Document [original]

Model for tooth development in vitro

vorgelegt von

Diplom-Ingenieurin

Jennifer Rosowski

geboren in Berlin

von der Fakultät III Prozesswissenschaften

der Technischen Universität Berlin

zur Erlangung des akademischen Grades

Doktor der Ingenieurwissenschaften

(Dr.-Ing.)

genemigte Dissertation

Promotionsausschuss

Vositzende: Prof. Dr. Vera Meyer

Gutachter: Prof. Dr. Roland Lauster

Gutachterin: Prof. Dr. Claudia Fleck

Gutachter: Prof. Dr. Juri Rappsilber

Gutachter: PD Dr. Frank P. Strietzel

Tag der wissenschaftlichen Aussprache: 25. Januar 2019

Berlin 2019

„Wer am Ende ist, kann von vorn anfangen,

denn das Ende ist der Anfang von der anderen Seite.“

- Karl Valentin -

Abstract

The ultimate goal of Tissue Engineering is the regeneration of whole organs or func-

tional organ units. Recent approaches rely on the usage of adult tissue-specific cells in

three-dimensional culture. It is now accepted that "Developmental Engineering", the

recapitulation of critical initial steps of organogenesis in vitro, is more expedient. Identi-

fication of key players and basic mechanisms behind organ formation is one of the major

challenges for tissue engineering. Developmental biology addresses these questions and

much knowledge has been accumulated on the mechanisms behind organogenesis by study-

ing animal models. However, animal models evince species-related limitations and arise

ethical issues. Functional in vitro models emulating the physiological processes during

human organ formation and homeostasis are requested and invaluable for future research.

Here, a developmentally inspired approach is pursued to reproduce fundamental steps of

human tooth organogenesis in vitro. The presented model comprises the usage of human

dental pulp cells from adult donors that were expanded in monolayer before to culture under

non-adherent conditions to accomplish a 3D self-organized mesenchymal condensation. The

cells reproducibly formed uniform organoids of 500

m in diameter, resembling the size of

a human mesenchymal tooth germ. Comprehensive gene expression analysis by qPCR and

Next Generation Sequencing revealed a dramatic remodelling of the signalosome in the

DPCs. The cells instantly responded to the changed culture conditions and subsequent

cell-cell interaction with significantly modulated gene expression regarding cytoskeletal

rearrangement. The suppression of RhoA activity was exhibited, a central molecule in

actin-mediated mechanotransduction leading to cell shape change and subsequent induction

of tissue-specific cell fate. The central role of actin-mediated signalling was evidenced by

a functional assay, in which the actin polymerization and thereby cytoskeletal signalling

was inhibited. No cell-cell contacts or condensation was observed in the DPCs upon

administration of the inhibitor. Furthermore, central signalling pathways of mesenchymal

condensation have been shown to be upregulated within the first six hours of the culture

model. Among them are the TGFß- and Activin, the FGF, the Wnt, and the Notch

pathway. The bivalent results from transcriptional analysis, regarding the activation status

of the MAPK pathway, were unraveled by a MAPK reporter assay, which evidenced an

immediate-early MAPK activity within minutes of condensation. A Collagen-binding

eGFP-fused protein (CNA-eGFP) was applied to the DPC condensations to track Collagen

protein secretion, which was visible after 4 hours. From protein analyses by immunohisto-

logical staining, after 4 days of condensation, the ECM components Tenascin, Fibronectin,

Collagen type I and type IV were present in the DPC condensates. Long-term cultures of

DPC condensates (4 weeks) showed odontogenic differentiation by upregulated expression

of Dentin sialophosphoprotein, TGFß1, Activin, and BMP7. Inductive abilities of the

self-organized dental mesenchyme were evidenced in co-culture with epithelial cells, that

exhibited invagination and cytodifferentiation.

The presented model of tooth development fulfills all demands on a functional human

organogenesis model. It recapitulates the initial step of mesenchymal condensation and

subsequent odontogenic differentiation and is capable of directing reciprocal differentiation

induction of combined epithelium. Therefore, it represents a valuable model to study

basic developmental mechanisms and is in the pipeline to find application in regenerative

therapies.

Zusammenfassung

Das Ziel des Tissue Engineering ist es, vollständige Organe oder funktionelle Organeinheiten

in vitro herzustellen. Aktuelle Forschungsansätze beruhen auf der Verwendung adulter,

gewebsspezifischer Zellen in drei-dimensionaler Zellkultur. Dabei wird die Rekapitulation

initialer Schritte der Organogenese als vielversprechendste Herangehensweise betrachtet.

Ein wesentlicher Aspekt des Tissue Engineering befasst sich daher mit der Identifizierung

von zentralen Molekülen und den grundlegenden Mechanismen der Organentwicklung. Das

Forschungsfeld der Entwicklungsbiologie hat unter Einsatz von Tiermodellen dahingehend

viel zum aktuellen Wissensstand beigetragen. Diese bergen allerdings spezies-geschuldete

Limitierungen und ethische Probleme. Funktionelle in vitro-Modelle, die die physiologischen

Prozesse der humanen Organentwicklung und -aufrechterhaltung nachbilden, sind daher

von unschätzbarem Wert für die zukünftige Wissenschaft.

In der vorliegenden Arbeit wurde die Nachahmung der natürlichen Prozesse bei der ini-

tialen Zahnentwicklung im Menschen unter Kulturbedingungen erreicht. Das Kulturmodell

basiert auf der Verwendung adulter in vitro-expandierter Zellen aus der Zahnpulpa (DPCs),

die unter nicht-adhärenten Bedingungen mesenchymale Kondensation autonom vollziehen.

Dabei formierten sich einheitliche Organoide von 500

m Durchmesser, was der Größe

eines humanen fetalen Zahnkeims entspricht. Umfassende Genexpressionsanalysen mit-

tels qPCR und Next Generation Sequencing, offenbarten drastische Veränderungen im

Signalosom der DPCs. Die Zellen antworteten auf die veränderten Kulturbedingungen

und zahlreichen Zell-Zell-Kontakte mit einer signifikanten Regulation der Gene, die eine

Rolle bei Remodellierung des Zytoskeletts spielen. Die RhoA-Aktivität wurde supprimiert,

einem zentralen Molekül der Aktin-vermittelten Mechanotransduktion, das Veränderung

der Zellform und die Induktion der gewebsspezifischen Zellidentität ermöglicht. Durch

Inhibition der Aktinfilamentbildung, konnte die zentrale Rolle des Aktin-vermittelten

Signalwegs in einem funktionellen Assay nachgewiesen werden. Die Ausbildung von Zell-

Zell-Kontakten und die mesenchymale Kondensation wurde dabei komplett verhindert.

Zentrale Signaltransduktionswege der mesenchymalen Kondensation waren nach sechs

Stunden der in vitro-Kondensation hochreguliert, unter anderem der TGFß-, der Activin-,

der FGF-, der Wnt- und der Notch-Signalweg. Der aufgrund der RNA Seq Ergebnisse

uneindeutige Aktivierungsstatus des MAPK-Signalwegs konnte in einem weiteren funktion-

ellen Assay mithilfe eines Reportervektors geklärt werden. Innerhalb von Minuten wurde

die MAPK-Aktivität unmittelbar als Reaktion auf die in vitro-Kondensation getriggert.

Nach vierstündiger Kultur im Kondensationsmodell konnte die Kollagensekretion mittels

eines Kollagen-bindenden-eGFP-Fusionsproteins in Echtzeit beobachtet werden. Weitere

Proteinanalysen per Immunhistologie zeigten nach viertägiger Kultur die Anwesenheit

der extrazellulären Moleküle TNC, FN, Collagen Typ I und IV. Die Genexpression von

DSPP, TGFß1, Activin und BMP7 wiesen nach vierwöchiger Langzeitkultur auf eine

odontogene Differenzierung innerhalb der Kondensate hin. Die Funktionalität im Hinblick

auf Induktivität und reziproker Interaktion mit Epithelzellen, konnte in Co-Kulturansätzen

gezeigt werden, wobei die epithelialen Zellen in das Mesenchym invaginiert sind und dort

differenziert sind. Zusammengefasst kann in dieser Arbeit gezeigt werden, dass das an-

gewandte Zellkulturmodell einem funktionellen humanen Organogenesemodell entspricht.

Der initiale Schritt der mesenchymalen Kondensation und anschließende odontogene Dif-

ferenzierung führen zur Bildung eines induktiven Zahnprimordiums, das mit epithelialen

Zellen in Interaktion treten kann. An diesem Modell können zukünftige weitere Studien zur

Aufklärung grundlegender Mechanismen der Organentwicklung stattfinden. Die produzier-

ten Zahnkeime sollen in naher Zukunft Anwendung in Studien für regenerative Therapien

finden.

Abbreviations

7-AAD 7-aminoactinomycin D

AKT protein kinase B

bmMSC bone marrow-derived mesenchymal stromal

cell

BMP bone morphogenic protein

CD cluster of differentiation

cDNA complementary DNA

CDS coding sequence

CFSE carboxyfluorescein succinimidyl ester

CNA collagen adhesin

COL collagen

CytD Cytochalasin D

DAPI 4,6-diamidin-2-phenylindol

DEJ dentin-enamel-junction

DMEM Dulbecco’s modified Eagle medium

DNA deoxyribonucleic acid

DPC dental pulp cell

DPSC dental pulp stem cell

DSPP dentin sialophophoprotein

ECM extracellular matrix

eGFP enhanced green fluorescent protein

EMT epithelial-mesenchymal transition

FACS fluorescence-activated cell sorting

FC fold change

FCS fetal calf serum

FDR false discovery rate

FGF fibroblast growth factor

FN fibronectin

FOXO forkhead box protein O

FPKM fragments per kilobase of transcript per

million mapped reads

FSC forward scatter

GAG glycosaminoglycan

GAPDH glyceraldehyde 3-phosphate dehydrogenase

GO gene ontology

GSEA Gene Set Enrichment Analysis

HEK293T human embryonic kidney cell line

HGF hepatocyte growth factor

INHBA inhibin ß A subunit

iPSC induced pluripotent stem cell

LiCl Lithiumchlorid

MAPK mitogen-activated protein kinase

mRNA messenger RNA

MSX1 msh homeobox

NCAM neural cell adhesion molecule

NES nestin

OD optical densitiy

PAX paired box

PBS phosphate buffered saline

PCA principal component analysis

PDL periodontal ligament

PEI polyethylenimine

Pi3K phosphatidylinositol-3-kinase

PS penicillin/streptomycin

PTX pertussis toxin

qRT-PCR quantitative reverse transcription

polymerase chain reaction

RE response element

RNA ribonucleic acid

RPM reads per million

SDC syndecan

SEM standard error of mean

SMAD mothers against decapentaplegic homolog

SSC side scatter

TF transcription factor

TGF transforming growth factor

TNC tenascin

ULA ultra-low attachment

WNT Wingless-type MMTV integration site

Contents

1 Introduction 1

1.1 Tooth anatomy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

1.1.1 Dental Pulp . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

1.1.2 Dentin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

1.1.3 Enamel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

1.1.4 Periodontium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

1.2 Tooth development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

1.2.1 Thickening . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

1.2.2 Bud stage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

1.2.3 Cap stage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

1.2.4 Bell stage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

1.2.5 Amelogenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12

1.2.6 Dentinogenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14

1.2.7 Tooth eruption . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

1.2.8 Permanent dentition . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16

1.2.9 Signaling pathways in tooth development . . . . . . . . . . . . . . . . 17

Transforming growth factor receptor pathway . . . . . . . . . . . . . 17

1.2.10 Mesenchymal Condensation . . . . . . . . . . . . . . . . . . . . . . . . 21

1.3 State of the Art - Tissue Engineering . . . . . . . . . . . . . . . . . . . . . . 23

1.4 Aims of this work . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

2 Materials & Methods 27

2.1 Cell isolation and cell culture . . . . . . . . . . . . . . . . . . . . . . . . . . . 29

2.1.1 Isolation of Human Dental Pulp Cells from adult third molars . . . . 29

2.1.2 Isolation of gingival keratinocytes . . . . . . . . . . . . . . . . . . . . 29

2.1.3 Standard cell culture . . . . . . . . . . . . . . . . . . . . . . . . . . . 29

2.1.4 Condensation process for formation of artificial tooth primordium . . 29

2.1.5 Co-Culture assays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30

2.1.6 In vitro differentiation assays . . . . . . . . . . . . . . . . . . . . . . . 30

2.1.7 Freezing and thawing of cells . . . . . . . . . . . . . . . . . . . . . . . 31

2.2 Flow Cytometry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31

2.2.1 Surface marker staining . . . . . . . . . . . . . . . . . . . . . . . . . . 31

2.2.2 CFSE assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31

2.2.3 Viability assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

2.3 Cell Tracker Red labeling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

2.4 Collagen tagging via CNA35-eGFP . . . . . . . . . . . . . . . . . . . . . . . 32

ii Contents

2.5 Histology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33

2.5.1 Sample preparation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33

2.5.2 Hematoxylin/Eosin staining . . . . . . . . . . . . . . . . . . . . . . . 33

2.5.3 Immunohistochemistry . . . . . . . . . . . . . . . . . . . . . . . . . . 33

2.6 Imaging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

2.7 Reporter assay strategies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

2.7.1 Cloning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

2.7.2 Transfection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

2.7.3 Transduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36

2.7.4 Reporter functionality test . . . . . . . . . . . . . . . . . . . . . . . . 36

2.8 Treatment with inhibitory agents . . . . . . . . . . . . . . . . . . . . . . . . 36

2.9 Transcriptome analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36

2.9.1 Reverse transcription . . . . . . . . . . . . . . . . . . . . . . . . . . . 36

2.9.2 Real-Time Quantitative Reverse Transcription PCR (qRT-PCR) . . . 37

2.9.3 Whole Genome Analysis . . . . . . . . . . . . . . . . . . . . . . . . . 39

2.10 Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40

2.11 Bioinformatics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40

3 Results 41

3.1 Characterisation of Human Dental Pulp Cells . . . . . . . . . . . . . . . . . 41

3.1.1 Isolation and in vitro growth characteristics . . . . . . . . . . . . . . . 41

3.1.2 Surface Marker Expression . . . . . . . . . . . . . . . . . . . . . . . . 42

3.1.3 Expression profile of relevant genes . . . . . . . . . . . . . . . . . . . 44

3.1.4 Differentation capacity . . . . . . . . . . . . . . . . . . . . . . . . . . 46

3.2 Mechanisms of ectomesenchymal condensation . . . . . . . . . . . . . . . . . 49

3.2.1 Establishment of 3D cell culture . . . . . . . . . . . . . . . . . . . . . 49

3.2.2 Expression kinetics of relevant genes . . . . . . . . . . . . . . . . . . . 50

3.2.3 Transcriptome of early phase of in vitro condensation . . . . . . . . . 53

3.2.4 In vitro live imaging of collagen deposition . . . . . . . . . . . . . . . 65

3.3 Functional analyses of the in vitro model for mesenchymal condensation . . 66

3.3.1 Analysis of relevant pathways . . . . . . . . . . . . . . . . . . . . . . 66

3.3.2 Inhibition of condensation with small molecules . . . . . . . . . . . . 70

3.3.3 Interaction of inductive condensates with epithelial cells . . . . . . . . 71

4 Discussion 79

4.1 Characteristics of dental pulp cells . . . . . . . . . . . . . . . . . . . . . . . . 79

4.2 Culture model for tooth development . . . . . . . . . . . . . . . . . . . . . . 84

4.3 Early phase of condensation . . . . . . . . . . . . . . . . . . . . . . . . . . . 87

4.4 Co-culture with epithelial cells . . . . . . . . . . . . . . . . . . . . . . . . . . 94

4.5 Conclusion and Perspectives . . . . . . . . . . . . . . . . . . . . . . . . . . . 95

Bibliography 97

Contents iii

5 Appendix A 115

5.1 Supplemental figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115

5.2 Supplemental videos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130

5.3 List of differentially expressed genes . . . . . . . . . . . . . . . . . . . . . . . 130

Publications 145

iv Contents

CHAPTER 1

Introduction

Mammalian teeth represent the mineralized organ appendage located in the oral cavity

as part of the gastrointestinal tract. Their functions are diverse, including mastication,

phonetic articulation, aesthetic perception and they comprise an immunological niche.

Oral health status is associated with overall health, and meta-studies indicate correlation

between poor oral health and cardiovascular diseases, stroke and negative social impacts

(Humphrey et al., 2008;Montebugnoli et al., 2004;Yoshida et al., 2011). Especially

on account to the aesthetic issue, tooth replacement is in the focus of regenerative therapy

research. Meaningful regenerative therapy research necessitates concise knowledge about

the cellular and molecular processes which occur during embryonic organogenesis and the

anatomy of the fully developed organ.

1.1 Tooth anatomy

Fig. 1.1:

Anatomy of a human mandibular

molar tooth (Lacruz et al., 2017)).

