

construed as a potential conflict of interest.

Received: 21 January 2014; accepted: 19 February 2014; published online: 11 March

2014.

Citation: Osmekhina E, Shvetsova A, Ruottinen M and Neubauer P (2014)

Quantitative and sensitive RNA based detection of Bacillus spores. Front. Microbiol.

5:92. doi: 10.3389/fmicb.2014.00092

This article was submitted to Microbiotechnology, Ecotoxicology and Bioremediation,

a section of the journal Frontiers in Microbiology.

access article distributed under the terms of the Creative Commons Attribution License

(CC BY). The use, distribution or reproduction in other forums is permitted, provided

the original author(s) or licensor are credited and that the original publication in this

journal is cited, in accordance with accepted academic practice. No use, distribution or

reproduction is permitted which does not comply with these terms.

Frontiers in Microbiology | Microbiotechnology, Ecotoxicology and Bioremediation March2014|Volume5|Article92|8