Investigation of experimental cell
lines and non-invasive online sensor
technologies in a 3D bioreactor
system for extracorporeal liver
support therapy
vorgelegt von
Diplom-Ingenieur
Marco Richter
geb. in Leipzig
Von der Fakultät III – Prozesswissenschaften
der Technischen Universität Berlin
zur Erlangung des akademischen Grades
Doktor der Ingenieurwissenschaften
-Dr.-Ing-
genehmigte Dissertation
Promotionsausschuss:
Vorsitzender: Prof. Dr. Peter Neubauer
Berichter: Prof. Dr. rer. nat. Roland Lauster
Berichter: Dr. vet. med. Katrin Zeilinger
Berichter: Prof. Dr. Jens Kurreck
Tag der wissenschaftlichen Aussprache: 11.07.2016
Berlin 2016
Acknowledgments I
I
Acknowledgments
The work presented was accomplished during the period of September 2011 till April
2016 at the Bioreactor Group (BCRT, Charité). The studies were performed within the
EU project d-Liver, which was funded by the European Community’s FP7 Research
Framework Programme under the grant agreement number 287596.
I am very grateful to have joined the research group of Dr. Katrin Zeilinger and want to
say: “Thank you” that I had the opportunity to contribute to the interesting research of
3D bioreactor technology with the focus on the liver. It made my time in your group
very exciting, working in such a field close to the clinical application. I thank you for
your guidance, your knowledge and motivation during my work, be it in laboratory
issues, writing this thesis or personal matters. The trust and the freedom as well as the
encouragement to make own decisions you have given, was what I cherish the most
since I believe this formed me to a responsible researcher and will strengthen my further
career.
I am very grateful to my colleagues in the group providing a cosy atmosphere in the lab.
I admire your motivation, be it your own work involved or the work of somebody else,
your cooperativeness and scientific input was outstanding. Additionally the friendly
talks during lunch and the fun we had beside work, made going to work an enjoyable
part and I miss it already. For the time invested in proof reading I would like to say
“Thank you” to Dr. Fanny Knöspel and Nora Freyer. You are the best!
Special thanks I want to say to Dr. Emma Fairhall of Professor Matthew Wright´s group
at University Newcastle with whom I performed my first B-13 bioreactor experiments
and with her expertise in pancreatic progenitor cells this project mainly resulted in
success. She also provided this study with the experimental human B-13 equivalent cell
line (H-14), which was investigated during the pilot study using up-scaled clinical
bioreactor. Furthermore, I would like to thank Professor Matthew Wright for his
scientific advice, his English proofreading and his friendly discussions during project
meetings.
I also thank Susanne Tröbs, who performed her Bachelor thesis and her Project work for
the Master degree under my supervision. Susanne Tröbs helped to establish multi-
parametric sensor monitoring in the analytical-scale bioreactor. She also participated in
the upscaling process for the pilot study using HPAC-derived H-14 (genetic modified)
cells.
Acknowledgments I
II
Acknowledgments go to the d-Liver consortium, especially to Herbert Schuck of
Fraunhofer IBMT for his expertise in impedance measurement and support during
impedance signal analysis during experiments. Likewise, I would like to thank Marie-
Line Cosnier and Cédric Goyer of CEA-Leti-France for their support regarding
ammonia sensor integration and signal analysis. I would like to thank Stem Cell
Systems, especially Frank Schubert for their technical support and scientific input
during the project time.
For the kind provision of rat tissue (liver and pancreas) received from Dr. Julia
Frühwald of Pharmacelsus I am very grateful.
I would like to thank Professor Roland Lauster for being my doctoral supervisor and for
the assessment of this work.
Finally I would like to thank my family for their constant support and motivation
fulfilling this task. I would like to dedicate this thesis to my fiancée who has always
been at my side at good and bad days during this period. Your encouragement, guidance
and also preventing me from getting lost in unnecessary details helped me to bring this
work to a success. Thank you so much! You are my role model and I never want to be
without you anymore.
Declaration of Authorship II
Declaration of Authorship
I certify that the work presented here is, to the best of my knowledge and belief, original
and the result of my own investigations, except as acknowledged. The present work has
not been submitted, either in part or whole, for a degree at this or any other University.
Parts of this work have been published under the following titles:
Richter, M., Fairhall, E.A., Hoffmann, S.A., Tröbs, S., Knöspel, F., Probert, P.M.E.,
Oakley, F., Stroux, A., Wright, M.C., Zeilinger, K. Pancreatic progenitor-derived
hepatocytes are viable and functional in a 3D high density bioreactor culture system.
Toxicology Research 2016, 5 (1), 278-290, DOI: 10.1039/C5TX00187K;
http://pubs.rsc.org/en/Content/ArticleLanding/2016/TX/C5TX00187K#!divAbstract.
Richter, M., Tröbs, S., Cosnier, M-L., Schuck, H., Freyer, N., Schubert, F., Wright,
M.C., Zeilinger, K. Integration of multi-parametric sensor systems in bioartificial liver
support system. 41st Annual Congress of the European Society for Artificial Organs
(ESAO), September 17-20 2014, Rom, Italy (Oral presentation).
Richter, M., Fairhall E.A., Hoffmann, S.A., Schubert, F., Wright, M.C., Zeilinger, K.
Hepatic trans-differentiation of pancreatic hepatocyte-progenitor cells (B-13) in a 3D
high-density culture system. German Association for the study of the Liver (GASL),
January 24-25 2014, Tübingen, Germany (Oral presentation).
Richter, M., Fairhall, E.A., Hoffmann, S.A., Frühwald, J., Wright, M.C., Zeilinger, K.
Dexamethasone induced hepatic differentiation of rat pancreatic progenitor cells (B-13)
in a 3D multi-compartment bioreactor system. European Association for the study of the
liver (EASL), April 24-28 2013, Amsterdam, Netherland (Poster).
Berlin, 28. April 2016
Marco Richter
Abstract
IV
Abstract
Liver transplantation is currently the only successful treatment to cure acute or acute-
on-chronic liver failure. However, the number of patients waiting for a donor organ is
constantly rising due to scarcity of organ donations. To overcome this bottleneck
different bio-artificial liver technologies are under investigation, which may take over
functions of the diseased liver until a suitable donor organ can be transplanted or the
diseased liver has recovered and regained its functions. A drawback so far is the lack of
an effective cell source compensating human liver functions in vivo during
extracorporeal liver support therapy. To be used in extracorporeal liver support therapy,
cells need to be available in sufficient numbers, and they should be of human origin to
minimize immunologic complications and safety risks for the patient.
In this study, a novel cell source and sensor-based online monitoring methods were
investigated using a multi-compartment hollow-fibre bioreactor technology developed
at the Charité in Berlin for application in clinical extracorporeal liver support therapy.
In the first part of the study, the rat pancreatic progenitor cell line (AR42J-B-13) was
investigated as a model cell source for use in the bioreactor system. The ability of B-13
cells to trans-differentiate to liver-like cells (B-13/H cells) and the maintenance of
hepatic functions were determined by means of metabolic parameters in addition to
gene expression and histological analyses. Experiments revealed successful trans-
differentiation in the bioreactor system. Bioreactor cultures showed increasing liver-
specific functions, namely production of albumin and urea as well as cytochrome P450
activity. In contrast, secretion of amylase, typical for undifferentiated B-13 cells,
declined over the culture period. Metabolic observations were confirmed by data from
gene expression and protein analysis. Immune histochemical staining showed the
expression of hepatic markers (CYP2E1, albumin, CK18, CEBP-β and MRP2) in B-
13/H cells after hepatic trans-differentiation in the bioreactor system.
In the second part of the study, the integration of multi-parametric sensors into the
bioreactor system was investigated to allow for cell culture surveillance in real-time.
For this purpose oxygen and pH sensors (PreSens-Precision Sensing GmbH), as well as
ammonia sensors and impedance sensors developed by the cooperation partners CEA-
Leti-France and Fraunhofer IBMT, respectively, were integrated in an analytical-scale
bioreactor for evaluation. In order to evaluate the ability of sensor-based methods to
detect cell injury, the toxic drug methapyrilene was applied to B-13/H cells trans-
differentiated in the bioreactor system. Online measurement of ammonia concentrations
Abstract
V
showed results comparable to offline values measured in samples from the culture
medium. However, further optimisation concerning sterilisation, sensitivity,
minimization of noise detection and sensor leakage is needed before using the
technology in clinical applications. Impedance measurement enabled safe, sensitive and
non-invasive detection of changes in the culture condition with a distinct response to
toxic stress. To evaluate the bio-artificial liver system in a clinical setting, primary
porcine liver cells (ppL) were investigated in the bioreactor system. As a model for
toxic plasma exposure during clinical liver support sessions, the effect of the
hepatotoxic drug acetaminophen (APAP) was evaluated. The response of the cells to
toxic drug exposure was successfully monitored by sensor-based measurements,
confirming the results from B-13/H cultures. Based on the results a procedure for
culture prediction and decision-making conceived for extracorporeal liver support in a
clinical setting was established.
In the third part of the work, an up-scaled version of the bioreactor system was used in a
pilot study to investigate the efficiency of cell culture and sensor-based monitoring in a
clinical setting. As a cell source the H-14 cells developed by the cooperation partner
Newcastle University were used as an experimental human equivalent of the B-13 cell
line. The results of the pilot study indicate the feasibility of sensor-based monitoring
during cell culture in the large-scale bioreactor. However, additional work has to be
conducted to ensure sufficient cell numbers and to optimize sensor techniques for
extracorporeal liver support in clinical application.
In conclusion, the B-13 cell line represents a suitable model cell source in combination
with the four-compartment bioreactor system for in vitro and clinical research. The
integration of non-invasive online sensors enables sensitive culture surveillance and
culture prediction. Finally, the genetically modified HPAC cell line H-14 might be a
vital step towards the establishment of a human cell source in sufficient quality and
quantity for extracorporeal liver support.
Zusammenfassung
VI
Zusammenfassung
Die Lebertransplantation stellt derzeit die einzige kurative Behandlungsmethode bei
chronischen und akuten Leberversagen dar. Aufgrund des ständig steigenden Bedarfs
bei gleichzeitigem Mangel an Spenderorganen versterben viele Patienten auf der
Warteliste für die Transplantation. Dieser Engpass hat dazu geführt, dass verschiedene
bioartifizielle Technologien entwickelt wurden, welche die Leberfunktionen temporär
übernehmen können, um die Wartezeit bis zur Transplantation zu überbrücken bzw. die
regenerative Fähigkeit der Leber bis zu ihrer Genesung zu unterstützen. Eine derzeitige
Hürde ist in der Erschließung einer effektiven Zellquelle für die extrakorporale
Leberunterstützungstherapie zu sehen. Diese sollte leberspezifische Funktionen
ausüben, in ausreichend großen Mengen zur Verfügung stehen und von humanem
Ursprung sein, um immunologische Komplikationen in der Klinik zu vermeiden.
In dieser Studie wurden eine neuartige Zellquelle, sowie sensorbasierte Methoden zur
Echtzeitüberwachung von Funktionsparametern für die extrakorporale
Leberunterstützung in einer an der Charité entwickelten 3D-Hohlfaser-
Bioreaktortechnologie untersucht.
Im ersten Teil dieser Arbeit wurde als Modellzellquelle die aus Rattenpankreas
stammende Vorläuferzellline AR42J-B-13 hinsichtlich ihrer Transdifferenzierung zu
leberähnlichen Zellen (B-13/H Zellen) in dem 3D-Bioreaktorsystem untersucht. Der
Differenzierungserfolg und der Erhalt leberspezifischer Funktionen wurden anhand des
Metabolismus, der Genexpression und histologischen Analysen bestimmt. Die
durchgeführten Experimente zeigten eine erfolgreiche Transdifferenzierung der B-13
Zellen mit einem Anstieg leberähnlicher Funktionen wie Albumin- und
Harnstoffproduktion sowie Cytochrom P450-Enzymaktivitäten. Gleichzeitig konnte
eine Abnahme der Amylasesekretion, charakteristisch für undifferenzierte B-13 Zellen,
nachgewiesen werden. Dies konnte ebenfalls mittels Genexpression und Proteinanalyse
bestätigt werden. Immunhistologische Färbungen zeigten eine Expression
leberspezifischer Proteine (CYP2E1, Albumin, CK18, CEBP-β und MRP2) in dem
Bioreaktorsystem nach erfolgter hepatischer Transdifferenzierung.
Ein weiteres Ziel dieser Studie war die Integrierung eines sensorbasierten Online-
Detektionssystems zur Überwachung des Zellverhaltens, sowie deren Funktionalität und
Vitalität in der 3D-Bioreaktorkultur. Zu diesem Zweck wurden Sauerstoff- und pH-
Sensoren (PreSens-Precision Sensing GmbH) sowie von den Kooperationspartnern
CEA-Leti-France und Fraunhofer IBMT entwickelte online Sensoren für Ammoniak-
Zusammenfassung
VII
und Impedanzmessungen in einer Laborvariante des Bioreaktorkultursystems
untersucht. Zur Analyse der Effektivität und Sensitivität der Sensoren wurde durch
Zugabe der toxischen Substanz Methapyrilen ein Zellstress induziert. Der integrierte
Ammoniaksensor zeigte gute Übereinstimmungen mit Werten aus offline gemessenen
Proben. Jedoch zeigte sich ein Verbesserungsbedarf für die klinische Anwendung
hinsichtlich des Sterilisationsverfahrens, der Sensitivität und der Sensordichtigkeit. Der
Impedanzsensor ermöglichte eine sichere, sensitive und nicht-invasive Detektion und
konnte die aktuellen Zellkonditionen aufzeigen. Für die Evaluierung des bioartifiziellen
Lebersystems unter kliniknahen Bedingungen wurden primäre porzine Leberzellen
verwendet. Als Modell für die Perfusion mit toxischem Plasma wurde der Effekt des
hepatotoxischen Medikamentes Acetaminophen untersucht. Die induzierte Toxizität
konnte erfolgreich mittels integrierter Sensoren identifiziert werden und bestätigte die
Ergebnisse der zuvor untersuchten B-13/H Zellkulturen. Auf der Basis der Ergebnisse
konnte ein Schema erarbeitet werden, welches eine Prognose über die Kulturqualität im
Bioreaktor ermöglicht und im Hinblick auf die klinische Anwendung eine zeitnahe
Entscheidung über die klinische Anwendung des Systems ermöglicht.
Im dritten Teil dieser Arbeit wurde eine Pilotstudie zur Evaluierung der Zellkultivierung
und der Online-Sensorsysteme in einer Bioreaktorvariante im Klinikmaßstab
durchgeführt. Hierfür wurde die experimentelle H-14 Zelllinie verwendet, welche von
der Universität Newcastle als humanes Äquivalent für die B-13 Zelllinie generiert
wurde. Die Ergebnisse der Pilotstudie zeigten die Machbarkeit einer sensorbasierten
Überwachung des Zellverhaltens. Jedoch sind noch weitere Experimente erforderlich,
um eine ausreichende Zellmenge für die extrakorporale Anwendung sicherzustellen,
sowie die Sensortechnologie zu optimieren.
Die Ergebnisse lassen den Schluss zu, dass B-13 Zellen in Kombination mit dem Vier-
Kompartiment Bioreaktorsystem eine geeignete Modellzelllinie für die in vitro oder
klinische Forschung darstellen. Die Integration nicht-invasiver Online-Sensoren
ermöglicht eine sensitive Überwachung der Zellkultur. Die genetisch modifizierte
HPAC-Zelllinie H-14 könnte einen wichtigen Schritt zur Generierung einer humanen
funktionellen Zellquelle in ausreichender Qualität und Quantität für die Anwendung zur
extrakorporalen Leberunterstützung darstellen.
Table of contents
VIII
Table of contents
Acknowledgments ................................................................................................. I
Declaration of Authorship ................................................................................. III
Abstract ............................................................................................................... IV
Zusammenfassung .............................................................................................. VI
Abbreviations ...................................................................................................... XI
1 Introduction ................................................................................................... 1
1.1 Liver injury .............................................................................................. 1
1.2 Artificial liver support ............................................................................. 3
1.2.1 MARS® ........................................................................................................ 4
1.2.2 Prometheus®................................................................................................. 4
1.3 Bio-artificial liver support ....................................................................... 5
1.3.1 Cell sources ................................................................................................... 5
1.3.2 AR42J-B-13 cell line as an alternative ......................................................... 7
1.3.3 Hollow fibre bioreactor systems and their clinical evaluation ..................... 8
1.4 Culture surveillance/monitoring of BAL devices ................................. 11
2 Aims of study ............................................................................................... 13
3 Material and Methods ................................................................................ 16
3.1 Materials ................................................................................................ 16
3.1.1 Chemicals and solutions ............................................................................. 16
3.1.2 Material for kits and assays ........................................................................ 16
3.1.3 Primary liver cell isolation .......................................................................... 18
3.1.4 Culture media, additives and solutions for cell culture .............................. 19
3.1.5 Cells ............................................................................................................ 21
3.1.6 Cell culture disposables .............................................................................. 21
3.1.7 Bioreactors and supplies ............................................................................. 22
3.1.8 External sensors .......................................................................................... 22
3.1.9 Gene expression and Western blotting ....................................................... 23
3.1.10 Immunohistochemistry ........................................................................... 24
3.1.11 Equipment ............................................................................................... 26
3.1.12 Software .................................................................................................. 27
3.2 Methods ................................................................................................. 28
3.2.1 2D culture of liver cell types used in the study ........................................... 28
Table of contents
IX
3.2.1.1 Expansion and trans-differentiation of B-13 cells in 2D culture ........ 28
3.2.1.2 Expansion and trans-differentiation of H-14 cells in 2D culture ........ 28
3.2.1.3 Isolation of primary porcine liver cells via collagenase P perfusion .. 28
3.2.1.4 Primary porcine liver cell 2D culture and toxicity testing .................. 30
3.2.2 3D cell culture model .................................................................................. 31
3.2.2.1 Bioreactor technology and set up ........................................................ 31
3.2.2.2 Bioreactor perfusion circuit ................................................................ 33
3.2.2.3 Sensor integration ............................................................................... 34
3.2.3 3D bioreactor culture of liver cell types used in the study ......................... 38
3.2.3.1 Trans-differentiation of B-13 cells and maintenance of B-13/H cells in
2 ml and 8 ml analytical-scale bioreactors .......................................................... 38
3.2.3.2 Methapyrilene application to trans-differentiated B-13 cells in 8 ml
analytical-scale bioreactors ................................................................................. 39
3.2.3.3 APAP exposure in primary porcine liver cells cultured in 8 ml
analytical-scale bioreactors ................................................................................. 40
3.2.3.4 Culture of H-14 cells in an 800 ml clinical-scale bioreactor .............. 40
3.2.4 Evaluation of cell quantity and quality in 2D- and 3D cultures ................. 41
3.2.4.1 Morphological characterization .......................................................... 41
3.2.4.2 Metabolic offline parameters .............................................................. 41
3.2.4.3 Online parameter monitoring using non-invasive online sensors ....... 42
3.2.4.4 Ethoxyresorufin-O-deethylase (EROD) assay .................................... 42
3.2.4.5 Gene expression and Western blot analysis ........................................ 42
3.2.4.6 Immunohistochemical analysis of tissue from 3D bioreactors ........... 42
3.2.5 Statistical evaluation ................................................................................... 43
4 Results and discussion ................................................................................ 44
4.1 Evaluation of trans-differentiation of B-13 cells and maintenance of B-
13/H cells in 2 ml analytical-scale bioreactors ................................................. 44
4.1.1 Assessment of metabolic activity and liver specific-functions in bioreactor
cultures .................................................................................................................... 44
4.1.2 Ethoxyresorufin-O-deethylase (EROD) activity of trans-differentiated B-13
cells in the bioreactor system .................................................................................. 48
4.1.3 Gene expression and protein analysis of hepatocyte-specific genes in trans-
differentiated B-13 cells .......................................................................................... 49
4.1.4 Immunohistochemical characterization of B-13 cells in the bioreactor ..... 51
4.1.5 Chapter discussion ...................................................................................... 53
4.2 Sensor integration and evaluation for clinical application .................... 57
4.2.1 Investigation of the efficiency of multi-parametric sensors for quality
assessment of bioreactor cultures ........................................................................... 57
4.2.1.1 Comparison of metabolic offline parameters in bioreactor cultures
with or without multi-parametric sensors ........................................................... 58
4.2.1.2 Evaluation of sensor-based oxygen and pH measurement in the
bioreactor system ................................................................................................ 58
4.2.1.3 Evaluation of ammonia sensors in the bioreactor system ................... 59
4.2.1.4 Evaluation of impedance sensors in the bioreactor system ................ 62
4.2.2 Identification of toxic drug induced cell damage in bioreactor cultures .... 63
4.2.3 Evaluation of primary porcine liver cell culture in the bioreactor system
equipped with multi-parametric sensors ................................................................. 70
Table of contents
X
4.2.3.1 Assessment of acetaminophen and diclofenac toxicity in 2D cultures ...
............................................................................................................ 70
4.2.3.2 APAP intoxication in bioreactor cultures with primary porcine liver
cells ............................................................................................................ 72
4.2.4 Chapter discussion ...................................................................................... 76
4.3 Investigation of an up-scaled bioreactor system for potential clinical
application using HPAC-derived H-14 cells .................................................... 85
4.3.1 Pilot study with H-14 cells cultured in an 800 ml clinical-scale bioreactor ...
.................................................................................................................... 85
4.3.2 Chapter discussion ...................................................................................... 86
5 Conclusions and perspectives .................................................................... 89
Figures ................................................................................................................. 90
Tables................................................................................................................... 92
Formulas ............................................................................................................. 92
References ........................................................................................................... 93
List of Publications ........................................................................................... 103
Conference and workshop participation ........................................................ 104
Abbreviations XI
Abbreviations
ACLF acute-on-chronic liver failure
ALF acute liver failure
ALT alanine aminotransferase
AMC-BAL Academic Medical Centre Bio-artificial Liver Device
APAP acetaminophen
AST aspartate aminotransferase
B-13 AR42J-B-13
B-13/H trans-differentiated B-13 cell showing hepatocyte characteristic
BAL bio-artificial liver
BLSS Bio-artificial Liver Support System
BSA bovine serum albumin
C3A subclone of the human hepatoma-derived HepG2 cell line
CEA-Leti Commissariat à l‘énergie atomique et aux énergies alternatives –
Laboratoire d’Electronique et de Technologie de l’Information
CEBP-β CCAAT/enhancer-binding protein
CK cytokeratin
CPS-1 carbamoyl phosphate synthetase
CYP cytochrome P450
Disp-FTC-HP8-S disposable optical-chemical flow-through cell for pH
measurement
Disp-FTC-PSt3 disposable optical-chemical flow-through cell for oxygen
measurement
DMEM Dulbecco’s modified Eagle’s medium
EDTA ethylenediaminetetraacetic acid
EGTA ethyleneglycol-bis(2-amino-ethylether)-N,N,N’,N’-tetraacetic
acid
ELAD extracorporeal liver assist device
Abbreviations XII
ELISA enzyme-linked immunosorbent assay
EROD ethoxyresorufin-O-deethylase
EtOH ethanol
FCS foetal calf serum
FPSA fractionated plasma separation and adsorption
Fraunhofer IBMT Fraunhofer Institut für Biomedizinische Technik
Gal galactosyltransferase
GCP good clinical practices
GLDH glutamate dehydrogenase
GMP good manufacturing practices
H-14 genetic modified HPAC
HBV hepatitis B virus
HCC hepatocellular carcinoma
HCV hepatitis C virus
HepaRG cell line derived from a human hepatocellular carcinoma
HepatAssist 2000 extracorporeal bio-artificial liver device
HNF hepatocyte nuclear factor
HPAC human pancreatic acinar cells
HRP horse-radish peroxidase
LAGESO Landesamt für Gesundheit und Soziales
LDH lactate dehydrogenase
LED light-emitting diode
MANOVA multivariate analysis of variance
MARS® Molecular Adsorbent Recirculating System
MRP2 multidrug resistance-associated protein 2
NAFLD non-alcoholic fatty liver disease
NOD/SCID non-obese diabetic/severe combined immunodeficient
P2HEMA poly-2-hydroxyethylmethacrylate
PBS phosphate buffered saline
PCR polymerase chain reaction
Abbreviations XIII
PERV porcine endogenous retrovirus
ppL primary porcine liver cells
PVC polyvinyl chloride
SEM standard error of the mean
TMB 3,3’,5,5’-tetramethylbenzidine
WNT signalling pathways of a group of signal transduction pathways
1. Introduction
1
1 Introduction
1.1 Liver injury
The liver is a complex and highly specialized organ of the human body. The liver is not
only responsible for the production of proteins, such as albumin, which is a major blood
protein, it also takes part in many other metabolic processes, like regulation of amino
acids, carbohydrates and fatty acids, necessary for the functionality of the body.
Furthermore, the ability to detoxify harmful endogenous substances such as ammonium
and to convert exogenous compounds, e.g. drugs or chemicals, in non-toxic metabolites
makes this organ unique and vital for the organism. For that reason, liver failure is a
life-threatening disease with great impact on mortality. In the United Kingdom, liver
disease is among the five most frequent causes for death. Rates increase even further in
comparison to other major causes of death.1 Primary liver cancer and liver cirrhosis are
characteristic for liver disease and describe the typical liver pathology at end-stage liver
failure.
Primary liver cancer, mainly hepatocellular carcinoma (HCC), is responsible for approx.
47,000 deaths in Europe,2 and there are approx. 550,000 new patients diagnosed with
HCC worldwide every year.3,4 Liver cirrhosis causes approx. 170,000 deaths per year
(1.8% of all deaths) in Europe.5 Excessive alcohol abuse represents a major risk factor
for liver cirrhosis.6–8 In 2010, a number of 500,000 people worldwide died due to
alcoholic cirrhosis, and further 80,000 deaths occurred as a result of alcohol related
hepatocellular cancer.9,10
Another major cause leading to liver cirrhosis or hepatocellular cancer is infection with
hepatitis B virus (HBV) or hepatitis C virus (HCV). Chronic infection with HBV is
associated with a 20-30% risk to develop liver cirrhosis11 and a 10% risk of
hepatocellular carcinoma in Europe/USA.12 Both HBV and HCV remain often
undiagnosed for a long time,13 and HBV was therefore called a “silent killer”.2,12 While
there is to date no causal therapy of HBV infection, an efficient drug therapy for
treatment of HCV was recently shown.14–16 However, despite this breakthrough in HCV
therapy, there are still many patients, who have no access to these drugs, or suffer from
irreversible liver damage. Other hepatitis virus infections, e.g. hepatitis delta virus
coinfection or hepatitis E virus infection cause a more acute form of hepatitis.
Compared to chronic HBV infection, patients show early progression to liver cirrhosis,
a rapid hepatic decompensation and death, and causal therapy is not possible so far.17–19
The enhanced emergence of non-alcoholic fatty liver disease (NAFLD) is mainly
caused by the excessive lifestyle in the industrialized countries. Overweight or obesity
1. Introduction
2
are associated with an increased risk of liver steatosis. NAFLD describes the
accumulation of liver fat in more than 5% of hepatocytes and is among the most
frequent liver diseases in the world.20 Beginning with steatosis of the organ,
steatohepatitis and finally liver cirrhosis may develop in consequence.21,22 People
suffering from diabetes mellitus type 2 are at an increased risk to develop NAFLD, and
the combination of both diseases goes along with a more aggressive disease progression
compared to patients suffering from NAFLD alone.23,24
Less frequent forms of liver diseases include haemochromatosis, autoimmune hepatitis,
primary biliary cirrhosis and primary sclerosing cholangitis. These diseases typically
show characteristics of chronic liver disease. Some of them, e.g. haemochromatosis
show an increasing incidence and the resulting clinical symptoms dramatically reduce
the quality of life.25 Patients suffering from chronic liver disease have a high risk of
liver failure, the so called acute-on-chronic liver failure (ACLF), which goes along with
encephalopathy progressing towards coma and multiple organ failure.26 Similar
symptoms are observed in acute liver failure (ALF), which can be caused either by drug
intoxication, e.g. acetaminophen (Paracetamol) overdosing or by acute viral hepatitis.
Since 1963, when liver transplantation was successfully performed for the first time by
Thomas E. Starzl,27 it became an essential treatment for irreversible ACLF or ALF28
and has become a routine procedure with survival rates between 83% and 90%.2,29 In
Europe approx. 5,500 liver transplantations are performed per year.2 However, due to
the scarcity of donor organs the number of transplantations is limited.30,31 The
introduction of procedures like split-liver transplantation or living related liver
transplantation, accounting for approx. 11% of all procedures today,2,20,21 cannot
overcome organ shortage, which remains the major limitation of liver transplantation. In
2011, a number of 1,199 liver transplantations were performed in Germany, while 1,792
liver disease patients were added to the waiting list,29 emphasizing the discrepancy
between patients in need and available donor organs. Another limitation is the high cost
of liver transplantation. According to Milliman et al. (2008 & 2014) more than 700,000
US dollars are required for liver transplantation and postoperative treatments in one
patient during the first year.32,33 Thus, there is a rising demand to develop new strategies
to overcome these limitations.2,34 Extracorporeal liver support systems for temporary
bridging of the failing liver represent one possible solution to solve these problems.