The mature permanent tooth organ

is divided into two parts: the crown

and the root. The crown is covered

by the acellular enamel, the hardest

biological tissue in the mammalian or-

ganism. Beneath the enamel, dentin

forms the bulk of the tooth. dentin is

a mineralized rigid but elastic collagen

matrix.

On the root side, the dentin is covered

by a thin layer of cementum. Together

with the periodontal ligament, the alve-

olar bone and the gingiva, it belongs to

the supportive tissues to anchor teeth

in the jaw (Figure 1.1). Dentin is pro-

duced by the innermost cellular part

of the tooth, the odontoblasts in the

dental pulp. The dental pulp is a con-

nective tissue containing the dental

pulp stem cells, odontoblasts, fibro-

blasts, and it is home for the tooth’s vasculature and innervation.

2Chapter 1 Introduction

1.1.1 Dental Pulp

The dental pulp resides within the rigid pulp chamber and root canals. As a consequence

of its function to produce dentin, a unique tissue organization of this specialized connective

tissue is determined.

The dentin-producing cells (

Odontoblasts

) represent the effector part of the pulp and

line the pulpal-dentin junction. The mature odontoblast is a polarized columnar cell,

attached to the secondary dentin, and projects into dentinal tubules with long processes

(Fig. 1.2). Odontoblasts deposit secondary dentin throughout life and tertiary dentin upon

injuries (see Chapter 1.2.6 Dentinogenesis). Besides this prime function, the odontoblast

layer functions as selective barrier. The integrity of the barrier is maintained by cell-cell-

junctions between the odontoblast cell bodies, including desmosomes, tight junctions, and

gap junctions. This property preserves the "well-being" of the pulp: a dentinal fluid is

constantly pressed outwards through the dentinal tubules to dilute potential bacterial or

environmental toxins. The release of proinflammatory cytokines by odontoblasts is further

supporting their protective role in the pulp. By regulating the concentration of potassium

and sodium ions in the tubules, the excitability of nerve endings, neighboring the long

odontoblast processes in the tubules, is adjusted. Thereby, the odontoblasts have a role

in sensory reception of heat and coldness. Gap junctions are formed to synchronize the

odontoblasts in the layer.

Figure 1.2:

Schematic representation of odontoblasts lining the pulpal-dentin complex and

their projection into the dentin (modified from Nanci,2012).

All other elements of the dental pulp have supportive functions by protecting, feeding,

replacing and mechanically stabilizing the odontoblast layer.

The cellular composition and tissue arrangement is depicted in figure 1.3. Odontoblasts are

post-mitotic cells and instantly die upon irreversible injury. They are replaced by dividing

1.1 Tooth anatomy 3

ectomesenchymal undifferentiated cells originating from dental pulp stem cells. Under

pathological conditions, their regenerative function is induced by activation signals (About,

2013) to produce tertiary dentin at the injured site to seal the pulp.

Dental pulp stem

cells (DPSCs)

are multipotent cells. In vivo, they are tissue-specific (Berkovitz et al.,

2009). Thus, these cells of ectomesenchymal origin represent precursor cells and regulate

the dentin-pulp tissue homeostasis. In vitro, these DPSCs are defined by similarities in

gene expression to mesenchymal stromal cells from other tissue sources and odontoblasts.

Immunosurveillance of the pulp is achieved by inflammatory cells that are located through-

out the pulp center. T cells increase in number and infiltrate the odontoblast layer upon

stimulation by dendritic cells in the pulp. Macrophages are involved in pulp turnover by

elimination of dead cells.

Figure 1.3:

Histologic overview of the dentin-pulp complex in lower (left) and higher magni-

fication (right)(Nanci,2012).

The fibroblast

is a ubiquitously occuring cell type in connective tissues. In the dental

pulp, it represents the cellular majority. Interestingly, fibroblasts in the dental pulp appear

stellate-like and show direct cell-cell-contacts among each other. Their function is to main-

tain the pulp matrix, consisting of collagens and glycosaminoglycans. Collagens, principally

type I and type III, are the predominant

extracellular matrix

component (25-32% dry

weight) and form fibrils of around 50 nm in diameter (Amerongen et al., 1983). Collagen

type V and VI are also abundant to a smaller extent, functioning as linking proteins

between the main collagens. Collagen type IV can be detected at the basal lamina between

the pulp and blood vessels, and in the dentino-enamel junction (DEJ) (McGuire et al.,

2014). Other glycoproteins in the pulp are integrins and tenascin. The "ground substance"

of the pulp is composed of water, glycosaminoglycans, and proteoglycans. All four types of

glycosaminoglycans (GAGs) are present in the dental pulp: chondroitin sulfate, dermatan

sulfate, heparan sulfate, and hyaluronic acid. These hydrophilic molecules swell and form

gels in their hydrated form. Also, they allow the movement of ions, water, and nutrients

within the ECM and facilitate cell movement (Berkovitz et al., 2009). In the developing

pulp, chondroitin sulfate is the major GAG, whereas in the mature pulp 60 % of the GAGs

4 Chapter 1 Introduction

are hyaluronic acid. The GAGs are attached to protein cores forming proteoglycans. In

the pulp, these include versican, syndecan, decorin, biglycan, fibronectin, and osteoadherin

(Berkovitz et al., 2009). Molecules exclusively expressed by odontoblast in the periphery

of the pulp to form (pre-)dentin, are dentin sialoprotein and dentin phosphoprotein (see

chapter 1.2.6).

Innervation and blood supply of the dental pulp

Fig. 1.4:

Vascular cast of a dog

tooth pulp. Arterioles occupy

a central position. Beneath the

dentin a high degree of branch-

ing is visible (Takahashi et al.,

1982).

Innervation and vasculature enter and exit the tooth

pulp through the apical foramen, the opening in the

root tip. One or two artery vessels of 150

m enter

the pulp in conjunction with sensory and sympathe-

tic nerve bundles. The vasculature branches in the

coronal area and an extensive vascular capillary net-

work is formed (see figure 1.4). The capillaries supply

the productive odontoblast layer with oxygen and

nutrients. The capillaries do not enter the dentinal

tubules. The pulp blood flow is under nervous control

and it is not surprising, that the dental pulp is richly

innervated. The innervation pattern follows the vas-

culature pattern, beginning with larger bundles in

the center, which extensively branch in coronary

direction. The nerve bundles consist primarily of

sensory afferent fibers and sympathetic branches. A

small number of nerves pass the odontoblast layer

and enter the dentinal tubules to reach the dentinoe-

namel junction. Together with the odontoblasts that

regulate the interstitial composition, they account

for of the "dentin sensitivity". Dentin sensitivity is

responsible for the well-known thermal and tactile

sensation which causes pain and discomfort.

1.1.2 Dentin

Dentin is a yellowish mineralized, yet elastic avascular tissue that encloses the dental

pulp. It is a remarkable tissue since it compensates for mastication forces that act on the

brittle enamel. dentin has a unique tubular architecture to withstand great compressive

and tensile strength. It is a sensitive tissue and capable of repair. Concerning volume,

dentin is composed of 50 % inorganic, 30 % organic compounds and 20 % water. The

mineral component is formed as hydroxyapatite crystals with around 27 % calcium, 13

% phosphorus and carbonate, sodium and magnesium. The crystals are embedded in an

organic matrix which is synthesized by the odontoblasts. This organic matrix is similar to

bone and is composed of 90 % collagens (Type I, Type II, Type V). The collagens form

1.1 Tooth anatomy 5

large fibrils of 100 nm and run parallel to the pulpal surface. Less extant, yet essential are

the other organic matrix components in the dental pulp, such as dentin phosphoproteins,

proteoglycans, osteonectin, osteopontin and growth factors. The dentin phosphoproteins

are the most acidic proteins due to their high phosphate content. Their calcium binding

activity is involved in mineralization of the dentin matrix. Proteoglycans allow collagen

assembly and have a role in cell signal transduction in many processes, such as proliferation,

differentiation, adhesion and migration. Several growth factors, e.g., bone morphogenic

protein (BMP)-2, transforming growth factor (TGF)-ß1 and insulin growth factor (IGF)-II

could be isolated from the dentin matrix. They are suggested to play a role in carious

destruction and induction of repair.

The dentin is traversed by dentin tubules. They contain extracellular fluid and cellular

processes of odontoblasts as well as of neurons. They have a diameter of 1 to 2

m and

play a major role in tooth sensitivity. Histologically a distinct layer can be observed at the

innermost border to the pulp. This matrix is called pre-dentin and contains the deposited

dentin matrix protein before mineralization by the odontoblast processes to form mature

dentin (see chapter Dentinogenesis 1.2.6).

1.1.3 Enamel

Enamel covers the tooth crown and is the hardest biological tissue. It has an enormous

abrasion resistance and withstands shearing and impact forces. Enamel cannot be restored

biologically since the producing cells, the ameloblasts no longer exist in the mature tooth.

Along with the hardness and stiffness comes the brittleness. Luckily, this feature is

compensated by the underlying elastic dentin. The principal component of enamel is

calcium hydroxyapatite which is architectured in the form of crystallites forming prisms.

They represent 90 % of the volume of enamel.

1.1.4 Periodontium

Fig. 1.5:

Schematic repres-

entation of the periodontium

constisting of the alveolar bone,

the periodontal ligament, the ce-

mentum and the gingiva (modi-

fied from Nanci,2012).

The tooth is held in the jaw by three supporting tissues

which together are termed as periodontium. The period-

ontium comprises the periodontal ligament (PDL), the

alveolar bone and the cementum. Cementum covers the

dentin at the root side. The key role of the cementum

is to maintain the integrity of the root, including rege-

neration and positional correction. On the inner surface,

cementum adheres to dentin and on the outer side it at-

taches to collagen fibres of the periodontal ligament. The

fibres of the PDL reach into the organic matrix of the

mineralizing cementum and are embedded into the mature

cementum. The periodontal ligament is a fibrous connec-

tive tissue between the root and the alveolar bone. The

periodontal ligament has important dental functions. Dur-

ing organogenesis it has a specific role in eruption while in

mature teeth it supports the tooth in the jaw. During mas-

ticory loading the PDL tissue acts as suspensory tissue and

comprising mechanoreceptors are involved in neurological

control of mastication. In figure 1.5 the innervation of the

PDL is schematically depicted. In contrast to the fibrous

6 Chapter 1 Introduction

dental pulp tissue, the collagens of the PDL are arranged in stong bundles of 5

m, which

reflects the mechanical demands on that tissue. The predominant cell type in the PDL is the

fibroblast, but since this tissue is regenerative, a proportion of undifferentiated PDL stem

cells can be found. Furthermore, the tissue is home for defence cells, cementoblasts at the

cementum border, osteoblasts lining the tooth socket as well as osteo- and cementoclasts.

Intriguingly, an epithelial remain of the developmental root sheet is located in the PDL,

referred to as epithelial rest of Malassez. Several groups postulate that these remnant cells

represent an epithelial stem cell source for tissue engineering and experimental models to

investigate tooth growth (Rincon et al., 2006;Tsunematsu et al., 2016). The alveolar

process represents the compact bone which lines the alveolus (tooth socket). It is consisting

of a buccal and a lingual cortical plate both meeting the cortical jaw bone 2 mm below

the cementoenamel junction. The alveolar bone is perforated with traversing vessels and

nerves. Collagen fiber bundles from the PDL are embedded into the bone matrix at the

PDL-alveolar border. Thereby, a close interaction between these two supporting tissues

is guaranteed. The alveolar bone shows high plasticity. As other bone tissues in the

body, the alveolar process continously remodels to adapt to functional situations. This

remodeling is accomplished by a balanced interaction of osteoblast mechanotransduction,

bone metabolism, and osteoclast-mediated bone catabolism.

Figure 1.6:

Longitudinal cut through the mandible showing the alveolar bone lining the

tooth socket (Nanci,2012).

1.2 Tooth development 7

1.2 Tooth development

In mammalian embryogenesis, the blastocyst has formed at day 5 to 6 after gestation. It is

divided into the trophoblast which gives rise to extraembryonic tissue and the embryoblast

which gives rise to the embryo itself. This embryoblast undergoes differentiation and during

week three of development, gastrulation starts. After the first two germ layers have formed

(ectoderm dorsally and endoderm ventrally), now the third germ layer, the mesoderm

forms between the two other layers through the development of the primitive streak. From

this three-layered embryo, all tissues and organs develop in the following weeks. The head

and face, including teeth, depend on differentiation of the neural crest from the ectoderm,

mesodermal differentiation, embryonic folding in the lateral and rostrocaudal axis, and

neural tube development. When the neural tube reaches the head region, it massively

expands to form the brain. The folding tissue at the head gives rise to the face with the oral

cavity, which is formed by the ectoderm and the endoderm. Thereby a future connection

between the oral cavity and the gut will form. Cells from the neuroectoderm separate,

undergo epithelial-mesenchymal transition which then allows them to migrate laterally

through the embryo (see figure 1.7, green cells). This process is marked by the expression of

the transcription factors Snail, and furthermore, morphogens (bone morphogenic proteins,

Wnt and fibroblast growth factors) play a critical role. Interestingly, additionally to the

sensory system, the neural crest cells form all connective tissues. This is special since, in

the rest of the embryo, connective tissue is formed from mesoderm. The next steps include

the development of the skull, the face with lips, the palate, the tongue, and the mandible,

and maxilla with joints and teeth. In the following paragraphs, only the process of tooth

formation will be delineated.

Figure 1.7:

Neural tube formation and migration of neural crest cells. Upon signaling of the

notochord, the neural plate folds and forms the neural tube. Neural crests cells (green) develop

at the edges of the closing plate, migrate laterally through the embryo to form craniofacial

structures. Image modified from Pearson Education Inc.

In the dental context, it is important to understand that teeth form from an interplay

between the ectodermal epithelium and the ectomesenychme. Odontogenesis is divided

into three major phases: initiation, morphogenesis, and histogenesis. During initiation

phase, the sites of the future tooth organs are established, and early tooth germs form.

The tooth shape (morphogenesis) is determined by cell proliferation, differentiation and

movement in response to morphogen gradients in the oral cavity. The progression of

8 Chapter 1 Introduction

differentiation leads to histogenesis of the different dental tissues, both mineralized and

unmineralized. Histologically, the developing tooth germs are classified into the following

stages: thickening, bud stage, cap stage, and bell stage.

1.2.1 Thickening

During week six after gestation, a thickened epithelial band forms around the future jaw.

At the site of the presumptive tooth formation, this band forms a placode (see figure 1.8)

and invaginates into the mesenchyme that has formed a mesenchymal condensate. It is

generally accepted that the epithelial invagination induces the mesenchymal condensation,

but recent studies suggest that mechanical strains directly generated by mesenchymal

condensations produce local curvature, namely evagination and invagination, at tissue

interfaces (Hughes et al., 2018). The signaling events involved in placode formation and

mesenchymal condensation interaction are conserved among species, and the underlying

mechanisms apply to all ectodermal appendages, such as teeth, hair, feathers, nails and

glands. The invaginated epithelial band is referred to as dental lamina.

Fig. 1.8:

Histologic

image of the dental

placode (Nanci,2012).

Most molecular analyses have been conducted in mouse

models. Therefore, the majority of the proposed signaling

cascade is based on murine research for understanding develop-

mental pathways during odontogenesis. An exact translation

to human signaling events, especially on the involved (homo-

logous) genes, is not possible. In murine models, an interplay

between stimulatory (FGFs, Wnts, Shh) and inhibitory signals

(BMPs) determines the site of the tooth initiation. PITX2

expression marks the oral epithelium, and SHH marks the

site where the teeth develop. As also shown in other tissue

developmental processes (neural tube patterning, hair, gut,

bladder) epithelial SHH cross-talks with mesenchymal Wnt

(WNT7B) to form the organ boundaries (Ahn et al., 2010;

Lei et al., 2006;Rishikaysh et al., 2014;Shin et al., 2011).

The earliest mesenchymal marker for dental capability are

the LIM-homeobox (Lhx) domain genes LHX6 and LHX7 whose expression is induced by

FGF8 in the first branchial arch. PAX9 (paired-box transcription factor 9) expression in

the mesenchyme marks the site of tooth formation. The PAX9 expression results from

morphogen gradients between FGF8, BMP2, and BMP4 which pattern the oral-aboral sites.

Together with Activin A expression, in the ectomesenchyme PAX9 expression is associated

with the condensation and epithelial budding, respectively. More than 90 genes have been

identified to play important roles in tooth initiation, all enmashed in a complex regulatory

network. Interestingly, once the ectomesenchyme has acquired the program to form teeth,

it will not lose it. Ex vivo cultured dedifferentiated tooth germ ectomesenchymal cells

will re-form teeth when recombined with dental epithelial cells. Even more intriguing is

the observation that murine dental ectomesenchyme induces tooth formation even when

recombined with chicken epithelium (E. Kollar et al., 1980;Thimios A Mitsiadis,

Chéraud et al., 2003), although the avian taxon lost the dental competence 116 million

years ago (Meredith et al., 2014).

1.2 Tooth development 9

1.2.2 Bud stage

The following transitory developmental stage is referred to as bud stage. During that

stage, the two adjacent components (epithelium and mesenchyme) are separated by a basal

membrane. The developing tooth organ at this stage appears as a compact ovoid with

densely packed ectomesenchymal cells around the epithelial bud. In the following step,

the tooth type (incisor, premolar, molar) and tooth shape is determined. This stage is

referred to as bud-to-cap transition. The tip of the bud invaginates (see figure 1.9, center

(arrowhead)) and will form the primary enamel knot. Formation of secondary knots will

form at the site of future tooth cusps.

Figure 1.9:

Bud-to-cap transition in murine tooth development (E13.5 to E14.5). Green

signal indicates cell membranes and red represents collagen type IV. Arrowhead indicates tip

invagination (Takigawa-Imamura et al., 2015).

It is suggested that tooth type specification is related to the odontogenic homeobox code

(see figure 1.10). This "field model hypothesis" is based upon a patterned expression of

various homeobox genes (MSX1, MSX2, BARX1, DLX1, DLX2, ALX3). This patterned

expression of transcription factors is established by overlapping morphogen gradients of

FGFs and BMPs (McCollum et al., 2001). FGF8 and FGF9 are expressed laterally

over the molar field, and BMP4 is expressed medially over the incisor field. BMP4 is in

a regulatory feedback loop with MSX1 and is expressed in the epithelium as well as in

the mesenchyme. Contrarily, in human dental development, the BMP4 expression is not

restricted to the incisor region (Lin et al., 2007).

1.2.3 Cap stage

By the 11th week of human development, the morphogenesis of the tooth organ has

progressed: the epithelium, or enamel organ, invaginates deeper and forms a cap on the

dental mesenchyme (see figure 1.9, right). The condensed mesenchymal tissue is called

dental papilla and will form the pulp and dentin. In histological sections also a mesenchymal

"sac" surrounds the organ, referred to as dental follicle which gives rise to the periodontium.

The enamel organ cells produce extracellular matrix, and the cells are distantly separated.

Still, they keep direct cell-cell-contact via desmosomes and through the pushing forces,

the cell become star-shaped (stellate reticulum). The complete structure is called

tooth

germ

at this stage. At that stage, the dental follicle becomes innervated. Interestingly,

due to nerve-repelling factors, the innervation does not enter the pulp until amelo- and

dentinogenesis take place.

10 Chapter 1 Introduction

Figure 1.10:

The odontogenic

homeobox code in the developing

dental mesenchyme, putatively medi-

ated by epithelial FGF8 and BMP4

morphogens. Domains of BARX1

and DLX1/2 expression overlap in

the molar region, while MSX1/2 and

ALX3 overlap in the incisor region

(McCollum et al., 2001).

1.2.4 Bell stage

Fourteen weeks after gestation morphodifferentiation has further developed and a bell

shape forms in the tooth germ. Up to that stage, the germ was connected to the oral

epithelium through the dental lamina. Now, this dental lamina degenerates. During that

stage, the crown shape is finally determined. The inner enamel epithelium folds inwards

and encompassed the mesenchyme (see figure 1.11). By taking a closer look at the tips

of the enamel organ, which are deepest in the mesenchyme, a zone where the outer and

inner epithelial cells meet, is visible. This region is called the cervical loop. The outer

enamel epithelium, which borders the periphery, appear cuboidal whereas the inner enamel

epithelial cells, which line the dental papilla, assume a columnar shape (see figure 1.12).

Figure 1.11:

Histologic image of

the bell stage of tooth development

(Nanci,2012). The dental lamina

degenerates and the inner enamel

epithelium folds inwards and finally

shapes the tooth.

1.2 Tooth development 11

Fig. 1.12:

Histologic image of the cervical loop with

detailed structure of the inner and outer epithelium

(modified from Poja Collection (3.5 POJA-L142 and

L145), L.G. Poels PhD and P.H.K. Jap PhD)

The cells of the loop have a

high mitotic activity and prolif-

erate until the crown attains its

full size. As indicated before,

within the inner enamel epithe-

lium a delicate structure forms,

the enamel knot. Enamel knots

are locally well-defined clusters of

non-dividing cells. The enamel

knot shares similarities with ec-

todermal ridges in limb develop-

ment. These act as major signal-

ing centers to ensure proper de-

velopment of limbs. Both express

FGFs, BMPs, and MSX2. Early in

bell stage, vascularization of the

pulp starts with small branches

from the vascular trunks, entering

the papilla base. They form a bed

of capillary network in the odon-

toblast layer. Occasionally small

loops enter the dentin (see figure

1.4 and chapter 1.1.1). Spatiotem-

porally with the blood vessels, also the sensory nerve fibers enter the pulp, whereas

sympathetic innervation follows later.

The late bell stage commences at week 18 after gestation and is associated with the

deposition of hard tissues. Detailed information on the enamel and dentin formation are

given in the subsequent chapters. Briefly, the adjacent cells from the pulp and the enamel

organ begin to differentiate to pre-secretory cells. Both cell types acquire a columnar

phenotype, and by deposition of matrix, they form the dentinoenamel junction (DEJ) (see

Figure 1.13). The whole process starts with the deposition of a layer of dentin which acts

as signaling inducer for further cytodifferentiation of the ameloblasts and odontoblasts.

12 Chapter 1 Introduction

Figure 1.13:

Histologic images from human late bell stage with Azan staining. (A) Complete

tooth germ in late bell stage. (B) Higher magnification of the cuspal tip. (C) Detailed image

of the adjacent cell layers of ameloblasts (top) and odontoblasts (bottom). In between, a layer

of dentin has been deposited (blue). (D) Later in development, more dentin (blue) and initial

enamel containing amelogenin (red) has been deposited (from Poja Collection (3.5 POJA-146,

L154 and L164), L.G. Poels PhD and P.H.K. Jap PhD)

1.2.5 Amelogenesis

The epithelial-mesenchymal interactions in the dentinoenamel junction constitute the

initiation of the enamel protein secretion by the inner enamel epithelium. During presecret-

ory stage, the inner enamel epithelial cells undergo a morphogenetic phase throughout

the bell stage of odontogenesis. These cells divide mitotically and are cuboidal or low

columnar. A basal lamina separates the inner enamel epithelium from the underlying

mesenchyme. At the future cusp tips of the tooth, differentiation to preameloblasts begins.

The cells become columnar and polarized. Substantial reciprocal interactions between

the preameloblasts and the preodontoblast allow cytodifferentiation on both sides (see

figure 1.14). Preameloblasts deposit TGFß ligands in the basal lamina which promote

odontoblast differentiation. The basal lamina becomes degraded resulting in an intimate

contact between the future ameloblasts and odontoblasts. This contact is lost when the first

dentin is laid down by the odontoblast, and also preameloblast secrete dentin sialoprotein

transitory. Dentin proteins secreted by odontoblasts (non-collagenous proteins and dentin

sialophosphoprotein (DSPP)) provide signals for the ameloblast to also begin secretion. At

the beginning of the secretory phase, the distal ends of the ameloblasts (facing towards

the odontoblasts), develop an extension, called Tomes’ process (see figure 1.14). The

shape of the Tomes’ processes is responsible for the prismatic pattern of enamel. In these

cellular processes, enamel proteins are translated and packaged into secretory granules

being constitutively secreted. Mineralization and subsequent crystallization immediately

take place interdigitately with the first dentin layer. With growing matrix deposition, the

1.2 Tooth development 13

ameloblasts are displaced from the DEJ, and the Tomes’ processes deeply penetrate the

forming enamel. The mineralizing front of the enamel appears as a honeycomb structure,

consisting of interrod structures, as a result from the proximal part of the Tomes’ processes,

and of enamel crystal rods, formed by the distal proportion of the processes (see Figure

1.15). The immature enamel has a high content of water and proteins, a low content of

carbonated hydroxyapatite including

HPO2 –

CO2–

, Na

, F

, and is porous. Once the

full thickness of enamel matrix has been laid down, the Tomes’ processes degenerate and

become flattened and ruffle-ended. Before the tooth erupts, the enamel is matured by

mineralization. During a transitional phase, the ameloblasts shorten and around 50 %

undergo apoptosis.

Figure 1.14:

Schematic illustration of differentiation processes involved in enamel development.

(a) Pre-secretory: At the interface of the inner enamel epithelium (IEE) and the dental

mesenchyme (DM), matrix deposition is initiated. The two differentiating cell layers of pre-

odontoblasts (Pre-Od) and pre-ameleoblasts (Pre-Am) are separated by a basal membrane

(BM) (b) Secretory: Beginning at the cusp tips, the epithelium will differentiate to ameloblast

(Am) and will produce Enamel (En) after dentin (De) has been deposited by the odontoblast

(Od). Note the special form of the secretory ameloblasts at the proximal end (Tomes’ process;

TP). The deposited enamel has two alternating configurations: interrod (IR) and rod (R)

enamel (either as result of the proximal or distal border of the Tomes’ process). (c) Maturation:

Enamel proteins will be degraded and replaced by hydroxyapatite crystals. During this stage,

the ameloblast become shorter and exhibit transitory phenotypes with ruffle-ends (resorptive)

or smooth ends (secretory). BV - blood vessels, PL - periodontal ligament, SI - stratum

intermedium (B Kulkarni et al., 2017).

During enamel maturation, the bulk of water and organic material is removed by the

ameloblasts and the space is filled with additional inorganic material (calcium, phosphate

and carbonate ions). Thereby, the crystal seeds from the secretory stage harden and

enlarge in diameter. The enamel proteins that were laid down during secretory phase now

play a role in the maturation. 90 to 95 % of the proteins are amelogenins, and 5-10 %

are non-amelogenins such as enamelins, ameloblastin, tuftelin, and proteolytic enzymes.

Amelogenins are hydrophobic low-molecular proteins that undergo extensive extracellular

processes by proteolytic enzymes (MMP20 and kallikrein). The resulting pieces all have

different functions in crystal growth. As described above, mineralization runs almost

parallel to secretion. That means that the ameloblasts modulate their phenotype from

14 Chapter 1 Introduction

secretory (smooth ended) to resorptive (ruffle-ended) about five to seven times in their

lifespan.

Figure 1.15:

Left: Schematic representation of the organization of secretory stage ameloblasts.

Top right: Enamel crystal alignment within the enamel rods. Bottom right: a transversal view

on enamel exhibits a honeycomb structure with the hexagonal rod crystallites surrounded by

inter-rod enamel (Gasse et al., 2013;Nanci,2012). Bar represents 20 µm.

1.2.6 Dentinogenesis

In parallel with the differentiation of the inner enamel epithelium during bell stage, also the

differentiation of the adjacent cells of the dental papilla occurs. The ectomesenchymal cells

lining the basal membrane elongate rapidly, polarize and turn on their protein-synthesizing

machinery. This odontoblast differentiation is thought to be induced by the reciprocal

epithelial-mesenchymal interaction, namely from signaling factors (BMPs, SHH, Wnt,

FGFs) expressed from the enamel knot and deposited in the basal lamina. In preparation

to matrix secretion, the surface of the odontoblasts is firstly enlarged by the formation of

1.2 Tooth development 15

numerous small cell processes towards the basal membrane. This border is later reduced

to single, thin and long processes, which occupy the dentin tubuli (Tomes’ fiber). After

differentiation, the organic matrix produced by the odontoblasts, is the basis for dentin.

Large collagen type III fibrils associated with fibronectin are the first product of secretion

(Korff’s fibers) (Abrahão et al., 2006). Afterwards, also smaller fibrils of collagen type I

are laid down parallel (in mantle dentin) and later orthogonal (in circumpulpal dentin) to

the later DEJ. Through constitutive deposition of matrix the thickness of the predentin

enlarges. The plasma membrane of the odontoblast extends, and the Tomes’ fiber (long

single process) is left behind in the matrix and thereby elongates (see figure 1.2). The

odontoblast secretes dentin sialophosphoprotein (DSPP). By protein cleavage, this precursor

results in dentin phosphoprotein (DPP) or phosphophorin and dentin sialoprotein (DSP).

DPP represents the most acidic protein known with an isoelectric point of 1, due to the

very high phosphate content. Its high calcium ion binding properties have been implicated

in the role of the mineralization process of the dentin. The mineralization process occurs in

two patterns: globular and linear calcification. In mantle dentin, calcification is initiated by

deposition of several crystal seeds, which grow in size, capturing the collagen matrix, and

then fuse (globular calcification). In circumpulpal dentin, also mineralization takes place,

which is under control of the protein DPP. Calcium ions are attracted to the predentin,

allowing the growth of crystals or calcospherites. The calcospherites are located in between

the collagen triple helices. This marks the mineralization front from where hydroxyapatite

formation nucleates with a growth parallel to the collagen fibers (see figure 1.16).

The formation of secondary dentin is carried out throughout life-, but is performed at

a much slower rate. The composition is indistinguishable from primary dentin, only the

direction of the dentinal tubules is different. Secondary dentin formation begins after

completion of root formation as the tooth occludes. Tertiary dentin is only produced upon

severe injury of the dentin (e.g., through caries) and depending on the severity of injury it

is described to be slightly irregular regarding tubule patterning or even completely atubular

and bone-like.

Figure 1.16:

Section showing the region of min-

eralized dentin. (A) predentin, (B) mineralized

dentin, (C) calcospherites (Berkovitz et al.,

2009)

16 Chapter 1 Introduction

1.2.7 Tooth eruption

Tooth eruption starts once the roots begin to develop. The process is remarkable, nowhere

else in the body, an organ leaves an intrabony location. In summary, tooth eruption

describes the axial movement of the tooth from its alveolar crypt into the oral cavity.

This includes root formation, bone remodeling, and formation of the periodontal ligament.

During root development, the roots’ hard matrix, the cementum has to be produced.

Cementoblasts derive from the dental follicle cells, and similarly to the odontoblasts, they

produce collagens and other organic material that will be mineralized. The cells of the

dental follicle also give rise to the fibroblasts of the periodontal ligament. They produce

a strong connective tissue that connects to bone and cementum and thereby ensures

attachment of the tooth organ. It is still not understood what initiates tooth eruption.

Undoubtedly, the complex process requires a well-regulated sequence of events. The tooth

germ expresses parathyroid-hormone-related protein and interleukin 1 as well as TGFß1

and epidermal growth factor to attract monocytes and regulate osteoclastogenesis. For

bone resorption of the overlying alveolar bone, mononuclear cells enter the eruption site to

form osteoclasts. They are recruited by macrophage-colony stimulating factor (MCSF) and

monocyte chemotactic protein (MCP)-1, released from the bone. As the tooth reaches the

proximity of the oral cavity, the outer cells of the tooth germs, namely the reduced enamel

epithelial cells, secrete enzymes to degrade the overlying connective tissue of gingiva. After

eruption, these cells unite with the gingiva epithelium to form the dentinogingival junction.

1.2.8 Permanent dentition

In humans and most mammals, there is a limited succession of teeth. To account for the

growth of the face and jaw, the deciduous teeth are replaced by permanent teeth during

physical development in childhood. The described dental lamina that gives rise to the

primary, deciduous dentition, also generates the permanent dentition (see figure 1.17). At

the incisor, canine and premolar site, the dental lamina exhibits a further proliferative

activity so that a second tooth bud forms at the lingual aspect of the deciduous tooth germ

(see figure 1.11). The permanent molars have no predecessor. They arise from the dental

lamina that grows posteriorly under the oral mucosa once the jaw has grown long enough.

The subsequent odontogenesis is virtually identical between deciduous and permanent

teeth although induced at different times of organism development.

Figure 1.17:

Schematic representation of tooth formation depicting the developed tooth buds

from the primary dentition and the small bud at the dental lamina (darker blue) that give rise

to permanent teeth (Nanci,2012).

1.2 Tooth development 17

1.2.9 Signaling pathways in tooth development

Reciprocal and sequential tissue interactions have been identified as the key inducers and

regulators of embryonic development. All inductive interactions in organisms follow a

conserved principle with conserved key players. The nature of the interaction is a chain

reaction of ligand 1 expression by tissue A, reception on tissue B that induces a signaling

cascade to activate gene transcription of ligand 2 in tissue B and subsequent reception of

ligand 2 on tissue A, which induces the expression of a further signaling molecule in tissue A,

etc. As discussed earlier, the reciprocal tissue interactions also apply to tooth development.

The Wnt, BMP, FGF and SHH pathways as well as their respective cross-talks are central

pathways in the reciprocal tissue interaction and will be described in detail here (see figure

1.18). The majority of current understanding of cellular and molecular mechanisms are

based on genetic analyses in the mouse as well as tissue recombinations.

Figure 1.18:

Regulation of tooth formation by reciprocal interactions of epithelial and

mesenchymal tissue. The molecular signaling chain reaction is mediated by BMP/TGFß, FGF,

SHH, and Wnt signaling molecules. The expression sites of transcription factors are listed in

bold boxes (modified from Nanci,2012;Thesleff,2018). For detailed information see text.