This approach could be used to support the liver function until liver transplantation or
until the patient´s own organ recovers, making use of the self-regeneration capacity of
the liver. Moreover, complications due to liver failure could be reduced and the quality
of life of liver disease patients could be improved by extracorporeal liver support
therapy.35–38 Two different types of extracorporeal liver support systems are available:
artificial devices based on chemical-mechanical detoxification of the patient´s blood
1. Introduction
3
plasma, and bio-artificial devices based on liver cell culture in an extracorporeal circuit
for plasma detoxification and substitution of metabolic products.
1.2 Artificial liver support
The working principle of artificial liver support systems is the removal of accumulated
toxins in the body, which cannot be achieved by the patient’s liver anymore due to
continuous progression of liver disease or the occurrence of liver failure. The blood
plasma of such patients contains high levels of ammonia, fatty acids, conjugated
bilirubin and other nitrogenous waste compounds, which are thought to be responsible
for the development of life-threatening conditions.39 Intentions to eliminate these
potentially harmful substances resulted in the attempt to filter them out of the system,
simulating the filtration ability of the kidney. In 1956 the group of Kiley et al. could
demonstrate the successful clearance of ammonia in four patients by treating them with
haemodialysis. Their positive results further encouraged other researchers to use this
separation technique to treat patients suffering from liver failure.40 The principle of
haemodialysis is based on a concentration exchange between two flowing solutions
separated by a partially permeable membrane (osmosis). During clinical use, blood of
the patient is pumped through the fibres of a dialyzer, whereas a dialysis solution is
pumped in opposite direction around the fibres, resulting in a high concentration
gradient of the substances contained in blood and dialysis liquid. The walls of the fibres
prevent passage of blood cells and large proteins, while they are permeable for smaller
and water soluble substances (e.g. urea, ammonia and exogenous toxic compounds).
Another possibility to filter toxic substances out of the blood stream is called
hemofiltration. Similar to haemodialysis, blood is separated by a partially permeable
membrane, but no dialysis solution is used. By adjusting a positive hydrostatic pressure,
water including dissolved substances is drained from the blood. Using this procedure,
toxic substances are removed by convection, in contrast to diffusion applied for
haemodialysis. The so called ultrafiltrate is discarded and liquid volume withdrawn is
replaced by a defined substitution solution to ensure a constant blood volume. In
hemofiltration also larger solutes are removed via convection which is in contrast to
haemodialysis where mostly small molecules are removed due to the slow speed of
larger molecules during diffusion. Both principles can be combined to optimise removal
of large and small solutes. Despite some positive effects of these mechanical
techniques, the clearance of blood from toxins in the case of hepatic failure is still
inefficient. The low toxin clearance is owned to the fact that many toxic substances are
bound to proteins and only low concentrations of free toxic substances are present in the
plasma.41 Albumin, which is the main protein of human blood plasma, binds a majority
of endogenous toxins, e.g. bilirubin or bile acids. It is an important transporter for
1. Introduction
4
endogenous and exogenous substances like intermediates and end products of
metabolism and drugs. The accumulation of toxins in the blood leads to organ failure
shown in patients suffering from acute hepatic failure.42,43 Exchanging the toxic plasma
with fresh frozen plasma from blood donors could be an alternative option, but its high
costs due to the large volume of fresh plasma needed and the risk of infection restrict
this method.44,45 Furthermore, the side-effects of coagulation imbalance and citrate load
can be problematic for patients with severe liver failure, if not carefully
implemented.46,47 In order to improve toxin removal from the plasma, albumin dialysis
was introduced as an additional method.48,49 Furthermore, chemical adsorption
techniques, e.g. anion exchange chromatography, charcoal or neutral resin filtration, can
improve clearance of patient blood containing toxic compounds.50
In the following, two artificial liver support systems currently used in clinical
application are described, the Molecular Adsorbent Recirculating System (MARS®)
and the Fractionated Plasma Separation Adsorption and Dialysis system known as
Prometheus®.
1.2.1 MARS®
Since its introduction in 1993 the MARS® device has been used in several clinical
studies to temporarily replace the detoxification function of the organ in patients
suffering from severe liver disease.51,52 The device is based on haemodialysis and uses
albumin as a scavenger molecule to remove lipophilic toxic compounds, which
accumulate in the blood during liver failure.53,54 Albumin is added to the dialysis
solution to compete with toxin-bound albumin in the blood stream.55 The dialysis
solution is regenerated and is used again in a closed loop circle (secondary circuit).
Small water-soluble compounds as well as toxins dissociated from albumin binding at
the blood site are able to pass through the membrane due to concentration gradients. In
the dialysis solution of the secondary circuit toxins are bound due to albumin, while
water soluble substances in the secondary circuit are removed via conventional low-flux
single pass dialysis. Albumin bound to toxins is regenerated by passing through
different adsorbers, e.g. a charcoal and an anion exchange column. Thereafter, albumin
solution is reused in the detoxification process until columns are saturated.49,56–58
Clinical studies investigating the efficiency of MARS® treatment in patients with ALF
or ACLF showed improvement of encephalopathy after removal of albumin-bound
toxins as well as improvement of kidney and liver function.54,59–62 However, a
significant effect on the survival rate was not observed.
1.2.2 Prometheus®
Since only unbound fractions of toxins can pass the membranes in the MARS® device,
which limits the detoxification of albumin-bound compounds,63 the Fractionated Plasma
1. Introduction
5
Separation and Adsorption (FPSA) technique evolved in 1999.63,64 FPSA is combined
with haemodialysis in the Prometheus® system introduced by Fresenius Medical Care
(Bad Homburg, Germany). Similar to the MARS® device, it is based on pumping the
patient´s blood through a dialyser with a partially permeable membrane. The membrane
prevents passage of blood cells and larger proteins, like e.g. fibrinogen, but enables
albumin and other smaller molecules to enter the dialysis circuit.65,66 The resulting
“fractionated” plasma, which is enriched with albumin-bound toxins, is pumped through
a neutral resin filter, followed by an anion exchange chromatography column. Protein-
bound toxins are bound to these adsorbers, whereas albumin is regenerated and can be
reincorporated in the blood flow. In a second step, water-soluble substances are
removed via conventional haemodialysis.
Successful application of the Prometheus® device in patients with acute liver failure in
association with multi-organ failure was described by Kramer et al. after severe
ecstasy/cocaine abuse.67 Improved clearance of ammonia, known to be closely related to
hepatic encephalopathy, and also of bilirubin and bile acids could be demonstrated in
patients treated with the Prometheus® device.68–70 Furthermore a study involving 77
patients suffering from ACLF showed an improvement of serum levels of bilirubin
when treated with the Prometheus® system.71 However, similar to the results from
MARS®, the probability of survival was not increased.52,72
These results implicate that successful detoxification alone is not sufficient to
effectively support liver regeneration. Further liver-specific functions, namely
metabolic regulation and protein synthesis, seem to be of great importance to this
process too.52,73
1.3 Bio-artificial liver support
Cell-based bio-artificial liver support systems offer the option to overcome the
limitations of artificial liver support systems by compensating the synthesis of proteins,
e.g. albumin or coagulation factors, and regulating carbohydrate, fat and amino acid
metabolism, in addition to plasma detoxification.74
1.3.1 Cell sources
A critical issue in bio-artificial liver support systems is the cell source and the
associated high functional requirements to the cells in a clinical setting: Cells need to be
functionally equivalent to human hepatocytes, free of pathogens, non-tumorigenic and
they should not evoke immunological side-effects in the patient. In addition, sufficient
and flexible cell availability and processing according to GMP/GCP conditions are
essential.
1. Introduction
6
Primary human hepatocytes represent the preferred choice of cells for in vitro liver
research as well as for clinical bio-artificial liver support because they provide the
typical functions of the organ. Besides, liver support systems using this cell source
would benefit of the biosafety and provision of homologous biologically active
substances.35,75 However, the lack of suitable donor tissue for cell isolation and the
occurrence of de-differentiation of the cells in vitro, resulting in a loss of hepatic
function,76,77 restrict their use in liver support systems. Hepatocyte proliferation is
observed in vivo during liver regeneration and growth, but has not yet been achieved
under in vitro cell culture conditions because they fail to undergo mitosis.78–81 Primary
porcine hepatocytes have the advantage of abundant availability, low cost and well-
established isolation methods.35 However, the metabolic performance of porcine liver
cells shows some differences to those of human liver cells due to species-dependent
differences in metabolic pathways. In addition, the use of primary porcine liver cells
(ppL) is associated with a risk of hypersensitivity reaction due to xenogeneic antigen
presentation when using these cells in bio-artificial liver support systems.82,83 This risk
can be minimized using filter techniques to prevent direct contact of immunoglobulins
contained in the patient blood with the cells immobilized in the bio-artificial liver
device.84 Use of Gal gene knockout pigs would minimize the probability of xenogenous
immune reactions even further.85 Another risk could be infection with porcine
endogenous retrovirus (PERV), although no infection in patients treated with bio-
artificial liver support therapy has been reported so far.86–89
Established hepatoma cell lines provide an unlimited cell source due to their
proliferative ability, but they exhibit altered hepatocyte-specific metabolic functions due
to transformation.26,90–92 The cell line C3A derived from a clone of the HepG2 cell line
is to date the only cell line used in clinical trials of liver support systems.35,92–94
However, this cell line lacks the ability to metabolise ammonia via the urea cycle and
therefore shows restrictions in nitrogen elimination.94 The HepaRG cell line represents
another promising cell line for bio-artificial liver support due to its ability to
differentiate into hepatocytes and biliary cells when treated with dimethyl-sulfoxide
(DMSO).95 Investigations of this cell line in different bio-artificial bioreactor types
showed a number of liver-specific functions of the cells, including ammonia
elimination, urea production and cytochrome P450 (CYP) dependent metabolism.96–99
Although human cell lines are an attractive cell source in extracorporeal liver support
because of their abundant availability and easy logistics, safety risks due to possible
tumour development by the cells have to be considered, if cells are rinsed into the blood
stream of the patient. This is especially dangerous for patients living under
immunosuppressive conditions.39 A suitable precaution would be the usage of filter
1. Introduction
7
techniques to prevent cell transfer into the patient´s blood, which is generally
accepted.92
Hepatic cells generated from human adult or pluripotent stem cells were proposed to
solve the problem of scarce availability of human liver cells.100,101 In addition, the use of
autologous stem cells would prevent immunological complications.102 However, the
functionality of stem cell-derived hepatocytes obtained with current differentiation
protocols is not equivalent to that of primary hepatocytes and so they are still
insufficient for clinical use in liver support systems.
1.3.2 AR42J-B-13 cell line as an alternative
The liver and the pancreas are closely related in their development, since both tissues
are derived from the embryonic endoderm.103,104 Investigations in rodents revealed that
hepatocytes engraft in the pancreas after induced cell damage, e.g. via copper-deficient
diet, cadmium exposure105,106 or overexpression of growth factors, e.g. keratinocyte
growth factor.107 Furthermore, exposure to elevated glucocorticoid concentrations was
reported to induce the trans-differentiation of acinar cells into hepatocytes in vitro.108
Glucocorticoids are steroid hormones primarily secreted from the adrenal gland. They
are involved in the regulation of multiple metabolic processes, e.g. hepatic
gluconeogenesis.109,110 Short-term administration of glucocorticoids (dexamethasone-
21-phosphate) to rats resulted in hepatic marker expression in acinar cells in vivo
without any damage to the tissue.111 Furthermore, in a transgenic mouse model trans-
differentiation of exocrine pancreas into liver-like tissue by elevated levels of
endogenous glucocorticoids was observed describing a pathophysiological
process.112,113 These observations were encouraged by the finding that elevation of
glucocorticoids resulted in a transient suppression of WNT3a expression during trans-
differentiation of acinar cells into hepatocytes.114 WNT signalling is known to be
involved in liver development and regulation of zonal hepatocyte gene expression in
adult liver cells.115,116
A similar pathophysiological process can be observed during trans-differentiation of the
AR42J-B13 (B-13) cell line to hepatocyte-like cells (B-13/H).117,118 The B-13 cell line,
a subclone isolated from the rat AR42J pancreatic cell line, is related to pancreatic
ductal progenitor cells.76,113,119,120 Upon glucocorticoid treatment, a majority (85 – 95%)
of treated B-13 cells exhibited immunoreactivity for hepatocyte markers such as
albumin, cytokeratin (CK) 8 and transferrin.119 Furthermore, expression of hepatic CYP
enzymes and oxidative metabolism of testosterone were demonstrated in B-13/H
cells.118,120,121 B-13/H cells remain differentiated for several weeks on plastic substrates
in contrast to primary hepatocytes, which rapidly de-differentiate in conventional two-
dimensional (2D) culture systems resulting in a loss of liver-specific functions.76 In
1. Introduction
8
addition, B-13 cells show no growth in soft agar, maintaining anchorage-dependent
growth and they respond to factors which prevent uncontrolled cell growth in contrast to
other hepatic cell lines (e.g. HepG2). Fairhall et al. showed that injection of B-13 cells
into NOD/SCID mice did not result in tumour formation, which is an important
advantage in potential clinical settings. Cells only engrafted in the pancreas and in the
liver of mice, and they trans-differentiated to B-13/H cells in the liver expressing
hepatic-specific markers, e.g. CYP2E1.118 Since B-13 cells rapidly proliferate under
standard cell culture conditions and can easily be trans-differentiated by glucocorticoid
addition, they provide a renewable, cost-effective source of functional hepatocyte-like
cells and could be used in in vitro studies such as preclinical drug testing or liver
disease research.
The engineering of a human cell line with equivalent characteristics to the B-13 cell line
would solve the problem of scarce availability and dysfunction of current cell sources in
clinical liver support strategies. In case of successful demonstration of the liver-specific
functionality of such a cell line, sufficient functional hepatocytes at low production
costs could be generated for bio-artificial liver devices. In addition, results from in vitro
research could be used to develop new clinical cell transplantation approaches, if the
clinical safety of the cells can be shown.
1.3.3 Hollow fibre bioreactor systems and their clinical evaluation
Studies on primary hepatocytes have shown an improved maintenance of cell viability
and liver-specific functions like drug metabolism, disposition and toxicity when using
models simulating a 3D environment, like e.g. sandwich cultures (reviewed by Swift et
al. 2010).122 Especially polarisation of hepatocytes, known to form distinct apical and
basolateral domains in native tissue, seems to have a crucial impact on cell viability and
function.123 For that reason models are of interest, which support cell adhesion, cell
communication and cell-matrix interaction by simulating the in vivo tissue
architecture.92,124–127 Furthermore, nutrient supply, metabolite removal and oxygenation
are of major importance to enable long-term maintenance of cell functionality and
prevent de-differentiation of the cultured cells. With regard to efficient extracorporeal
liver support these systems have to be suitable for hosting and sustaining high cell
numbers to ensure sufficient substitution of the failing liver. It is suggested that 150-
300 g liver cells are needed to compensate the impaired liver function in patients with
ALF.128,129 This would represent 10-20% of an adult human liver, which contains
approx. 1.5x1011 hepatocytes.130 It has to be considered that the cell function in
extracorporeal liver devices is not completely the same as that of native liver in vivo,
due to in vitro cell culture conditions and/or use of xenobiotic cells or cell lines. Thus,
higher cell numbers would be likely advisable.
1. Introduction
9
A number of different bioreactor configurations were conceived to provide suitable
culture conditions and enable a scale-up in a three-dimensional (3D) architecture. The
most common bioreactor configurations used for extracorporeal liver support in clinical
application are hollow fibre systems.26,35,37,90,91,131 In most systems, hollow fibres made
out of partially permeable membranes are packed in cylindrical columns providing a
scaffold as an anchorage for the liver cells.35,132 The cells are usually seeded outside the
fibres in the extra-capillary space and the perfusate (e.g. plasma or blood) is pumped
through the capillaries providing nutrient supply and substance mass transfer across the
membrane. However, many individual modifications were made to improve bio-
artificial performance.35
Extracorporeal liver devices used in clinical trials:
The extracorporeal liver assist device (ELAD) developed by Sussman et al. (1992)133 is
based on a modified dialysis cartridge. The ELAD uses the human hepatoblastoma cell
line C3A, which is grown to confluence in the extra-capillary space of the dialysis
cartridge. One cartridge houses approx. 100 g of C3A cells.93 Up to four cartridges are
combined in a single device for extracorporeal liver support treatment. The ultrafiltrate
is generated from the blood drawn from the patient and pumped through the lumen of
the hollow fibres. Heparin is used to prevent blood coagulation in the system. Glucose
and oxygen are added to the recirculation circuit of the ELAD cartridges to provide
adequate nutrient and oxygen supply to the immobilized cells. The risk of escaping cells
from the ELAD circuit entering the patient blood circuit is prevented using filters prior
to the ultrafiltrate entry in patient blood circuit. In clinical applications of ELAD, no
acute complications of the liver support therapy such as hemodynamic instability or
complement activation were observed.134 Furthermore, the patient status improved with
respect to encephalopathy and patients could be successfully bridged until liver
transplantation.90,93
Another similar system represents the Bioartificial Liver Support System (BLSS) by
Excorp Medical, Inc..135 In the BLSS primary porcine hepatocytes are mixed with 20%
collagen and seeded into the extra-capillary space of the device. Blood of the patient is
oxygenized in an oxygenator and pumped through the capillary lumen allowing plasma
compounds to diffuse between the blood and the cell compartment. First clinical use of
the BLSS showed successful treatment of patients with ALF and demonstrated clinical
safety.88,136 Clinically a reduction in ammonia, lactate and total bilirubin could be
achieved.35,88,137
Further extracorporeal liver support systems using primary porcine cells are the
HepatAssist 2000 and the Academic Medical Centre Bioartificial Liver Device (AMC-
BAL). The HepatAssisst 2000 device uses cryopreserved cells, which are seeded in the
extra-capillary space of the cartridge and hollow fibres are perfused with patient plasma
1. Introduction
10
following plasma detoxification by a charcoal column.138 The HepatAssist 2000 device
participated in several Phase I clinical trials and was successfully used as bridging
device in patients waiting for liver transplantation.35,139 The neurological status of
patients improved140 and a reduction in ammonia, bilirubin and transaminase levels was
achieved during treatment. In a study with 39 patients six patients suffering from ALF,
mostly due to acetaminophen (APAP) overdosing, recovered spontaneously after
HepatAssist 2000 treatment.141 Although the survival rate, with regard to entire patient
population, was not increased in a randomized trial involving a total of 171 patients, a
significant increase in survival was observed in HepatAssist 2000 treated patients
suffering from fulminant/sub-fulminant hepatic failure as compared to the control group
receiving standard medical treatment.139
In the AMC-BAL a nonwoven hydrophilic polyester matrix is spirally wound around a
massive core. Primary porcine hepatocytes attach to this matrix in a 3D configuration.
Hollow fibres responsible for on-site gas exchange are placed between accrued layers in
a longitudinal direction.142 Plasma pumped through the device has direct contact with
the cultured cells providing optimal mass transfer and oxygenation.35,88 Six patients
suffering from ALF were successfully treated with the AMC-BAL device and were
transplanted afterwards. Similar to previously described systems the encephalopathy
status was improved, and plasma levels of ammonia and bilirubin decreased. Patients
included in this study were not detected positive for PERV after extracorporeal liver
support treatment.87,143
The system developed at the Charité in Berlin is based on a multi-compartment hollow-
fibre structure.144 It consists of three independent capillary systems, which form an
interwoven capillary network for counter-current medium perfusion (via two bundles of
the capillary systems), and direct oxygenation (via the third bundle). Thus, efficient
mass transfer to the cells immobilized in the extra-capillary space (cell compartment) is
provided. Thus, a micro-environment is created, which allows for 3D high-density
culture of liver cells, mimicking the native environment of the liver with physiological
cell-cell contacts and cell communication. The system can be combined with albumin
dialysis to reduce the toxin load on cultured cells during extracorporeal liver support
application.35,88,89 The bioreactor system has been successfully tested in clinical
extracorporeal liver support settings with primary porcine145 or human hepatocytes.26,146
Zeilinger et al. (2004) could show that primary liver cells re-organized to neo-tissue
with formation of connective tissue by the cells in the bioreactor. Immunohistochemical
staining revealed neo-biliary channels and neo-sinusoidal endothelial structures.147,148
Improved cell regeneration and elevated growth factor expression was observed after
perfusing the bioreactor system with acute liver failure plasma during extracorporeal
liver support therapy,148 suggesting that cells cultured in such a device respond to
1. Introduction
11
alterations of the environment. Down-scaled variants of the technology developed for in
vitro research showed stable maintenance of hepatocyte performances indicating that
the technology can be scaled according to individual study designs and requirements.149
In addition, their suitability for drug metabolism studies was shown.77,150 In vivo like
patterns of liver-specific transporter proteins involved in biliary excretion were
demonstrated.77,149,150 Furthermore, previous studies showed stable maintenance of
human-relevant CYP enzyme activities when culturing the hepatoma cell line HepaRG
in the four-compartment bioreactor system.97,99
1.4 Culture surveillance/monitoring of BAL devices
In order to ensure efficient and safe therapeutic application of cell-based extracorporeal
liver support devices (BAL), methods and parameters have to be identified that allow
evaluation of the quality of the bio-artificial liver system prior to clinical use and during
therapeutic application. Parameters suitable to assess the BAL functionality have to
provide information on cell integrity and metabolic performance of the culture. In the
case of bio-artificial liver support, release rates of intracellular enzymes, e.g. aspartate
aminotransferase (AST), alanine aminotransferase (ALT), lactate dehydrogenase
(LDH), glutamate dehydrogenase (GLDH), alkaline phosphate, γ-glutamyltransferase
and pseudocholinesterase, provide useful information on the cell integrity.89,136,151–153
Monitoring of glucose production/consumption, lactate production and oxygen
consumption give insight into energy metabolism of the cell culture housed in the
device.77,90,93,145,146,150,153 Ammonia elimination, urea production and bilirubin
metabolism provide information on specific hepatic functions.77,90,143,150,152–154
Additional parameters describing liver function are galactose and sorbitol clearance,
CYP enzyme activities, albumin production or C-reactive protein release.77,97,150,152,154
Monitoring and control of environmental factors that could influence the culture quality
are important to allow maintaining standardized and constant conditions for the cells in
the bio-artificial liver. The temperature and pH value are crucial to cell viability and
have to be maintained on a constant level.135,138,147 Nutrient supply as well as removal of
waste products of cell metabolism has to be controlled.77,144 In addition, observation of
system pressures is needed to prevent exceeding pressure fluctuations, which could
influence the cell behaviour in the system.93,135
Furthermore, successful integration of non-invasive sensors for monitoring vital culture
parameters would improve real-time surveillance of bioreactor cultures and allow for
timely intervention. Oxygen measurement can give information about cell activity,
energy metabolism and the occurrence of potential bacterial contamination. In addition,
it can be used to estimate cell numbers in 3D constructs, provided that data on oxygen
consumption of the used cell type are available.155 Independently of using oxygen as an
1. Introduction
12
evaluation parameter, the used oxygen flow rates have to be adjusted according to the
need of cell culture.135,138
Impedance measurement describes a non-invasive label-free method for real-time
monitoring of cell behaviour in 2D culture. The assay is based on measuring the
resistance or capacitance of cells.156,157 The cell membrane, which separates the cell
cytoplasm from the extra-cellular space, is made of a phospholipid bilayer with
cholesterol and proteins enclosed. Biological cells are poor electric conductors,158
showing a resistance to an electrical field reflecting cell conditions. Thus, changes in the
cell number and/or cell behaviour are reflected in an altered resistance. The method has
been successfully established in the xCELLigence® system (Roche)159 and was
employed in various cell assays characterizing cell stress in response to drug or virus
exposure.157,159–165 Impedance measurement has also successfully used for
characterization of cell culture conditions in a 3D environment.156,166–168 Cell expansion
as well as toxic reactions to anti-cancer drug application could be detected in a 3D
culture system (perfusion microfluidic chip).167 In addition, recent investigations using
multiplexed 4-terminal impedance measurement revealed successful sensing of HepG2
cell aggregates in spatial location within large 3D gelatine scaffolds.168
Ammonia measurement can give information about the cells nitrogen metabolism
describing the conversion of ammonia into glutamine and urea. Ammonia concentration
can be used as a lead parameter characterising liver function since ammonia clearance
represents one of the main aims of extracorporeal liver support application and is known
to be closely related to hepatic encephalopathy.39,68–70
Several requirements have to be addressed to ensure safety and stability of sensor-based
monitoring methods. In particular, biocompatibility of sensors getting in contact with
cells and/or culture medium/plasma/blood has to be ensured. Therefore, sensor
components have to be suitable for sterilisation with clinically approved sterilisation
methods, e.g. ethylene oxide gas sterilisation and/or autoclaving/hot steam sterilisation
at 121°C. In case of sensor integration in the BAL device, sensors should be adjustable
to the pH-value set range (7.35-7.45) and to the temperature set range (37-39 °C) in the
bioreactor circuit. Furthermore, alterations of the culture medium/plasma/blood
components due to the sensors have to be excluded.
2. Aims of study
13
2 Aims of study
The work performed within this thesis was conducted within the d-LIVER project
aiming to provide a bio-artificial liver support system with multi-parametric sensors
enhancing the quality of medical treatment and management and to improve the quality
of life for patients (see also http://www.D-LIVER.eu/).
Aims of this study were the investigation of experimental cell lines and the integration
and evaluation of new non-invasive online sensor technologies in the used 3D
bioreactor technology for potential clinical application.
The AR42J-B-13 (B-13) cell line shows potential to be a pioneer cell source for
utilisation in extracorporeal liver support. Therefore, the first aim of this study was the
evaluation of the trans-differentiation of rat pancreas progenitor cells (B-13 cells) and
the maintenance of B-13/H cells in a 2 ml analytical bioreactor. Undifferentiated B-13
cells were trans-differentiated in bioreactors by dexamethasone addition for 8 or 15
days (group B-13T). In addition, to evaluate the maintenance of functional
characteristics under 3D culture conditions, pre-differentiated B-13/H cells were
cultured in parallel bioreactors over 15 days (group B-13/HP). The efficacy of trans-
differentiation and the cell performance were assessed by determination of functional
parameters in the bioreactor perfusate, including synthesis of glucose, lactate, urea and
albumin. Cytochrome P450 (CYP) 1A1 activity and product conjugation by phase II
enzymes were assessed by analysis of ethoxyresorufin metabolism. The reorganization
grade of the cells in the bioreactor cell compartment and the distribution pattern of
typical hepatocyte markers was analysed by immunofluorescence. In addition, PCR
analysis was performed to determine the mRNA expression of liver-typical proteins.
The second aim described in this thesis focused on the investigation of non-invasive
sensors integration for surveillance of cell quality and functionality in an extracorporeal
liver support system. Therefore, impedance sensors were integrated and tested to give
insight into the culture status. In addition, sensors detecting the ammonia level, which is
a main clinical indicator for hepatic injury, and also pH and oxygen sensors were
evaluated. Initial testing was performed in small-scale experimental bioreactors, using
B-13/H cells as a model cell line. The multi-parametric sensor system was evaluated
with respect to biocompatibility, comparing results from bioreactor systems containing
named sensors with control bioreactors lacking those sensors. Furthermore, the
sensitivity and reliability of non-invasive online sensors was compared to standard
offline parameters measured daily in bioreactor culture perfusates (e.g. glucose, lactate,
urea, albumin, ammonia, ALT, AST, LDH and GLDH). Methapyrilene, which has been
2. Aims of study
14
reported to exert a toxic effect on B-13/H cells, was used as a test substance to analyse
the effect of toxin exposure and to evaluate potential recovery of cells from toxic stress
in the bio-artificial liver (BAL) with incorporated multi-parametric sensors. To evaluate
the BAL system in a clinical setting, primary porcine liver cells (ppL) were used due to
their abundant availability. As a model for toxic patient plasma exposure to the cells,
the effect of the hepatotoxic drug acetaminophen (APAP) was investigated in the
bioreactor system.
The third aim of this thesis was to evaluate the use of the tested non-invasive online
sensors in a large-scale bioreactor type for potential clinical use. Modifications on
sensors were performed to facilitate incorporation into the clinical-scale bioreactor. In a
pilot study a human-equivalent cell line to the B-13 cell line, namely the H-14 cell line
derived by genetic modification of human pancreatic acinar cells (HPAC) was used in a
clinical-scale BAL experiment.