Transforming growth factor receptor pathway

The TGFß superfamily includes more than 30 ligand members which are grouped in the

TGFß, the BMP/GDF, the Activin/Inhibin and the GDNF subfamily. They all share the

characteristic of binding to a hetero-tetrameric receptor complex with a serine/threonine

kinase domain and thereby activate an intracellular SMAD-signaling. The activated

receptor complex always consists of two type I and two type II subunits. Once the ligand

binds the type II receptor dimer, it recruits the type I receptor dimer to form the fully

functional receptor complex. The serine/threonine kinase domain of type II receptor

subsequently phosphorylates a glycine-serine-rich domain on the intracellular domain of

18 Chapter 1 Introduction

type I receptor. This leads to a conformational change to expose the catalytic site of type

I receptor and the prior phosphorylation acts as a binding site for the downstream effector

molecule SMAD. The SMAD, in turn, is phosphorylated by the type I receptor and is

thereby activated to dimerize with a co-activating SMAD resulting in the release from

the inhibitor. This enables the dimer to enter the nucleus where it binds transcriptional

promoters and cofactors to regulate transcription of target genes (Massagué et al., 2000).

There exist several levels of regulation and fine-tuning of the TGFß-signaling pathways.

For example, co-receptors can act as "storage" for ligands (e.g., betaglycan). Since the

TGFß superfamily ligands represent the epitome of morphogens, they act in morphogenic

gradients in the extracellular matrix (ECM) between the signaling and the receiving cell in

developing tissues. This gradient is realized by the attachment of the ligands in the ECM,

the expression of inhibitors/antagonists of the ligands or receptor subunits, by expression of

proteases to restrict their sphere, or by the release of proteases by the target cell to liberate

the ligand from the ECM. Expression of these proteases is again subject to complex levels

of regulation, and often an autoregulatory feedback loop with the ligand itself is involved.

On the intracellular level, the signaling is regulated by the balance of availability of receptor

molecules, of SMADs and inhibitors of the intracellular signalosome. This includes the

presence of inhibitory SMADs that compete with Co-SMADs and guide the SMAD dimer

to the proteasome. It becomes evident that the fine-tuned signaling cascade induced by

TGFß superfamily ligands is highly complex and there are many more inhibitory events

that could not be discussed here.

In embryonic tissue development, the TGFß and the BMP pathway seize opposing roles.

They bind to different type I receptor complex types: TGFß and Activin/Inhibin ligands

bind to ALK4/5/7 and subsequently SMAD2 or SMAD3 dimerized with the Co-SMAD 4,

whereas the bone morphogenic proteins bind to ALK1/2/3/6 and thereby activated SMAD1,

SMAD5 or SMAD8 to dimerize with SMAD4. By that they compete on the SMAD4

abundance and once the balance shifts to one side (e.g., through elevated stimulation), the

SMAD4 abundance is no longer sufficient for the other side and indirectly this pathway is

inhibited. These opposing roles come into play during epithelial-mesenchymal-transition of

embryonic development. The transition from epithelial cells to mesenchymal cells and vice

versa is a central process in tissue differentiation and morphogenesis. Epithelial cells are

not capable of migration, and therefore, whenever they have to leave a specific location in

the body, beginning at gastrulation, they have to acquire a mesenchymal phenotype which

is established by TGFß signaling. When cells lose their migratory phenotype and polarize

(e.g., during somitogenesis), they underwent mesenchymal-epithelial-transition induced by

BMPs. A hallmark publication of Zeisberg et al. shows the opposing roles of BMP7 and

TGFß1 in renal fibrosis and regeneration (Zeisberg et al., 2003).

During early murine tooth development, a vibrant activity of BMP2 and BMP4 in the

dental epithelium and mesenchyme is described. The BMPs not only determine the tooth-

forming site and tooth type. Interestingly, they are also implicated in bud-to-cap stage

transition, whereby the odontogenic potential shifts from the epithelium to the dental

mesenchyme. Tissue recombinations have shown that the prime potential to instruct tooth

formation lies in the dental epithelium. However, after the initiation stage at murine E12

(day 12 after gestation), the dental epithelium loses its odontogenic potential, which is

1.2 Tooth development 19

then shifted to the ectomesenchyme (Mina et al., 1987). Epithelial BMP4 induces the

expression of MSX1 in the dental ectomesenchyme which in turn, induces mesenchymal

BMP4 expression (Vainio et al., 1993a). PAX9 and MSX1 act as synergistic transcription

factors on the Bmp4 promoter. In bud-to-cap-stage transition, it induces activation of p21

and MSX2, inducing the epithelium to proliferate and form the enamel knot. Activin A is a

homodimer of two ßA subunits (gene symbol INHBA) and is expressed in the presumptive

tooth germ mesenchyme. It regulates a central receptor, EDAR. INHBA mutants fail

to develop mandibular teeth beyond bud stage (Ferguson et al., 1998). The inhibitor

follistatin has been shown to be required in enamel knots for normal crown and cusp

formation by blocking ameloblast differentiation (X.

P. Wang,Suomalainen,Jorgez

et al., 2004).

TGFß1 also plays a crucial role in ameloblast differentiation and enamel mineralization by

upregulation of MMP20 and KLK4 which degrade the enamel matrix to be replaced by

inorganic material (Cho et al., 2013).

Fibroblast growth factor pathway

The TGFß/BMP signaling during tooth development is in a tight cross-talk with the

fibroblast growth factor (FGF) signaling pathway. FGFs are expressed in all tissues in

adult life and during embryogenesis. The canonical FGFs function auto- or paracrine to

control proliferation, differentiation, and survival. FGFs are tightly bound to heparan

sulfate proteoglycans in the ECM to limit their sphere and to increase their specificity. FGF

receptors (FGFR) are tyrosine-kinase linked with an extracellular immunoglobulin-like

domain for ligand binding. Upon ligand binding, the intracellular domains of the receptor

units cross-phosphorylate and thereby activate docking sites for downstream messengers

or effectors. Different classes of pathways can be induced intracellularly, depending on

the receptor adapter that is recruited: Ras-MAPK, Pi3K-Akt, phospholipase C or STAT

pathway (Ornitz et al., 2015).

In murine tooth development, FGF signaling plays a critical role in invagination of the

epithelium and mesenchymal condensation (T. Mammoto,A. Mammoto,Torisawa

et al., 2011). FGF8 and semaphorin 3f, expressed in the early dental epithelium (E11)

attract and repulse ectomesenchymal cells. The resulting mechanical compaction induces

expression of key odontogenic transcription factors PAX9 and MSX1, as well as BMP4

in the dental mesenchyme. Fgfr2b-knockout mice fail to progress tooth formation beyond

bud stage, demonstrating the role of FGFs in the bud-to-cap-stage (Kettunen et al.,

2007). In tooth development, FGF3 and FGF10 have shown to be functionally overlapping.

Double-mutant mice, but not single-mutant, show an arrest at bud stage. FGF3 regulates

epithelial stem cell proliferation in the cervical loop, whereas BMP4 inhibits proliferation

and induces ameloblast differentiation (X.

P. Wang,Suomalainen,Felszeghy et al.,

2007). Knock-out mice of FGF inhibitors, the Sprouty genes, exhibit supernumerary teeth

and ectopic tooth formation (Klein et al., 2008) while Fgf8 knockout is lethal in early

embryonic development. Migration and with it gastrulation is impaired (Sun et al., 1999).

In tooth development, FGF8 of the epithelium induces DLX2 of the mesenchyme (Thomas

et al., 2000).

20 Chapter 1 Introduction

Sonic hedgehog pathway

In murine tooth development, Sonic hedgehog (SHH) ligand expression is restricted to

the presumptive dental ectoderm at E11. Mutations in the human gene lead to severe

holoprosencephaly, so the role of the ligand in odontogenesis cannot be identified from

this phenotype. Conditional knockout of Shh in mice led to the disruption of tooth

morphogenesis from bud stage onwards (Dassule et al., 2000). Upon binding of SHH

to the receptor Patched (PTCH1/2), a signaling cascade with the involvement of the

co-receptor Smoothend (Smo), a repressor complex is inhibited, and the transcription

factors GLI1/2/3 are stabilized to induce target gene transcription. It is known, that SHH

is required for the maintenance of the epithelial stem cell niche and is a key morphogen in

organogenesis. The spatiotemporal expression of SHH gradients in the ventral neural tube

is fate determining for the floor plate cells and motoneurons. Furthermore, it induces the

neural tube formation, explaining the severe phenotypes of SHH mutants.

SHH is not only needed in the dental epithelial stem cell niche, but also in odontoblast

differentiation and the dental stem cell population. Interestingly, alveolar nerves secrete

SHH and the loss of innervation leads to reduced GLI1 expression, first in the mesenchyme,

later also in the epithelium. The loss of the SHH led to a decrease in the stem cell

populations (Hu Zhao et al., 2014). Gli-mutant mice have a complete lack in tooth

development which supports the early role of SHH in tooth development (Hardcastle

et al., 1998).

Wnt pathway

Wnt ligands are short range morphogens that regulate tissue development and homeostasis

by supporting the stem cell niche. Especially permanently regenerated tissues, such as

the intestine, skin, stomach, and blood, are dependent on active stem cell niches whose

proliferative activity is animated by Wnt signaling. Wnts bind to receptors of the 7-

transmembrane frizzled family (FRZ). Upon ligand-receptor interaction, the co-receptor

LRP5/6 is recruited to FRZ and a degradation complex, comprising the APC (adenomatous

polyposis coli) protein, axin, dishevelled (DVLl) and GSK3ß (glycogen synthase kinase 3),

is inhibited. Thereby, ß-catenin is stabilized, enters the nucleus and activates TCF/LEF-

mediated Wnt target gene transcription. Multiple Wnt genes are expressed throughout

dental developmental stages. WNT4, WNT6 and WNT10 are expressed in the early dental

epithelium (Sarkar et al., 1999). Mutations of the WNT10A gene in humans is associated

with tooth agenesis and hypodontia. Introduction of stabilized ß-catenin, and thereby

constitutively active Wnt pathway, resulted in massive development of supernumerary teeth

(Järvinen et al., 2006). Inactivation of ß-catenin in the epithelium results in arrest at

bud stage, whereas inactivation in the mesenchyme leads to arrest at bud-to-cap transition

(J. Chen et al., 2009). A reported Wnt-Bmp feedback loop includes the activation of

LEF1 by BMP4 and its target MSX1, respectively. Additionally BMP4 suppresses the

expression of dickkopf 2 (DKK22) and odd-skipped-related 1 (OSR1), both inhibitors of

Wnt (Jia et al., 2013). In turn, LEF1 activates FGF3 signaling, which is followed by

Shh transcription in the epithelium (Kratochwil et al., 2002), demonstrating the tight

network between the signaling pathways.

1.2 Tooth development 21

Lessons from human congenital tooth malformations

Developmental biology excellently describes the morphologic stages of odontogenesis in

humans and mice. Nevertheless, the knowledge on molecular pathways involved in human

tooth development is necessarily limited, since ethics prohibit genetic engineering in human

(development) for basic research. Yet, experiments of nature, hereditary developmental

malformations, give insight to the molecular control of human tooth development. Tooth

agenesis describes conditions were the dentition, primary, permanent or both, has failed.

The term includes hypodontia (maximum of six teeth), oligodontia (some missing teeth)

and anodontia (no teeth). Mostly, tooth agenesis is non-syndromic. However, cleft lip

and cleft palate are often associated with missing teeth. Genetic defects in non-syndromic

tooth agenesis are described to be affected by MSX1,PAX9 and AXIN2. In mice, all

these genes have been implicated in early stages, particularly bud-to-cap stage. Contrarily

to what is expected from mouse (where only incisor region was impaired), MSX1, as

well as PAX9, mutations affect premolars and molars in humans. AXIN2 phenotypes

exclusively affect permanent dentition. Canines are rarely affected universally. It is of

particular importance that the common model for organogenesis, the mouse only has one

generation and only two classes of teeth (incisors and molars). Syndromic implications of

MSX1 result in Witkop syndrome where also nail development is defected. In ectodermal

dysplasia, where all skin appendages are affected, genetic defects in EDA (Ectodysplasin A)

pathway, which includes the ligand EDA, the receptor EDAR, and downstream molecules

such as EDARADD,IKKgamma, NEMO or p63 are reported. Defects in PITX2 cause

absence of maxillary incisors. Other significant roles in tooth agenesis play TGFA,IRF6,

FGFR1,MMP1 and MMP20. All the described hereditary developmental malformations

are detailed in the online compendium OMIM (Online Mendelian Inheritance in Man,

https://www.omim.org/) and are summarized in T. Mitsiadis et al., 2011.

1.2.10 Mesenchymal Condensation

A focus of this thesis has been laid on the process of mesenchymal condensation. This

process is conserved concept in embryonic formation of organs, such as skin appendages

(teeth, salivary gland, hair, mammary gland, nail, feather, eye), the skeleton (bone, cartil-

age, tendons), kidney and lung (Paus,2003). At the site of presumptive organ formation,

scattered connective tissue mesenchymal cells condense or aggregate to a compact cell mass.

This compaction is mechanotransduced via an extracellular and intramembrane sensor

network into the cell signalosome. At the end of an intracellular signaling cascade, the

stimulated cell then changes its enzymatic activity and the cytoskeletal arrangement and,

more importantly, tissue-specific transcription factor expression is induced, committing

the cells’ fate. Mediated by the expression of the transcription factors, tissue-specific

morphogens are produced that drive organ formation. These morphogens regulate organ

size, comparted tissue and cell differentiation, and all required spatiotemporal activities.

The concept of mesenchymal condensation has been extensively studied in skeletal develop-

ment (Hall et al., 2000). Different hypotheses have been proposed, and various molecules

are described for their role in mesenchymal condensation, but still the precise molecular

22 Chapter 1 Introduction

mechanism remains unknown. Thus, it is accepted that the player may differ among the

different tissue types but the mechanism is transferable.

It is now common sense, that mechanobiology is the main driver of organ formation (T.

Mammoto,A. Mammoto and Ingber,2013). Through different physical properties (e.g.,

stiffness), of two interacting and via a basal lamina connected tissue types folding, stretch-

ing, compaction or other mechanical cues are exerted on the cells. Cells sense physical

force changes and transduce these signals intracellularly to produce a response, which is

either a change in enzymatic activity and/or transcription factor expression. Of particular

interest are the ECM molecules (collagens, fibronectin, proteoglycans, hyaluronan) that

are connected to cell surface molecules such as N-CAM, integrin, and syndecan. Also,

direct cell-cell contact via cadherins plays a pivotal role. Inside the cell, conformation of

focal adhesion proteins (FAK) is changed, small GTPases are activated and kinases such

as MAPK, ERK and JNK are regulated.

In tooth development, the dental epithelium expresses two chemokines to induce mesen-

chymal cell migration. FGF8 has a wide action range and attracts underlying ectomesen-

chymal cells while the second chemokine Semaphorin 3f (SEMA3f) is expressed at the exact

same site, repulses mesenchymal cells. Thereby, the cells are stacked and squeezed, which

has an enormous impact on their cytoskeleton and on the extracellular environmental cues.

A cascade of kinases is regulated and, finally, RhoA kinase is downregulated, resulting

in rearrangement of the cytoskeletal actin filaments and gene transcription of PAX9 and

MSX1 is induced (T. Mammoto,A. Mammoto,Torisawa et al., 2011) (see figure 1.19).

Recent findings suggest that the actin-p38MAPK-SP1 pathway is activated as a response

to the mechanical stress, which in turn regulates the expression of interconnecting collagen

type VI. Collagen VI in turn physically stabilizes the compressed mesenchymal cell shapes

to ensure efficient cell fate switching (T. Mammoto,A. Mammoto,Jiang et al., 2015).

1.3 State of the Art - Tissue Engineering 23

Figure 1.19:

Mechanochemical control of mesenchymal condensation during embryonic tooth

formation. FGF8 and SEMA3F expressed from dental epithelium, induce attraction and

repulsion of mesenchymal cells, which undergo compaction. The induced actin remodeling

upregulates organ-fate specific transcription factors, and the extracellular matrix is rebuilt and

stabilized (T. Mammoto,A. Mammoto and Ingber,2013).

Taken together, cellular mechanobiology is a prime example of biologic beauty and

complexity. The molecular mechanism remains to be unraveled. One reason for that was

the lack of a functional model systems in vitro. In recent times reasonable efforts have

been made to create those models (T. Mammoto,A. Mammoto,Torisawa et al., 2011;

S. Zhang et al., 2018).

1.3 State of the Art - Tissue Engineering

As extensively illustrated above, tooth organogenesis comprises complex temporal-spatial

organization of tissue interaction. The mature organ has well defined, intricates structures

with unique properties of the mineralized and non-mineralized structures. The traditional

approach to restoring missing or lost teeth are dental implants. However, this requires a

significant surgical procedure and, eventually, laborious follow-up care. Synthetic implants

do not meet all demands on a tooth, like proper integration into the jaw bone by the

natural periodontal ligament. New approaches in the field of tissue engineering attempt

to regenerate dental tissues (e.g., pulp, enamel or dentin) or entire teeth (Volponi et al.,

2018). For whole-tooth-bioengineering, two main hurdles exist: cell sources capable of

tooth-formation, and the appropriate "setting", including scaffolds, signaling molecules,

mechanical cues and time.