According to the project aims, bioreactor experiments performed in this study are
summarized in the schematic illustration shown in Figure 1. The figure shows the three
main aims of the study: 1) Evaluation of trans-differentiation of B-13 cells and
maintenance of B-13/H cells, 2) Evaluation of non-invasive multi-parametric sensors
using B-13/H cells and ppL, and 3) Pilot study: System up-scaling using HPAC-derived
H-14 cells. In the outlook, the application perspective for this sensor-based bioreactor
technology is shown, using multi-parametric sensors as a decision tool for culture
prediction and decision support in clinical extracorporeal liver support.
2. Aims of study
15
Figure 1: Structure of study.
The figure shows the three main aims of the study, the performed experiments in this study as well as an outlook for in vitro or clinical application.
3. Material and methods
16
3 Material and Methods
3.1 Materials
3.1.1 Chemicals and solutions
Phosphate buffered saline
(PBS) w/o CaMg Life Technologies, Carlsbad, CA, U.S.
4% paraformaldehyde solution
Herbeta Arzneimittel, Berlin
Aqua Polymount
Polysciences Inc., Warrington, PA, U.S.
Ethanol
Herbeta Arzneimittel
Ethanol absolute
Merck, Darmstadt
Hoechst 33342 Solution
Life Technologies
Hydrochloric acid
Carl Roth, Karlsruhe
Methanol
J.T. Baker, Deventer, Netherlands
ParaClear Intermedium;
ProTaqs Clear
Quartett Immunodiagnostika Biotechnologie
GmbH, Berlin
Paraffin (pastille)
Merck
Sodium hydroxide solution
Merck
TRIZOL® reagent
Life Technologies
Trypan blue, 0,5% w/v
Biochrom, Berlin
3.1.2 Material for kits and assays
Albumin ELISA
96-well plates, ELISA
Sarstedt, Nümbrecht-Rommelsdorf
Albumin fraction V
Carl Roth
Potassium bicarbonate
Merck
Rat albumin ELISA kit
Biomol GmbH, Hamburg
Sodium chloride
Merck
3. Material and methods
17
Sulphuric acid
Sigma-Aldrich, St. Louis, MO, U.S.
TMB substrate
Biomol
TRIZMA Base
Sigma-Aldrich
Tween 20
Merck
Ethoxyresorufin-O-deethylase (EROD) activity assay
96-well plate; Fluoronunc™
Nunc, Roskilde, Denmark
Resorufin
Sigma-Aldrich
Sodium acetate
Sigma-Aldrich
β-glucuronidase/arylsulfatase
Roche, Mannheim
Gene expression analysis
DNA ladder
New England Biolabs® Inc., Ipswich,
MA, U.S.
ECL® kit
Life Technologies
Random primer
Promega Corporation, Madison, WI, U.S.
3. Material and methods
18
3.1.3 Primary liver cell isolation
The solutions listed in the following table were used for isolation of primary liver cells
from resected porcine liver. They were stored at 4°C and used within four weeks after
preparation.
Table 1: Compositions of solutions used for primary porcine liver cell isolation.
Compound
Company
Final concentration
Perfusion solution I (pH=7.4)
Ethylene glycol-bis(2-amino-ethylether)-
N,N,N’,N’-tetraacetic acid (EGTA) Sigma-Aldrich 2.4 mmol/l
Hepes
Sigma-Aldrich
10 mmol/l
N-Acetyl-L-cysteine
Carl Roth
1.26 mmol/l
Potassium chloride
Merck
6.7 mmol/l
Sodium chloride
Merck
142 mmol/l
Perfusion solution II (pH=7.6)
Solution A (pH=7.6)
Albumin fraction V
Carl Roth
0.5%
Hepes
Sigma-Aldrich
100 mmol/l
Potassium chloride
Merck
6.7 mmol/l
Sodium chloride
Merck
67 mmol/l
Solution B
Calcium chloride
Sigma-Aldrich
6.3 mmol/l
Stop solution
PBS w/o CaMg
Life Technologies
80% (v/v)
Foetal calf serum (FCS)
PAA, Dartmouth,
MA, U.S. 20% (v/v)
3. Material and methods
19
Additional reagents
Collagenase P
Roche
Stainless steel cannula (1464 LL 1A)
Acufrim Ernst Kratz GmbH, Dreieich
Tissue glue (Histoacryl®)
B.Braun, Rubi, Spain
William’s E medium, with Glutamax
Life Technologies
3.1.4 Culture media, additives and solutions for cell culture
The culture media listed in the following tables were used for culture of B-13 or B-13/H
cells, ppL and H14 cells. They were stored at 4°C and used within two weeks after
preparation.
Table 2: Composition of B-13 cell culture medium.
Compound
Company
Final concentration
2D culture
3D culture
DMEM high glucose Biochrom
88% (v/v) Expansion
95.5% (v/v) Experiment 95.5% (v/v)
FCS PAA
10% (v/v) Expansion
2.5% (v/v) Experiment 2.5% (v/v)
L-Glutamine, 200 mM
Life Technologies
2 mmol/l
Penicillin/streptomycin,
10,000 U/ml/10,000 μg/ml
Life Technologies 100 U/ml/100 µg/ml
Table 3: Composition of ppL culture medium.
Compound
Company
Final concentration
2D culture
3D culture
Heparmed Vito 143
Biochrom
88% (v/v)
98% (v/v)
FCS
PAA
10% (v/v)
-
Glucagon
Sigma-Aldrich
3µg/l
Insulin-transferrin-
selenium (ITS-G) (100x) Life Technologies 1% (v/v)
Penicillin/streptomycin,
10,000 U/ml/10,000 μg/ml
Life Technologies 100 U/ml/100 µg/ml
3. Material and methods
20
Table 4: Composition of H14 cell culture medium.
Compound
Company
Final concentration
2D culture
3D culture
DMEM low glucose
Sigma-Aldrich
87.8% (v/v)
65.3% (v/v)
DMEM high glucose
Sigma-Aldrich
-
30% (v/v)
FCS
PAA
10% (v/v)
2.5% (v/v)
Genicitin (G418)
Life Technologies
100 mg/l
L-Glutamine, 200 mM
Life Technologies
2 mmol/l
Penicillin/streptomycin,
10,000 U/mL/10,000
μg/mL
Life Technologies 100 U/ml/100 µg/ml
Table 5: Composition of freezing medium.
Compound
Company
Final concentration
DMSO
Sigma-Aldrich
10% (v/v)
FCS
PAA
90% (v/v)
Additional cell culture supplements and reagents:
Acetaminophen (APAP)
Sigma-Aldrich
Dexamethasone
Sigma-Aldrich
Diclofenac
Sigma-Aldrich
Geneticin G-418 Sulphate
Life Technologies
Methapyrilene HCl
Sigma-Aldrich
Resorufin ethyl ether
Biomol
Trypsin-EDTA (0.05%, 0.02%)
Biochrom
Trypsin-EDTA (0.5%, 10x)
Life Technologies
3. Material and methods
21
3.1.5 Cells
B-13 cell line
Kindly provided by Professor M.C.
Wright, University of Newcastle,
Newcastle upon Tyne, U.K., within the
EU project “d-Liver” (Grant agreement
no: 287596)
Primary porcine liver cells (ppL)
Isolated from resected liver of house
swine. Organ harvesting from pigs for
research was performed with approval (T
0130/15) from the Landesamt für
Gesundheit und Soziales, Berlin
(LAGESO).
H-14 cell line (human glucocorticoid-
sensitive pancreatic ductal
adenocarcinoma cell line [HPAC]
capable of differentiation into
hepatocyte-like cells, genetically
modified to improve hepatic
functionality)
Kindly provided by Professor M.C.
Wright, University of Newcastle,
Newcastle upon Tyne, U.K., within the
EU project “d-Liver” (Grant agreement
no: 287596)
3.1.6 Cell culture disposables
6-well plates
Falcon, BD Biosciences, San Jose, CA,
U.S.
Cell culture flasks (25 cm2 - 175 cm2)
Falcon
Cover slides
Carl Roth
Falcon tubes (15mL/50mL)
BD Biosciences, San Jose, CA, USA
Glass slides; super frost plus
R. Langenbrinck, Emmendingen
Microcentrifuge tubes 1.5/2 ml
Sarstedt
Pipette tips 10-1000 µl
Sarsted
Serological pipettes 1- 50 ml
BD, Franklin Lakes, NJ, U.S.
WhatmanTM paper
Schleicher & Schuell GmbH, Dassel
3. Material and methods
22
3.1.7 Bioreactors and supplies
Additional tubes, PharMed
Medorex, Nörten-Hardenberg
Bioreactors
Stem Cell Systems, Berlin
Combidyn® adapter
B.Braun, Melsungen
Combi-stopper luer-lock
Fresenius Kabi, Bad Homburg
Disposable cannula
B.Braun
Gas filter
Sartorius, Göttingen
Glass vessel (250mL/500mL)
Schott, Mainz
Liquid filter (0.45 µm)
Sartorius
Perfusion line
B.Braun
Syringes (1-50mL)
B.Braun
Three-way valves
B.Braun
Tubing system
Stem Cell Systems
Vessel lid with integrated luer-lock
Stem Cell Systems
3.1.8 External sensors
Oxygen sensor (Disp-FTC-PSt3-S)
PreSens-Precision Sensing GmbH,
Regensburg
pH sensor (Disp-FTC-HP8-S)
PreSens-Precision Sensing GmbH
Ammonium flow-through cell and
monitoring device
Kindly provided by CEA-Leti-France,
Grenoble, France, within the EU project
“d-Liver” (Grant agreement no: 287596)
Impedance sensor foil and measuring
device with data analysis software
Kindly provided by Fraunhofer Institut
(IBMT), St. Ingbert, within the EU project
“d-Liver” (Grant agreement no: 287596)
3. Material and methods
23
3.1.9 Gene expression and Western blotting
Table 6: DNA oligonucleotide sequences employed in RT-PCR or PCR genotyping.
Oligo ID 5'-3' sequence
Annealing
conditions
(35 cycles)
Comments
rmCYP2E1US
rmCYP2EDS
TCGACTACAATGACAAGAAGTGT
CAAGATTGATGAATCTCTGGATCTC 42oC
Will amplify a rat
CYP2E
(NM_031543) cDNA
sequence of 525bp
rmhGAPDHUS
rmhGAPDHDS2
TGACATCAAGAAGGTGGTGAAG
TCTTACTCCTTGGAGGCCATGT 50°
Will amplify rat
(NM_017008), hu-
man (NM_002046) or
mouse
(NM_008084)
glyceraldehyde 3
phosphate dehydro-
genase cDNA
sequence of 243bp
rCPS1US
rCPS1DS
ATACAACGGCACGTGATGAA
GCTTAACTAGCAGGCGGATG 55 °C
Will amplify rat CPS
(NM_017072.1)
cDNA sequence of
390bp
rmAMYLASEUS
rmAMYLASEDS
CAAAATGGTTCTCCCAAGGA
CAAAATGGTTCTCCCAAGGA 57°C
Will amplify rat pan-
creatic amylase 2
(NM_031502.1)
cDNA
sequence of 224bp
rCYP2C11 US
rCYP2C11 DS
CTGCCATGGATCCAGTCCTAGTCC
TTCCCTCTCCCAAAGCTCTGTCTCC 55°C
Will amplify rat (
NM_019184.2) cDNA
sequence of 88bp
rAlbumin US
rAlbumin DS
CGTCAGAGGATGAAGTGCTC
CTTAGCAAGTCTCAGCAGCAG 47oC
Will amplify rat al-
bumin (NM_134326)
cDNA sequence
sequence of 471bp
3. Material and methods
24
3.1.10 Immunohistochemistry
Blocking buffer
PBS
w/o CaMg Life Technologies
+ 3% bovine serum albumin (BSA)
Sigma-Aldrich
+ 2% FCS
PAA
Citrate buffer (pH = 6.0)
Distilled water
+ 1.8% 0.1 mmol/l citric acid
Merck
+ 8.2% 0.1 mmol/l sodium citrate
Sigma-Aldrich
3. Material and methods
25
Table 7: Primary and secondary antibodies used for immunohistochemical analysis of
bioreactor tissue.
Antigen
Company
Isotype
Species
Immunogen
Dilution
Primary antibodies
β-actin Sigma-Aldrich Monoclonal IgG Mouse
Mouse, Rat,
Human WB 1:4000
Albumin
Abcam,
Cambridge, U.K.
Polyclonal IgG
Chicken
Mouse, Rat,
Human
WB 1:3000
IHC 1:400
Amylase
Abcam
Polyclonal IgG
Rabbit
Mouse, Human
WB 1:3000
Santa Cruz,
Dallas, TX, U.S.
Monoclonal IgG
Mouse
Mouse, Rat,
Human
IHC 1:100
CEBP-β
Abcam
Polyclonal IgG
Rabbit
Mouse, Rat,
Human
IHC 1:100
CK18
Abcam
Monoclonal IgG
Rabbit
Rat, Human
IHC 1:100
CPS-1
Abcam
Polyclonal IgG
Rabbit
Mouse, Rat
WB 1:2000
CYP2E1
Abcam
Polyclonal IgG
Rabbit
Mouse, Rat,
Human
WB 1:5000
IHC 1:100
CYP3A4
Abcam
Polyclonal IgG
Rabbit
Human
WB 1:2000
MRP2
Sigma-Aldrich
Polyclonal IgG
Rabbit
Rat, Human
IHC 1:100
Antigen
Company
Fluorochrome
Species
Immunogen
Dilution
Secondary antibodies
Anti-Goat
HRP 2° Sigma-Aldrich - Rabbit Goat 1:3000
Anti-Mouse
HRP 2°
Dako, Glostrup,
Denmark
-
Goat
Mouse
1:3000
Anti-Rabbit
HRP 2°
Dako
-
Goat
Rabbit
1:3000
Anti-Mouse
Life Technologies
Alexa Fluor 488
Goat
Mouse
1:1000
Anti-Rabbit
Life Technologies
Alexa Fluor 594
Goat
Rabbit
1:1000
Anti-
Chicken
Life Technologies
Alexa Fluor 594
Goat
Chicken
1:1000
3. Material and methods
26
3.1.11 Equipment
Bench drill; OPTI B23 Pro
Optimum-Maschinen Germany GmbH,
Hallstadt
Bioreactor perfusion device
Stem Cell Systems
Blood gas analyzer; ABL 700 Series
Radiometer, Brønshøj, Denmark
Centrifuge; Varifuge 3.OR
Heraeus Instruments, Hanau
Dako pen wax crayon
Dako, Hamburg
Device for gas valves
Vögtlin Instruments, Aesch, Switzerland
Fluorescence microscope camera; Retiga
2000R
QImaging, Surrey, BC, Canada
Fluorescence microscope lamp; AttoArc,
HBO 100 W
Carl Zeiss, Göttingen
Fluorescence microscope; Axiovert
200M
Carl Zeiss
Heat exchange pump
Julabo GmbH, Seelbach
Incubators; Cytoperm CO
2
/O
2
Heraeus Instruments GmbH
Laminar air flow; HB2448
Heraeus Instruments GmbH
Light microscope camera;
MicroPublisher 3.3 RTV
QImaging
Light microscope; Axiovert 40 CFL
Carl Zeiss, Jena
Microcentrifuge; 5417R
Eppendorf, Hamburg
Microtome; Microm HM355s
Microm-International, Walldorf
Paraffin embedding center AP 250
Microm-International
Perfusor; Secura FT
B.Braun
Plate-reading fluorometer;
FumostarOptima
BMG Labtech, Ortenberg
Realtime cycler; Mastercycler ep
Realplex 2
Eppendorf
Spectrophotometer; Nanodrop
Thermo Fisher Scientific, Waltham, MA,
USA
Water bath
Julabo GmbH
3. Material and methods
27
3.1.12 Software
Get red-y 5
Vögtlin Instruments
Image Pro Plus
Media Cybernetics, Silver Spring, U.S.
LabView
National Instruments Germany GmbH,
München
MATLAB
MathWorks, Natick, MA, U.S.
GraphPad Prism 5.0
GraphPad Software, San Diego, CA, U.S.
QCapture Pro 5.1
QImaging, Surrey, BC, Canada
SPSS Statistics 21
IBM Corporation, Armonk, NY, U.S.
3. Material and methods
28
3.2 Methods
3.2.1 2D culture of liver cell types used in the study
B-13, B-13/H, H14 and ppL cultures were maintained at 37°C in a humidified incubator
in a mixture of 5% CO2 and 95% air, unless otherwise indicated.
3.2.1.1 Expansion and trans-differentiation of B-13 cells in 2D culture
For cell expansion a number of 5×106 B-13 cells were seeded in 175 cm2 cell culture
flasks. Medium exchange was performed every second day using culture medium
described in Table 2. Cells were passaged 1:5 to 1:10 when culture confluency reached
70-80%. For passaging, cells were trypsinized with 0.05% trypsin for 5-7 min at 37°C
after rinsing once with PBS. Cells were frozen in appropriate aliquots using medium
described in Table 5.
For experimental investigations a number of 0.75-1×106 B-13 cells were seeded in one
well of a 6-well culture plate, respectively, and were maintained with “Experiment”
medium Table 2, unless other indicated. Dexamethasone was added at a concentration
of 10 µmol/l to trans-differentiate B-13 cells to liver-like B-13/H cells.
When using trans-differentiated B-13/H cells for bioreactor experiments 10×106 B-13
cells were seeded and cultured for 5 days in 175 cm2 cell culture flasks using
“Expansion” medium (Table 2) adjusted with 10 µM dexamethasone.
3.2.1.2 Expansion and trans-differentiation of H-14 cells in 2D culture
For cell expansion a number of 1.5-5×106 H-14 cells were seeded in 175 cm2 cell
culture flasks. Medium exchange was performed every second day using culture
medium described in Table 4 and cells were passaged 1:10 when culture confluency
reached 70-80%. For passaging, cells were trypsinized with 0.5% trypsin for 5-7 min at
37°C after rinsing twice with PBS. Cells were frozen in appropriate aliquots using
medium described in Table 5. To trans-differentiate H-14 cells into liver-like cells 10
µmol/l dexamethasone were added to the culture medium.
3.2.1.3 Isolation of primary porcine liver cells via collagenase P perfusion
Cells were isolated from fresh porcine livers and used for characterization of the cell
response to toxic stress using multi-parametric sensors.
The isolation procedure was performed according to primary human liver isolation
protocols previously described.169,170 Prior to cell isolation required materials and
solutions were prepared. To start isolation the water bath with temperature control (set
to 39°C), an empty glass vessel with funnel and a glass vessel with “Perfusion solution
I” (Table 1) were placed under the sterile bench (Figure 2A). The working area was
covered with a sterile drape sheet, and a glass petri dish, sterile compresses, a forceps, a
scalpel and stainless steel cannulas for perfusion were placed on the drape sheet (Figure
3. Material and methods
29
2B). A piece of liver capsule was taken from the organ (Figure 2C) and stored in sterile
4°C cold Williams E medium for the transport from animal experimentation facilities to
the laboratory. In the next step the resection area was examined to identify large vessels
and bile ducts for cannulation (Figure 2D). Cannulas were fixed in large vessels using
Histoacryl® tissue glue. To ensure optimal perfusion remaining vessels were closed
with tissue glue (Figure 2E). Tissue perfusion was initiated using “Perfusion solution I”
(Table 1) containing EGTA to remove blood and temperate the liver tissue. Perfusion
with a volume of 400-500 ml “Perfusion solution I” over approx. 30 min was required
to rinse out remaining blood. For collagen P digestion 100 mg of the enzyme were
dissolved in 50 ml “Perfusion solution II” and 50 ml “Stop solution” and conducted
through a sterile filter. The solution was kept on a temperature of 38°C to ensure
sufficient enzyme activity. To reduce the enzyme amount required, the perfusion setup
was changed to a recirculating mode. Emerged perfusate was captured in a glass vessel
and re-perfused through the liver tissue (Figure 2F-G). Enzyme perfusion was
terminated as soon as the liver deformed and did not regenerate when putting pressure
to it, which was attained mostly after 10-11 min. Thereafter the liver piece was placed
in a glass petri dish containing ice-cold “Stop solution” (Table 1) to inactivate
collagenase P activity and prevent exceeding digestion. To open the liver capsule the
liver tissue was cut in halves using scalpel and forceps, and liver cells were shaken out
carefully in “Stop solution” (Figure 2H-J). The obtained cell solution was collected in
50 ml Falcon tubes using the funnel containing a compress to remove tissue debris.
After a centrifugation step (5 min with 50 g at 4°C) performed to remove cell debris the
cell pellet was carefully resuspended in “2D culture” medium (4°C) described in Table
3 (Figure 2K-L). The cell number and viability were assed using trypan blue (diluted
1:4 in PBS) and a Neubauer cell counter chamber. Thereafter the cells were prepared for
2D and/or bioreactor experiments.
3. Material and methods
30
Figure 2: Procedure of primary porcine liver cell isolation using collagenase P perfusion.
(A-B) Preparation of isolation equipment, (C) Liver capsule resection, (D-F) Fixation of
cannula in vessels and bile ducts, (G) Perfusion of liver tissue with perfusion solutions, (H-J)
Opening of liver capsule and cell harvesting, (K-L) Resuspension of obtained cell pellet.
3.2.1.4 Primary porcine liver cell 2D culture and toxicity testing
For experimental investigation freshly isolated ppL (see 3.2.1.3) were seeded into 6-
well culture plates using culture medium (see Table 3). Prior to cell seeding, wells were
coated with rat-tail collagen (1:100) for at least 30 min at room temperature. Thereafter
the collagen solution was aspirated and a number of 2×106 cells were seeded in each
well of a 6-well culture plate. After four hours the medium was exchanged by fresh
medium to remove not attached or dead cells. A medium exchange was conducted every
day and culture parameters (lactate and ammonia) were analysed in culture
supernatants.
3. Material and methods
31
In order to induce different grades of stress, APAP or diclofenac were applied at three
different concentrations to the cell culture. APAP was applied at 5, 10 or 30 mmol/l,
and diclofenac at 100, 300 or 1000 µmol/l. Toxic stress was maintained for six days by
daily medium exchange using fresh drug-containing culture medium. Each day culture
parameters (lactate and ammonia) were analysed in supernatants.
3.2.2 3D cell culture model
For 3D liver culture a hollow fibre bioreactor technology developed in the group was
used.144
3.2.2.1 Bioreactor technology and set up
The bioreactor is composed of four compartments to accomplish efficient mass
exchange in cell culture. Two different types of hollow fibres are used, i) medium
bearing hollow fibres made of polyether sulfone (MicroPRS® TF10, Membrana,
Wuppertal, Germany) and ii) hydrophobic oxygenation hollow fibres (Mitsubishi
MHF200TL, Mitsubishi Rayon, Tokyo, Japan). These are arranged in interwoven layers
forming a 3D network enclosing the fourth compartment (cell compartment) as shown
in Figure 3A. The capillary bundles are set in defined angles for efficient counter-cross
medium perfusion with low mass gradients (Table 8). Additionally internal oxygenation
through hydrophobic hollow fibres provides a large surface area for gas exchange and
avoids oxygen gradients within the medium flow. Cells are located in the extra-capillary
space enclosed by a polyurethane housing (Figure 3B). Cells are inoculated via silicone
tubes into the cell compartment.
Figure 3: Architecture of 3D multi-compartment bioreactor.
(A) Illustration of the bioreactor showing the capillary structure in the bioreactor with two
independent bundles of hollow fibre membranes serving for counter-current medium perfusion
(blue and red) and an additional capillary system for integral oxygenation (yellow). (B)
Illustration of cells located in the extra-capillary space.
3. Material and methods
32
In this study three different bioreactor types varying in cell compartment volume and
surface area were used (Figure 4). Technical information for two analytical-scale
bioreactors with 2 ml or 8 ml compartment volume and a clinical-scale bioreactor with
800 ml compartment volume are shown in Table 8.
Figure 4: Bioreactor used for 3D-cultivation.
Differently sized Bioreactors (from left to right: 800 ml clinical-scale, 8 ml analytical-scale and
2 ml analytical-scale) in front of the perfusion device for 3D-bioreactor operation (Stem Cell
Systems). The device includes a heating chamber, a gas mixing unit and pumps for medium
recirculation and fresh medium substitution. Additionally ports required for connection of
optical-chemical oxygen and pH sensors (PreSens-Precision Sensing GmbH) are mounted.
Perfusion parameters are regulated via labView software through an integrated PC.
3. Material and methods
33
Table 8: Technical properties of differently sized types of 3D multi-compartment
bioreactors.
Analytical-scale
bioreactor (2 ml)
Analytical-scale
bioreactor (8 ml)
Clinical-scale
bioreactor (800 ml)
Technical properties
Number of layers
40
56
166
Number of medium capillaries
500
1,020
8,430
Number of gas capillaries
600
1,380
16,530
Cell compartment volume (ml)
~2
~8
~800
Total system volume, including
the tubing circuit (ml) ~20 ~40 ~1,300
Surface area (cm2)
293
986
4.48×104
Angel between capillary bundles
(Medium I-Medium II) 45° 45° 60°
Angel between capillary bundles
(Medium I/II-Gas) 60° 45° and 90° 60°
Integrated impedance sensors no
yes
3 sensor foils
yes
6 sensor foils
Integrated pH sensor
no
yes
yes
Integrated oxygen sensor
no
yes
yes
Integrated ammonia sensor
no
yes
yes
3.2.2.2 Bioreactor perfusion circuit
Hollow fibre bundles and inoculation tubes are connected via luer-lock connectors with
the tubing system, which is operated in a special perfusion device. The tubing system is
made out of tygon 2275. It consists of a recirculation circuit to ensure accumulation of
substances produced and needed by cells and a feed-outflow system for provision of
fresh medium and removal of used medium. The tubing system contains clamps for
changing the perfusion modes, bubble traps to avoid gas import into the medium
capillaries, pressure measurement lines and three-way-valves for sample collection.
Bioreactors are placed in the heating chamber of the perfusion device (Figure 4) and
maintained at a constant temperature of 37°C via sensor-based electronic temperature
control. Medium flow rates are adjusted via roller pumps. Pressure sensors allow for
monitoring of system pressures, and pump flow is automatically stopped if the system
pressure increases above set system values. Gas influx is adjusted using electronically
regulated gas valves for analytical-scale bioreactors (2 ml and 8 ml). For clinical
3. Material and methods
34
bioreactor operation gas supply is provided via manually controlled rotameters for air
and CO2.
3.2.2.3 Sensor integration
In some experiments, optical-chemical sensors for oxygen and pH (PreSens-Precision
Sensing GmbH) were integrated into the recirculation tubing line, and ammonia sensors,
provided by CEA-Leti-France, Grenoble France were mounted in the outlet line. Signals
were detected via polymer optical fibres between sensors and the readout unit of the
perfusion device for oxygen and pH monitoring or via electrical plugs for ammonia
monitoring.
In case of oxygen or pH sensor integration (Figure 5A), sensors consist of a flow-
through cell with an optical-chemical polymer layer placed inside allowing direct
contact with the culture perfusate. This layer is excitable by the blue LED array and
interacts with the components of the perfusate. The flow-through cells are connected to
the transmitter via an optical fibre, which was carefully placed into the T-connector tube
of the flow-through cell (Figure 5B). Afterwards sensors were connected to the
perfusion device (Figure 5C). The pH or the oxygen concentration was monitored via
dual lifetime referenced fluorometry,171, which enables internally referenced
measurements. Intensity changes were detected by a combination of different
fluorescent dyes in the time domain. Calibration values for pH and oxygen sensors were
set in the calibration mask of labView software prior use.
Figure 5: Online sensors for oxygen and pH measurement in the culture perfusate.
(A) Optical-chemical flow-through cell sensors (PreSens-Precision Sensing GmbH) for oxygen
and pH. (B) Connecting the flow-through cell with optical fibres for signal detection. (C)
Connecting optical-chemical sensors via optical fibres with readout units integrated in the
perfusion device.
Online sensors to detect changes of ammonia concentrations in the culture perfusate
were placed in the outlet line of the tubing system to minimize the risk of microbial
contamination, since sterilization of sensors without harming them was only possible
3. Material and methods
35
with 70% EtOH. As shown in Figure 6 the sensor construct for ammonia consisted of
two measurement chambers, with one chamber being flushed with medium leaving the
bioreactor and the second camber being flushed with fresh medium serving as a
reference for measured ammonia concentrations in the bioreactor perfusate. Both
chambers housed cone sensors for ammonia measurement. The sensor consisted of a
polyvinyl chloride (PVC) cavity containing an internal electrolyte solution and a
working electrode made of chlorinated silver wire. The cavity was sealed with an
ammonium sensitive membrane, which stays in contact with the culture medium in the
chamber for measurement of the electric potential. To avoid air entry into the chambers,
which could disturb detection of ammonia, bubble traps were placed in front of
measurement chambers. Both chambers were connected via tubes for measurement and
join the waste line. Sensors were connected with the read-out device via electrical plugs.
Figure 6: Online sensor for ammonia measurement in the culture perfusate (CEA-Leti-
France).
(A) The ammonia sensor consists of two medium chambers. One of these is flushed with
bioreactor perfusate and the second one with fresh medium serving as a reference. (B)
Bioreactor perfusate and fresh medium is flushed through the chambers after passing bubble
traps to avoid air bubbles on ammonium sensitive membranes (red arrow). Both chambers are
connected via tubes for measurement of the reference potential (red-blue arrows). Both outlets
of measurement chambers join the waste line (blue arrow). Electrical plugs are introduced into
corresponding electrical sockets (black square).
Further, in some experiments foil-based impedance sensors, provided by the Fraunhofer
IBMT were integrated into the cell compartment of the 8 ml analytical-scale or 800 ml
clinical-scale bioreactors by the manufacturer (Stem Cell Systems). Sensor foils are
made of polyimide covered by a platinum electrode array where impedance is measured
between two electrodes each (channel). The impedance describes the electric resistance
to the set voltage, which depends on the frequency. Cells inoculated into the bioreactor
show natural poor conductor ability due to their composition and force changes in
impedance measurement when attaching to sensor electrodes and therefore offer a
resistance. Three sensor foils containing eight sensor points each were integrated in one
3. Material and methods
36
8 ml analytical-scale bioreactor as shown in Figure 7A-B, and six sensor foils
containing eight sensor points each were placed vertically in an angle of 60° to each
other in the cell compartment of the 800 ml clinical-scale bioreactor (Figure 7C).
Impedance sensors were carefully connected with the adapter board. Therefore the
sensor foils were inserted into the connector and fixed. By fastening the adapter board
to metal angles the sensor construct was hold in place to avoid tensile stress to the
sensor foil. The flat ribbon cable, which connects the adapter board with the
Multiplexer/Switch, was stabilized with a cable relief to avoid broken solder joints on
the adapter board Figure 7D.
Figure 7: Foil-based impedance sensors located in the cell compartment of bioreactors.
(A-B) Localisation and arrangement of sensor foils in the cell compartment of the 8 ml
analytical-scale bioreactor. (C) Localisation and arrangement of sensor foils in the cell
compartment of the 800 ml clinical-scale bioreactor. (D) Fixation of sensor foil-adapter board
construct to metal angle on bioreactor shell.
Readout units for oxygen and pH measurement were integrated in the perfusion device.
For ammonia and impedance measurement external detection devices in combination
with data analysis software provided by the cooperation partners CEA-Leti-France and
Fraunhofer IBMT were used. The set-up and assembly of the bioreactor culture system
with flexible variation in bioreactor-scale and online sensor integration is shown in
Figure 8.
3. Material and methods
37
Figure 8: Set up and architecture of bioreactor culture system.
Tubing system consists of a recirculation and a feed-outflow circuit where medium flow rates
are controlled via roller pumps. Different variance of bioreactor-scale can be placed in heating
chamber, where heating module is controlled via temperature sensor. An electronic gas mixing
unit is used for fumigation. Bioreactor culture system can be equipped with i) impedance
sensor foils (Fraunhofer IBMT) mounted in the cell compartment, ii) optical-chemical sensors
for oxygen or pH (PreSens-Precision Sensing GmbH) mounted in the recirculation circuit or iii)
ammonia sensor (CEA-Leti-France) mounted in the outlet line of the feed-outflow circuit.
3. Material and methods
38
3.2.3 3D bioreactor culture of liver cell types used in the study
B-13, B-13/H, H14 cells or ppL were maintained in bioreactors at 37°C and using a gas
mixture of 5% CO2 and 95% air, unless otherwise indicated. In some experiments,
online sensors were integrated into bioreactors as previously described. Bioreactors and
tubing systems were exposed to formaldehyde gas (60°C) for sterilisation. Before
starting bioreactor experiments the assembled bioreactor system was flushed with PBS
for at least two days at room temperature to eliminate possible residues from
manufacturing and sterilisation. Prior to cell inoculation PBS was exchanged with the
required culture medium and the heating chamber was heated up to 37°C. Values of pH
were measured in daily samples (3.2.4.2) or via online pH sensors (3.2.4.3). The
concentration of CO2 in the supplied gas mixture was adjusted, if required, to maintain
the pH between 7.2 and 7.4. Table 9 shows medium and gas flow rates required for
different types of bioreactors used in this study. Bioreactors can be operated in different
perfusion modes according to study requirements: i) standard perfusion mode (medium
recirculation with continuous feed and medium removal), ii) closed perfusion mode
(medium recirculation without feed and medium removal) and iii) single-pass perfusion
(feed and medium removal without medium recirculation).
Table 9: Perfusion parameters used for 3D-bioreactor culture
Analytical-scale
bioreactor (2 ml)
Analytical-scale
bioreactor (8 ml)
Clinical-scale
bioreactor (800 ml)
Perfusion parameters
Recirculation rate (ml/min)
10
20
250
Medium feed rate (ml/h) 2
6 (B-13/H, ppL
during the first 24 h
of culture)
2 (ppL after the first
24h of culture)
20-50 (in dependence
of glucose
consumption rates)
Gas flow rate (ml/min)
20
40
500
3.2.3.1 Trans-differentiation of B-13 cells and maintenance of B-13/H cells
in 2 ml and 8 ml analytical-scale bioreactors
In this study, the trans-differentiation of B-13 cells into hepatocyte-like cells (B-13/H)
and their functional performance in the bioreactor culture system was investigated. In
the first approach (B-13/HT) a number of 4×107 undifferentiated B-13 cells were
inoculated into the 2 ml analytical bioreactor. Bioreactors were perfused with culture
medium (see Table 2). After 24 hours of culture an EROD assay was performed
(3.2.4.4), followed by treatment with 10 µmol/l dexamethasone to initiate trans-
differentiation to B-13/H cells. The culture was continued over 15 days in the presence
3. Material and methods
39
of dexamethasone. The EROD assay was repeated on day 8 and 15 of culture. To
evaluate the maintenance of functional characteristics under 3D culture conditions,
trans-differentiated B-13/H cells were inoculated and cultured in parallel bioreactors
over 15 days (second approach: B-13/HP). Therefore 1×108 differentiated B-13/H cells
were inoculated into the bioreactor system. The cells were then treated with 10 µmol/l
dexamethasone and maintained for 15 days. On day 1, 8 and 15 of culture, an EROD
assay was performed (3.2.4.4). Culture parameters were analysed daily in samples from
the bioreactor perfusate (3.2.4.2). Upon termination of the bioreactor cultures, cell
material for protein and RNA analysis was withdrawn from the cell compartment by
drilling it open. For RNA analysis, cells were re-suspended in TRIZOL, while cells for
Western blotting were used without further processing (3.2.4.5). For
immunohistochemistry (3.2.4.6), cell material (including capillary layers) was fixed in
4% formaldehyde buffer, dehydrated and embedded in paraffin.
To investigate the efficacy of multi-parametric online sensors 8 ml analytical-scale
bioreactors were used. A number of 2×108 undifferentiated B-13 cells were inoculated
into the cell compartment of 8 ml bioreactors. On day 1, 8 and 15 of culture, and EROD
assay was performed (3.2.4.4). After the first EROD assay the culture medium was
supplemented with 10 µmol/l dexamethasone to initiate trans-differentiation to B-13/H
cells. Sample taking and processing for analysis of culture parameters and
immunohistochemistry analysis was performed as described above.
3.2.3.2 Methapyrilene application to trans-differentiated B-13 cells in 8 ml
analytical-scale bioreactors
To investigate the effect of methapyrilene exposure in trans-differentiated B-13 cell (B-
13/H) cultures, two 8 ml analytical-scale bioreactors were inoculated with B-13 cells as
previously described in 3.2.3.1. Methapyrilene is metabolised in a toxic product by
CYP2C11, which is present in B-13/H cells but not in undifferentiated B-13 cells. The
culture medium was supplemented with 10 µmol/l dexamethasone and cells were trans-
differentiated for 11-14 days to ensure efficient trans-differentiation of B-13/H cells in
the bioreactor. For the purpose of dose finding in the bioreactor culture, methapyrilene
was applied consecutively in four different concentrations (0.2, 0.4, 0.8 and 1.6 mmol/l /
standard perfusion mode) for six hours, respectively, to the same bioreactor. After each
methapyrilene session the bioreactor system was flushed (single-pass perfusion mode)
with fresh culture medium to wash out residual toxic products. After 1.5 days of culture
regeneration the next methapyrilene concentration was applied. An untreated further
bioreactor was run in parallel as a control. Culture parameters were analysed in daily
samples as described above (3.2.4.2).
To investigate the response of oxygen, pH and impedance to methapyrilene exposure in
B-13/H bioreactor cultures two 8 ml analytical-scale bioreactors were identically
3. Material and methods
40
prepared with respective online sensors. A concentration of 2 mmol/l methapyrilene
was chosen based on dose finding experiments to ensure detectable toxic stress upon
drug exposure. After 14 days of trans-differentiation one bioreactor was exposed to
methapyrilene for 24 hours, whereas the second bioreactor was used as an untreated
control. Intoxication was followed by flushing the bioreactors to wash out residual toxic
products. Thereafter, bioreactors were set in standard perfusion mode with continuous
medium feed. On day 17 and 18 control bioreactor was exposed to 2 mmol/l
methapyrilene for 2.5 h to validate the response of sensor signals to drug-induced cell
stress.
3.2.3.3 APAP exposure in primary porcine liver cells cultured in 8 ml
analytical-scale bioreactors
For each experiment two bioreactors were run in parallel. Primary porcine liver cells
(ppL) were isolated as previously described (3.2.1.3). A number of 2.5-4×108 ppL were
inoculated in each bioreactor. Cells were cultured in the medium described in Table 3.
After an adaption phase of three days, APAP was applied at a final concentration of 5
mmol/l to one of the bioreactors for 24 hours (standard perfusion mode). Thereafter the
bioreactor was flushed (single-pass perfusion mode) with fresh culture medium to wash
out residual toxic products followed by a regeneration phase of two days. On day 6 the
procedure of APAP application was repeated. The second bioreactor was used as
untreated control. Culture parameters were analysed in daily taken samples (3.2.4.2).
Online monitoring of oxygen concentrations, pH value and impedance signals was
performed as described in 3.2.4.3.
3.2.3.4 Culture of H-14 cells in an 800 ml clinical-scale bioreactor
The human H-14 cell line derived from HPAC was provided by the group of Professor
Wright (University Newcastle, U.K.). The cell line showed successful culture
performance in previous experiments using small-scale 2 ml bioreactors (data not
shown). For the pilot study using an up-scaled 800 ml clinical-scale bioreactor H-14
cells were expanded in 2D culture before inoculation in the bioreactor. The composition
of the culture medium used is provided in Table 4. The bioreactor system was prepared
as followed: i) oxygen and pH sensors were integrated in volume adapted flow-through
cells, ii) an ammonia sensor was mounted at the outlet line and iii) six impedance sensor
foils were vertically integrated into the cell compartment of the clinical-scale bioreactor.
Readout devices were prepared and tested: i) provided calibration values (PreSens-
Precision Sensing GmbH) were registered in sensor software, ii) ammonia sensors were
calibrated via different ammonia concentrations by CEA-Leti-France and iii) impedance
measurement was tested when bioreactor was flushed with PBS showing values of
approx. 103 Ω when the sensor was functional.
3. Material and methods
41
A number of 5.8×108 H-14 cells were inoculated into the cell compartment and cultured
over 15 days. From day 12 of culture, 30 mmol/l APAP were continuously applied to
the bioreactor culture over three days. Culture parameters were analysed in daily taken
samples (3.2.4.2). Online monitoring of oxygen concentrations, pH value and
impedance signals was performed as described in 3.2.4.3.
3.2.4 Evaluation of cell quantity and quality in 2D- and 3D cultures
3.2.4.1 Morphological characterization
The morphology of B-13, B-13/H, ppL or H-14 cells in 2D cultures was daily evaluated
using a phase contrast light microscope. Pictures were acquired using the digital
imaging software QCapture Pro 5.1. Cells were characterized analysing the cell shape,
size, nucleus-cytoplasm ratio, cell density, cytoplasmic granulation and in case of
proliferating cell lines the expansion capacity.
3.2.4.2 Metabolic offline parameters
Daily medium samples were taken from bioreactor perfusates or 2D supernatants and
analysed for ALT, AST, GLDH, LDH, amylase (only in B-13, B-13/H and H-14
cultures), urea and ammonia concentrations using an automated clinical chemistry
analyser. Glucose, lactate and oxygen concentrations as well as pH values were
analysed using a clinical blood gas analyser. Albumin concentrations were determined
by means of an ELISA (according to manufacturer instruction). Metabolic rates were
calculated using the following equation according to Hoffmann et al. (2012).77
Equation 1: Calculation of metabolic rates in bioreactor cultures
𝑃𝑃.𝑟𝑟𝑟𝑟𝑟𝑟𝑟𝑟 =𝜌𝜌𝑅𝑅(𝑟𝑟2)×𝑉𝑉𝑅𝑅−𝜌𝜌𝑅𝑅(𝑟𝑟1)×(𝑉𝑉𝑅𝑅−𝑉𝑉𝑆𝑆)−𝑉𝑉𝑠𝑠×𝜌𝜌𝐵𝐵+�𝜌𝜌𝑅𝑅(𝑟𝑟2)+𝜌𝜌𝑅𝑅(𝑟𝑟1)
2−𝜌𝜌𝐵𝐵�×𝑉𝑉𝑊𝑊𝑊𝑊𝑠𝑠𝑊𝑊𝑊𝑊(𝑟𝑟2)
∆𝑟𝑟
P.Rate: production rate
ρR(t): concentration in recirculation at time t
ρB: medium blank concentration
VR: volume in recirculation
VS: sampling volume
VWaste: waste volume
∆t: time between sampling at t1 and t2
3. Material and methods
42
3.2.4.3 Online parameter monitoring using non-invasive online sensors
Online signals for oxygen concentration and pH were determined every 100 seconds.
Signals for ammonia concentrations were determined every 30 seconds and the
electrical potential between the sensor and the reference electrode was measured and
plotted as a function of time. Signals for impedance measurement (in total 40
independent measuring channels) were determined every 15 minutes at a frequency of
10 kHz.
3.2.4.4 Ethoxyresorufin-O-deethylase (EROD) assay
The CYP1A1 activity of the cultures was tested by measuring the conversion of 7-
ethoxy-resorufin to its product resorufin, which is detected fluorometrically using an
extinction wavelength of 544 nm and an emission wavelength of 590 nm. The substrate
was applied at a final concentration of 20 µmol/l to the recirculation circuit. The
bioreactor culture was switched to closed perfusion mode (recirculation without feed
and medium removal). After substrate application samples were taken from the
perfusate after 0.5, 1, 1.5 and 2 hours. At the end of the assay the bioreactor was flushed
and set to standard perfusion mode (recirculation with feed and medium removal).
Samples were analysed fluorometrically with an ELISA reader using authentic resorufin
in a concentration range of 5-320 nmol/l as a standard for the free product
concentration. In order to detect the absolute amount of product, including conjugated
metabolites, conjugates were cleaved by addition of β-glucuronidase/arylsulfatase.
Therefore 150 µl of sample and 150 µl of 1 mol/l sodium acetate solution (pH=5.5)
were mixed with 20 µl of the enzyme solution and incubated at 37°C overnight.
Resorufin formation rates were calculated from the slope of the regression line of the
concentration-time curve.
3.2.4.5 Gene expression and Western blot analysis
Gene expression and Western blot analysis were performed by Dr. Emma Fairhall
(University of Newcastle) as previously described.172 Details of DNA oligonucleotide
sequences employed in RT-PCR or PCR genotyping and primary antibodies used can be
found in Table 6 and Table 7 respectively. In addition to bioreactor samples, RNA from
freshly isolated primary rat hepatocytes and rat pancreas (kindly provided by
Pharmacelsus, Saarbrücken, Germany) and B-13 and B-13/H cells cultured in 2D flasks
as described before in 3.2.1.1 was investigated for comparison.
3.2.4.6 Immunohistochemical analysis of tissue from 3D bioreactors
Upon termination of bioreactor cultures, cell material was retrieved from the cell
compartment for immunohistochemical staining. The cell material (including
capillaries) was fixated using 4% formaldehyde buffer, stepwisely dehydrated (50%,
70%, 80%, 96%, 100% EtOH and 100% Paraclear) and embedded in paraffin.
3. Material and methods
43
Thereafter slides of 3-4 µm of thickness were prepared. Afterwards, slides were
deparaffinised (100% Paraclear) and re-hydrated (100%, 96%, 80%, 70% EtOH). For
antigen retrieval slides were covered with citrate buffer (3.1.10) and heated in a pressure
cooker for 15 minutes. Afterwards blocking buffer (3.1.10) was applied for one hour to
reduce unspecific binding. Double staining was performed using monoclonal mouse in
combination with polyclonal rabbit or chicken antibodies, which were diluted in
blocking buffer. The corresponding secondary antibodies contained Alexa
fluorochromes for fluorescence detection at 488 nm or 594 nm wavelength (excitation).
Each incubation step was performed for one hour at room temperature. Between each
incubation step the slides were rinsed three times with PBS. Primary and secondary
antibodies were employed as described in Table 7. Counterstaining of nuclei was
performed using bisBenzimide H 33342 trihydrochloride (Hoechst) according to the
manufacturer´s instructions. After completion of the staining procedure slides were
mounted with Aqua Polymount solution and analysed with a fluorescence microscope.
Unspecific staining was excluded by performance of negative controls omitting the
primary antibody (no primary antibody control).
3.2.5 Statistical evaluation
Each experiment was performed three times with cultures from different cell passages
(B-13 or H14 cells) or donors (ppL) if not indicated otherwise. Values are shown as
means ± SEM, if not otherwise indicated. Changes over time in bioreactor experiments
with B-13 cells were compared using multivariate analysis of variance (MANOVA)
with the two approaches (B-13/HT and B-13/HP) as inter-subject variables. Two-sided
p values ≤ 0.05 are considered significant. No Bonferroni correction was performed.
SPSS 21 was used for statistical calculation.
4. Results and discussion
44
4 Results and discussion
4.1 Evaluation of trans-differentiation of B-13 cells and
maintenance of B-13/H cells in 2 ml analytical-scale
bioreactors
In the first part of the study, the trans-differentiation of B-13 cells into hepatocyte-like
cells (B-13/H) and their functional performance in the bioreactor culture system were
investigated using 2 ml analytical bioreactors. In the first approach, undifferentiated B-
13 cells were trans-differentiated in bioreactors by dexamethasone addition over 8 or 15
days (group B-13/HT). To evaluate the maintenance of functional characteristics under
3D culture conditions, pre-differentiated B-13/H cells were cultured in parallel
bioreactors over 15 days (group B-13/HP). The efficacy of trans-differentiation and the
cell performance were assessed by determination of functional parameters in the
bioreactor perfusate, including synthesis of glucose, lactate, urea and albumin. CYP1A1
activity and product conjugation by phase II enzymes were assessed by analysis of 7-
ethoxy-resorufin metabolism. The reorganization grade of the cells in the bioreactor cell
compartment and the distribution pattern of typical hepatocyte markers were analysed
by immunofluorescence. In addition, PCR analysis was performed to determine the
mRNA expression of liver-typical proteins.
4.1.1 Assessment of metabolic activity and liver specific-functions in
bioreactor cultures
Bioreactor cultures of B-13 cells subjected to trans-differentiation (B-13/HT) showed a
significant increase in glucose consumption (p = 0.029) during first three days. Those,
inoculated with cells pre-differentiated prior to seeding into the bioreactor (B-13/HP)
showed an increase in glucose (p = 0.005) and lactate (p = 0.009) metabolism until day
6 followed by stable rates. Both groups showed significant differences in energy
metabolism considering the overall culture period (glucose consumption: p = 0.001;
lactate production: p < 0.001), but no significant difference between both groups was
observed at the end of culture time (glucose consumption: p = 0.609; lactate production:
p = 0.691) (Figure 9).
4. Results and discussion
45
Figure 9: Energy metabolism in B-13/H bioreactor cultures.
Glucose consumption (A) and lactate production (B) in 3D multi-compartment bioreactors with
B-13 cells subjected to trans-differentiation in the bioreactor (B-13/HT / dotted line) or with
pre-differentiated B-13/H cells (B-13/HP / solid line) over a time period of 15 days. Values
were calculated as rates per 106 cells. Comparisons concerning changes over time were
performed using multivariate analysis of variance (MANOVA) with the two approaches as
inter-subject variables. Two-sided p values ≤ 0.05 are considered significant. Significant
changes over time are marked as bars enclosing respective time intervals. (n=3, means ± SEM)
The release of intracellular enzymes (ALT, AST, GLDH and LDH) was analysed in
bioreactor perfusates to detect potential cell damage in the cultures (Figure 10). ALT
and AST levels showed in both approaches a slight, yet significant increase during the
culture period (p = 0.028 and p < 0.001), while GLDH only significantly increased in
the B-13/HP group from day 9 to 15 (p = 0.045). Release rates of ALT were
significantly different in both groups (p = 0.026). The levels of LDH activity were
constant with no significant increase (p = 0.635) over the culture period, with slightly
higher enzyme release rates in B-13/HP in comparison to B-13/HT.
4. Results and discussion
46
Figure 10: Cell integrity in B-13/H bioreactor cultures.
Enzyme release of ALT (A), AST (B), GLDH (C) and LDH (D) in 3D multi-compartment
bioreactors with B-13 cells subjected to trans-differentiation in the bioreactor (B-13/HT / dotted
line) or with pre-differentiated B-13/H cells (B-13/HP / solid line) over a time period of 15
days. Values were calculated as rates per 106 cells. Comparisons concerning changes over time
were performed using multivariate analysis of variance (MANOVA) with the two approaches as
inter-subject variables. Two-sided p values ≤ 0.05 are considered significant. Significant
changes over time are marked as bars enclosing respective time intervals. (n=3, means ± SEM)
4. Results and discussion
47
Figure 11A-B shows the course of urea and albumin concentrations in bioreactor culture
supernatants. Urea production in B-13/HT bioreactors showed an increase, though not
significant, until day 3 after dexamethasone induction and declined afterwards. In B-
13/HP bioreactors urea production increased significantly until day 6 (p = 0.043)
followed by a slight decrease to a stable level for the remaining culture time with no
significant changes in production rates. In total B-13/HP showed significantly higher
production rates than B-13/HT (p = 0.012). Albumin synthesis showed a tendency,
though not significant (p = 0.365), towards increase from day 7 in B-13/HT bioreactors
with a peak on day 10, while B-13/HP showed a maximum in albumin synthesis on day
3 followed by a slight, yet not significant (p = 0.175) decline. Both groups showed
different albumin production rates considering the overall culture time, although the
difference was not significant (p = 0.081). Ammonia release showed a similar course as
urea production in both groups, with a significant increase until day 6 in B-13/HP
cultures (p = 0.042) and rather stable values thereafter with no significant changes.
Similarly, ammonia levels in B-13/HT increased during the first days, although not
significant (p = 0.106), and slowly declined to ammonia levels comparable to B-13/HP
cultures until the end of culture (Figure 11C). B-14/HT showed significantly higher
ammonia release rates as compared with B-13/HP (p = 0.001). Amylase release
characteristic for pancreas exocrine cells also significantly increased over the first week
of culture (p < 0.047) in the B-13/HT group and stayed stable thereafter with no
significant changes. Initial values for amylase release were lower for B-13/HP
compared to B-13/HT and did not significantly change over the culture period
(p = 0.11) (Figure 11D). Amylase release rates were significantly different between
both groups during bioreactor culture (p = 0.022).
4. Results and discussion
48
Figure 11: Liver- and pancreas-specific marker expression in B-13/H bioreactor cultures.
Production rates of urea (A), albumin (B) and release rates of ammonia (C) and amylase (D) in
3D multi-compartment bioreactors with B-13 cells subjected to trans-differentiation in the
bioreactor (B-13/HT / dotted line) or with pre-differentiated B-13/H cells (B-13/HP / solid line)
over a time period of 15 days. Values were calculated as rates per 106 cells. Comparisons
concerning changes over time were performed using multivariate analysis of variance
(MANOVA) with the two approaches as inter-subject variables. Two-sided p values ≤ 0.05 are
considered significant. Significant changes over time are marked as bars enclosing respective
time intervals. (n=3, means ± SEM)
4.1.2 Ethoxyresorufin-O-deethylase (EROD) activity of trans-
differentiated B-13 cells in the bioreactor system
CYP1A1 dependent deethylation of ethoxyresorufin was analysed on day 1, day 8 and
day 15 by detection of the fluorescent product 7-hydroxyresorufin. In both bioreactor
groups (B-13/HT and B-13/HP), formation rates of non-conjugated (phase I) and
conjugated (phase II) 7-hydroxyresorufin could be measured from day 1 to day 15, with
phase I+II showing a significant increase (phase I: p = 0.128; phase I+II: p = 0.014).
Values were significantly different between groups for phase I+II (p = 0.033) (Figure
12). B-13/HP cultures showed higher formation rates of 7-hydroxyresorufin on day 8
4. Results and discussion
49
when compared to B-13/HT (p = 0.033), although not at a significant level for phase I
(p = 0.114), while on day 15 of culture similar formation rates were observed. Cleavage
of conjugated 7-hydroxyresorufin (phase II) resulted in the detection of higher amounts
of the free product in the B-13/HP group, although not at a significant level.
Figure 12: Ethoxyresorufin-O-deethylase activity in B-13/H bioreactor cultures.
Biotransformation of 7-ethoxyresorufin in 3D multi-compartment bioreactors with B-13 cells
subjected to trans-differentiation in the bioreactor (B-13/HT / grey) or with pre-differentiated B-
13/H cells (B-13/HP / black-grey) on day 1, 8 and 15 of culture. Phase I: Formation rate of the
free product, phase I+II: Sum of formation rates of free and conjugated products. Values were
calculated as rates per 106 cells. Comparisons concerning changes over time were performed
using multivariate analysis of variance (MANOVA) with the two approaches as inter-subject
variables. Two-sided p values ≤ 0.05 are considered significant. Significant changes over time
are marked as bars enclosing respective time intervals. (n=3, means ± SEM)
4.1.3 Gene expression and protein analysis of hepatocyte-specific genes in
trans-differentiated B-13 cells
The expression of hepatic and pancreatic markers at the mRNA and protein levels was
investigated in B-13/HT on day 8 and 15 and in B-13/HP on day 15 in comparison with
B-13 cells and B-13/H cells cultured in 2D flasks, as well as rat pancreatic tissue and
primary rat hepatocytes (Figure 13).
The expression of genes encoding liver-specific CPS-1 and albumin was similar in the
experimental groups B-13/HT and B-13/HP as in 2D cultured B-13/H cells, but lower as
compared to primary hepatocytes (Figure 13A). The expression of CYP2E1 and also of
CYP2C11 specific for male rats could be demonstrated for B-13/HT, while B-13/HP
cultures showed expression of CYP2E1, but not of CYP2C11, similar to B-13/H cells
cultured under 2D conditions. The expression of liver-specific markers increased from
day 8 to day 15 in B-13/HT bioreactors. Amylase mRNA transcripts characteristic for
exocrine pancreas cells were expressed in B-13/HT and B-13/HP cultures at a similar
4. Results and discussion
50
level as in B-13/H cells maintained in 2D cultures, but its expression was lower than in
native rat pancreas or undifferentiated B-13 cells.
Western blot analysis (Figure 13B) showed a weaker expression of CPS-1, albumin and
CYP2E1 in B-13/HT or B-13/HP bioreactors than in primary rat hepatocytes, while
CYP3A expression was comparable to that of primary cells. The expression of liver-
specific markers (albumin, CPS-1, CYP2E1 and CYP3A) was similar to that of B-13/H
cells generated in 2D culture. Amylase expression was comparable to B-13 and B-13/H
cells, with a lower intensity than in pancreatic tissue in all approaches. In accordance
with results from PCR analysis, an increase of liver-specific markers and a decline of
pancreatic amylase between day 8 and day 15 of culture were observed.
Figure 13: Gene and protein expression of B-13/H bioreactor cultures.