One of the first approaches to regenerate teeth was performed in 1966 when embryonic

mouse tooth germs (epithelium and mesenchyme) were explanted, dedifferentiated in vitro,

24 Chapter 1 Introduction

and then isologously transplanted in vivo. The cultures "developed into incisor teeth that

were almost perfect in shape and structure." (Main,1966). In a variety of following studies,

embryonic and postnatal dental cells were presented to be the ideal cell source to regenerate

teeth for research purpose (Oshima et al., 2011;E. E. Smith et al., 2017;Young et al.,

2005). In all attempts, epithelial and mesenchymal dental cells were recombined, sometimes

from different developmental stages. Only early dental epithelium (before E11) has been

proven to be inductive, whereas this odontogenic potential shifts to mesenchyme after E12

(Mina et al., 1987). Additionally, embryonic stem cells (ESCs) have been proven to be

capable of differentiating to odontogenic epithelia and odontogenic mesenchyme (Kawai

et al., 2014;Ning et al., 2010). The approach to use embryonic or postnatal (dental) cells

is successful in terms of tooth formation, but when it comes to patient therapy, it is not

applicable.

Therefore, researchers seek for tooth inducing stem cells from adult dental or nondental

tissue. Adult mesenchymal stromal cells are characterized by a panel of surface markers

(i.e., CD44, CD73, CD90, CD105, CD106, CD13) and their plastic adherence in cell culture.

They can be obtained from various tissue sources such as the bone marrow, adipose tissue,

umbilical cord, and the tooth. In extracted adult teeth, stem cells reside in the dental pulp

(DPSC), in deciduous teeth named human exfoliated deciduous cells (SHED), in the dental

follicle (DFC), in the apical papilla (SCAP) and in the periodontal ligament (PDLSC).

A benefit of DPSCs is that they derive from discarded teeth, mainly from third molar

extractions. This cell type has been extensively studied (Gronthos et al., 2000;Sloan

et al., 2009). Their odontogenic capacity has been shown in vitro and in vivo (Hu et al.,

2018). Interestingly, even isolated bone marrow MSCs have been capable to contribute to

tooth regeneration in vivo, when cultured under appropriate conditions (Ohazama et al.,

2004). So far, the presence of an epithelial reciprocal interaction partner is indispensable

to induce tooth formation from adult stem cells in vitro and in vivo, which is a drawback

since inductive epithelium can only be found in embryonic dental epithelium.

One idea to circumvent embryonic epithelium is the usage of induced pluripotent stem

cells (iPSCs). So far, this was not achieved, yet Arakaki et al., 2012 established a system

to create ameloblasts from murine iPSCs by usage of an enamel-secreting feeder layer of

ameloblasts from mouse embryos.

Either epithelial or mesenchymal cell populations are induced to be odontogenic (capable

of initiation of de novo odontogenesis) and were subsequently recombined with the respons-

ive cell population counterpart. An early-stage tooth primordium can be generated from

an epithelial-mesenchymal-cell recombination, which can be either directly transplanted at

the location of the missing tooth or cultured ex vivo to form a whole tooth to replace the

missing tooth.

In addition to the used cell type, an appropriate environment (signaling molecules,

scaffolds, culture time) is crucial for whole tooth engineering. Growth factors that found

application in regenerative dentistry and whole-tooth bioengineering included BMPs,

TGFß1 and TGFß3, insulin-like growth factor (IGF) and platelet-derived growth factor

(PDGF) (Hosseini et al., 2018). Natural and synthetic materials have been used as

replacements for missing teeth. Decellularized tooth buds or organic polymers (gelatine

1.3 State of the Art - Tissue Engineering 25

gels, poly-lactic acid, polyglycolic acid, PLGA, hydroxyapatite and more) were fabricated

with a biometic porosity, stiffness-elasticity, texture and shape to support cell adhesion

and differentiation. These scaffolds were then seeded with cells from different sources and

were implanted in vivo (Oshima et al., 2011;W. Zhang et al., 2017). Occasionally, these

construct produced organized, bioengineered teeth. Outstanding research was published in

2017, where the group of Takashi Tsuji showed whole-tooth restoration by bioengineered

tooth germ in a large-animal model, the beagle dog. Permanent molar tooth germs were

extracted from postnatal individuals, epithelium and mesenchyme were dissected and then

reconstituted in a collagen gel. After two days of organ culture, the organoids were then

transplanted into the mandible and 180 days later, erupted, and functional bioengineered

teeth were grown (Ono et al., 2017).

Figure 1.20:

Vision of autologous tooth regeneration. Suitable adult cells (epithelial and

mesenchymal) are collected from dental patients and expanded in vitro. By an induction step

(eventually chemical or mechanical cues), these cells are converted into odontogenic cells, that

will be recombined and either transplanted as tooth germ or cultured to form a whole tooth ex

vivo (Volponi et al., 2018).

Taken together, human odontogenesis needs to be understood in more detail, and an

appropriate human organogenesis models are required to elucidate molecular networks and

events. Furthermore, different cell sources and configurations have to be evaluated further

for dental engineering, to achieve the ultimate goal of autologous tooth bioengineering in

human patients (see figure 1.20).

26 Chapter 1 Introduction

1.4 Aims of this work

In the course of one’s life, everyone is highly likely to be confronted with tooth loss,

depending on individual health status and life expectancy. The gold standard of tooth

replacement techniques are dental implants from composite materials, such as ceramics

with titan screws. However, synthetic materials neither converge nor communicate with the

body at the site of implantation, therefore, an appropriate response to changing demands

cannot be assured.

Numerous studies for regenerative therapies, i.e., partial tissue replacement and whole-tooth

bioengineering, have been published, but to date, no regenerative therapy approach was

successful in humans. Two key elements need to be improved. Firstly, the knowledge on

molecular events of human organogenesis with a special focus on the initiation step for tooth

development is very limited. Most of the available data was conducted in murine models,

but for at least two aspects the mouse dentition is not comparable with human. Mice only

have on set of teeth, and they do not develop a second set as humans do during their youth.

Furthermore, mice only have two types of teeth: molars and incisors. Therefore, much more

effort has to be made to obtain reliable human data on organogenesis by providing suitable

human in vitro models. The second key element of human whole-tooth bioengineering is

the cell source. It is just not possible to use embryonic or postnatal dental cells in the

clinics. For the moment also induced pluripotent stem cells do not represent an alternative

due to potential risk of genetic aberrations and teratoma formation. The ideal disposable

cell source for transplantation would be adult autologous cells.

One aim of this work is to show that adult human dental pulp stem cells can be programmed

to inductive dental mesenchymal tooth germs in vitro when cultured under appropriate

conditions. Thereby, cellular self-organization to induce the cascade of molecular event

sequences that lead to differentiation is allowed and propagated. Their nature of inductivity

shall be demonstrated by expression of dental marker genes as well as by interaction with

a receptive interaction or partner cell, which are, in the dental context, epithelial cells.

The steps to achieve an inductive tooth germ have to be evaluated in detail, focussing on

the process of mesenchymal condensation. Mesenchymal condensation is considered to be

the key to organ development initiation. It has to be validated that the presented in vitro

model of condensation of dental pulp stem cells recapitulates the steps of mesenchymal

condensation by comparison to published in vivo data in human or mouse. Finally, by

usage of this condensation model, new putative targets of organogenesis research shall be

defined.

CHAPTER 2

Materials & Methods

Table 2.1: Materials for cell culture applications

Product Distributor

PBS Applichem

DMEM (High Glucose + stable glutamin) Corning

FCS Corning

Trypsin EDTA Corning

Penicillin/Streptomycin Corning

Collagenase NB4 Serva

Dispase II Sigma Aldrich

DermaLife Basal medium Lifeline Cell Technology

DermaLife K Life Factors Lifeline Cell Technology

Collagen A Biochrom

Neurobasal Plus Life Technogies

B27 Plus Life Technogies

gelatin Sigma Aldrich

L-ascorbic acid phosphate Sigma Aldrich

Isobutylmethylxanthine Applichem

Hydrocortisone Sigma Aldrich

Indomethacin Sigma Aldrich

Insulin Sigma Aldrich

L-Glutamin Sigma Aldrich

rh Epidermal growth factor Promokine

rh basic Fibroblast growth factor Promokine

Dexamethasone Applichem

ß-glycerophosphate Sigma Aldrich

DMSO Sigma Aldrich

NaCl Chemsolute Th.Geyer

Polyethylenimine 9002-98-6 Polysciences

Polybrene VWR

LY294002 Cell Signaling

LiCl VWR

rh Transforming Growth Factor ß 1 Promokine

28 Chapter 2 Materials & Methods

Table 2.1: Materials for cell culture applications

Cytochalasin D VWR

Pertussis Toxin Sigma Aldrich

CellTracker™Red CMTPX Dye Thermo Fisher

standard tissue culture flasks Greiner Bio-One

tissue culture dishes Sarstedt

Ultra-low attachment 96 well plate Corning

Table 2.2: Materials for molecular biology applications

Product Distributor

Formaldehyde Roth

Ethanol VWR

Acetone VWR

Oil Red O Alfa Aesar

Alizarin Red Roth

Hematoxylin VWR

Eosin Roth

Fast Digest Restriction Enzymes Fermentas

T4 Ligase Fermentas

NucleoSpin-Gel and PCR Clean up Macherey-Nagel

NucleoBond-Xtra Midi Plus Macherey-Nagel

Agarose Serva

Tris-HCl Roth

Imidazole Roche

DNase Macherey-Nagel

PMSF Sigma

Lysozyme Roth

Cell Trace CFSE cell Proliferation Kit Invitrogen

7-Aminoactinomycin R&D Systems

DAPI Sigma

Tissue-Tek O.C.T. Compound Sakura

APODirect TUNEL Assay Kit Phoenix Flow Systems

Imsol Mount VWR

TaqMan®Reverse Transcription Kit ThermoFisher

SensiFast SYBR No-ROX Kit Bioline

TruSeq®Stranded mRNA LT Kit Illumina

Mag-Bind®RXNPure Plus beads Omega Bio-Tec

SnakeSkin ThermoFisher

Ni-NTA agarose qiagen

2.1 Cell isolation and cell culture 29

2.1 Cell isolation and cell culture

2.1.1 Isolation of Human Dental Pulp Cells from adult third molars

Extracted third molars were collected, with patient’s informed consent and approval by

Ethics Committee Charité, from 18 to 30-year old adults from Charité Department of

Cranio Maxillofacial Surgery (Berlin, Germany) and from dental practice Amler, Mönch,

Knebel (Berlin, Germany) as well as from specialist for oral and maxillofacial surgery

Gülseren Köksal (Berlin, Germany). Teeth were kept in DMEM high glucose containing

10% FCS and 1 % antibiotic-antimycotic solution and stored at 4

C for not longer than

24 hours. Human dental pulp cells are isolated under sterile conditions according to a

modified protocol (Stan Gronthos et al., 2011). Briefly, extracted specimens were wiped

with ethanol to reduce contamination risk. To open the pulpal cavity, teeth were cracked

mechanically. Pulp tissue was removed with forceps and placed into a phosphate buffered

saline (PBS) containing petri dish. The tissue was minced and washed twice with PBS to

remove debris and blood. Enzymatic tissue digestion was performed with a collagenase (3

mg/ml)/dispase II (4 mg/ml) enzyme mix in PBS for 1 h at 37

C. After filtering through

a 70

m cell strainer and washing with PBS by centrifugation (400 x g for 5 min), the cell

pellet is resuspended in DMEM with 10% FCS and antibiotics.

2.1.2 Isolation of gingival keratinocytes

Residual gingival tissue from molar extractions (see above) was enzymatically digested

with dispase II (4 mg/ml) for 30 min at 37

C in PBS. After filtering through a 70

cell strainer and washing with PBS by centrifugation (300 x g for 5 min), the cell pellet

was resuspended in complete DermaLife Basal medium supplemented with DermaLife K

LifeFactors. Cells were grown on collagen A-coated (0.1mg/mL Collagen A) tissue culture

vessels under standard culture conditions (see below).

2.1.3 Standard cell culture

Isolated dental pulp cells were cultivated and expanded in a humidified atmosphere at 37

C, 5 % vol/vol CO

in standard tissue culture flasks in DMEM high glucose containing

10% FCS and 1 % antibiotic-antimycotic solution.

2.1.4 Condensation process for formation of artificial tooth primordium

For culture under non-adherent conditions, human dental pulp cells of between passage

two and eight were passaged two days before use. They were harvested and resuspended in

DMEM with 10% FCS to yield up in a suspension of 10

cells per ml. The cell suspension

(0.2 ml per well) was given to 96 well low attachment plate (Ultra Low Cluster Plate,

Corning, Germany). In contrast to the negatively charged, hydrophilic surface of standard

tissue culture dishes, the ultra-low attachment plates possess a neutral, hydrophilic hydrogel

coated surface that greatly minimizes the binding of attachment proteins. Condensation

process starts shortly after seeding and is observed macroscopically by cells forming

aggregates. To ensure constant culture conditions, the medium was changed regularly

every three days. Cultures were kept under standard cell culture conditions.

30 Chapter 2 Materials & Methods

2.1.5 Co-Culture assays

For co-culture of human dental pulp-derived cells and cells of epithelial origin (gingiva or

skin-derived) the condensates, produced by the method described above, are transferred

between day 1 to 2 in a composite medium appropriate for both cell types (DMEM high

glucose (with FCS) and Dermal Life; 1:1). A single cell suspension of epithelial cells, in

a ratio of 1:4 related to the initial cell number used for mesenchymal condensation, was

added and the resulting mixture was cultured under non-adherent conditions. To ensure

constant culture conditions, the medium was changed regularly every 1 to 3 days.

2.1.6 In vitro differentiation assays

Adipogenic differentiation

Cultured DPCs were grown until confluency before the differentiation was induced by

exchanging the media to adipogenic media (standard DMEM supplemented with 10 % FCS

and 1 % antibiotic-antimycotics, 0.1 mM L-ascorbic acid phosphate, 0.5 mM isobutylmethyl-

xanthine, 0.5

M hydrocortisone, 60

M indomethacin and 10

g/ml insulin). Media was

changed three times per week for three weeks. To confirm adipogenic differentiation, cell

cultures were stained for lipid vacuoles by Oil Red O, and gene expression of lipid marker

genes was assessed by qRT-PCR. Before staining, cells were fixed in 10 % formaldehyde

for 30 minutes at room temperature and washed with PBS. Lipid droplets were stained

with freshly filtered Oil Red O working solution (0.7 % in propylene glycol). Excessive Oil

Red O was carefully rinsed off with tap water. The extent of intracellular lipid vesicles was

documented microscopically.

Neurogenic differentiation

Neurogenic differentiation was performed according to the protocol of Miura et al., 2003.

Briefly, culture plates were coated with 0.1 % gelatin for 30 minutes and allowed to dry

for at least two hours. Cultured DPCs were then seeded at a low density of 10 000 cells

per cm

in Neurobasal Plus Medium (Life Technologies) supplemented with 2 % B27

Plus (Life Technologies), 250

M L-Glutamine, 20 ng/ml EGF, 40 ng/ml FGF2 and 1 %

antibiotic-antimycotics. The medium was changed every three days. Cells were cultured

for 14 days and were then analyzed via qRT-PCR and immunocytological staining (see

Chapter 2.5.3).

Odontogenic/Osteogenic differentiation

DPCs were grown until confluency before osteogenic/odontogenic differentiation was

induced. For this purpose media was exchanged to "mineralisation" media containing

10 % FCS and 1 % antibiotic-antimycotics, 0.1 mM L-ascorbic acid phosphate, 100 nM

dexamethasone, 0.5

M hydrocortisone, and 5 mM ß-glycerophosphate. Media was changed

regularly two to three times per week for three weeks. Gene expression of osteogenic

marker genes was assessed by qRT-PCR. For detection of mineralization, the cell cultures

were stained with Alizarin Red. Therefore, the fragile cell layer was rinsed gently with

PBS without Calcium or Magnesium, fixed in ice-cold 70 % ethanol for one hour and

washed twice with distilled water. Afterwards filtered Alizarin Red (2 g in 100 ml dH

pH 4.1 to 4.3 (HCl)) was incubated for 45 Minutes at room temperature. After four

2.2 Flow Cytometry 31

washing steps with distilled water, the red staining of the mineralization was documented

photographically.

2.1.7 Freezing and thawing of cells

Prior to freezing, 10

cells were centrifuged (400 x g for 5 min) and the cell pellet was gently

resuspended in ice-cold FCS containing 10 % DMSO. With a cooling rate of 1

C/min

cooling rate (in Mr. Frosty container, Nalgene), cells were frozen down to -80

C. After

one day they were transferred to liquid nitrogen.