Analysis of hepatocyte-specific markers via RT-PCR and Western blot in 3D multi-
compartment bioreactors with B-13 cells subjected to trans-differentiation in the bioreactor (B-
13/HT, day 8 and 15) or with pre-differentiated B-13/H cells (B-13/HP, day 15) compared to B-
13 or B-13/H cells cultured in 2D, primary rat hepatocytes and rat pancreas tissue. (A) RT-PCR
for the indicated transcripts and RT control amplification in the absence of input RNA. (B)
Western blot of the indicated proteins.
4. Results and discussion
51
4.1.4 Immunohistochemical characterization of B-13 cells in the bioreactor
Immunofluorescence staining of liver- and pancreas-specific markers was performed in
B-13/HT bioreactors on day 8 and 15 and in B-13/HP cultures on day 15 and compared
to tissue of rat pancreas and liver (Figure 14). Double-staining was performed using
antibodies against pancreas-specific amylase in combination with antibodies against
various liver-specific marker antigens (Table 7).
Amylase was observed only in a few cells in B-13/HT and B-13/HP cultures on day 15.
In B-13/HT bioreactors a decrease was detected from day 8 to day 15.
The liver-specific markers albumin, CK18 and CCAAT/enhancer-binding protein
(CEBP-β), a marker of early liver development, showed a similar distribution in B-
13/HT (day 15) and B-13/HP bioreactors. An increase in expression of these markers
between day 8 and day 15 was observed in B-13/HT, indicating progression of trans-
differentiation. CYP2E1 showed a higher expression in B-13/HT cultures than in B-
13/HP cultures, while positive staining for multidrug resistance-associated protein 2
(MRP2), an apical membrane transporter found in primary hepatocytes, was only
observed in B-13/HP bioreactors.
Native rat and liver tissue investigated for comparison showed the typical expression of
specific markers. Rat liver tissue showed albumin, CK18, CYP2E1 and MRP2 positive
cells but no amylase, whereas rat pancreas tissue strongly expressed amylase, but no
CYP2E1, albumin or CEBP-β. Cytokeratin 18 showed immunoreactivity in some cells
of pancreatic tissue, probably associated with pancreatic duct epithelia. Negative
controls (no primary antibody control) showed no unspecific staining by secondary
antibodies (Figure 14/row 6).
4. Results and discussion
52
Figure 14: Immunohistochemical analysis of tissue retrieved from bioreactor cultures.
Immunohistochemical analysis of hepatic and pancreatic markers in B-13 cells trans-
differentiated in the bioreactor system (B-13/HT) over 8 (A) or 15 (B) days, B-13/H cells
cultured in the bioreactor system for 15 days (B-13/HP, C), native pancreas (D), and native liver
(E) in 400x magnification. Amylase positive cells are shown in green and markers characteristic
for the liver are shown in red. Row (1) shows amylase and CYP2E1, row (2) amylase and
albumin, row (3) amylase and CK18, row (4) amylase and CEBP-β, and row (5) amylase and
MRP2 immunoreactivity. Row (6) shows negative controls (no primary antibody control).
Counterstaining of nuclei was performed with Hoechst staining (blue).
4. Results and discussion
53
4.1.5 Chapter discussion
The B-13 cell line has shown to be a potential candidate capable of providing a donor-
free supply of functional hepatocyte-like cells in an up-scaled manner without the
requirement of intensive culture requirements using simple cost effective culture
medium supplemented with glucocorticoids and short proliferation time (doubling time
of 30±7.3 hours).76,118–120 The majority of B-13 cells convert to liver-like B-13/H in
response to glucocorticoid exposure providing yields of up to 95%. Therefore this cell
source shows an advantage in producing large cell numbers in a quite pure population
of functional hepatocytes with relative low effort and expense. Additionally, the B-13/H
phenotype gained can be maintained for several weeks in culture, in contrast to primary
hepatocytes which rapidly de-differentiate in 2D cultures requiring more complex
culture conditions.76,77,173 Since the 3D multi-compartment bioreactor culture system
used in this study showed successful liver cell cultivation for application in
extracorporeal liver support89,145,146 or analysis of drug metabolism in small-scale
systems77,97,149,150 the suitability of the technology to support hepatic trans-
differentiation of B-13 cells was investigated in the present study. Previous experiments
with other cell types (e.g. primary human hepatocytes or human embryonic stem cells)
seeded into the bioreactors had demonstrated that the cells do not only adhere to the
artificial capillaries, but also to each other.149,174 In another experiment B-13 cells were
cultured in suspension by seeding them in plastic dishes coated with poly-
2hydroxyethylmethacrylate (P2HEMA), which prevents attachment of the cells to the
surface.175,176
In this study, cells were treated with or without dexamethasone to investigate trans-
differentiation behaviour in designed state. Experiments resulted in aggregation of
undifferentiated B-13 as well as trans-differentiated B-13 cells (B-13/H) showing liver-
specific marker expression (e.g. albumin, CPS1, CYP2E1). Furthermore, clusters
without evolving necrotic centres were formed. Suspension cultures showed suppressed
proliferation upon glucocorticoid exposure similar to 2D cultures.176 Conducted
experiments encouraged culturing these cells in the 3D high density bioreactor system
to investigate if it is suitable to support trans-differentiation of B-13 cells (B-13/HT)
and to maintain the hepatocyte-like phenotype of pre-differentiated B-13/H cells (B-
13/HP). Since proliferation is suppressed but not stopped when dexamethasone is
applied to the B-13 culture medium different cell densities used for bioreactor
inoculation of the two different approaches had to be used.172 Due to analysis of
proliferation in B-13 suspension culture experiments a 2.5 fold gain in cell mass during
14 days of bioreactor culture was estimated.176
Monitoring of metabolic parameters in bioreactor perfusate showed successful culture
of B-13 or B-13/H cells in the system. B-13/HT and B-13/HP showed similar glucose
4. Results and discussion
54
consumption and lactate production rates with an increase in lactate production during
the first days and stable metabolism afterwards. The lower initial production of lactate
could be due to adaptation of the cells to the culture environment. Increasing lactate
values at the beginning could be a sign of cell proliferation to fill out the space due to
lower inoculation cell density in B-13/HT. Interestingly, glucose/lactate metabolism of
B-13/HT approximated that in B-13/HP at the end of the culture period. This indicates
that a comparable cell number and metabolic status was attained in both groups after 15
days supporting the estimated proliferation rate of 2.5 over the culture duration in B-
13/HT used as a basis of data calculation.
The analysis of enzyme release (ALT, AST, GLDH and LDH) in bioreactor perfusates
as indicators for possible cell damage,77,149,153 showed a continuous increase, although at
low levels, in parallel with increasing metabolic activity, which can be interpreted as
necrosis of a small proportion of cultured cells during cell growth (B-13/HT) and trans-
differentiation. No drastic peaks in enzyme release were observed over the entire culture
period indicating no harmful stress to the cells.
Production of albumin, the most abundant protein produced by hepatocytes, was
detected in both approaches with a maximum in the first week in the pre-differentiated
cultures (B-13/HP) and in the second week in cultures trans-differentiated in the 3D
bioreactor (B-13/HT), demonstrating successful induction of hepatic protein synthesis
upon dexamethasone exposure. Furthermore, stable production of urea, generated by
hepatocytes for nitrogen elimination via the urea cycle, was monitored over the culture
period in bioreactor perfusates. The finding of lower urea concentrations in B-13/HT
than in B-13/HP cultures suggests lower activity in cultures subjected to trans-
differentiation within the 3D bioreactor. This is supported by the results from ammonia
measurements, which show a correlation of ammonia release with urea secretion,
indicating insufficient ammonia detoxification via the urea cycle. To enhance urea
formation, stimulation of the urea cycle, e.g. by addition of N-carbamoyl-glutamate
could be tested, which has been successfully used for improving the differentiation state
of HepaRG cells.175,177
Amylase, characteristic for exocrine pancreas cells, is typically expressed by
undifferentiated B-13 cells.76 Increasing rates of amylase as reported for B-13/H cells
during trans-differentiation of B-13 cells119 could be observed in B-13/HT bioreactor
cultures after addition of 10 μmol/l dexamethasone to the culture medium. The decrease
of amylase release observed in bioreactor cultures of B-13/HP and B-13/HT in the
second week of culture indicates a decrease of pancreas-specific characteristics in the
cultures.
As a further functional parameter, the expression and activity of CYP isoenzymes,
which are responsible for hepatic xenobiotic metabolism (phase I reaction), were
4. Results and discussion
55
assessed. Formation of 7-hydroxyresorufin from 7-ethoxyresorufin, a known CYP1A1
substrate,178 was detected in both bioreactor groups, with B-13/HP bioreactors showing
higher formation rates than B-13/HT cultures on day 8, but comparable values on day
15. Furthermore, the ongoing rise of phase I + II metabolism between day 1 and day 15
in B-13/HT cultures indicated ongoing progression of trans-differentiation in these
cultures. Thus, further prolongation of the trans-differentiation period could be useful to
increase CYP activities even further.
The analysis of mRNA expression (RT-PCR) and protein expression (Western blot)
confirmed successful differentiation of B-13 cells to hepatic B-13/H cells in the
bioreactor culture system. The expression of hepatocyte-specific markers previously
described for B-13/H 2D cultures111,118 was maintained at both the mRNA and protein
expression level. The CYP isoenzymes CYP2E1, CYP3A1, and CYP2C11, typical for
rat liver179 could be detected. Furthermore, mRNA transcript levels of albumin and of
CPS-1 were comparable in B-13/HT and B-13/ HP to primary hepatocytes. Expression
of albumin and CPS-1 proteins was also detected, though in low levels. CPS-1 is an
important enzyme involved in the urea cycle and its expression in B-13/HT and B-
13/HP on gene and protein levels further confirms urea production via the urea cycle.
However it cannot be excluded that part of the observed urea release is produced via
hydrolysis of arginine by arginase as described for human liver cell line C3A.35,94
Immunohistochemical staining showed the formation of 3D cell clusters in bioreactor
cultures and confirmed the hepatic differentiation of B-13 cells in the 3D bioreactor
culture system in that there was a loss in expression of amylase and an increase in
hepatocyte-specific markers. CYP2E1 and albumin expression confirmed the results of
gene expression and Western blot analysis. In addition, cells positive for CK18, a
marker for liver epithelial cells,77 as well as expression of MRP2, a major canalicular
transporter responsible for biliary elimination of drugs in hepatocytes180 indicate a liver-
like phenotype of B-13/H cells in the bioreactor cultures. Further, activation of CEBP-β
shows the involvement of this transcription factor in generating liver-like tissue,
according to results from other studies.119
In conclusion, the studies show successful hepatic trans-differentiation of B-13 cells as
well as stable maintenance of B-13/H cells over two weeks in the bioreactor. Significant
improvement of hepatic differentiation in 3D as compared with 2D cultures could not be
demonstrated in our study. However some liver markers, e.g. CPS-1 and albumin, while
showing lower expression in suspension cultures than in 2D cultures, showed at least
equal expression in bioreactor cultures of pre-differentiated (B-13/HP) or trans-
differentiated (B-13/HT) cells. In both 2D and 3D culture systems B-13/H cells do not
attain the functionality of native hepatocytes. These results suggest that trans-
differentiation takes more time in 3D configuration but liver functions may be preserved
4. Results and discussion
56
much longer. Additionally improvement of this cell line may need further genetic
modification. For example expression of metabolically functional human CYP1A2 was
achieved by introducing the corresponding gene into the cells.121 If approaches for
improvement are successful, B-13 cells could provide a cost-effective, plenty available
cell source for larger scale in vitro studies, if improved hepatic maturation and human is
achieved. Moreover, the use of B-13/H cells in the described 3D bioreactor system
would be an option for clinical liver support therapy, since these cells do not show
engraftment in soft tissue reducing the risk of tumour formation in the body, if cells are
transferred into the patient´s blood circulation.118
4. Results and discussion
57
4.2 Sensor integration and evaluation for clinical application
In this part of the study multi-parametric sensors integrated in the 8 ml analytical-scale
bioreactor system were established and evaluated. At first the biocompatibility of the
integrated online sensors was investigated followed by evaluation of the sensor
performance during bioreactor culture. B-13/H cells or ppL were used as model cell
types to investigate points of interest. For monitoring the cell response to toxic stress
occurring during exposure to toxic plasma from acute liver failure patients, B-13/H
bioreactor cultures were treated with the reference substance methapyrilene, which has
been shown to exert rat hepatocytes and trans-differentiated B-13 cells. Primary porcine
liver cells (ppL) cultured in 8 ml bioreactors were treated with APAP as a drug with
known hepatotoxicity for humans for validation of the sensor-based monitoring system.
4.2.1 Investigation of the efficiency of multi-parametric sensors for quality
assessment of bioreactor cultures
To evaluate multi-parametric sensors integrated in the bioreactor system, the
biocompatibility, functionality and sensitivity of the used sensors were investigated. For
these purposes two 8 ml analytical-scale bioreactors equipped with oxygen, pH,
ammonia and impedance sensors were inoculated with B-13 cells. The cultures were
subjected to trans-differentiation by applying dexamethasone after an adaption phase of
24 hours. In order to detect possible effects of sensors on the cell viability and function,
data from sensor-equipped bioreactors were compared with those from a bioreactor run
in parallel without sensors. In addition to sensor-based online parameters, a number of
offline parameters were measured daily (release of ALT, AST, GLDH, LDH, ammonia
and amylase, glucose consumption, production of lactate, urea and albumin, pH value,
oxygen concentration). Cultures were conducted over 15 days. An EROD activity assay
was performed on day 1, 8 and 15. Upon termination bioreactor tissue material for
immunohistochemical investigation was retrieved. Figure 15 shows the experimental
set-up of the bioreactor system with integrated sensors and corresponding measuring
devices.
4. Results and discussion
58
Figure 15: Experimental set-up of the bioreactor system for non-invasive, sensor-based
monitoring of system functions and culture parameters.
Impedance measuring device with data analysis software (Fraunhofer IBMT) (a). Perfusion
device holding an 8 ml analytical-scale bioreactor (Stem Cell Systems) with integrated
impedance sensors (Fraunhofer IBMT) and pH and oxygen sensors (PreSens-Precision Sensing
GmbH) integrated into the tubing system of the recirculation circuit (b). Perfusion parameters
are set via an external computer unit (c). Online ammonia sensor and ammonia readout device
(CEA-Leti-France) (d).
4.2.1.1 Comparison of metabolic offline parameters in bioreactor cultures
with or without multi-parametric sensors
Measured offline parameters including glucose, lactate, enzyme leakage (ALT, AST,
GLDH and LDH), urea, albumin, ammonia, amylase and CYP1A1 dependent
conversion of ethoxyresorufin in bioreactor cultures with or without integrated sensors
showed a similar performance as previously evaluated in B-13/HT and B-13/HP
bioreactor cultures (4.1.1 and 4.1.2). No difference in marker detection could be found
between groups when immunofluorescence staining of liver- and pancreas-specific
markers was performed. Bioreactor tissue in both groups expressed cells positive for
amylase, characteristic for pancreas or B-13 cells, and also cells showing liver-specific
marker expression (albumin, C/EBP β, CK18, CYP2E1 and MRP2) as previously
described (4.1.4).
4.2.1.2 Evaluation of sensor-based oxygen and pH measurement in the
bioreactor system
Online sensor-based monitoring of oxygen and pH was compared with offline analysis
of these parameters to assess the comparability and sensitivity of the methods. Oxygen
concentrations in the circulating medium of bioreactors with B-13 cells showed a
continuous decrease over 15 days of culture. Offline measurement by means of a blood
gas analyser (ABL) was comparable between bioreactors with or without integrated
4. Results and discussion
59
sensors. Absolute values measured online via flow-through sensors (PreSens-Precision
Sensing GmbH) were lower than offline values, but the course of oxygen levels was
similar to offline measurement (Figure 16A).
Comparison of online and offline pH measurement also revealed generally lower
absolute values for online measurements, while both measurement methods showed a
similar time-course of pH values (Figure 16B). After an initial fluctuation during the
adaption phase, stable pH was maintained until the end of culture. An outlier for pH
online sensor was detected on day 11 showing temporary lower values which recovered
on the next day.
Figure 16: Offline versus online measurement of oxygen (A) and pH values (B) in an 8 ml
analytical-scale bioreactor.
B-13 cells were trans-differentiated in 8 ml analytical-scale bioreactors over 15 days. Sensors
for online measurement for oxygen and pH (PreSens-Precision Sensing GmbH) were integrated
in two bioreactors (red) and data were compared to values obtained from offline measurement
via blood gas analyser (blue) of daily samples. Graphs show mean values of two experiments.
4.2.1.3 Evaluation of ammonia sensors in the bioreactor system
Two ammonia sensors for online measurement were integrated each into outlet lines of
two 8 ml analytical-scale bioreactors. Bioreactors were run with B-13 cells subjected to
trans-differentiation and ammonia was continuous measured from day 10 (completion
of trans-differentiation) until the end of culture on day 15. Every sensor was integrated
in a flow-through cell (Figure 17) and mounted at the medium outlet line of the tubing
system. Sensors were calibrated using different concentrations of NH4Cl before and
after sensor integration to check their functionality, and they were flushed with fresh
culture medium prior to use. Additionally, one bioreactor (Bioreactor 01) received a
true reference electrode, whereas for the second bioreactor (Bioreactor 02) a pseudo-
reference electrode was used. Electrical potential curves were generated for each
bioreactor using the readout device and compared with offline measured ammonia
4. Results and discussion
60
concentrations. Analysis and plotting of received data was accomplished by the
cooperation partner CEA-Leti-France.
Figure 17: Individual ammonia sensor integrated in a Luer-Lock T-connector (CEA-Leti-
France).
The sensor is composed of a PVC cavity containing an internal electrolyte solution, a working
electrode, which is connected to the readout device. The cavity is sealed with an ammonium
sensitive membrane, which stays in contact with the culture medium. The ammonia sensor is
integrated in a three-way valve.
At the beginning of ammonia measurement sensors detected an increase of potential
when sensors got in contact with culture medium flowing out from the bioreactor
circuit. In the following, stable values were maintained until culture termination (Figure
18).
Figure 18: Ammonia sensor potential performance at the beginning of online
measurement.
Electrical potential development is shown at the beginning of ammonia measurement for sensor
3 and 4 of bioreactor 02 on culture day 10 for 83 min. Initially sensors were flushed with fresh
culture medium and needed a transition time of approx. 1000 s to adapt to bioreactor culture
medium. Analysis and plotting of received data was accomplished by the cooperation partner
CEA-Leti-France.
4. Results and discussion
61
Monitoring of ammonia concentration in culture perfusates measured online or offline is
shown in Figure 19. After filtering interferences, which regularly occurred, monitoring
of ammonia concentrations in bioreactor 01 (Figure 19A) showed no potential variation
for Sensor 1. In contrast Sensor 2 showed comparable performance in potential
detection when compared to the performance of offline ammonia concentrations
measured in daily samples in the clinical laboratory. Sensor 2 recorded some
oscillations on culture day 11. Sensors 3 and 4 used in the bioreactor 02 showed a
similar performance of electric potentials (Figure 19B). After a short increase at the
beginning of ammonia measurement values slowly declined until day 13. Thereafter a
strong increase in potentials could be observed while offline measured ammonia
concentrations remained relatively stable.
Figure 19: Comparison of online and offline measurement of ammonia in bioreactors with
B-13 cells.
4. Results and discussion
62
B-13 cells were trans-differentiated in two 8 ml analytical-scale bioreactors over 15 days. From
day 10 on (completion of trans-differentiation) ammonia concentrations were measured either
online via sensors in outlet lines of bioreactor tubing system or offline in daily samples from the
bioreactor perfusates. Sensor performances for online measurement (blue and brown lines) of
ammonia were compared to offline measurement (green lines). Analysis and plotting of
received data was accomplished by the cooperation partner CEA-Leti-France.
4.2.1.4 Evaluation of impedance sensors in the bioreactor system
The time-course of impedance signals was investigated in two 8 ml analytical-scale
bioreactors cultured with B-13 cells subjected to trans-differentiation. Figure 20
exemplarily shows the time course of impedance values in one of these bioreactors. The
individual sensors located at different sites within the bioreactor cell compartment
showed a comparable time course, although absolute values partly differed between the
sensors. Channels 1-12 describe the measurement of two electrodes directly on
impedance sensor foils comparable to the situation in 2D cultures whereas channels 13-
19 describe impedance measurements between sensor foils exhibiting rather
characteristics of a 3D environment. Channel 20 monitored the temperature
development during the experiment. During initial perfusion of the bioreactor with PBS
(day -5 to day -3) basal signals were detected, followed by a slightly increase in
impedance signal after changing to culture medium perfusion (day -3 to day 0). Cell
inoculation on day 0 caused a marked peak in impedance signals. In the majority of
measurement channels an increase of approx. 100 Ω could be observed when cells were
cultured in the bioreactor system, resulting in approximately 1000 Ω. Values decreased
to stable levels during the first five days of culture until culture termination. Channel 12
of the shown bioreactor showed higher impedance values during the whole
measurement period than the other channels, but no increase was observed after cell
inoculation. Furthermore, channel 2 and 16 showed a continuous increase in impedance
signals subsequent to cell inoculation, which persisted until day 10 (channel 16) or day
15 (channel 2). Aberrant signals observed for some of the channels indicate defect
sensors or disturbed impedance measurement (not shown).
4. Results and discussion
63
Figure 20: Impedance signal detection in an 8 ml analytical-scale bioreactor with B-13
cells.
The graph shows the time-course of impedance values in bioreactor cultures with B-13 cells
subjected to trans-differentiation. Three impedance sensor foils were integrated in the cell
compartment of the bioreactor. During the first two days (day -5 to day -3) PBS perfusion was
performed followed by three days of culture medium perfusion (day -3 to day 0). Thereafter
undifferentiated B-13 cells were inoculated and trans-differentiated over 15 days. The graph
shows 20 channels of impedance measurement in one exemplary bioreactor over the culture
time. Channels 1-12 show measurements on impedance sensor foils, channels 13-19 show
impedance measurements between impedance sensor foils and channel 20 shows temperature
measurement over time.
4.2.2 Identification of toxic drug induced cell damage in bioreactor
cultures
The culture behaviour of B-13/H cells during toxic stress was investigated in 8 ml
analytical-scale bioreactors (Figure 21). Methapyrilene was used to induce toxic stress
to B-13/H cell cultures, since trans-differentiated B-13 cells possess the CYP isoform
CYP2C11 responsible for toxic product formation from methapyrilene. Previous studies
in 2D cultures have shown that a concentration of 0.2 mmol/l of methapyilene resulted
in cell death when applied to B-13/H cells.121
Methapyrilene was successively applied in increasing concentrations to identify toxic
concentrations in 3D bioreactor cultures. Two 8 ml analytical-scale bioreactors were
inoculated with undifferentiated B-13 cells followed by 11 days of trans-differentiation
4. Results and discussion
64
using 10 µmol/l dexamethasone. On day 11, 13, 15 and 17 methapyrilene was applied at
a final concentration of 0.2, 0.4, 0.8 and 1.6 mmol/l to one of the bioreactors for six
hours, respectively. The second bioreactor was used as untreated control during this
time. Bioreactors were flushed with fresh culture medium and allowed to regenerate for
1.5 days after each toxic stress induction. The bioreactor exposed to methapyrilene
treatment was terminated on day 22, whereas the control bioreactor was treated with 0.8
µmol/l methapyrilene for validation of the toxic effect of the drug at that concentration.
During the trans-differentiation period of 11 days both bioreactors showed similar
performance in enzyme release (AST, LDH) and energy metabolism (glucose
consumption and lactate production), as shown in Figure 21. Release rates of AST
remained on basal levels over time. LDH started with increased values but declined to
basal values during the first six days and stayed stable thereafter. Glucose and lactate
decreased until day 5 followed by a continuous increase until day 11. Methapyrilene
exposure resulted in a moderate increase in AST and LDH release at a concentration of
0.8 mmol/l, and in a drastic increase of enzyme release at 1.6 mmol/l. The untreated
control bioreactor maintained stable values during toxic stress induction. Glucose
consumption and lactate production showed a similar performance in the bioreactor
treated with methapyrilene and in the untreated control bioreactor up to 0.8 mmol/l,
with the exception of slight oscillations immediately after methapyrilene exposure. A
drastic decrease in glucose consumption and lactate production was observed when the
bioreactor (Bioreactor Intoxication) was exposed to 1.6 mmol/l methapyrilene and
thereafter no regeneration could be observed. In accordance with the findings from the
drug-treated bioreactor, AST and LDH release rates also increased dramatically in the
control bioreactor when induced to 0.8 mmol/l methapyrilene on day 23, while glucose
consumption and lactate production showed a prompt decrease.
4. Results and discussion
65
Figure 21: Identification of toxic methapyrilene concentrations in B-13/H bioreactor
cultures.
Enzyme leakage of AST and LDH (A) as well as glucose consumption and lactate production
(B) are shown over 22 days (black) or 28 days (orange) in B-13/H bioreactor cultures. Different
concentrations of methapyrilene (0.2, 0.4, 0.8 and 1.6 mmol/l) with an incubation time of 6
hours were successively applied on days 11, 13, 15 and 17 (dark grey) in one bioreactor (black,
Bioreactor Intoxication) with a parallel bioreactor used as a control (orange, Bioreactor
Control). After each methapyrilene treatment a regeneration phase of approx. 36 hours (light
grey) was performed. For further evaluation of methapyrilene toxicity the control bioreactor was
exposed to 0.8 mmol/l methapyrilene on day 23.
To investigate the suitability and sensitivity of multi-parametric sensors (oxygen,
ammonia and impedance) to detect toxicity in response to methapyrilene exposure in B-
13/H bioreactor cultures two analytical-scale bioreactors were identically prepared. A
concentration of 2 mmol/l methapyrilene was chosen based on dose-finding
experiments to ensure detectable stress by integrated non-invasive online sensors. After
14 days of trans-differentiation one of the bioreactors was exposed to methapyrilene for
24 hours whereas the second bioreactor was used as an untreated control. Intoxication
was followed by flushing the bioreactors to wash out residual toxic products.
Afterwards bioreactors were set in standard perfusion mode with medium recirculation
and continuous feed. To validate the results from the drug-treated bioreactor, the control
bioreactor was also exposed to 2 mmol/l methapyrilene after termination of the first
bioreactor, i.e. on day 17 and 18. Drug incubation was performed for 2.5 h each to
detect potential cell regeneration between the drug applications.
The time-courses of offline parameters during the experiment are described in Figure
22. Enzyme release rates and rates of glucose and lactate metabolism showed a similar
course as previously described until day 14. Methapyrilene exposure resulted in a
temporary increase in AST and LDH release, which declined afterwards to almost zero.
4. Results and discussion
66
Glucose and lactate metabolism decreased to zero after 2 mmol/l methapyrilene was
introduced to the bioreactor culture, whereas the control bioreactor was unaffected.
During intoxication of the control bioreactor on day 17 and 18, a similar reaction to
methapyrilene in enzyme release and energy metabolism was observed, confirming the
results from the first bioreactor. No indications for cell regeneration could be detected
between methapyrilene applications. Intoxication on day 18 did not intensify the effect
on enzyme release and energy metabolism.
Figure 22: Enzyme release and energy metabolism in B-13/H bioreactor cultures treated
with toxic doses of methapyrilene.
AST and LDH leakage (A) as well as glucose consumption and lactate production (B) are
shown over 17 days (red) or 21 days (blue) of B-13/H bioreactor cultures. The bioreactor treated
with 2 mmol/l methapyrilene on day 14 (red, Bioreactor Intoxication) was observed over 17
days and the control bioreactor over 21 days (blue, Bioreactor Control). For validation of the
toxic stress response the control bioreactor was exposed to 2 mmol/l methapyrilene on day 17
and 18 each.
Monitoring of B-13/H bioreactor cultures using multi-parametric sensors resulted in
recording signals in response to toxic methapyrilene induction for integrated sensors
respectively.
Oxygen concentration in the circulating medium (Figure 23) continuously decreased
during trans-differentiation of B-13 cells over 14 days in both bioreactors. Some short-
time increases or decreases could be detected during this phase, which are probably due
to temporary air bubbles disturbing optical-chemical sensor measurement. Application
of 2 mmol/l methapyrilene for 24 h on day 14 resulted in a rapid increase in oxygen
concentration until day 17 indicating a decrease in oxygen consumption by the cells, in
consistence with the observed decrease in glucose metabolism. In contrast, the control
bioreactor was not affected. However, an increase in oxygen concentration was shown
4. Results and discussion
67
in the control bioreactor after exposure to 2 mmol/l methapyrilene on day 17 and 18
supporting the findings from the first bioreactor.
Figure 23: Online monitoring of oxygen concentrations in B-13/H bioreactor cultures
exposed to 2 mmol/l methapyrilene.