For thawing, cell vials were removed from the liquid nitrogen, transported on ice to a 37

C water bath, where they were thawed for 30 seconds under gentle agitation. Pre-warmed

culture medium was then added dropwise to the cells that were subsequently transferred to

a culture vessel with pre-warmed medium. After approximately 12 hours of regeneration,

the medium was exchanged for fresh culture medium.

2.2 Flow Cytometry

Flow cytometry allows quantification and characterization of the cellular morphology,

vitality and protein expression. Hydrodynamic focusing inside the flow cell of the cytometer

ensures single-cell analysis via laser excitation. Specific photomultipliers detect the emitted

cell signals.

Human dental pulp cells were analyzed by flow cytometry for the surface marker expression

by immunofluorescent staining, for viability, proliferation and eGFP expression. All flow

cytometric analyses were conducted on MACSQuant analyzer (Miltenyi Biotec, Germany).

2.2.1 Surface marker staining

After cell harvest by trypsinization, the cells were resuspended in PBS/BSA (0.5 %).

Incubation of the respective antibodies was conducted on ice for 30 minutes. For each isotype

and fluorescent label, an isotype control was included. The following antibodies were used:

anti-human-CD105-APC (Biolegend), anti-human-CD106-APC (Biolegend), anti-human-

CD90-FITC (Miltenyi Biotec), anti-human-CD146-FITC (Miltenyi Biotec), anti-human-

CD13-APC-Cy7 (Biolegend), anti-human-CD44-PacificBlue (Miltenyi Biotec), anti-human-

CD45-VioBlue (Miltenyi Biotec), anti-human-CD14-FITC (eBioscience), anti-human-CD34-

APC (Miltenyi Biotec) and anti-human-CD31-Alexa405 (DRFZ) After incubation, the cells

were washed to remove unbound antibodies and resuspended in PBS/BSA prior to analysis

on flow cytometer.

2.2.2 CFSE assay

To track proliferation time, a CFSE assay was conducted using the CellTrace

™

CFSE

Cell Proliferation Kit. Carboxyfluorescein succinimidyl ester (CFSE) is a cell permeable

dye that is converted inside the cell by internal esterases, whereby it is covalently bound

to intracellular proteins and acquires a fluorescence with an excitation maximum of 492

nm and an absorption maximum of 517 nm. With each cell division, the proteins, and

subsequently the bound CFSE molecules are equally distributed among the daughter cells,

resulting in a halved fluorescence intensity compared to the parent cell.

Dental pulp cells from passage 3 were trypsinized and labeled with CFSE according to

the manufacturer’s protocol. 200 000 cells were directly fixed with 10 % formalin and stored

32 Chapter 2 Materials & Methods

at 4

C for later analysis. The remaining positively labeled cells were seeded into six-well

dishes. After 24, 48 and 120 hours one well each was trypsinized and fixed in formalin.

Afterwards, the cells were analyzed by flow cytometry to assess the CFSE fluorescence

intensity. Control of fixed, non-labeled cells was included.

2.2.3 Viability assay

To discriminate viable from non-viable cells, the molecule 7-aminoactinomycin D (7-AAD)

was used. 7-AAD is a DNA intercalating dye that emits at 635 to 675 nm wavelength upon

DNA binding. Intact cell membranes of viable cell exclude 7-AAD, whereas compromised

membranes of dying/dead cells allow the dye to pass. Cells were analyzed by flow cytometry

after 10 minutes of incubation with 7-AAD in the channel B3 of the MACSquant.

2.3 Cell Tracker Red labeling

Keratinocytes were labeled fluorescently to be visualized by fluorescence microscopy.

Therefore, a labeling dye, CellTracker

™

Red CMTPX, was used. Briefly, keratinocytes

were trypsinized and resuspended in pre-warmed working solution, containing serum-free

DermaLife medium and 5

M of the dye (solubilized in DMSO). Cells were incubated at 37

C for 45 minutes under gentle agitation. After washing and resuspension in fresh medium,

the cells convert the permeable dye to a membrane impermanent label via glutathione-S-

transferase. CellTracker Red is excitable at 577 nm and emits at 602 nm, which corresponds

to the red channel in the fluorescence microscope.

2.4 Collagen tagging via CNA35-eGFP

For real-time live imaging of collagen production, a recombinant fusion protein CNA35-

eGFP was used. The CNA represents a 35 kDa collagen-binding protein domain of bacterial

adhesins. An overexpression vector pET28a-EGFP-CNA35 was purchased from addgene (#

61603) for recombinant prokaryotic expression of the CNA35-eGFP fusion protein. Briefly,

a starter culture of transformed E.coli BL21 DE3 was prepared with LB media containing

kanamycin. After 5 hours, the starter culture was transferred to the main culture, that

was incubated with agitation at 37

C until OD 0.55. Protein expression was induced by

addition of isopropyl ß-D-1-thiogalactopyranoside (IPTG) at a concentration of 0.8 mM.

The culture was induced overnight at room temperature. The culture was centrifuged at

3500 x g for 20 minutes and the pellet was resuspended in lysis buffer (50 mM Tris-HCl,

300 mM NaCl, 20 mM Imidazole). Lysozyme (0.2 mg/ml) to ensure bacterial cell wall lysis,

DNase with 10 mM MgCl

to break released DNA polymers that bring up a high viscosity,

and 1 mM phenylmethylsulfonyl fluoride (PMSF), a serine protease inhibitor that inhibits

proteases that would destroy the recombinant protein, were added. After 10 minutes of

incubation, the suspension-containing tubes were transferred to liquid nitrogen to enhance

the lysis. The tubes were thawed and shock-frosted for two more cycles. Disrupted cells

were centrifuged at 10000 x g for 30 minutes. The 6x-histidine-tagged CNA35-eGFP in

the supernatant was now purified by affinity chromatography with Ni-NTA Agarose. The

histidine residues of the His tag bind to immobilized nickel ions in the agarose matrix with a

high affinity and specificity. After equilibration of the matrix with lysis buffer, the bacterial

supernatant was incubated with the Ni-NTA agarose. Upon binding of the protein, the

2.5 Histology 33

matrix color changes from blue to white. Afterwards the loaded matrix was transferred

to chromatography columns. After intense washing with lysis buffer, the CNA-eGFP was

eluted from the matrix with increasing concentrations of imidazole in the elution buffer (70

mM, 150 mM, and 250 mM). Imidazole acts as a competitor for the nickel ion binding. In

between the elution steps, the column was washed. For each used imidazole concentration

1 ml of the eluted protein in buffer was collected. Since high imidazole concentrations

are harmful to living cells, the eluted protein was dialyzed against PBS for 5 hours in

SnakeSkin dialysis membrane.

The CNA-eGFP was directly added to the DPC cultures at a concentration of 0.4

during to condensation. The fluorescence was imaged by fluorescence microscopy in the

green channel.

2.5 Histology

2.5.1 Sample preparation

Samples for histological analyses were embedded in cryomolds in O.C.T. Compound (Tissue-

TEK) and frozen at -80

C. Prior to sectioning by the cryotome (Leica), the frozen blocks

were equilibrated at -20

C for 30 minutes. At a cutting temperature of -18

C 8

sections were transferred on glass slides (Histobond, Marienfeld, Germany). Slides were

stored at -20 °C after two hours of drying at room temperature.

2.5.2 Hematoxylin/Eosin staining

Slides were thawed at room temperature and fixed in 10 % formalin for 10 minutes at

room temperature. After washing twice with distilled water, they were transferred to

Hematoxylin solution and incubated for 5 minutes. Slides were then washed in running

tap water for 10 minutes and cleared in distilled water. The slides were transferred into

Eosin solution, incubated for 2 minutes and after washing with distilled water, they were

dehydrated in a graded ethanol series with terminal xylene treatment. Prior to microscopic

analysis, they were mounted in a resinous medium.

2.5.3 Immunohistochemistry

After thawing, the slides were fixed in acetone for 20 minutes at -20

C. Slides were washed

three times in PBS. Unspecific binding was blocked with 10 % serum from host animal of

the secondary antibody for 20 minutes. Afterwards, primary antibody dilution was added

to the sections and was incubated overnight at 4

C. After washing with PBS, secondary

antibody dilution was pipetted on the sections and was incubated for 45 minutes at room

temperature in the dark. During the last 10 minutes of this incubation, DAPI (1:500) was

added to the solution. After the last washing step, the sections were covered with Imsol

Mount and a coverslip and were analyzed by fluorescence microscopy. To exclude unspecific

background from the secondary antibody, a no primary antibody control was included.

34 Chapter 2 Materials & Methods

Table 2.3: Antibodies for immunhistochemistry

Antibody Distributor Dilution

mouse anti-human Collagen type I Sigma C2456 1:100

mouse anti-human Collagen type IV Sigma C1926 1:100

mouse anti-human Cytokeratin 14 Abcam ab7800 1:100

mouse anti-human Cytokeratin8/18 Invitrogen MA5-14088 1:100

mouse anti-human Ki67 eBioscience 14-5699-82 1:100

rabbit anti-human Cytokeratin 15 Abcam ab52816 1:100

rabbit anti-human Cytokeratin 19 DB-biotech DB103-T 1:100

rabbit anti-human Tenascin C Santa Cruz sc-20932 1:100

rabbit anti-human Vimentin Invitrogen PA5-27231 1:100

rabbit anti-human Fibronectin 1 Abcam ab2413 1:100

goat anti-mouse CF488 Biotium 20010 1:200

goat anti-rabbit CF594 Biotium 20112 1:200

goat anti-mouse CF594 Biotium 20119 1:200

2.6 Imaging

Keyence BZ-9000 Microscope was used for all fluorescence imaging with the BZ-II-Viewer

software and images were analyzed via BZ-II-Analyzer software. Cell cultures were imaged

either with Keyence microscope, Carl Zeiss AxioVert A1 or Carl Zeiss AxioVert 40C. Phase

contrast and fluorescent images were adjusted for tone levels, brightness and contrast.

For long-term video, a stage top incubator system (TOKAI-Hit) was installed on the

microscope, that allows standard culture conditions with a humidified atmosphere at 37

°C, 5 % vol/vol CO2.

2.7 Reporter assay strategies

2.7.1 Cloning

Backbone for all constructed reporter vectors was the lentiviral pLL3.7. The sequences of

the response element including a minimal promoter was amplified by PCR from the donor

vectors by usage of specific up- and downstream primers. The donor vectors which had the

MAPK response element (RE), the TGFß response element and the FoxO response element

were based on pGL4.26 (Promega). The primer sequences for fragment amplification for

these three elements were: pGl4.26up 5’ AGTC

ATGCAT

AATAGGCTGTCCCCAGTGC

and pGL4.26do 5’CTGA

ACCGGT

TTGTCATGGCCTAACGGTTC. The underlined se-

quences mark the restriction site for NsiI and AgeI for cloning into the target vector pLL3.7.

After enyzmatic digestion of the pLL3.7 and the amplified PCR fragments with AgeI and

NsiI (Fast Digest, Thermo Scientific), they were ligated with T4 ligase (Fermentas) at 14

°C overnight in front of the eGFP CDS.

The control vector, which had only the minimal promoter in front of the eGFP coding

sequence (CDS) was constructed by insertion of an oligonucleotide (minPup 5’ TTAGAGG-

GTATATAATGGAAGCTCGACTTCCAGCTTGGCAATCCGGTACTGTTA, minPdo

5’ CCGGTATCTCCATATATTACCTTCGAGCTGAAGGTCGAACCGTTAGGCCAT-

2.7 Reporter assay strategies 35

GACAAATGCA). For hybridization, 60 pmol of each oligonucleotide were mixed in 60

O and placed at 95

C for 5 minutes. Optimized hybridization conditions were provided

by a slow continuous incubation temperature decrease (0,5

C/min) to 65

C followed by

accelerated cooling rate of 2

C/min to 40

C. The obtained fragment was then inserted

into the pLL3.7 as described above by restriction with AgeI and NsiI.

The Wnt-RE fragment was amplified from the M50 Super 8x Topflash vector with the

following primer pair: Wnt-RE-up 5’ AGGT

CTCGAG

CAAAATAGGCTGTCCCCAGT

and WNT-RE do 5’ GCAC

ATGCAT

CGCGCCCCTTTGATCT. The amplified fragment

was inserted into the minimal-promoter-pLL3.7 using the restriction enzymes NsiI and

XhoI (Fast Digest, Fermentas) and subsequent ligation.

Ligated vector constructs were transformed into E.coli TOP10 strain by heat shock. Colon-

ies were picked, and cells were amplified for plasmid isolation (Macherey-Nagel). After

restriction analysis with the above-mentioned restriction enzymes, positive clones were

sequenced. It was confirmed by sequencing (GATC Biotech) with the sequencing primer

pLLseq 5’ AAGCTCGCTTCACGAGATTC that the respective response elements with

the minimal promoter (Wnt-, MAPK-, TGFß- or FoxO-RE) were then located in front

of the eGFP-CDS on the lentiviral plasmid pLL3. All vector maps can be found in the

Appendix. To obtain sufficient amount of vector DNA, a maxi preparation of the plasmid

were accomplished by Nucleobond Xtra maxi plus kit (Macherey-Nagel).

2.7.2 Transfection

Virus was produced by transient transfection of HEK293T packaging cells. Therefore,

4.5x10

cells were seeded on a 10 cm culture dish one day prior to transfection in 10 ml

DMEM with 10 % FCS. To assure biosafety, a three plasmid system with incapacity to

viral replication was used. Viral gag-pol region, encoding reverse transcriptase, protease,

integrase, and capsid are located on the used pAX2 plasmid, viral env region for envelope

protein on the pVSVG plasmid, and the eGFP-marker under response-element control

was on the expression plasmid pLL3.7. Cell transfection with the three plasmids was

carried out by polyethyleneimine (PEI) transfection. DNA was premixed with the following

components:

Transfection mix:

10 µg shuttle plasmid (pLL3.7)

6.6 µg psPAX2

3.3 µg pVSVG

1 mL NaCl

A second mix from 20

l PEI and 1 ml NaCl wass prepared, and both mixtures were

incubated for 5 minutes at room temperature. Subsequently, they were mixed and dropwise

added to the HEK293T cell layer. After 12 hours of incubation, the medium was exchanged.

Virus harvest began additional 12 hours later by collecting the cell culture medium and

subsequent sterile filtration to prevent HEK293T-transfer to the primary cell cultures.

36 Chapter 2 Materials & Methods

2.7.3 Transduction

The dental pulp cells were transduced in suspension. Therefore, they were harvested by

trypsinization and two million cells were resuspended in 10 ml of the viral supernatant, 1

ml FCS, additional 5 ml standard culture medium and 1.5

l polybrene, and were seeded

in a culture dish. 24 hours later, the medium was replaced for standard culture medium.

Transduction efficiency was measured by flow cytometry 72 hours later.

2.7.4 Reporter functionality test

The functionality of the reporter vectors was tested in transduced DPCs. The cells were

seeded in 6-well-culture dishes and after confluency was reached, they were treated with

molecules that activate the eGFP expression by activation of the respective response

elements.

The TGFß1-response element was activated by stimulation of the TGFß-SMAD2/3 pathway

using the TGFß1 ligand.

The response element for the MAPK/ERK pathway is receptive for high serum concentra-

tions and is activated by the transcription factors Elk1/SRF (serum-response factor). The

respective signaling cascade was induced here by usage of the epidermal growth factor EGF.

The FoxO response element is a binding site of the FoxO transcription factor. Phosphoinositol-

3-kinase (PI3K) is constantly phosphorylating FoxO to mark it for proteasomal degradation.

By inhibition of PI3K with the small molecule LY294002, FoxO is stabilized and translo-

cates to the nucleus to activate the FoxO gene transcription as well as the reporter.

The Wnt response element consists of eight repeats of the TCF/Lef binding sites. Those

two transcription factors are activated through ß-catenin. Without stimulation of the Wnt

pathway, ß-catenin is constantly degraded by the proteasome. The stimulation of cells with

Lithium chloride (LiCl), inhibits the degrading complex of ß-catenin, thereby stabilizing it,

and allows ß-catenin activated gene transcription via TCF/Lef1.

The concentrations of the stimuli can be found in table 3.3.1.

2.8 Treatment with inhibitory agents

To get insight into the molecular processes during condensation, DPCs were treated with

different inhibitory molecules in ultra-low attachment culture. Pertussis toxin inhibits G

protein-coupled signaling by inhibition of G

subunit, LY249002 inhibits the phosphoinositol-

3-kinase, and Cytochalasin D inhibits actin filament polymerization. The substances were

reconstituted according to supplier’s recommendations and administered to the culture

wells with the DPCs in the designated concentrations (see chapter 3.3.2). The control

group without inhibitor was supplemented with an equal amount of DMSO. After five and

24 hours, microscopic pictures were taken.

2.9 Transcriptome analysis

2.9.1 Reverse transcription

In preparation to qRT-PCR, reverse transcription of mRNA was performed according to

manufacturer’s protocol using 100-200 ng of total RNA, oligo d(T)

, random hexamers

and reverse transcriptase (TaqMan®Reverse Transcription Kit, ThermoFisher).

2.9 Transcriptome analysis 37

2.9.2 Real-Time Quantitative Reverse Transcription PCR (qRT-PCR)

Quantitative analysis of RNA expression by Real Time PCR was performed in the Strata-

gene MX3005P QPCR System (Agilent Technologies, Germany) using the SYBR Green®

format. SYBR

Green is a double-strand DNA specific dye that binds in the minor groove

and emits light upon excitation. After each PCR cycle, the amount of double-stranded

DNA is measured. Thus, as the PCR product accumulates the fluorescence increases. To

exclude non-specificity of the PCR reaction due to contamination or primer dimers, melting

curve analysis was performed after each PCR run.

Gene expression levels were normalized to glyceraldehyde 3-phosphate dehydrogenase

(GAPDH). All primers were obtained from TIB MOLBIOL (Berlin, Germany). The qPCR

primer sequences are listed in table 1.4.

Measurements were conducted in 20 µl assays with the following components:

1µl cDNA

0.5 µl

gene specific upstream and downstream

primer (10 µM each)

10 µl 2xSYBR NoROX Mix

8µl dH2O

∑︀20 µl

Temperature profile:

4 min 95 °C

12 sec 95 °C

11 sec 64 °C

12 sec 72 °C

⎫

⎬

⎭

40 x

Melting point analysis:

Samples were heated to 95

C for 3 min, cooled to 62

C for 30 sec, and subsequently, the

temperature was ramped from 62

C to 95

C in steps of 1

C every 30 s, while fluorescence

intensity was measured.

Table 2.4: Primer pairs used for qPCR

Primer name Sequence

GAPDH up 5’TGTTGCCATCAATGACCCCTT

GAPDH do 5’CTCCACGACGTACTCAGCG

BMP4 up 5’CGGGATCTTTACCGGCTTC

BMP4 do 5’TCTGCTGGGGGCTTCATAAC

continued on next page . . .

38 Chapter 2 Materials & Methods

Primer name Sequence

BMP7 up 5’ACTGTGAGGGGGAGTGTGC

BMP7 do 5’CGAAGTAGAGGACGGAGATGG

INHBA up 5’GGGAGAACGGGTATGTGGAG

INHBA do 5’CTGGAAGAGGCGGATGGT

TGFß1 up 5’CCTGGCGATACCTCAGCAAC

TGFß1 do 5’GCCATGAGAAGCAGGAAAGG

FGF2 up 5’AGCGACCCTCACATCAAGC

FGF2 do 5’GCCCAGTTCGTTTCAGTGC

HGF up 5’GCCATGAATTTGACCTCTATGAAAAC

HGF do 5’TTTACCCCGATAGCTCGAAGG

PAX9 up 5’CCTACCACAgCCCCAAGGT

PAX9 do 5’AGCAACATAACCAGAAGGAGCAG

MSX1 up 5’GAGAGGACCCCGTGGATG

MSX1 do 5’CGATGGACAGGTACTGCTTCTG

DSPP up 5’GGCCATTCCAGTTCCTCAAA

DSPP do 5’TGGGTATTCTCTTGCCTTCCTC

COL1A1 up 5’GCCGTGACCTCAAGATGTG

COL1A1 do 5’GCCGAACCAGACATGCCTC

OPN up 5’CACTGATTTTCCCACGGACCT

OPN do 5’CCATTCAACTCCTCGCTTTCC

OCN up 5’CTCACACTCCTCGCCCTATTG

OCN do 5’CTCCCAGCCATTGATACAGGTAG

LPL up 5’GGCTGAAACTGGGCGAATCTAC

LPL do 5’CGTTGGAGGATGTGCTATTTGG

FABP4 up 5’GCAGAAATGGGATGGAAAATCA

FABP4 do 5’CGTCCCTTGGCTTATGCTCTC

Nestin up 5’AGGCTGAGGGACATCTTGAGG

Nestin do 5’AGCGTTGGAACAGAGGTTGG

TUJ1 up 5’CAGCAAGGTGCGTGAGGAG

TUJ1 do 5’TGCGGAAGCAGATGTCGTAG

SDC up 5’GGGGAGCAGGACTTCACCT

continued on next page . . .

2.9 Transcriptome analysis 39

Primer name Sequence

SDC do 5’TCCCAGCACCTCTTTCCTGT

TNC up 5’GGGACAGCAGGTGACTCCAT

TNC do 5’TGTCCCCATATCTCCCCATC

NCAM up 5’GTTCAAGCAACACCCCCTCTT

NCAM do 5’TTCTTCACCAACTGCTCTCCAC

FN1 up 5’CAGACCTATCCAAGCTCAAGTGG

FN1 do 5’TGGGTGGGATACTCACAGGTC

For calculation of expression ratios, the following formula was used, whereas the efficiency

(E) of amplification was set to 1.95 and the crossing point (C

) indicates the number of

cycles required for the fluorescent signal to cross the predefined background level:

𝐸𝑐𝑝

𝑐𝑜𝑛𝑡𝑟𝑜𝑙 𝑔𝑒𝑛𝑒

𝐸𝑐𝑝

𝑔𝑒𝑛𝑒 𝑜𝑓 𝑖𝑛𝑡𝑒𝑟𝑒𝑠𝑡

2.9.3 Whole Genome Analysis

Transcriptome analysis was performed by using next-generation sequencing (NGS) from

Illumina. First, a cDNA library was generated employing the TruSeq

Stranded mRNA

LT Sample Prep Kit (Illumina), according to the TruSeq

Stranded mRNA Sample

Preparation Protocol LS (Illumina). The initial quantity of total RNA was 1

g per

sample. The cDNA was enriched via PCR. Diverse purification steps to separate the nucleic

acid from reaction mix between the steps were performed with Mag-Bind

RXNPure

Plus magnetic beads (Omega Bio-Tec Inc.). As a quality control and to determine

the concentration and size of the fragments, the cDNA was analyzed with a UV-Vis

spectrophotometer (NanoDrop2000, Thermo Scientific) and gel electrophoresis (2% agarose).

Sequencing was carried out by the Illumina MiSeq

System. Raw data, generated by

the Illumina MiSeq

platform, was processed on the Galaxy Project Platform (Afgan

et al., 2018), using the tools FASTQ Groomer, to convert the output data into Sanger

sequencing data. Fragments were then mapped against the human genome (hg38) to

detect splice junctions between exons by HISAT2. Mapped reads were processed to the

FeatureCount tool on the Galaxy Project Platform. Differential expression analysis was

performed by the DESEQ2 algorithm (nominal p-value < 0,05; FD>2) provided by DE

analysis (https://yanli.shinyapps.io/DEApp/ - App bioinformatics core, Center for Research

Informatics (CRI), Biological Science Division (BSD), University of Chicago). Differentially

regulated genes were analyzed for overrepresented gene sets by GSEA (Gene Set Enrichment

Analysis – http://software.broadinstitute.org/gsea/index.jsp; broad institute, Cambridge)

(Subramanian et al., 2005). Heatmap generation was conducted by ClustVis analysis

platform (Metsalu et al., 2015) and the Morpheus tool from broad institute Cambridge

(https://software.broadinstitute.org/morpheus).

40 Chapter 2 Materials & Methods

2.10 Statistical analysis

Statistical analyses were conducted using GraphPad Prism software version 6.04 (GraphPad

Software Inc., USA). Paired t-test was applied to paired data series and Mann-Whitney

U test was applied to unpaired series, both for not normally distributed data as verified

by Shapiro-Wilk test. P values smaller than or equal 0.05 were considered as statistically

significant.

2.11 Bioinformatics

Primers were designed with Primer3 version 0.4.0 (http://bioinfo.ut.ee/primer3-0.4.0/). Re-

striction analyses were performed with NEB Cutter V2.0 (http://nc2.neb.com/NEBcutter2/)

and sequence alignments were conducted using CLUSTALW (https://www.genome.jp/tools-

bin/clustalw). Vector sequences were obtained from addgene (https://www.addgene.org/)

and vector maps were designed with SnapGene Viewer 4.2.6.

Raw data from qPCR runs conducted on Stratagene MX3005P qPCR thermal cycler were

analyzed using MxPro QPCR software (Agilent Technologies, Germany) and MS Excel

software (Microsoft Corporation).

Flow cytometric data obtained from MacsQuant analyzer were evaluated by usage of the

FlowJo, LLC software V10 (FlowJo, Oregon, United States) including proliferation kinetic

calculation.

Time-lapse videos were assembled from individual frames with Photolapse software.

Single-cell fluorescence intensity measurements were conducted using Fiji ImageJ software

(Schindelin et al., 2012).

CHAPTER 3

Results

3.1 Characterisation of Human Dental Pulp Cells

3.1.1 Isolation and in vitro growth characteristics

Human dental pulp cells (DPCs) reside in the pulp tissue of teeth. The pulp tissue was

obtained from wisdom teeth of donors after informed consent. The Hematoxylin/Eosin

staining (see figure 3.1) showed, that the obtained pulp tissue consisted of the fibrous

extracellular matrix, with the fibroblasts dispersed in it, a cell-rich layer of odontoblasts

which was located at the pulpal-dentin-junction (top) and blood vessels lined by cells

(pericytes and endothelial cells) (bottom).

Figure 3.1:

Hematoxylin/Eosin staining of pulpal specimen obtained from human donor

patients with detailed structure of the remaining odontoblast layer (top) and vasculature

(bottom).

After cracking up the hard tissue of the teeth, the pulp was enzymatically dissociated,

and single cells were isolated. Since they are of mesenchymal stromal cell type (Shi et al.,

2005), DPCs can be isolated by plastic adherence on tissue culture dishes. They exhibited

a fibroblastic phenotype and expanded quickly with the ability to generate clonogenic

cell clusters (see figure 3.2 b, c). In comparison to mesenchymal stromal cells from bone

marrow, dental pulp cells were much smaller in in vitro culture.

42 Chapter 3 Results

(a) (b) (c)

Figure 3.2:

(a) Removal of dental pulp from tooth specimen, (b) colony of DPCs 72 hours

after isolation, (c) confluent layer of DPCs in standard cell culture condition and visible

fibroblastic morphology of expanded cells.

Fig. 3.3:

Histogram plots of CFSE intensity of

DPCs after 1, 2 and 5 days in monolayer culture

compared to initial CFSE-labeled population (0 h).

For analysis of cell growth char-

acteristics, a CFSE assay was per-

formed. Cells were covalently

labeled with an intracellular fluor-

escent dye which is evenly distrib-

uted among daughter cells after

cell division, resulting in a fluores-

cence intensity half of the parental

generation. This assay was used to

quantify population doublings per

time by FACS analysis. The CFSE

assay resulted in a generation time

of 25 hours, calculated by FlowJo

Proliferation Platform for stand-

ard monolayer culture (see figure

3.3) which is in conformity with lit-

erature (Huang et al., 2006;Pis-

ciotta et al., 2015;Suchánek,

Soukup,Ivančaková et al., 2007).

3.1.2 Surface Marker Expression

Cultured human dental pulp stem cells displayed the typical surface marker expression

that are described for mesenchymal stromal cells. They were positive for CD90 (Thy-1),

CD105 (SH2), CD106 (VCAM-1), CD13, CD44 (hyaluronic acid receptor) and CD146

(MCAM), and were negative for the hematopoietic markers CD45, CD14, CD34 as well

as the endothelial cell marker CD31 (PECAM-1) as shown in figures 3.4 and 3.5. For

comparison, the expression of the markers was also measured in bmMSCs (see Appendix

5.1 A).

3.1 Characterisation of Human Dental Pulp Cells 43

Figure 3.4:

Representative plots of surface marker expression of DPSCs analyzed by Flow

Cytometry. Open histograms (red) are shown for the respective stained surface molecule, and

tinted histograms represent the corresponding isotype controls (grey). The upper left plot

shows the "live" gate in FSC/SSC.

Figure 3.5:

Summary of expression of typical MSC surface markers assessed by flow cytometric

analysis. Positive markers are shown in red and negative in green (N=4).

44 Chapter 3 Results

3.1.3 Expression profile of relevant genes

Upon standard cell culture, when dental pulp cells adhered to plastic, they changed their

morphology and exhibited a fibroblast-like phenotype. Since the process of dedifferentiation

upon ex vivo culture, especially of mesenchymal cells, is described, a literature review

was performed to identify marker genes of odontoblast or mature dental pulp cell type.

The expression of these genes was measured of freshly isolated cells from the dental pulp

(DPCs), as well as from cultured DPCs over six passages. Additionally, dedifferentiated

bone marrow mesenchymal stromal cells (MSCs) from passage six (MP6) were characterized

for the respective gene expression.

Figure 3.6:

Gene expression profile of freshly isolated human dental pulp cells, in standard

culture over six passages (P0-P6) and in comparison to MSCs from bone marrow in passage

six (MP6). Quantitative RT-qPCR data is shown as mean

SEM compared to GAPDH

expression. Statistical analysis was performed using Mann-Whitney U test. Differences were

significant for P < 0.05 (*), P < 0.01 (**), P < 0.005 (***).

𝑁≥

5 biological replicates. n.d. -

not detected

3.1 Characterisation of Human Dental Pulp Cells 45

Figure 3.6 shows the relative expression of selected genes which are described to play

central roles in dental homeostasis, cytodifferentiation or tooth development. Among

them are morphogens belonging to the TGFß superfamily: BMP7,TGFß1 and INHBA

(Activin).

Freshly isolated dental pulp cells expressed BMP7 at a moderate level and the expression

entirely dropped in two-dimensional cell culture. Over the culture period of six passages,

the expression further decreased and was barely detectable. In cultured MSCs from late

passage six also no transcripts of BMP7 were detected. INHBA was expressed at a

comparable level in freshly isolated pulp cells and decreased about 3-fold upon monolayer

culture. The INHBA gene encodes a protein subunit whose homodimers form ACTIVIN A.

The TGFß1 expression was higher, compared to the other genes, and decreased more than

2.5-fold in cultured DPCs compared to directly isolated. It did not change over time of

monolayer culture. For none of these three markers of the TGFß superfamily, a significant

difference between dedifferentiated DPCs and MSCs was detected.

Furthermore, transcript expression of two other morphogens, fibroblast growth factor

2 (FGF2) and hepatocyte growth factor (HGF), was analyzed. No difference in FGF2

expression was observed between primary isolated and monolayer cultured DPCs. Although

not statistically significant, a tendency of a higher expression of FGF2 in MSCs from bone

marrow was observed. No statistically significant difference in HGF expression between

isolated DPCs and cultured DPCs as well as MSCs was detected.

Two main dental transcription factors were included in this analysis: the homeobox

transcription factor Msh homeobox 1 (MSX1 ) and paired box gene 9 (PAX9). Interestingly,

both transcription factors tended to be specific for the dental pulp cells here, since they

were not or barely measured in MSCs from bone marrow. It is known that in general, the

expression height of transcripts from transcription factors is lower than that of secreted

molecules, such as growth factors or extracellular matrix proteins. Nevertheless, PAX9

was expressed at a considerably high level in DPCs and was not diminishing upon 2D

culture. MSX1 was expressed about 2.5-fold lower than PAX9 in freshly isolated DPCs

and significantly decreased upon monolayer culture.

Collagen type I (COL1A1) is the predominant extracellular matrix molecule in the dental

pulp. Therefore, it is not surprising that a remarkable high expression in the isolated

cells from the dental pulp was detected. After monolayer culture, the cells exhibited a

diminished expression of COL1A1, though it was still high (one- to two-fold higher than

GAPDH). The expression of COL1A1 in MSCs in culture was at a comparable level.

The DSPP gene encodes for a preproprotein secreted by odontoblasts. This preprotein is

proteolytically processed to generate dentin sialoprotein and dentin phosphoprotein, both

principal mineralization proteins of the dentin extracellular matrix. Here, the transcripts

of DSPP were exclusively detected in primary isolated cells from the dental pulp. Neither

the de-differentiated DPCs nor the MSCs showed any expression of this marker gene.

Compared to COL1A1 the expression of DSPP was more than 25-fold lower.

46 Chapter 3 Results

3.1.4 Differentation capacity

On the basis of marker gene expression of cultured DPCs in monolayer (see Chapter 3.1.3),

dedifferentiation of the cells was assumed. The cells represented a precursor phenotype,

and a mandatory feature of mesenchymal precursor cells is the ability to differentiated

to multiple cell types under appropriate conditions. This attribute is referred to as

multipotency. In order to assess the multipotent capacity of the isolated DPCs, standard

protocols for adipogenic, osteogenic and neurogenic differentiation were applied.

Fig. 3.7:

Marker gene

expression of adipogenic

differentiation. Quantit-

ative RT-qPCR data is

shown as mean

SEM

compared to GAPDH

expression. Statistical

analysis was performed

using paired t test. N=5

biological replicates.