One bioreactor (red, Bioreactor Intoxication) was treated with 2 mmol/l methapyrilene on day
14 (arrow) and observed over 17 days, whereas the control bioreactor (blue, Bioreactor Control)
was continued until day 21. For validation of the toxic stress response the control bioreactor was
applied to 2 mmol/l methapyrilene on day 17 and 18 (arrows).
Concentrations of ammonia in bioreactor culture perfusate (Figure 24) were measured
offline as well as online, using an improved ammonia sensor (see 3.2.2.3). Both
bioreactors showed a slight but continuous increase for online sensor measurement
during 14 days of trans-differentiation whereas the electrical potential increase was
more pronounced in the intoxication bioreactor as compared to the control bioreactor.
Offline values of ammonia increased until day 5 and remained stable until day 15.
Application of 2 mmol/l methapyrilene on day 15 resulted in a decline in ammonia
release, which was detected with both, offline and online measurements. Regeneration
from toxic injury was not observed thereafter. In the control bioreactor, the performance
of online sensors integrated in the tubing system was comparable with values measured
in daily samples (offline) out of bioreactor culture perfusate. Similar to the first
bioreactor, a decline during 24 h of intoxication on day 17 and 18 was observed.
Measurements of daily samples mostly showed values matching online values, except
for some fluctuations in online signals due to medium or gas leakage in the sensor
connections. In addition, data obtained by online sensors showed considerable
background noises in signal retrieval. Analysis and plotting of received data was
accomplished by the cooperation partner CEA-Leti-France.
4. Results and discussion
68
Figure 24: Online and Offline monitoring of ammonia concentrations in B-13/H bioreactor
cultures exposed to 2 mmol/l methapyrilene.
The potential obtained from online ammonia sensors (blue) and ammonia concentrations
measured offline (green) was analysed in B-13/H bioreactor cultures subjected to intoxication
on day 15 (A, Bioreactor Intoxication) or used as a control during day 15 and intoxicated on
days 17 and 18 (B, Bioreactor Control). Arrows and areas marked in dark grey indicate the
application of 2 mmol/l methapyrilene for 24 h (A) or 2.5 h (B). Thereafter, a regeneration
period was applied (shown in light grey). The red zone illustrates leakage occurring in ammonia
sensors of the control bioreactor culture on day 14. Analysis and plotting of received data was
accomplished by the cooperation partner CEA-Leti-France.
4. Results and discussion
69
Impedance signals showed an initial increase after cell inoculation (Figure 25) in both
bioreactors followed by rising values of impedance during the first 14 days of culture.
Impedance signals rapidly declined to values similar to those measured prior to cell
inoculation after application of 2 mmol/l methapyrilene to the first bioreactor on day 14
(Bioreactor Intoxication, Figure 25A / channel 1-4), while the untreated bioreactor
(Bioreactor control) showed stable impedance signals on day 14 (Figure 25B / 6-9).
This bioreactor showed a drastic decline in impedance signals when exposed to 2
mmol/l methapyrilene on day 17 and 18 for 2.5 h. Thus, a comparable response to toxin
exposure was observed in both bioreactor cultures. Repeated small signal peaks of
impedance signals correlating with daily sample taking management were detected
during the whole culture period. Further peaks were observed during flushing of
bioreactors after toxin exposure on day 14 (Bioreactor Intoxication) resp. day 17 and 18
(Bioreactor control).
Figure 25: Online monitoring of impedance in B-13/H bioreactor cultures exposed to 2
mmol/l methapyrilene.
Impedance signals were monitored during PBS perfusion prior to cell inoculation (day -2 to
day 0) and during B-13 cell culture, including 14 days of trans-differentiation followed by toxic
drug application. The first bioreactor (A, Bioreactor Intoxication) was subjected to intoxication
with 2 mmol/l methapyrilene on day 14 for 24 h (black arrow). In addition, methapyrilene was
applied to the untreated control (B, Bioreactor Control) on day 17 and 18 for 2.5 h each (black
arrow) for validation. Channels 1, 2, 6 and 7 show measurements on impedance sensor foils,
channels 3, 4, 8 and 9 show impedance measurement between different impedance sensor foils
and channels 5 and 10 show temperature measurements over time.
4. Results and discussion
70
4.2.3 Evaluation of primary porcine liver cell culture in the bioreactor
system equipped with multi-parametric sensors
To evaluate the multi-parametric sensor system in a clinical setting, ppL were
investigated in the system as an optional cell source for the establishment of a clinical-
grade bio-artificial liver. As a surrogate for toxic patient plasma, the effect of exposure
to the hepatotoxic drugs APAP and diclofenac was investigated.
4.2.3.1 Assessment of acetaminophen and diclofenac toxicity in 2D cultures
In order to identify suitable doses of APAP and diclofenac to induce a toxic stress
response in ppL, initial tests were performed in 2D cultures treated with different drug
concentrations (APAP: 5 mmol/l, 10 mmol/l, 30 mmol/l, diclofenac: 100 µmol/l,
300 µmol/l, 1000 µmol/l). Figure 26 shows morphological changes in 2D cultures of
ppL after three days of toxin exposure. The application of 5 mmol/l APAP had no
apparent effect on the cells, while 10 or 30 mmol/l APAP resulted in cell injury with
loosening of cell-cell contacts, detachment from culture plate surface and cell
disintegration. Similar effects were observed for diclofenac at a concentration of 1000
µmol/l. Analysis of metabolic parameters (Figure 27) revealed a decline in lactate
production, which increased with increasing concentrations of APAP or diclofenac over
six days of drug exposure. In accordance with findings from lactate production,
increasing ammonia release rates were observed with increasing substance
concentrations indicating increasing cell injury. In contrast to the findings from
microscopic observation, metabolic data indicate an effect of drug exposure already at
the lowest concentrations investigated, i.e. 5 mmol/l for APAP and 100 µmol/l for
diclofenac.
4. Results and discussion
71
Figure 26: Morphological alterations in ppL treated with APAP or diclofenac in 2D
culture systems.
Light microscopic pictures (Magnification 100x) of ppL exposed to APAP (left) or diclofenac
(right) at different concentrations, as compared with untreated control cultures. Cultures were
examined after three days of drug application.
4. Results and discussion
72
Figure 27: Lactate production and ammonia release in ppL treated with APAP or
diclofenac in 2D culture systems.
The metabolic performance (lactate and ammonia production) of ppL exposed to different
concentrations of APAP or diclofenac is shown over a time period of six days. Values were
calculated as rates per 106 cells.
4.2.3.2 APAP intoxication in bioreactor cultures with primary porcine
liver cells
Based on the results from 2D cultures, APAP was used to assess the effect of toxin
exposure in bioreactor cultures with integrated multi-parametric sensors. Experiments
were performed in 8 ml analytical bioreactors equipped with online sensors for
impedance, ammonia, pH and oxygen measurement. In each experiment, one bioreactor
was chosen as intoxication model whereas the second one was used as untreated
control. A concentration of 5 mmol/l APAP was chosen to enable cell regeneration after
24 h of APAP exposure. Experiments were conducted three times with cells from
different preparations.
Evaluation of primary porcine liver cell cultures in the bioreactor system (Figure 28)
showed an increase in ammonia release during 5 mmol/l APAP exposure (24 h), which
declined to levels prior to APAP application after flushing the system with fresh culture
medium. Production of urea started with increased values, which strongly declined until
day 3, followed by relatively stable values during the further culture. Control
bioreactors showed no significant increase in ammonia release during first APAP
intoxication, but during the second APAP exposure on day 6 ammonia release increased
and maintained levels until end of culture. Urea production was not influenced during
intoxication period but declined to similar levels of bioreactors subjected to 5 mmol/l
4. Results and discussion
73
APAP intoxication. Upon application of 5 mmol/l APAP, values declined further but
regenerated to values prior to APAP exposure after flushing with fresh culture medium.
Glucose and lactate production showed a stable performance during 9 days of culture
with a slow decrease for glucose until day 4. Production rates of both parameters were
reduced during intoxication and slowly regenerated thereafter. Glucose production
showed higher values in the control bioreactor than in the bioreactor treated with 5
mmol/l APAP and levels remained stable during the culture period. Lactate production
was not markedly affected by APAP exposure.
Figure 28: Performance of offline parameters during APAP application in ppL bioreactor
cultures.
Bioreactor cultures were maintained over 9 days with daily measurement of ammonia release,
urea, glucose and lactate production. One group of bioreactors (red, Bioreactor Intoxication)
were exposed to APAP at a concentration of 5 mmol/l for 24 h on day 3 and day 6 (dark grey)
followed by a regeneration phase (light grey) of two days. Untreated bioreactor cultures (blue,
Bioreactor Control) were used as a control. Graphs show means ± SEM of three independent
experiments (n=3).
Time-courses of oxygen concentrations measured online in culture perfusates are shown
in Figure 29. After cell inoculation the concentration of oxygen drastically declined
until day 1 describing values between 12-15%. Thereafter a continuously increase could
be observed until the end of culture reaching values of 19-21%. Absolute oxygen
concentrations in culture perfusates were lower in control bioreactors than in bioreactor
cultures subjected to intoxication, while the course of the oxygen curve was
comparable. No effect could be detected during exposure of 5 mmol/l APAP on day 3
and day 6.
4. Results and discussion
74
Figure 29: Online monitoring of oxygen concentrations during APAP application in ppL
bioreactor cultures.
Bioreactor cultures were maintained over 9 days with continuous measurement of oxygen
concentration in the culture perfusate. One group of bioreactors (red, Bioreactor Intoxication)
were exposed to APAP at a concentration of 5 mmol/l for 24 h on day 3 and day 6 (dark grey)
followed by a regeneration phase (light grey) of two days. Untreated bioreactor cultures (blue,
Bioreactor Control) were used as a control. Graphs show means ± SEM of three independent
experiments (n=3).
Unfortunately data of online ammonia measurement using upgraded ammonia sensors
(Figure 6) could not be used for these experiments due to occurrence of electrical
noises, which disturbed signals throughout the experiments (data not shown). The usage
of an inverter did not reduce the source of noise.
Impedance measurement showed a temporary peak during cell inoculation. Thereafter
impedance values remained rather stable until the first intoxication session. During
exposure of 5 mmol/l APAP for 24 h impedance values declined in bioreactor cultures
subjected to intoxication whereas control bioreactor cultures were unaffected. Flushing
the bioreactors with fresh culture medium at the end of APAP application resulted in a
strong increase in impedance to values similar to those detected prior to intoxication.
Toxic effects were less marked during second APAP application session on day 6. In
total a slight decrease could be observed during nine days of culture in bioreactors
subjected to intoxication, whereas impedance values of control bioreactors were stable.
Signal courses of representative impedance channels are shown in Figure 30.
4. Results and discussion
75
Figure 30: Online monitoring of impedance during APAP application in primary ppL
bioreactor cultures.
Bioreactor cultures were maintained over 9 days with continuous measurement of impedance.
One group of bioreactors (A) was exposed to APAP at a concentration of 5 mmol/l for 24 h on
day 3 and day 6 (dark grey, arrows) followed by a regeneration phase (light grey) of two days.
Untreated bioreactor cultures (B) were used as a control. Graphs show representative signal
curves of impedance channels. Channels 1-4 and 8-11 show measurements on impedance sensor
foils, channels 5, 6, 12 and 13 show impedance measurements between different impedance
sensor foils and channels 7 and 14 show temperature measurement over time.
4. Results and discussion
76
4.2.4 Chapter discussion
In order to ensure efficient and safe therapeutic application of a bio-artificial liver
device in extracorporeal liver support sessions the cell source housed in such a device
has to be closely observed before and during clinical application. To ensure patient
safety in clinical applications, system functions and culture quality parameters need to
be monitored on a regular basis to control culture conditions and ensure sufficient
metabolic activity of the cells during therapeutic use. In addition, an early prediction of
the culture quality could improve the decision about potential clinical use of the culture.
Therefore, integration of online sensors for monitoring of the cell behaviour and
perfusion conditions, would contribute to the successful and safe clinical application of
the bio-artificial liver device. In particular, non-invasive real-time monitoring methods
are of interest for culture evaluation in clinical liver support sessions.
In this part of the thesis potential online sensors for oxygen, pH, ammonia and
impedance when integrated in the bio-artificial liver device were investigated. Oxygen
sensors can give information about cell activity and can also be used to estimate cell
numbers in 3D constructs, if data on oxygen consumption of the used cell type are
available.155 Further, the determination of ammonia concentration in the culture
perfusate would be of interest since ammonia clearance represents one of the main aims
of extracorporeal liver support application.39,69 Impedance measurement describes an
option to assess the cell behaviour during culture due to the non-invasive label-free
methodology.156,157 The cell viability and proliferation activity in 2D cultures are
usually assessed by means of microscopic observation or destructive analytical methods
(e.g. cell counting in a counting chamber, quantification of DNA or live/dead
fluorescent dye staining). Such end-point analyses would require opening of the
bioreactor and are therefore not feasible during clinical application. 156,168
To ensure safe usage, possible effects of sensors intended for use in the bio-artificial
liver device were tested comparing the metabolic activity and functionality of B-13 cells
in bioreactors with or without integrated sensors (oxygen, pH, ammonia, impedance).
Results from experiments culturing B-13 cells in 8 ml analytical-scale bioreactors
confirmed previously obtained results when evaluating B-13 cell trans-differentiation in
the 2 ml analytical-scale bioreactor system (B-13/HT)(4.1). The comparison of offline
parameters (glucose and lactate metabolism, enzyme release [ALT, AST, GLDH, LDH,
amylase], production of urea and albumin or transformation of CYP1A1 substrate) in
bioreactors with or without integrated sensors showed no negative effects on cell
performance when online sensors were integrated into the bioreactor or the tubing
system. Immunohistochemical staining confirmed these observations. Thus, integration
of non-invasive online sensors for oxygen, pH, ammonia and impedance measurement
did not impair the outcome of B-13 cell trans-differentiation in 3D bioreactor system.
4. Results and discussion
77
Flow-through optical-chemical sensors integrated in the recirculation tubing were used
for oxygen and pH monitoring in bioreactor cultures due to their easy accessibility,
smooth integration into the system and stable performance. Oxygen sensors detected a
continuous decrease in oxygen concentration in the culture perfusate during B-13 cell
trans-differentiation over 15 days, which was confirmed by daily offline measurement
using a clinical blood gas analyser. Overall lower values measured via online sensors
compared to offline measurement can be attributed to sensor calibration using PBS
solution conducted by the supplier. Different compositions of culture medium used
corresponded to variances in signal manifestation. Similar, lower online pH values were
revealed compared to offline measurement during evaluation of pH online sensors due
to PBS calibration conducted by the supplier. Temporary occurrence of signal
oscillations can be ascribed to air bubble formation blocking the contact of the optical-
chemical polymer layer to the culture perfusate. As a precaution it is advisable to set
medium bubble traps in front of the optical-chemical flow-through cells to minimize the
described disturbing interference.
Since ammonia is a critical marker in ALF or ACLF, it is regularly measured during
extracorporeal liver support, e.g. via micro-diffusion apparatus or via enzymatic
methods using the reaction of GLDH or ammonium electrodes.35,60,88–90,139 The
ammonia sensor construct used in this study was made of a three-way flow-through cell
containing in one outlet the cone sized ammonia sensor. Ammonia sensors were placed
in the outlet line of the bioreactor tubing system, which represents the inlet line
conducting plasma to the patient after passing the bioreactor. Thus, measurement at this
site allows for assessment of the ammonia concentration supplied to the patient during
liver support treatment. The ammonium sensitive membrane was in direct contact with
the culture perfusate. To allow for accurate determination of actual ammonia
concentrations in the perfusate, ammonia was measured in culture perfusate from the
bioreactor and fresh culture medium, and the ammonia production was calculated based
on the difference between both values. For evaluation of online ammonia sensors, these
had to be sterilized to avoid microbial contamination. Studies performed at the
cooperation partner CEA-Leti-France showed that gamma or beta irradiation of
ammonium sensitive membranes caused uninterpretable and noisy signal detection. Hot
steam sterilization at 121°C would have harmed the ammonium sensitive membrane.
Thus, sensors were assembled under sterile conditions and flushed with 70% ethanol for
sterilization, which showed no influence on sensor performance. Since sensors were
integrated into the outlet line of the bioreactor tubing system equipped with a recoil
valve to prevent retrograde flow of the perfusate, the risk for contamination was low in
the in vitro experiments performed in this study. However, the sterilization process has
to be optimized before potential clinical use of the system.
4. Results and discussion
78
First measurements using ammonia sensors resulted in positive ammonia detection in
the bioreactor culture perfusate. In the B-13 bioreactor experiments analysed by CEA-
Leti-France the time-course of ammonia recorded with the online sensors was similar to
that of offline values analysed in samples from the culture perfusate. Critical issues of
ammonia sensors can be seen in the regular occurrence of interference in signal
detection and also in the limited detection range of approx. 1800 µmol/l. The
disturbances observed in the electric potential could be due to air bubbles on ammonium
sensitive membrane, as it was also shown for optical-chemical flow-through cells of
oxygen or pH measurement. As a solution bubble traps were integrated prior to
ammonia sensors to prevent those signal interferences. Another problem was in frequent
sensor leakages increasing the risk of microbial contamination. The sensor construct
was quite instable in its current structure suggesting an update of the design. The use of
a pseudo-reference electrode (Bioreactor 02) strongly affected the lifetime of the
ammonia sensor (approx. 3.5 days) due to induction of a drift of the electric potential,
suggesting the usage of true reference electrodes for further experiments. Therefore,
CEA-Leti-France changed the design of the ammonia sensor construct as described in
3.2.2.3, and the modified version of the sensor was investigated in the following
experiments (4.3).
For measurement of impedance to monitor changes in the cell behaviour sensor
electrodes were placed inside the cell compartment of the bioreactor. The foil-based
impedance sensors were selected due to their flexibility making the integration
procedure more practicable. First cell culture tests at the cooperation partner Fraunhofer
IBMT showed the suitability of designed foil-based impedance sensors for cell
adherence and culture (data not shown). For online measurement of impedance, sensor
electrodes were placed between the capillaries inside the cell compartment of the 8 ml
analytical bioreactor by the cooperation partner Stem Cell Systems, Berlin. Three sensor
foils were used in the 8 ml analytical bioreactor carrying 8 electrodes each, which
creates a network of 24 independent electrodes in the cell compartment. Thus
measurement of impedance variances between each sensor point was possible, with
single sensor failure being compensated by parallel measurement. Furthermore,
measurements between single sensor electrodes on different sensor foils integrated at
different locations in the cell compartment were performed to enable a better overall
evaluation of cells housed in different areas within the bioreactor. Formaldehyde gas
sterilisation was used and did not influence impedance measurement. Pilot bioreactor
experiments using B-13 cells subjected to trans-differentiation revealed that impedance
measurement can be used as a sensitive non-invasive method to observe the culture
performance in the bioreactor. Impedance measurement was capable of detecting
changes of the culture medium. Furthermore, cell inoculation was detected by strong
4. Results and discussion
79
impedance increase, probably caused by cell attachment on single sensor electrodes.
The following decline of impedance signals can be attributed to partial loss of cells due
to initial cell stress, in consistence with the observed peak in LDH release during the
first days of culture. Stable values were observed after 3 days of culture, showing
approx. 100 Ω higher impedance values compared to values prior to cell inoculation,
which indicates successful and stable adherence of a number of cells to the foils. Cell
attachment can be found in an area of around 1000 Ω whereas decreasing values
indicate cell detachment or cell damage resulting in decreased electric potentials.
Impedance sensor performance showing a constant increase could be ascribed to cell
proliferation.
Values above 106 Ω or steadily increasing can indicate sensor failure. One possibility
causing sensor failure could be defaults in the manufacturing process, e.g. encapsulation
of sensor electrodes in the polyurethane housing resulting in a strong interference of the
impedance measurement. Another critical point is the sensor connection to the
measuring device. The sensor foil has a thickness of only 20 µm to minimize possible
disturbing effects to the internal medium flow in the cell compartment. Thus, the foils
are quite fragile and bear the risk of sensor snapping. This was improved by making the
sensor ends thicker for safe connection to the adapter board. A continuous increase in
impedance signals gaining values above 1.5x103 Ω as observed in part of the bioreactors
can be due to air bubble accumulation on sensor electrodes in the cell compartment,
which can disturb impedance measurement. To avoid this effect, regular degassing of
the cell compartment should be performed.
Methapyrilene was selected as a model drug for investigating toxicity in B-13/H
bioreactor cell cultures, since it is bioactivated by CYP2C11,181 which is found to be
expressed in B-13/H cells.121 Toxicity experiments showed methapyrilene induced
stress in B-13 bioreactor cultures subjected to trans-differentiation, as previously
described for 2D cultures by Probert et al.121 Investigation of different methapyrilene
concentrations revealed toxic effects in a concentration range of 0.8-1.6 mM. Cell
damage was indicated by a strong increase in release of liver enzymes (AST, LDH) and
a decline in glucose consumption and lactate production. Enzyme levels decreased
rapidly until day 17 of culture, which can be explained by exhaustion of cytosolic
enzyme stores. Compared to 2D experiments conducted by Probert et al.121 an 8-fold
higher methapyrilene concentration was required to induce toxic stress in bioreactor
cultures. One explanation could be incomplete trans-differentiation of B-13 cells in the
bioreactor, for example due to adsorption of dexamethasone, used to induce B-13 cell
differentiation, to the bioreactor material. However, such binding processes were
excluded by comparing absolute levels of dexamethasone in bioreactor perfusates and
2D cultures.172 The trans-differentiation success of B-13 cells in the bioreactor system
4. Results and discussion
80
was shown to depend on the cell density favouring the use of lower densities.172
Furthermore, bioreactor cultures maintained for prolonged time periods revealed higher
numbers of differentiated B-13/H cells in association with higher liver-specific marker
expression, suggesting that the trans-differentiation process in the 3D environment
requires more time compared to B-13 2D cultures. This hypothesis is supported by the
finding that exposure to 0.8 mmol/l methapyrilene showed only slight effects in the
bioreactor when applied on day 15, but induced strong toxic stress upon exposure on
day 23, which indicates an increased sensitivity of the cells on day 23 due to advanced
cell maturation with higher CYP2C11 activity. Methapyrilene exposure at increased
concentrations from day 11 to day 17 showed distinct toxic stress from a concentration
of 1.6 mmol/l, as indicated by increased enzyme release and decline in glucose
metabolism.
Based on these results a concentration of 2 mmol/l methayprilene applied for 24 h in B-
13/H bioreactor cultures was chosen for the investigation of non-invasive sensor
performance during toxic stress application. Toxic stress was successfully monitored via
non-invasive sensors integrated in the bioreactor system. The application of 2 mmol/l
methapyrilene for 24 h resulted in a rapid increase in oxygen concentration indicating
decreasing oxygen uptake of the cells, which can be ascribed to cell damage leading to
impaired energy metabolism of the cells. As expected, the untreated bioreactor showed
no changes in oxygen concentration in the culture medium, as recorded by the online
sensors. The toxic effect of 2 mmol/l methapyrilene also resulted in a decrease in
ammonia production by the cells measured via online sensors, which was confirmed by
offline measurement of daily samples. During the second week the ammonia sensor in
the control bioreactor showed leakage causing drying out of the ammonia sensor, which
resulted in a drastic signal decline to a lower level. Despite of this disturbance,
intoxication on day 17 resulted in a decrease in ammonia concentration as well, which
was confirmed by offline measurement of ammonia in culture samples. Another
problem was the occurrence of background signals during potential measurement of the
ammonia sensors. Analysis of the frequency spectrum via Fast Fourier Transformation
would be an option to identify the source of electric noises. As a compromise CEA-
Leti-France added an inverter to their measurement device to avoid electrical noise for
further experiments.
Foil-based impedance measurement allowed for continuous real-time detection of
changes in the bioreactor culture after toxic methapyrilene exposure. A rapid decline in
impedance signals to values similar to those measured prior to cell inoculation was
observed upon 2 mmol/l methapyrilene application. The observed decrease could be the
result of cell detachment from the sensor electrodes and/or morphologic changes due to
apoptosis or necrosis of the B-13 cells induced by toxin exposure. No recovery in
4. Results and discussion
81
impedance signals was observed after flushing the bioreactor, indicating that cells were
irreversibly damaged by toxic methapyrilene exposure. Comparable responses to toxin
exposure were observed in the bioreactor treated on day 14 (Bioreactor Intoxication)
and in the bioreactor treated on day 17 (Bioreactor Control). The second treatment on
day 18 of the control bioreactor did not result in a further decrease confirming
irreversible cell damage after the first treatment, in consistence with offline parameters
showing an exhaustion of intracellular enzyme stores and a breakdown in energy
metabolism.
To evaluate the bio-artificial bioreactor system including multi-parametric sensors in a
clinical setting, ppL were isolated and cultured in the bioreactor system. Primary
porcine liver cells (ppL) had proven to be a competent candidate in the realization of
extracorporeal liver support therapies.35,88,135–137,139,141 As a model for toxic patient
plasma perfusion of bioreactor cultures, the effect of toxic drug exposition was
investigated. Studies in 2D primary porcine liver cell cultures revealed distinct
morphological and metabolic changes when using APAP in a concentration range of 10-
30 mmol/l or diclofenac at a concentration of 300 µmol/l to 1000 µmol/l. As a model
drug in bioreactor experiments APAP was chosen, since it is a widely used analgetic
and antipyretic agent and is known to cause severe liver damage when applied in high
doses.182 Investigations focused on the identification of drug-induced cell stress by non-
invasive sensors. To enable cell recovery after toxic drug exposure APAP was applied
at a concentration of 5 mmol/l for 24 h followed by a regeneration phase of 48 h.
Measurement of offline parameters (urea, ammonia, glucose and lactate) in primary
porcine liver cell bioreactors showed an increased glucose production during the first
days of culture, which can be ascribed to glycogen breakdown in the initial culture
phase, when cells are stressed by the preceding cell isolation procedure.77,169 After an
adaption time of approx. three days stable metabolic performance of cell cultures was
observed. Measurement of offline parameters revealed a direct influence of APAP
exposure on cell metabolism. APAP induced stress was manifested by increasing
ammonia levels in the intoxicated bioreactor, in addition to a temporal decrease in urea
and lactate production indicating impaired cell metabolism. Cells regenerated
afterwards during the recovery phase as indicated by stabilization of metabolic
activities. The untreated control bioreactor cultures showed no direct affection by APAP
exposure on day 3, but ammonia levels increased after day 6 and urea and lactate
production declined after day 5. A possible reason for these changes in metabolic
behaviour of the cells can be seen in air intake into the cell compartment of the control
bioreactor. Air intake into the bioreactor cell compartment can result from overpressure
produced by the gas supply device resulting in the bursting of the gas capillaries.
Blocking of the degassing tube during daily bioreactor management could have
4. Results and discussion
82
produced a similar effect. During the experiments it was not possible to clearly identify
the cause of undesired air intake
APAP induced cell stress could not be recognized via online oxygen measurements. The
continuous increase in oxygen concentrations over the culture period indicates a
decrease in metabolic activity of the cells, which was not further affected by drug
exposure. Direct measurement of oxygen uptake by the cells in the cell compartment
could be more suitable to detect induced stress, but this would require temporary
stopping of perfusion and gas supply and therefore may negatively impact medium flow
and pressure conditions in the system. Integration of micro-sensors, e.g. needle-type
oxygen micro-sensor (PreSens-Precision Sensing GmbH), into the cell compartment
would be another option but bears an additional risk of microbial contamination during
integration of sensor channels. In addition, using such micro-sensors in the bioreactor
device is difficult due to their fragility.
Investigation of ammonia measurement unfortunately still showed deficiencies due to
the offspring of unidentified noises in signal detection. The integration of an inverter
into the ammonia measurement device did not reveal the source of noises. Thus,
evaluation of results from ammonia measurement was not possible.
The results of online impedance measurements showed a decline of signals after drug
exposure. Cell regeneration during the recovery phase was detected by increasing
impedance signals, indicating reversible changes in cell morphology and/or cell
composition upon drug exposure. Impedance measurements in the control bioreactors
showed less pronounced changes in impedance signal performance after intoxication on
day 6, probably due to the undesired intake of air into the cell compartment, indicated
by an increase in impedance values up to greater than 2000 Ω resulting in several
measured channels (data not shown).
In conclusion, optical-chemical flow-through cell sensors for oxygen or pH showed
good correlation with offline values of those parameters, easy feasibility and provide
options for closed-loop culture management keeping culture conditions constant, e.g.
pH or gas supply. The online ammonia sensors used showed acceptable correlation to
ammonia concentrations measured in offline samples. Still further effort has to be taken
into sensor development to avoid noise evolvement and liquid leakage during signal
detection. In addition, a suitable method for sensor sterilisation according to clinical
requirements has to be established. The chemical material for ammonium sensitive
membrane showed low sensitivity and cross-reaction with other ions, e.g. Na+, K+ and
Cl-, which limits the sensor sensitivity. Thus, alternative options could be considered,
e.g. use of fibre optic ammonia sensors183 but need to be adapted for clinical
application. Furthermore, based on the experimental results a concept for culture
prediction and decision-making was established based on impedance measurement. The
4. Results and discussion
83
development of impedance signals in a 3D high-density liver cell bioreactor culture can
be classified into three culture states namely “Normal”, “Sub-critical” and “Critical”.
The “Normal” state describes constant or rising impedance values representing stable
cell culture performance. In case of B-13 cell culture it additional describes cell
proliferation and successful trans-differentiation in the bio-artificial liver. The “Sub-
critical” state describes a moderate decrease in impedance values indicating possible
cell stress or cell damage with the possibility of recovery, or changes in the cell
morphology, composition or adhesion to impedance sensor foils. If this scenario occurs,
the bio-artificial liver cell culture has to be kept under careful surveillance. In particular,
any further changes in impedance values and additional parameters (e.g. oxygen,
ammonia) should be taken into account to make a decision about measures to be taken,
e.g. additional application of albumin dialysis for detoxification of the plasma to protect
the cells from toxic injury. The “Critical” state in impedance signal interpretation
indicates a sudden and drastic decrease in impedance values describing significant stress
resulting in irreversible damage to the bio-artificial bioreactor culture. If this scenario
occurs, recovery of the bioreactor culture will be unlikely and the bioreactor culture
should be terminated. Figure 31 describes the concept for culture prediction and
decision-making based on B-13 bioreactor cultures subjected to trans-differentiation and
intoxication using 2 mmol/l methapyrilene.
4. Results and discussion
84
Figure 31: Classification of bio-artificial liver culture behaviour
Classification of the status of the cell culture by impedance measurement and procedures for
culture surveillance and decision making, based on the three different scenarios for bio-artificial
liver support: “Normal”, “Sub-critical” and “Critical” exemplarily using B-13 bioreactor culture
subjected to trans-differentiation and intoxication to 2 mmol/l methapyrilene.
4. Results and discussion
85
4.3 Investigation of an up-scaled bioreactor system for potential
clinical application using HPAC-derived H-14 cells
For the pilot experiment performed in this study H-14 cells expanded in 2D culture
were inoculated in an up-scaled 800 ml bioreactor. Sensor constructs and tubing
systems were modified and adapted with respect to the larger volume of the bioreactor
system.
4.3.1 Pilot study with H-14 cells cultured in an 800 ml clinical-scale
bioreactor
Impedance, oxygen and pH sensors were successfully initiated after assembling the 800
ml bioreactor system. The ammonia sensor had to be removed from the system due to
strong leakage, which could not be prevented during the experiment. A number of
5.8×108 H-14 cells were inoculated into the bioreactor cell compartment and cultured
over 15 days. From day 12 of culture, 30 mmol/l APAP were continuously applied to
the bioreactor culture over three days to record the response to toxic stress of cultured
cells.
Technical system parameters, including temperature, gas perfusion, pump circulation
and online monitoring showed stable functionality during the whole culture period.
Results of metabolic parameters and impedance measurement data are shown in Figure
32. Enzyme leakage of the H-14 cells maintained in the up-scaled 800 ml bioreactor
was at basal levels for ALT, AST and GLDH while LDH release showed an increase
over the first four days and declined to basal values afterwards. Glucose consumption
and lactate production continuously decreased. The time course of ammonia showed a
decreasing performance during the first day followed by relatively stable values until
the end of culture. Online measurement of oxygen concentration in the culture perfusate
revealed no significant changes over the whole culture period (data not shown).
Impedance measurement showed a signal decrease during cell inoculation and no
increase thereafter. The application of 30 mmol/l APAP induced a temporary increase in
ammonia, urea and glucose production followed by a sharp decrease. A slight increase
was also detected via impedance monitoring.
4. Results and discussion
86
Figure 32: Metabolic performance and impedance measurement of humanized H-14 cells
in an up-scaled 800 ml bioreactor.
The bioreactor was inoculated with H-14 cells and run over 15 days. On day 12 APAP was
applied at a concentration of 30 mmol/l. Daily samples from the culture perfusate were analysed
for enzyme leakage (A), energy metabolism (B) and ammonia release (C). In addition, the
culture behaviour was observed using online impedance measurement (D). Six sensor foils were
integrated into the bioreactor cell compartment providing 40 independent measurement points.
Graph (D) shows a selection. Channels 1-6 show measurements on impedance sensor foils,
channels 7-9 show impedance measurements between different impedance sensor foils and
channel 10 shows temperature measurements over time.
4.3.2 Chapter discussion
A major limitation of the B-13 cell line is that it is of rat origin, which restricts the
predictive value of research results for humans, and implies some differences in
metabolic enzymes.111,113,184 To solve this problem, introduction of human genes into
the B-13 cells was attempted,121 which opens the opportunity to generate cell lines with
human characteristics to be used in in vitro models. To meet clinical requirements,
generation of a cell line of human origin with similar characteristics is desirable for
provision of human-typical functions and high clinical safety. If successful, the
possibility of generating great quantities of liver cells at low costs within short time
would meet the high demand of cells required for extracorporeal liver support.
4. Results and discussion
87
The H-14 cell line, provided by the group of Professor Matthew Wright, University of
Newcastle, was derived from a human pancreatic ductal adenocarcinoma cell line
(HPAC). HPAC are sensitive to glucocorticoid treatment inducing trans-differentiation
to hepatic cells as previously described for the B-13 cell line. The trans-differentiation
of the cell line into a liver-like phenotype was improved by genetic encoding of
transcription factors, which have been reported to be involved in the process of trans-
differentiation (HNF-1, HNF-3α, HNF-3β, HNF-4, C/EBPα, C/EBPβ),185–187 resulting
in the generation of the humanized H-14 cell line. H-14 cells showed successful culture
performance using small-scale bioreactors (data not shown) encouraging their usage in
up-scaled clinical grade bioreactors.
The scalable 3D four-compartment bioreactor technology used at the Charité group in
Berlin enables adaptation of the culture system for individual fields of application.149 In
contrast to conventional 2D cultures, the flexible size of the 3D bioreactor system
facilitates the generation of large cell masses, as shown for mouse embryonic stem
cells.188 Furthermore, the option of periodic cell harvesting allows cell expansion in a
highly controlled environment generating sufficient cell numbers for in vitro or clinical
application.151 Thus, the technology is of interest for cell cultivation at a large scale for
extracorporeal liver support therapy.
Based on experiments using non-invasive online sensors (oxygen, ammonia and
impedance) in an 8 ml analytical-scale bioreactor, the methodology was implemented in
an up-scaled bioreactor variant for potential use in clinical application. Integration of
online sensors was successful except for the online ammonia sensor, which had to be
withdrawn due to leakage interfering with the electrical read out device. This issue can
be addressed in future experiments by better shielding of electronic components from
the liquid part of the sensors and by gluing individual sensor chambers using material
which is resistant to dynamic pressure changes located in the bioreactor perfusion.
The culture performance of humanized H-14 cells in the clinical-scale bioreactor,
showing promising results in 2 ml small-scale bioreactor cultures, indicates a decrease
in cell number and/or viability during culture. Increased LDH release of the first four
days followed by a decline to basal levels indicates cell stress due to enzymatic cell
harvesting prior to cell inoculation. In addition, cell damage may occur as a result of
low cell attachment in the cell compartment. Decreasing energy metabolism as shown
by glucose consumption and lactate production rates indicates that significant
proliferation did not occur in the bioreactor. This was confirmed by the results of
impedance measurement showing no signal increase, which is expected when cells
proliferate. Online measurement of oxygen concentrations in the culture perfusate
showed similar results. The application of 30 mmol/l APAP induces a temporary
increase in ammonia and glucose production followed by a sharp decrease indicating
4. Results and discussion
88
cell damage. Toxic stress was also detected via impedance monitoring showing a slight
increase of signals after drug exposition.
A potential reason for the rather low performance of the cells can be seen in the low cell
number used in relation to the cell compartment volume. Since the number of cells
inoculated was lower than that used for primary human liver cell culture, where a cell
number of approx. 1.4×1010 is proposed,89,148 the cell density of H-14 cells used in the
clinical-scale bioreactor was probably not sufficient to enable efficient cell proliferation.
To gain the needed larger cell numbers for the clinical-scale bioreactor, labour- and
material-intensive 2D cell expansion is required. To solve this issue, multi-layer culture
flasks (e.g. cell factory, Thermo Scientific) or small-scale variants of the bioreactor
technology in combination with periodic cell harvesting could be used to facilitate cell
expansion.151 The absence of a stronger effect caused by toxic drug exposure as
observed in 8 ml B-13/H bioreactor cultures can be attributed to the lower cell density
in the clinical scale BAL. Furthermore, the vertical arrangement of impedance sensor
foils in the clinical-scale bioreactor, which was necessary due to short length of the
sensor foils, could have had a negative effect of cell attachment on the sensor foils,
which is essential to impedance measurement. Horizontal alignment of impedance
sensor foils in 8 ml analytical-scale bioreactor simplified cell attachment. In order to
improve cell attachment, the use of larger sensor foils and arrangement in a way
favouring cell adhesion would be an option.
In conclusion, the results of the pilot study performed in this thesis show that the
generated cell line H-14 can be cultured and shows metabolic activity in the 3D
bioreactor system. The low level of cell activity observed could be due to an insufficient
cell density in the pilot experiment. The utilization of non-invasive sensors integrated in
the bioreactor system requires additional work. The results obtained encourage further
labour to achieve the goal of making available a suitable human cell source in large
numbers for extracorporeal liver support approaches.
6. Conclusions and perspectives
89
5 Conclusions and perspectives
Extracorporeal liver support systems are under investigation as a temporary therapy in
acute or acute-on chronic liver failure. In order to provide a safe, cost-effective,
functional system for extracorporeal liver support, a suitable cell source and methods
for quality assessment during clinical sessions are required.
In this thesis successful culture and trans-differentiation of B-13 cells into functional
hepatocyte-like B-13/H cells was shown in a 3D high-density bioreactor system. B-
13/H bioreactor cultures showed a tendency to improve liver-like functions in prolonged
culture. To provide a human cell source for clinical use, culturing genetically modified
HPAC (e.g. H-14) in an up-scaled four-compartment bioreactor provides a promising
option, if sufficient functionality and achievement of required cell numbers can be
achieved. Online impedance measurement (Fraunhofer IBMT) was shown to be a safe,
sensitive, label-free and non-invasive method to monitor culture conditions in 3D high-
density bioreactor cultures. The technology was successfully used for detecting drug-
induced cell damage in 3D bioreactor cultures. Furthermore, online measurement of
oxygen and pH using optical-chemical sensors (PreSens-Precision Sensing GmbH)
provided additional information on bioreactor cell culture and allowed closely
controlled culture performance. The integration of an online ammonia sensor (CEA-
Leti-France) showed acceptable correlation to offline ammonia values, but further
improvement of the method with regard to sensitivity, sterility, signal shielding and
sensor leakage is required. Based on the results, a procedure for culture prediction and
decision-making conceived for bio-artificial liver support in a clinical setting was
established.
These results highlight the potential of pancreas-derived cell lines, such as B-13/H or
human H-14 cells, in combination with the 3D bioreactor system and online sensor
technologies to provide a liver culture model for in vitro and clinical application. For
example, the model can be used to perform studies on hepatic drug toxicity and
metabolism, enabling various modes of substance application and regular sample taking
with the option to connect automated analytic devices. The integration of online sensor
technologies can be used for non-invasive monitoring of the culture state and the cell
behaviour in such studies. The prospective of 3D culture systems to investigate more
precisely questions of pathogenesis and of disease processes in the body offers the
opportunity to better translate research results into clinical applications.
Figures
90
Figures
Figure 1: Structure of study. ........................................................................................... 15
Figure 2: Procedure of primary porcine liver cell isolation using collagenase P
perfusion. ................................................................................................................ 30
Figure 3: Architecture of 3D multi-compartment bioreactor. ......................................... 31
Figure 4: Bioreactor used for 3D-cultivation. ................................................................. 32
Figure 5: Online sensors for oxygen and pH measurement in the culture perfusate. ..... 34
Figure 6: Online sensor for ammonia measurement in the culture perfusate (CEA-Leti-
France). ................................................................................................................... 35
Figure 7: Foil-based impedance sensors located in the cell compartment of bioreactors.
................................................................................................................................ 36
Figure 8: Set up and architecture of bioreactor culture system. ..................................... 37
Figure 9: Energy metabolism in B-13/H bioreactor cultures. ......................................... 45
Figure 10: Cell integrity in B-13/H bioreactor cultures. ................................................. 46
Figure 11: Liver- and pancreas-specific marker expression in B-13/H bioreactor
cultures. ................................................................................................................... 48
Figure 12: Ethoxyresorufin-O-deethylase activity in B-13/H bioreactor cultures. ........ 49
Figure 13: Gene and protein expression of B-13/H bioreactor cultures. ........................ 50
Figure 14: Immunohistochemical analysis of tissue retrieved from bioreactor cultures. 52
Figure 15: Experimental set-up of the bioreactor system for non-invasive, sensor-based
monitoring of system functions and culture parameters. ........................................ 58
Figure 16: Offline versus online measurement of oxygen (A) and pH values (B) in an 8
ml analytical-scale bioreactor. ................................................................................ 59
Figure 17: Individual ammonia sensor integrated in a Luer-Lock T-connector (CEA-
Leti-France). ........................................................................................................... 60
Figure 18: Ammonia sensor potential performance at the beginning of online
measurement. .......................................................................................................... 60
Figure 19: Comparison of online and offline measurement of ammonia in bioreactors
with B-13 cells. ....................................................................................................... 61
Figure 20: Impedance signal detection in an 8 ml analytical-scale bioreactor with B-13
cells. ........................................................................................................................ 63
Figures
91
Figure 21: Identification of toxic methapyrilene concentrations in B-13/H bioreactor
cultures. ................................................................................................................... 65
Figure 22: Enzyme release and energy metabolism in B-13/H bioreactor cultures treated
with toxic doses of methapyrilene. ......................................................................... 66
Figure 23: Online monitoring of oxygen concentrations in B-13/H bioreactor cultures
exposed to 2 mmol/l methapyrilene. ....................................................................... 67
Figure 24: Online and Offline monitoring of ammonia concentrations in B-13/H
bioreactor cultures exposed to 2 mmol/l methapyrilene. ........................................ 68
Figure 25: Online monitoring of impedance in B-13/H bioreactor cultures exposed to 2
mmol/l methapyrilene. ............................................................................................ 69
Figure 26: Morphological alterations in ppL treated with APAP or diclofenac in 2D
culture systems. ....................................................................................................... 71
Figure 27: Lactate production and ammonia release in ppL treated with APAP or
diclofenac in 2D culture systems. ........................................................................... 72
Figure 28: Performance of offline parameters during APAP application in ppL
bioreactor cultures................................................................................................... 73
Figure 29: Online monitoring of oxygen concentrations during APAP application in ppL
bioreactor cultures................................................................................................... 74
Figure 30: Online monitoring of impedance during APAP application in primary ppL
bioreactor cultures................................................................................................... 75
Figure 31: Classification of bio-artificial liver culture behaviour .................................. 84
Figure 32: Metabolic performance and impedance measurement of humanized H-14
cells in an up-scaled 800 ml bioreactor. ................................................................. 86
Tables
92
Tables
Table 1: Compositions of solutions used for primary porcine liver cell isolation. ......... 18
Table 2: Composition of B-13 cell culture medium. ...................................................... 19
Table 3: Composition of ppL culture medium................................................................ 19
Table 4: Composition of H14 cell culture medium. ....................................................... 20
Table 5: Composition of freezing medium. .................................................................... 20
Table 6: DNA oligonucleotide sequences employed in RT-PCR or PCR genotyping. .. 23
Table 7: Primary and secondary antibodies used for immunohistochemical analysis of
bioreactor tissue. ..................................................................................................... 25
Table 8: Technical properties of differently sized types of 3D multi-compartment
bioreactors. .............................................................................................................. 33
Table 9: Perfusion parameters used for 3D-bioreactor culture ....................................... 38
Formulas
Equation 1: Calculation of metabolic rates in bioreactor cultures .................................. 41
References
93
References
1. Williams, R. Global challenges in liver disease. Hepatology 44, 521–526 (2006).
2. Blachier, M., Leleu, H., Peck-Radosavljevic, M., Valla, D.-C. & Roudot-
Thoraval, F. The burden of liver disease in Europe: a review of available
epidemiological data. J. Hepatol. 58, 593–608 (2013).
3. Bosch, F. X., Ribes, J., Díaz, M. & Cléries, R. Primary liver cancer: Worldwide
incidence and trends. in Gastroenterology 127, S5–S16 (2004).
4. Yu, M. C. & Yuan, J. M. Environmental factors and risk for hepatocellular
carcinoma. Gastroenterology 127, S72–78 (2004).
5. Zatoński, W. A. et al. Liver cirrhosis mortality in Europe, with special attention
to Central and Eastern Europe. Eur. Addict. Res. 16, 193–201 (2010).
6. Mann, R. E., Smart, R. G. & Govoni, R. The epidemiology of alcoholic liver
disease. Alcohol Res. Health 27, 209–219 (2003).
7. Rehm, J. et al. Alcohol as a risk factor for liver cirrhosis: A systematic review
and meta-analysis. Drug Alcohol Rev. 29, 437–445 (2010).
8. Bedogni, G. et al. Incidence and natural course of fatty liver in the general
population: The dionysos study. Hepatology 46, 1387–1391 (2007).
9. Dugum, M. & McCullough, A. Diagnosis and Management of Alcoholic Liver
Disease. J. Clin. Transl. Hepatol. 3, 109–116 (2015).
10. Rehm, J., Samokhvalov, A. V. & Shield, K. D. Global burden of alcoholic liver
diseases. J. Hepatol. 59, 160–168 (2013).
11. Mota, A., Areias, J. & Cardoso, M. F. Chronic liver disease and cirrhosis among
patients with hepatitis B virus infection in northern Portugal with reference to the
viral genotypes. J. Med. Virol. 83, 71–77 (2011).
12. Hatzakis, A. et al. The state of hepatitis B and C in Europe: Report from the
hepatitis B and C summit conference. J. Viral Hepat. 18, 1–16 (2011).
13. European Liver Patients Association. Report on Hepatitis Patient Self-Help in
Europe by the European Liver Patients Association (ELPA). (2010). at
<http://www.hepbcppa.org/wp-content/uploads/2011/11/Report-on-Patient-Self-
Help.pdf>
14. Patel, N. et al. Hepatic decompensation/serious adverse events in post-liver
transplantation recipients on sofosbuvir for recurrent hepatitis C virus. World J.
Gastroenterol. 22, 2844–2854 (2016).
15. Wilder, J. M. & Muir, A. J. Strategies for treating chronic HCV infection in
patients with cirrhosis: latest evidence and clinical outcomes. Ther. Adv. Chronic
Dis. 6, 314–327 (2015).
16. Zhang, X. Direct anti-HCV agents. Acta Pharm. Sin. B 6, 26–31 (2016).
17. Rizzetto, M. Hepatitis D: Thirty years after. J. Hepatol. 50, 1043–1050 (2009).
18. Romeo, R. et al. A 28-year study of the course of hepatitis Delta infection: a risk
factor for cirrhosis and hepatocellular carcinoma. Gastroenterology 136, 1629–
1638 (2009).
19. FitzSimons, D., Hendrickx, G., Vorsters, A. & Van Damme, P. Hepatitis A and
E: Update on prevention and epidemiology. in Vaccine 28, 583–588 (2010).
20. Smith, B. W. & Adams, L. A. Non-alcoholic fatty liver disease. Crit. Rev. Clin.
Lab. Sci. 48, 97–113 (2011).
References
94
21. Schattenberg, J. M. Nicht-alkoholische Fettleber (NAFLD) und nicht-
alkoholische Steatohepatitis (NASH): Pathophysiologie und Ernährungsaspekte.
Ernährungs Umschau M92–M100 (2015).
22. Radu, C. et al. Prevalence and associated risk factors of non-alcoholic fatty liver
disease in hospitalized patients. J. Gastrointestin. Liver Dis. 17, 255–260 (2008).
23. Smith, B. W. & Adams, L. A. Nonalcoholic fatty liver disease and diabetes
mellitus: pathogenesis and treatment. Nat. Rev. Endocrinol. 7, 456–465 (2011).
24. Angulo, P. GI epidemiology: nonalcoholic fatty liver disease. Aliment.
Pharmacol. Ther. 25, 883–889 (2007).
25. Cowan, M. L. et al. The increasing hospital disease burden of haemochromatosis
in England. Aliment. Pharmacol. Ther. 31, 247–252 (2010).
26. Gerlach, J. C., Zeilinger, K. & Patzer Ii, J. F. Bioartificial liver systems: why,
what, whither? Regen. Med. 3, 575–595 (2008).
27. Starzl, T. E. et al. Homotransplantation of the liver in humnans. Surg. Gynecol.
Obstet. 117, 659–76 (1963).
28. Crossan, C. et al. Cost-effectiveness of non-invasive methods for assessment and
monitoring of liver fibrosis and cirrhosis in patients with chronic liver disease:
systematic review and economic evaluation. Health Technol. Assess. 19, 1–409,
v–vi (2015).
29. Pascher, A., Nebrig, M. & Neuhaus, P. Irreversible liver failure: treatment by
transplantation: part 3 of a series on liver cirrhosis. Dtsch. Arztebl. Int. 110, 167–
173 (2013).
30. Riordan, S. M. & Williams, R. Perspectives on liver failure: Past and future.
Seminars in Liver Disease 28, 137–141 (2008).
31. Chistiakov, D. A. Liver regenerative medicine: Advances and challenges. Cells
Tissues Organs 196, 291–312 (2012).
32. Hauboldt, R. H., Hanson, S. G. & Bernstein, G. R. 2008 U.S. organ and tissue
transplant cost estimate and discussion. Milliman Res. Rep. April, 1–17 (2008).
33. Bentley, T. S. & Hanson, S. G. 2014 U.S. organ and tissue transplant cost
estimates and discussion. Milliman Res. Rep. December, 1–16 (2014).
34. Bengmark, S. Curcumin, an atoxic antioxidant and natural NFkappaB,
cyclooxygenase-2, lipooxygenase, and inducible nitric oxide synthase inhibitor: a
shield against acute and chronic diseases. JPEN. J. Parenter. Enteral Nutr. 30,
45–51 (2006).
35. Wang, Y. et al. Current development of bioreactors for extracorporeal
bioartificial liver (Review). Biointerphases 5, FA116–FA131 (2010).
36. Stutchfield, B. M., Simpson, K. & Wigmore, S. J. Systematic review and meta-
analysis of survival following extracorporeal liver support. Br. J. Surg. 98, 623–
631 (2011).
37. Bañares, R., Catalina, M.-V. & Vaquero, J. Liver support systems: will they ever
reach prime time? Curr. Gastroenterol. Rep. 15, 312 (2013).
38. Carpentier, B., Gautier, A. & Legallais, C. Artificial and bioartificial liver
devices: present and future. Gut 58, 1690–1702 (2009).
39. Court, F. G., Wemyss-Holden, S. A., Dennison, A. R. & Maddern, G. J.
Bioartificial liver support devices: Historical perspectives. ANZ Journal of
Surgery 73, 739–748 (2003).
40. Kiley, J. E., Welch, H. F., Pender, J. C. & Welch, C. S. Removal of blood
ammonia by hemodialysis. Proc. Soc. Exp. Biol. Med. 91, 489–90 (1956).
41. Patzer 2nd, J. F. Thermodynamic considerations in solid adsorption of bound
solutes for patient support in liver failure. Artif. Organs 32, 499–508 (2008).
References
95
42. Saliba, F. The Molecular Adsorbent Recirculating System (MARS) in the
intensive care unit: a rescue therapy for patients with hepatic failure. Crit. Care
10, 118 (2006).
43. Mitzner, S., Klammt, S., Stange, J. & Schmidt, R. Albumin regeneration in liver
support-comparison of different methods. Ther. Apher. Dial. 10, 108–117 (2006).
44. Stange, J. et al. Liver support by extracorporeal blood purification: A clinical
observation. Liver Transplant. 6, 603–613 (2000).
45. Pless, G. Artificial and bioartificial liver support. Organogenesis 3, 20–24
(2007).
46. Palsson, R. & Niles, J. L. Regional citrate anticoagulation in continuous
venovenous hemofiltration in critically ill patients with a high risk of bleeding.
Kidney Int 55, 1991–1997 (1999).
47. Bouchard, J. & Madore, F. Role of citrate and other methods of anticoagulation
in patients with severe liver failure requiring continuous renal replacement
therapy. NDT Plus 2, 11–19 (2009).
48. Patzer 2nd, J. F., Safta, S. A. & Miller, R. H. Slow continuous ultrafiltration with
bound solute dialysis. ASAIO J 52, 47–58 (2006).
49. Kreymann, B., Seige, M., Schweigart, U., Kopp, K. F. & Classen, M. Albumin
dialysis: Effective removal of copper in a patient with Fulminant wilson disease
and successful bridging to liver transplantation: A new possibility for the
elimination of protein-bound toxins. J. Hepatol. 31, 1080–1085 (1999).
50. Santoro, A. et al. Prometheus System: A Technological Support in Liver Failure.
Transplant. Proc. 38, 1078–1082 (2006).
51. Rademacher, S., Oppert, M. & Jörres, A. Artificial extracorporeal liver support
therapy in patients with severe liver failure. Expert Rev. Gastroenterol. Hepatol.
5, 591–599 (2011).
52. Bernal, W., Lee, W. M., Wendon, J., Larsen, F. S. & Williams, R. Acute liver
failure: A curable disease by 2024? Journal of Hepatology 62, S112–S120
(2015).
53. Sen, S., Mookerjee, R. P., Davies, N. A., Williams, R. & Jalan, R. Review article:
the Molecular Adsorbents Recirculating System (MARS) in liver failure.
Aliment. Pharmacol. Ther. 16, 32–38 (2002).
54. Sen, S., Jalan, R. & Williams, R. Liver failure: Basis of benefit of therapy with
the molecular adsorbents recirculating system. Int. J. Biochem. Cell Biol. 35,
1306–1311 (2003).
55. Collins, K. L., Roberts, E. A., Adeli, K., Bohn, D. & Harvey, E. A. Single pass
albumin dialysis (SPAD) in fulminant Wilsonian liver failure: A case report.
Pediatr. Nephrol. 23, 1013–1016 (2008).
56. Heemann, U. et al. Albumin dialysis in cirrhosis with superimposed acute liver
injury: a prospective, controlled study. Hepatology 36, 949–958 (2002).
57. Mitzner, S. R. et al. Improvement of Hepatorenal SyndromeWith Extracorporeal
Albumin Dialysis MARS: Results of a Prospective, Randomized, Controlled
Clinical Trial. Liver Transplant. 6, 277–286 (2000).
58. Peszynski, P. et al. Albumin dialysis: single pass vs. recirculation (MARS). Liver
22, 40–42 (2002).
59. Mitzner, S. R. et al. Extracorporeal detoxification using the molecular adsorbent
recirculating system for critically ill patients with liver failure. J. Am. Soc.
Nephrol. 12, S75–S82 (2001).
60. Sauer, I. M. et al. In Vitro Comparison of the Molecular Adsorbent Recirculation
System (MARS) and Single-pass Albumin Dialysis (SPAD). Hepatology 39,
References
96
1408–1414 (2004).
61. Sen, S. et al. Pathophysiological effects of albumin dialysis in acute-on-chronic
liver failure: A randomized controlled study. Liver Transplant. 10, 1109–1119
(2004).
62. Stange, J., Hassanein, T. I., Mehta, R., Mitzner, S. R. & Bartlett, R. H. The
molecular adsorbents recycling system as a liver support system based on
albumin dialysis: A summary of preclinical investigations, prospective,
randomized, controlled clinical trial, and clinical experience from 19 centers.
Artif. Organs 26, 103–110 (2002).
63. Patzer, J. Principles of bound solute dialysis. Ther. Apher. Dial. 10, 118–124
(2006).
64. Falkenhagen, D. et al. Fractionated plasma separation and adsorption system: A
novel system for blood purification to remove albumin bound substances. Artif.
Organs 23, 81–86 (1999).
65. Rifai, K. et al. Prometheus(R) - A new extracorporeal system for the treatment of
liver failure. J. Hepatol. 39, 984–990 (2003).
66. Rifai, K. et al. Removal selectivity of prometheus: A new extracorporeal liver
support device. World J. Gastroenterol. 12, 940–944 (2006).
67. Kramer, L. et al. Successful treatment of refractory cerebral oedema in
ecstasy/cocaine-induced fulminant hepatic failure using a new high-efficacy liver
detoxification device (FPSA-Prometheus). Wien. Klin. Wochenschr. 115, 599–
603 (2003).
68. Krisper, P. et al. In vivo quantification of liver dialysis: Comparison of albumin
dialysis and fractionated plasma separation. J. Hepatol. 43, 451–457 (2005).
69. Vaquero, J., Chung, C., Cahill, M. E. & Blei, A. T. Pathogenesis of hepatic
encephalopathy in acute liver failure. Semin. Liver Dis. 23, 259–269 (2003).
70. Evenepoel, P. et al. Prometheus versus molecular adsorbents recirculating
system: Comparison of efficiency in two different liver detoxification devices.
Artif. Organs 30, 276–284 (2006).
71. Kribben, A. et al. Effects of fractionated plasma separation and adsorption on
survival in patients with acute-on-chronic liver failure. Gastroenterology 142,
782–789.e3 (2012).
72. Bañares, R. et al. Extracorporeal albumin dialysis with the molecular adsorbent
recirculating system in acute-on-chronic liver failure: The RELIEF trial.
Hepatology 57, 1153–1162 (2013).
73. Stauber, R. E. & Krisper, P. MARS and Prometheus in Acute-on-Chronic Liver
Failure : Toxin Elimination and Outcome. Transplantationsmedizin 22, 333–338
(2010).
74. Stange, J. Extracorporeal liver support. Organogenesis 71, 64–73 (2011).
75. Tsiaoussis, J., Newsome, P. N., Nelson, L. J., Hayes, P. C. & Plevris, J. N. Which
hepatocyte will it be? hepatocyte choice for bioartificial liver support systems.
Liver Transplant. 7, 2–10 (2001).
76. Wallace, K., Fairhall, E. A., Charlton, K. A. & Wright, M. C. AR42J-B-13 cell:
An expandable progenitor to generate an unlimited supply of functional
hepatocytes. Toxicology 278, 277–287 (2010).
77. Hoffmann, S. A. et al. Analysis of drug metabolism activities in a miniaturized
liver cell bioreactor for use in pharmacological studies. Biotechnol. Bioeng. 109,
3172–3181 (2012).
78. Padgham, C. R. et al. Alteration of transcription factor mRNAs during the
isolation and culture of rat hepatocytes suggests the activation of a proliferative
References
97
mode underlies their de-differentiation. Biochem. Biophys. Res. Commun. 197,
599–605 (1993).
79. Jakubowski, A. et al. TWEAK induces liver progenitor cell proliferation. J. Clin.
Invest. 115, 2330–2340 (2005).
80. Erker, L. & Grompe, M. Signaling networks in hepatic oval cell activation. Stem
Cell Research 1, 90–102 (2007).
81. Scheving, L. A., Stevenson, M. C., Zhang, X. & Russell, W. E. Cultured rat
hepatocytes upregulate Akt and ERK in an ErbB-2-dependent manner. Am J
Physiol Gastrointest Liver Physiol 295, G322–331 (2008).
82. Rozga, J. et al. Development of a hybrid bioartificial liver. Ann Surg 217, 502–
509 (1993).
83. Gerlach, J. C. et al. Extracorporeal liver support : Porcine or human cell based
systems ? Int. J. Artif. Organs 25, 1013–1018 (2002).
84. Stockmann, H. B., Hiemstra, C. A., Marquet, R. L. & IJzermans, J. N.
Extracorporeal perfusion for the treatment of acute liver failure. Ann. Surg. 231,
460–70 (2000).
85. Harrison, S. et al. An efficient method for producing alpha(1,3)-
galactosyltransferase gene knockout pigs. Cloning Stem Cells 6, 327–331 (2004).
86. Irgang, M. et al. Porcine endogenous retroviruses: No infection in patients treated
with a bioreactor based on porcine liver cells. J. Clin. Virol. 28, 141–154 (2003).
87. Di Nicuolo, G. et al. No evidence of in vitro and in vivo porcine endogenous
retrovirus infection after plasmapheresis through the AMC-bioartificial liver.
Xenotransplantation 12, 286–292 (2005).
88. Van De Kerkhove, M. P., Hoekstra, R., Chamuleau, R. A. F. M. & van Gulik, T.
M. Clinical application of bioartificial liver support systems. Ann. Surg. 240,
216–230 (2004).
89. Gerlach, J. C. et al. Use of primary human liver cells originating from discarded
grafts in a bioreactor for liver support therapy and the prospects of culturing adult
liver stem cells in bioreactors: a morphologic study. Transplantation 76, 781–786
(2003).
90. Ellis, A. J. et al. Pilot-controlled trial of the extracorporeal liver assist device in
acute liver failure. Hepatology 24, 1446–1451 (1996).
91. Poyck, P. P. et al. In vitro comparison of two bioartificial liver support systems:
MELS CellModule and AMC BAL. Int. J. Artif. Organs 30, 183–191 (2007).
92. Allen, J. W., Hassanein, T. & Bhatia, S. N. Advances in bioartificial liver
devices. Hepatology 34, 447–455 (2001).
93. Millis, J. M. et al. Initial experience with the modified extracorporeal liver-assist
device for patients with fulminant hepatic failure: system modifications and
clinical impact. Transplantation 74, 1735–1746 (2002).
94. Mavri-Damelin, D. et al. Cells for bioartificial liver devices: The human
hepatoma-derived cell line C3A produces urea but does not detoxify ammonia.
Biotechnol. Bioeng. 99, 644–651 (2008).
95. Gripon, P. et al. Infection of a human hepatoma cell line by hepatitis B virus.
Proc. Natl. Acad. Sci. U. S. A. 99, 15655–15660 (2002).
96. Andersson, T. B., Kanebratt, K. P. & Kenna, J. G. The HepaRG cell line: a
unique in vitro tool for understanding drug metabolism and toxicology in human.
Expert Opin. Drug Metab. Toxicol. 8, 909–920 (2012).
97. Lübberstedt, M. et al. HepaRG human hepatic cell line utility as a surrogate for
primary human hepatocytes in drug metabolism assessment in vitro. J.
Pharmacol. Toxicol. Methods 63, 59–68 (2011).
References
98
98. Nibourg, G. A. A. et al. Increased hepatic functionality of the human hepatoma
cell lineHepaRG cultured in the AMC bioreactor. Int. J. Biochem. Cell Biol. 45,
1860–1868 (2013).
99. Darnell, M. et al. Cytochrome P450-dependent metabolism in HepaRG cells
cultured in a dynamic three-dimensional bioreactor. Drug Metab. Dispos. 39,
1131–1138 (2011).
100. Takayama, K. et al. Generation of metabolically functioning hepatocytes from
human pluripotent stem cells by FOXA2 and HNF1α transduction. J. Hepatol.
57, 628–636 (2012).
101. Zhang, Z. et al. Generation, characterization and potential therapeutic
applications of mature and functional hepatocytes from stem cells. J. Cell.
Physiol. 228, 298–305 (2013).
102. De Freitas Souza, B. S. et al. Current status of stem cell therapy for liver
diseases. Cell Transplantation 18, 1261–1279 (2009).
103. Lemaigre, F. & Zaret, K. S. Liver development update: New embryo models, cell
lineage control, and morphogenesis. Current Opinion in Genetics and
Development 14, 582–590 (2004).
104. Zaret, K. S. & Grompe, M. Generation and regeneration of cells of the liver and
pancreas. Science 322, 1490–1494 (2008).
105. Yeldandi, A. V et al. Coexpression of glutamine synthetase and
carbamoylphosphate synthage I genes in pancreatic hepatocytes of rat. Proc.
Natl. Acad. Sci. U. S. A. 87, 881–885 (1990).
106. Waalkes, M. P., Cherian, M. G., Ward, J. M. & Goyer, R. A.
Immunohistochemical evidence of high concentrations of metallothionein in
pancreatic hepatocytes induced by cadmium in rats. Toxicol. Pathol. 20, 323–326
(1992).
107. Krakowski, M. L. et al. Pancreatic Expression of Keratinocyte Growth Factor
Leads to Differentiation of Islet Hepatocytes and Proliferation of Duct Cells. Am.
J. Pathol. 154, 683–691 (1999).
108. Lardon, J. et al. Plasticity in the adult rat pancreas: transdifferentiation of
exocrine to hepatocyte-like cells in primary culture. Hepatology 39, 1499–1507
(2004).
109. Munck, A., Guyre, P. M. & Holbrook, N. J. Physiological functions of
glucocorticoids in stress and their relations to pharmacological actions. Endocr
Rev 5, 25–44 (1984).
110. Kotelevtsev, Y. et al. 11Beta-Hydroxysteroid Dehydrogenase Type 1 Knockout
Mice Show Attenuated Glucocorticoid-Inducible Responses and Resist
Hyperglycemia on Obesity or Stress. Proc. Natl. Acad. Sci. U. S. A. 94, 14924–
14929 (1997).
111. Wallace, K., Marek, C. J., Currie, R. A. & Wright, M. C. Exocrine pancreas
trans-differentiation to hepatocytes-A physiological response to elevated
glucocorticoid in vivo. J. Steroid Biochem. Mol. Biol. 116, 76–85 (2009).
112. Wallace, K., Flecknell, P. A., Burt, A. D. & Wright, M. C. Disrupted pancreatic
exocrine differentiation and malabsorption in response to chronic elevated
systemic glucocorticoid. Am. J. Pathol. 177, 1225–1232 (2010).
113. Fairhall, E. A. et al. Adult human exocrine pancreas differentiation to
hepatocytes – potential source of a human hepatocyte progenitor for use in
toxicology research. Toxicol. Res. (Camb). 2, 80–87 (2013).
114. Wallace, K., Marek, C. J., Hoppler, S. & Wright, M. C. Glucocorticoid-
dependent transdifferentiation of pancreatic progenitor cells into hepatocytes is
References
99
dependent on transient suppression of WNT signalling. J. Cell Sci. 123, 2103–
2110 (2010).
115. Thompson, M. D. & Monga, S. P. S. WNT/beta-catenin signaling in liver health
and disease. Hepatology 45, 1298–1305 (2007).
116. Burke, Z. D. et al. Liver Zonation Occurs Through a β-Catenin-Dependent, c-
Myc-Independent Mechanism. Gastroenterology 136, 2316–2324.e1–3 (2009).
117. Tosh, D., Shen, C. N. & Slack, J. M. W. Differentiated properties of hepatocytes
induced from pancreatic cells. Hepatology 36, 534–543 (2002).
118. Fairhall, E. A. et al. The B-13 hepatocyte progenitor cell resists pluripotency
induction and differentiation to non-hepatocyte cells. Toxicol. Res. (Camb). 2,
308–320 (2013).
119. Shen, C. N., Slack, J. M. W. & Tosh, D. Molecular basis of transdifferentiation
of pancreas to liver. Nat. c 2, 879–887 (2000).
120. Marek, C. J., Cameron, G. A., Elrick, L. J., Hawksworth, G. M. & Wright, M. C.
Generation of hepatocytes expressing functional cytochromes P450 from a
pancreatic progenitor cell line in vitro. Biochem. J. 370, 763–769 (2003).
121. Probert, P. M. E. et al. Utility of B-13 progenitor-derived hepatocytes in
hepatotoxicity and genotoxicity studies. Toxicol. Sci. 137, 350–370 (2014).
122. Swift, B., Pfeifer, N. D. & Brouwer, K. L. R. Sandwich-cultured hepatocytes: an
in vitro model to evaluate hepatobiliary transporter-based drug interactions and
hepatotoxicity. Drug Metab. Rev. 42, 446–471 (2010).
123. Decaens, C., Durand, M., Grosse, B. & Cassio, D. Which in vitro models could
be best used to study hepatocyte polarity? Biol. Cell 100, 387–398 (2008).
124. Rhee, S. Fibroblasts in three dimensional matrices: cell migration and matrix
remodeling. Exp. Mol. Med. 41, 858–865 (2009).
125. Schyschka, L. et al. Hepatic 3D cultures but not 2D cultures preserve specific
transporter activity for acetaminophen-induced hepatotoxicity. Arch. Toxicol. 87,
1581–1593 (2013).
126. Abbott, A. Cell culture: biology’s new dimension. Nature 424, 870–2 (2003).
127. Cukierman, E., Pankov, R. & Yamada, K. M. Cell interactions with three-
dimensional matrices. Current Opinion in Cell Biology 14, 633–639 (2002).
128. Morsiani, E. et al. Biologic liver support: optimal cell source and mass. Int. J.
Artif. Organs 25, 985–93 (2002).
129. Kelly, J. H. & Sussman, N. L. The hepatix extracorporeal liver assist device in
the treatment of fulminant hepatic failure. Asaio J 40, 83–85 (1994).
130. Erro, E. et al. Bioengineering the liver: scale-up and cool chain delivery of the
liver cell biomass for clinical targeting in a bioartificial liver support system.
Biores. Open Access 2, 1–11 (2013).
131. Allen, J. W. & Bhatia, S. N. Improving the next generation of bioartificial liver
devices. Seminars in Cell and Developmental Biology 13, 447–454 (2002).
132. Zeilinger, K. et al. [Liver cell culture in bioreactors for in vitro drug studies as an
alternative to animal testing]. ALTEX 17, 3–10 (2000).
133. Sussman, N. L. et al. Reversal of fulminant hepatic failure using an
extracorporeal liver assist device. Hepatology 16, 60–65 (1992).
134. Sussman, N. L., Gislason, G. T., Conlin, C. A. & Kelly, J. H. The Hepatix
extracorporeal liver assist device: initial clinical experience. Artif. Organs 18,
390–6 (1994).
135. Patzer, J. F. et al. Novel bioartificial liver support system: Preclinical evaluation.
in Annals of the New York Academy of Sciences 875, 340–352 (1999).
136. Mazariegos, G. V et al. Safety observations in phase I clinical evaluation of the
References
100
Excorp Medical Bioartificial Liver Support System after the first four patients.
ASAIO J. 47, 471–475 (2001).
137. Mazariegos, G. V et al. First clinical use of a novel bioartificial liver support
system (BLSS). Am. J. Transplant 2, 260–266 (2002).
138. Watanabe, F. D. et al. Clinical experience with a bioartificial liver in the
treatment of severe liver failure. A phase I clinical trial. Ann. Surg. 225, 484–
491; discussion 491–494 (1997).
139. Demetriou, A. A. et al. Prospective, Randomized, Multicenter, Controlled Trial
of a Bioartificial Liver in Treating Acute Liver Failure. Ann. Surg. 239, 660–670
(2004).
140. Samuel, D. et al. Neurological improvement during bioartificial liver sessions in
patients with acute liver failure awaiting transplantation. Transplantation 73,
257–264 (2002).
141. Mullon, C. & Pitkin, Z. The HepatAssist® Bioartificial Liver Support System:
clinical study and pig hepatocyte process. Expert Opin. Investig. Drugs 8, 229–
235 (1999).
142. Sosef, M. N. et al. ASSESSMENT OF THE AMC-BIOARTIFICIAL LIVER IN
THE ANHEPATIC PIG. Transplantation 73, 204–209 (2002).
143. Van De Kerkhove, M. P. et al. Phase I clinical trial with the AMC-bioartificial
liver. Int. J. Artif. Organs 25, 950–959 (2002).
144. Gerlach, J. C. Development of a hybrid liver support system: A review.
International Journal of Artificial Organs 19, 645–654 (1996).
145. Sauer, I. M. et al. Clinical extracorporeal hybrid liver support - Phase I study
with primary porcine liver cells. Xenotransplantation 10, 460–469 (2003).
146. Sauer, I. M. et al. Extracorporeal liver support based on primary human liver
cells and albumin dialysis - Treatment of a patient with primary graft non-
function. J. Hepatol. 39, 649–653 (2003).
147. Zeilinger, K. et al. Time course of primary liver cell reorganization in three-
dimensional high-density bioreactors for extracorporeal liver support: an
immunohistochemical and ultrastructural study. Tissue Eng. 10, 1113–1124
(2004).
148. Schmelzer, E. et al. Effect of human patient plasma ex vivo treatment on gene
expression and progenitor cell activation of primary human liver cells in multi-
compartment 3D perfusion bioreactors for extra-corporeal liver support.
Biotechnol. Bioeng. 103, 817–827 (2009).
149. Zeilinger, K. et al. Scaling down of a clinical three-dimensional perfusion
multicompartment hollow fiber liver bioreactor developed for extracorporeal
liver support to an analytical scale device useful for hepatic pharmacological in
vitro studies. Tissue Eng. Part C. Methods 17, 549–556 (2011).
150. Lübberstedt, M. et al. Serum-free culture of primary human hepatocytes in a
miniaturized hollow-fibre membrane bioreactor for pharmacological in vitro
studies. J. Tissue Eng. Regen. Med. 9, 1017–1026 (2015).
151. Knöspel, F., Freyer, N., Stecklum, M., Gerlach, J. C. & Zeilinger, K. Periodic
Harvesting of Embryonic Stem Cells from a Hollow-Fiber Membrane Based
Four-Compartment Bioreactor. Biotechnol. Prog. 32, 141–151 (2015).
152. Raschzok, N. et al. Imaging of primary human hepatocytes performed with
micron-sized iron oxide particles and clinical magnetic resonance tomography. J.
Cell. Mol. Med. 12, 1384–1394 (2008).
153. Pless, G. et al. Evaluation of primary human liver cells in bioreactor cultures for
extracorporeal liver support on the basis of urea production. Artif. Organs 30,
References
101
686–694 (2006).
154. Gerlach, J. C. et al. Lidocaine/monoethylglycinexylidide test, galactose
elimination test, and sorbitol elimination test for metabolic assessment of liver
cell bioreactors. Artif. Organs 34, 462–72 (2010).
155. Santoro, R., Krause, C., Martin, I. & Wendt, D. On-line monitoring of oxygen as
a non-destructive method to quantify cells in engineered 3D tissue constructs. J.
Tissue Eng. Regen. Med. 6, 696–701 (2012).
156. Lei, K. F., Wu, M. H., Hsu, C. W. & Chen, Y. D. Real-time and non-invasive
impedimetric monitoring of cell proliferation and chemosensitivity in a perfusion
3D cell culture microfluidic chip. Biosens. Bioelectron. 51, 16–21 (2014).
157. Sharma, R., Blackburn, T., Hu, W., Wiltberger, K. & Velev, O. D. On-chip
microelectrode impedance analysis of mammalian cell viability during
biomanufacturing. Biomicrofluidics 8, 54108 (2014).
158. Ehret, R. et al. Monitoring of cellular behaviour by impedance measurements on
interdigitated electrode structures. Biosens. Bioelectron. 12, 29–41 (1997).
159. Peyre, L. et al. High-content screening imaging and real-time cellular impedance
monitoring for the assessment of chemical ’ s bio-activation with regards
hepatotoxicity. Toxicol. Vitr. 29, 1916–1931 (2015).
160. Witkowski, P. T. et al. Cellular impedance measurement as a new tool for
poxvirus titration, antibody neutralization testing and evaluation of antiviral
substances. Biochem. Biophys. Res. Commun. 401, 37–41 (2010).
161. Ramasamy, S., Bennet, D. & Kim, S. Drug and bioactive molecule screening
based on a bioelectrical impedance cell culture platform. International Journal of
Nanomedicine 9, 5789–5809 (2014).
162. Atienza, J. M. et al. Dynamic and label-free cell-based assays using the real-time
cell electronic sensing system. Assay Drug Dev. Technol. 4, 597–607 (2006).
163. Tang, W., Song, H., Cai, W. & Shen, X. Real Time Monitoring of Inhibition of
Adipogenesis and Angiogenesis by (-)-Epigallocatechin-3-Gallate in 3T3-L1
Adipocytes and Human Umbilical Vein Endothelial Cells. Nutrients 7, 8871–
8886 (2015).
164. Urcan, E. et al. 300_Urcan_xCellignece_2010. Dent. Mater. 26, 51–58 (2010).
165. Quereda, J. J. et al. Validation of xCELLigence real-time cell analyzer to assess
compatibility in xenotransplantation with pig-to-baboon model. Transplant.
Proc. 42, 3239–3243 (2010).
166. Lei, K. F., Huang, C. H. & Tsang, N. M. Impedimetric quantification of cells
encapsulated in hydrogel cultured in a paper-based microchamber. Talanta 147,
628–633 (2016).
167. Lei, K. F., Wu, M. H., Hsu, C. W. & Chen, Y. D. Electrical impedance
determination of cancer cell viability in a 3-Dimensional cell culture microfluidic
chip. Int. J. Electrochem. Sci. 7, 12817–12828 (2012).
168. Canali, C. et al. An impedance method for spatial sensing of 3D cell constructs--
towards applications in tissue engineering. Analyst 140, 6079–6088 (2015).
169. Knobeloch, D. et al. Human hepatocytes: isolation, culture, and quality
procedures. Methods Mol. Biol. 806, 99–120 (2012).
170. Pfeiffer, E. et al. Featured Article: Isolation, characterization, and cultivation of
human hepatocytes and non-parenchymal liver cells. Exp. Biol. Med. (Maywood).
240, 645–56 (2015).
171. Borisov, S. M., Neurauter, G., Schroeder, C., Klimant, I. & Wolfbeis, O. S.
Modified dual lifetime referencing method for simultaneous optical
determination and sensing of two analytes. Appl. Spectrosc. 60, 1167–1173
References
102
(2006).
172. Fairhall, E. A. Hepatocyte generation from pancreatic acinar cell lines. PhD
thesis Newcastle Univ. Fac. Med. Sci. Inst. Cell. Med. 1–228 (2013). at
<https://theses.ncl.ac.uk/dspace/handle/10443/2375>
173. Probert, P. M. E. et al. An expandable donor-free supply of functional
hepatocytes for toxicology. Toxicol. Res. 4, 203–222 (2015).
174. Stachelscheid, H. et al. Teratoma formation of human embryonic stem cells in
three-dimensional perfusion culture bioreactors. J. Tissue Eng. Regen. Med. 7,
729–741 (2013).
175. Hoekstra, R. et al. The HepaRG cell line is suitable for bioartificial liver
application. Int. J. Biochem. Cell Biol. 43, 1483–1489 (2011).
176. Richter, M. et al. Pancreatic progenitor-derived hepatocytes are viable and
functional in a 3D high density bioreactor culture system. Toxicol. Res. (Camb).
5, 278–290 (2016).
177. Mew, N. A. et al. Effects of a single dose of N-carbamylglutamate on the rate of
ureagenesis. Mol. Genet. Metab. 98, 325–330 (2009).
178. Meredith, C., Scott, M. P., Renwick, A. B., Price, R. J. & Lake, B. G. Studies on
the induction of rat hepatic CYP1A, CYP2B, CYP3A and CYP4A subfamily
form mRNAs in vivo and in vitro using precision-cut rat liver slices. Xenobiotica.
33, 511–527 (2003).
179. Thangavel, C., Dhir, R. N., Volgin, D. V. & Shapiro, B. H. Sex-dependent
expression of CYP2C11 in spleen, thymus and bone marrow regulated by growth
hormone. Biochem. Pharmacol. 74, 1476–1484 (2007).
180. Mottino, A.-D. & Catania, V.-A. Hepatic drug transporters and nuclear receptors:
regulation by therapeutic agents. World J Gastroenterol 14, 7068–7074 (2008).
181. Ratra, G. S., Cottrell, S. & Powell, C. J. Effects of induction and inhibition of
cytochromes P450 on the hepatotoxicity of methapyrilene. Toxicol. Sci. 46, 185–
96 (1998).
182. Laine, J. E., Auriola, S., Pasanen, M. & Juvonen, R. O. Acetaminophen
bioactivation by human cytochrome P450 enzymes and animal microsomes.
Xenobiotica. 39, 11–21 (2009).
183. Rodríguez, A. J. et al. A fiber optic ammonia sensor using a universal pH
indicator. Sensors (Basel). 14, 4060–4073 (2014).
184. Stanger, B. Z. & Hebrok, M. Control of cell identity in pancreas development
and regeneration. Gastroenterology 144, 1170–1179 (2013).
185. Dabeva, M. D., Hurston, E., Shafritz, D. A. & Bessin, M. Transcription Factor
and Liver-Specific mRNA Expression in Facultative Epithelial Porgenitor Cells
of Liver and Pancreas. Am. J. Pathol. 147, 1633–1648 (1995).
186. Rao, M. S., Yukawa, M., Omori, M., Thorgeirsson, S. S. & Reddy, J. K.
Expression of transcription factors and stem cell factor precedes hepatocyte
differentiation in rat pancreas. Gene Expr. 6, 15–22 (1996).
187. Huang, P. et al. Induction of functional hepatocyte-like cells from mouse
fibroblasts by defined factors. Nature 475, 386–389 (2011).
188. Gerlach, J. C. et al. Interwoven four-compartment capillary membrane
technology for three-dimensional perfusion with decentralized mass exchange to
scale up embryonic stem cell culture. Cells Tissues Organs 192, 39–49 (2010).
List of Publications 103
List of Publications
Knöspel, F., Jacobs, F., Freyer, N., Damm, G., De Bondt, A., Van Den Wyngaert, I.,
Snoeys, J., Monshouwer, M., Richter, M., Strahl, N., Seehofer, D., Zeilinger, K. In
vitro model for hepatotoxicity studies based on primary human hepatocyte cultivation in
a perfused 3D bioreactor system. Int. J. Mol. Sci. 2016, 17 (4), pii:E584, DOI:
10.3390/ijms17040584; http://www.mdpi.com/1422-0067/17/4/584.
Richter, M., Fairhall, E.A., Hoffmann, S.A., Tröbs, S., Knöspel, F., Probert, P.M.E.,
Oakley, F., Stroux, A., Wright, M.C., Zeilinger, K. Pancreatic progenitor-derived
hepatocytes are viable and functional in a 3D high density bioreactor culture system.
Toxicol. Res. 2016, 5 (1), 278-290, DOI: 10.1039/C5TX00187K;
http://pubs.rsc.org/en/Content/ArticleLanding/2016/TX/C5TX00187K#!divAbstract.
Fairhall, E.A., Charles, M.A., Wallace, K., Schwab, C.J., Harrison, C.J., Richter, M.,
Hoffmann, S.A., Charlton, K.A., Zeilinger, K., Wright, M.C. The B-13 hepatocyte
progenitor cell resists pluripotency induction and differentiation to non-hepatocyte cells.
Toxicol. Res. 2013, 2(5), 308-320, DOI: 10.1039/C3TX50030F;
http://pubs.rsc.org/en/content/articlelanding/2013/tx/c3tx50030f#!divAbstract.
Miller, L., Richter, M., Hapke, C., Nitsche, A. Genomic expression libraries for the
identification of cross-reactive orthopoxvirus antigens. PLoS One 2011, 6(7), e21950,
DOI:10.1371/journal.pone.0021950;
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0021950.
Conference and workshop participation 104
Conference and workshop participation
Richter, M., Tröbs, S., Cosnier, M-L., Schuck, H., Freyer, N., Schubert, F., Wright,
M.C., Zeilinger, K. Integration of multi-parametric sensor systems in bioartificial liver
support system. 41st Annual Congress of the European Society for Artificial Organs
(ESAO), September 17-20 2014, Rom, Italy (Oral presentation).
Richter, M., Fairhall E.A., Hoffmann, S.A., Schubert, F., Wright, M.C., Zeilinger, K.
Hepatic trans-differentiation of pancreatic hepatocyte-progenitor cells (B-13) in a 3D
high-density culture system. German Association for the study of the Liver (GASL),
January 24-25 2014, Tübingen, Germany (Oral presentation).
Richter, M., Fairhall, E.A., Hoffmann, S.A., Frühwald, J., Wright, M.C., Zeilinger, K.
Dexamethasone induced hepatic differentiation of rat pancreatic progenitor cells (B-13)
in a 3D multi-compartment bioreactor system. European Association for the study of the
liver (EASL), April 24-28 2013, Amsterdam, Netherland (Poster).
Richter, M., Ertel, C., Hoffmann, S.A., Lübberstedt, M., Müller-Vieira, U., Biemel, K.,
Schulz, A., Damm, G., Nüssler, A.K., Zeilinger, K. Bioreactor system suitable for in
vitro studies on hepatic metabolism and cell re-organization. German Conference on
Bioinformatics; Satellite Workshop Organ-oriented System Biology, September 19.
2012, Jena, Germany (Oral presentation).
Richter, M., Hoffmann, S.A., Ertel, C., Müller-Vieira, U., Biemel, K., Damm, G.,
Nüssler, A.K., Zeilinger, K. Characterization of the time course of re-organization of
primary human liver cells in a miniaturized 3D bioractor system. Conference on
Systems Biology of Mammalian Cells (SBMC), July 9-11 2012, Leipzig, Germany
(Poster).