Adipogenic differentiation

As shown in figure 3.7 the expression of lipoprotein lipase

(LPL) and fatty acid binding protein 4 (FABP4), marker genes

for adipocytes, tended to be upregulated upon adipogenic

differentiation. Nevertheless, in the control group as well as in

the differentiated cells, expression of these two marker genes

was extremely low (10 000 to 2000-fold lower than GAPDH).

The poor differentiation capacity to adipogenic lineage was not

only observed at molecular level. The Oil Red O staining for

detection of lipid vacuoles inside the cytoplasm revealed only

faint staining (see figure 3.8, right). The vacuoles tended to be

numerous, yet small in size. However, a microscopic difference

between the two groups (undifferentiated vs. differentiated

DPCs) was observed. The left picture in figure 3.8 depicts

a representative image the control group of undifferentiated

cells.

Figure 3.8: Oil Red O staining for lipid droplets upon

adipogenic differentiation (representative image), N=6

3.1 Characterisation of Human Dental Pulp Cells 47

Fig. 3.9:

Marker gene

expression of osteogenic

differentiation. Quantit-

ative RT-qPCR data is

shown as mean

SEM

compared to GAPDH

expression. Statistical

analysis was performed

using paired t test. N=5

biological replicates.

Osteogenic differentiation

To assess differentiation capacity to osteogenic lineage upon

culture in specific differentiation media, gene expression ana-

lysis of marker genes of osteoblasts was performed 28 days

after induction. Figure 3.9 indicates an upregulation of Os-

teopontin (OPN) and Osteocalcin (OCN). Osteopontin is a

major component of the bone matrix and binds hydroxylapat-

ite. Osteocalcin represents a peptide hormone that regulates

bone mineralization and calcium ion homeostasis. During the

osteogenic culture a remarkable matrix deposition was noticed

on the cell layer. Macroscopically, a strong positivity of Aliz-

arin Red staining was observed (see figure 3.10, right picture).

Alizarin Red stains calcified matrix deep red. The left picture

in 3.10 depicts a representative image of non-differentiated

DPCs in monolayer stained with Alizarin red.

Figure 3.10: Alizarin Red Staining for deposition of

calcified matrix upon osteogenic differentiation

(representative image), N=6

48 Chapter 3 Results

Fig. 3.11:

Marker gene

expression of neurogenic

differentiation. Quantit-

ative RT-qPCR data is

shown as mean

SEM

compared to GAPDH

expression. Statistical

analysis was performed

using paired t test. Dif-

ferences were significant

for P < 0.05 (*), N=5

biological replicates.

Neurogenic differentiation

Human dental pulp cells are of ectomesenchymal origin. There-

fore, ontologically they have a close relationship to ectodermal

cells. Several groups have shown that they are capable to dif-

ferentiate to neurogenic lineage upon suitable differentiation

induction. To show that the used cells are also capable of

neurogenic differentiation, they were cultured in neurogenic

media. Figure 3.11 displays an approximately 3-fold upregula-

tion of the measured neurogenic markers genes Nestin (NES)

and TUJ1 after two weeks of differentiation induction. The

TUJ1 gene encodes the neuron-specific class III ß-tubulin, a

structural protein that contributes to microtubule stability

in neuronal cell bodies and axons. Nestin is an intermediate

filament expressed mostly in nerve cells with an implication

in the radial growth axons. Morphologically the differentiated

cells were distinct from the non-differentiated DPCs. They

were elongated, bigger and had larger cell processes. On pro-

tein level, a high accumulation of the NESTIN protein was

detected in the cytoplasm as assessed by immunocytological

staining (see figure 3.12). Nuclei were counterstained with

DAPI.

Figure 3.12: Immunocytological staining for Nestin (green)

and nuclear counterstaining with DAPI (blue).Left: Dental pulp

cells without neuronal differentiation induction (Control); Right:

Dental pulp cells after 14 days of neuronal differentiation

induction. (representative image), N=5

3.2 Mechanisms of ectomesenchymal condensation 49

3.2 Mechanisms of ectomesenchymal condensation

In the course of embryogenesis, the development of numerous organs such as hair, teeth,

feathers, salivary glands, mammary glands, bone, cartilage, kidney, lung and many more

is induced by the so-called mesenchymal condensation. Organ fate-specific mesenchymal

cells form a tightly packed signaling center and thereby orchestrate the organ development.

For long, this step of organogenesis was underestimated, and to date, only little is known

about the molecular events during human mesenchymal condensation especially in the

tooth development. Therefore, the focus of this thesis was to generate a suitable model to

study human dental mesenchymal condensation. Based on my experiences of mesenchymal

condensation in cartilage development, the model was established as a non-forced aggrega-

tion of cells. In contrast to previous publications from other groups, that actively pack the

cells by micromass, pellet, hanging drop or fibronectin island culture, here the cells were

seeded into ultra-low attachment plates. In this setup, the cells have no opportunity to

interact with a matrix or the culture dish.

3.2.1 Establishment of 3D cell culture

Human tooth initiation begins in the fifth week after gestation when the ectomesenchymal

cells from the neural crest have already migrated into the developing jaws and crowd

underneath the oral epithelium at the site of tooth development. The complete mesenchymal

condensate in late cap stage of tooth formation has an approximate size of 500

m. Only

one condensate per tooth is formed. Therefore, the requirement for the tooth condensate

model was to generate one aggregate of 500

m diameter per well from single cell DPCs.

The ideal cell concentration to obtain a single aggregate turned out to be approximately 1

million DPCs per ml medium seeded into ultra-low attachment (ULA) wells. The number

of used cells was decisive for the condensate size. It turned out that 200 000 DPCs seeded

in 96-well of ULA resulted in a condensate with 500

m in diameter. A videomicroscropic

analysis was performed to assess the kinetics of the condensation process. Depending on

the primary human donor, the time until a dense aggregate has formed, took between 20

to 36 hours. In figure 3.13 representative images from the microscopic video records are

shown. After 12 hours all cells were integrated into a cellular network, and afterwards,

the cell-cell-attachments led to an intense self-orchestrated aggregation. The upper right

picture, shows the seeded DPCs at the start of the experiment. In the lower right picture

a higher magnification, of the condensing cells at 6 hours after induction in ULA-culture is

imaged. Notably, strong cell-cell contacts were identified (arrows).

50 Chapter 3 Results

Figure 3.13:

Time-lapse videomicroscopic analysis of in vitro condensation in 96-well format

over a course of 24 hours. At higher magnification the suspended cells at the beginning (top

right) and after six hours of condensation (bottom right) are depicted. The cell-cell contacts

are visible (arrows).

3.2.2 Expression kinetics of relevant genes

To gain insight into the molecular events triggered by the initiation of the in vitro con-

densation, a panel of described dental developmental genes was chosen to be analyzed

by qRT-PCR. Furthermore, whole transcriptome analysis was performed by using a Next

Generation Sequencing method (Illumina). First, gene expression in long-term range was

investigated. The dental pulp cells were seeded into the ultra-low attachment wells, and

RNA was extracted after 24 hours, four days and four weeks for subsequent qRT-PCR.

These expressions were compared to the expression of cells in standard monolayer culture,

as well as to freshly isolated dental pulp cells. The panel of genes included four members

of the TGFß superfamily ligands (TGFß1,BMP7,BMP4 and INHBA), FGF2, the ECM

molecules COL1A1 and DSPP, as well as the transcription factors MSX1 and PAX9.

As described before, the molecules of the TGFß superfamily play a significant role in

early and late tooth development. Three of the four investigated members (BMP7,TGFß1

and INHBA) were subject to the dedifferentiation, exhibiting a lowered abundance in

cultured monolayer compared to directly isolated cells. BMP4 expression was not changed

upon standard culture. 24 hours after condensation induction, the expression level of

BMP4 dramatically dropped and also after four days barely any BMP4 transcripts were

detected. Only after four weeks, higher expression was observed again. The expression

3.2 Mechanisms of ectomesenchymal condensation 51

BMP4

freshly isolated

ML P4-P6

24h

10-5

10-4

10-3

10-2

10-1

Ratio GAPDH

****

P valueComparison

f.i. vs ML

ML vs 4d

ML vs 4w

ML vs 24h

f.i. vs 4w

0.9980

< 0.0001

****

< 0.0001

****

0.0946

0.0635

BMP7

freshly isolated

24h

10-6

10-5

10-4

10-3

10-2

10-1

Ratio GAPDH

***

P valueComparison

f.i. vs ML

ML vs 4d

ML vs 4w

ML vs 24h

f.i. vs 4w

0.0003

***

0.7267

0.0072

0.0013

0.2222

TGFß1

freshly isolated

ML P4-P6

24h

10-3

10-2

10-1

100

Ratio GAPDH

****

P valueComparison

f.i. vs ML

ML vs 4d

ML vs 4w

ML vs 24h

f.i. vs 4w

0.0244

0.3672

0.6837

< 0.0001

****

0.9004

INHBA

freshly isolated

ML P4-P6

24h

10-3

10-2

10-1

Ratio GAPDH

P value

Comparison

f.i. vs ML

ML vs 4d

ML vs 4w

ML vs 24h

f.i. vs 4w

0.0084

0.3680

0.0170

0.0053

0.6753

FGF2

freshly isolated

ML P4-P6

24h

10-3

10-2

10-1

100

Ratio GAPDH

P value

Comparison

f.i. vs ML

ML vs 4d

ML vs 4w

ML vs 24h

f.i. vs 4w

0.6827

0.1542

0.0656

0.0017

0.0173

MSX1

freshly isolated

ML P4-P6

24h

10-6

10-5

10-4

10-3

10-2

10-1

Ratio GAPDH

****

P value

Comparison

f.i. vs ML

ML vs 4d

ML vs 4w

ML vs 24h

f.i. vs 4w

< 0.0001

****

< 0.0001

****

< 0.0001

****

0.5635

0.0051

PAX9

freshly isolated

ML P4-P6

24h

10-4

10-3

10-2

10-1

Ratio GAPDH

P value

Comparison

f.i. vs ML

ML vs 4d

ML vs 4w

ML vs 24h

f.i. vs 4w

0.7037

0.0050

0.2005

0.2318

0.3095

DSPP

freshly isolated

ML P4-P6

24h

10-6

10-5

10-4

10-3

10-2

10-1

100

Ratio GAPDH

P value

Comparison

f.i. vs ML

ML vs 4d

ML vs 4w

ML vs 24h

f.i. vs 4w

0.0238

0.9000

0.8000

COL1A1

freshly isolated

ML P4-P6

24h

10-2

10-1

100

101

102

Ratio GAPDH

****

P value

Comparison

f.i. vs ML

ML vs 4d

ML vs 4w

ML vs 24h

f.i. vs 4w

0.3983

0.0011

< 0.0001

****

0.0484

0.0823

Figure 3.14:

Gene transcription level of chosen marker genes during the long-term condens-

ation process. Depicted are relative expression values (mean

SEM; relative to GAPDH )

of the DPC condensates at 24 hours (24h), 4 days (4d) and 4 weeks (4w) after induction of

condensation culture. For comparison also expression values of freshly isolated DPCs (f.i.) and

dedifferentiated monolayer DPCs in different passages (ML P2-P6) are presented. Significance

was calculated by Mann-Whitney U-Test: ns - not significant; * - P < 0.05 ; ** - P < 0.01; ***

- P < 0.001; **** - P < 0.0001. 𝑁≥5 biological replicates.

52 Chapter 3 Results

profiles of BMP7,TGFß1 and INHBA were concordant: no significant change was detected

after 24 hours in low attachment culture. After four days, the expression was elevated

(TGFß1 only slightly). Notably, after four weeks the transcript level of TGFß1,BMP7,

and INHBA was similar to that of the primary isolated dental pulp cells.

The fibroblast growth factor 2 (FGF2) is described to promote the survival and proliferation

of multiple cell types and to enhance angiogenesis (El Agha et al., 2016). Also it is

described to promote mesenchymal condensation in vivo (Perantoni et al., 1995;Song

et al., 2004). Since the signaling cascade, inducing the condensation in the presented ultra-

low attachment culture model was unknown, it was hypothesized that it is FGF2-based

by autocrine stimulation. Nevertheless, FGF2 expression was not elevated in the earlier

phases of condensations (24 hours and four days). Only after four weeks, a significant

increase in expression was noticed.

Two important transcription factors were included in the panel: MSX1 and PAX9. Surpris-

ingly, MSX1 expression dramatically decreased upon 3D culture and only slightly increased

at four weeks. PAX9 transcript level was not changed upon dedifferentiation in 2D culture.

After induction of in vitro condensation, the expression slightly dropped after 24 hours and

then reconstituted to the initial level. Taking into account that PAX9 is a transcription

factor, the overall expression was comparably high.

The initial expression of dentin sialophosphoprotein (DSPP) in the freshly isolated DPCs

was completely lost upon standard monolayer culture. In some donor populations, an

increase in expression was observed upon long-term cultivation of the condensates (4 weeks).

Here, statistical analysis was not possible due to the small number of expression values. As

described before, the collagen type I expression (COL1A1) slightly, but not significantly,

decreased in monolayer culture and diminished further after induction of condensation

and after four days. In the 4 week-condensates, an elevation of transcript expression was

detected.

Odontogenic differentiation requires initial cytoskeletal rearrangement induced by mechan-

ical compaction and traction forces. Therefore, the very first signals, that are induced upon

and in the course of the contraction during the in vitro condensation were of interest in the

next experiment. A short-term kinetic was performed, and condensation and odontogenic

marker genes were measured. The goal was to determine the time point at which the cells

reacted with the most prominent change in gene expression on the condensation induction.

Figure 3.15 depicts the analysis of the condensations at two to six hours, each in comparison

to the monolayer. Genes that are described to be physically involved in cell-cell-adhesion

show the same tendency. Transcripts of the extracellular matrix glycoproteins fibronectin 1

(FN1) and tenascin C (TNC), and the membrane receptors neural cell adhesion molecule

(N-CAM) and syndecan 1 (SDC1) decreased slightly with time. Tenascin C was expressed

10-fold higher than fibronectin. After four and six hours, transcript level of fibronectin was

significantly reduced. Also, in expression of BMP4,INHBA and FGF2 striking differences

were observed over time. The dramatic drop of BMP4 expression, which has been observed

in the long-term analysis (see figure 3.14), occurred already after four hours. The expression

of INHBA and FGF2 rose with time around 3-fold. No tendency of change in PAX9

expression was detected at the depicted early time points. A significant reduction was only

3.2 Mechanisms of ectomesenchymal condensation 53

observed after 24 hours (see figure 3.14).

Figure 3.15:

Gene expression (mean

SEM) of condensation marker genes during early

phase of three-dimensional culture relative to GAPDH expression. Significance was calculated

by paired t-test: ns - not significant; * - P < 0.05. N=4 biological replicates.

3.2.3 Transcriptome of early phase of in vitro condensation

Transcriptome analysis was performed at a very early time point, at six hours after

condensation induction. This point in time was chosen for two reasons. Firstly, the goal

was to identify gene expression changes that are directly associated with the change of

cellular morphology. Secondly, the short-term kinetic (see figure 3.15) revealed that changes

regarding the expression of the chosen marker genes was minor and only at six hours

after condensation induction, three of the eight chosen genes were significantly up- or

down-regulated. For two individual donor cell populations, the total RNA of monolayer

cells, and of cells, that were cultured in ultra-low attachment for six hours, was prepared

for RNA sequencing. This work was done within the supervised Diploma thesis of Julia

Bräunig.

Data quality

Figure 3.16 (a) shows that the obtained data from the RNA Seq significantly correlated

with qRT-PCR results. Real-Time PCR was performed by using the cDNA from the

54 Chapter 3 Results

samples, that were used for RNA Seq. The Pearson coefficient is calculated to be R

=0.829

(P value<0.0001). A "Differential Gene Expression Analysis" by the DESEQ2 method

was performed to identify the genes which are significantly differentially expressed upon

the culture condition in both donor cell populations. The analysis with a cutoff in fold

change of 1.5 and a significant nominal P value resulted in 521 differentially expressed

genes (303 upregulated, 218 downregulated). The complete list of differentially expressed

genes containing the "Reads per Million" for each gene and each sample is attached in the

Appendix.

Figure 3.16:

Quality of the RNA Seq data. (a) Significant correlations between expressions

of quantitative real-time PCR and RNA-Seq. Depicted are the log

fold changes of seven genes,

obtained by RNA Seq (FPKM values) or by qRT-PCR (

𝛥

Ct to GAPDH values). FPKM-

fragments per kilobase of transcript per million mapped reads.

Analysis of the whole transcriptome

For significant determination of cell type-specific and condensation dependent expression

pattern an additional data set of cell condensation (24h) conducted with bone marrow-

derived stromal cells was included. Heatmap analysis produced two main groups represented

by the DPC and MSC subpopulations. Within the MSC group, monolayer cultivated cells

and condensed cells after 24h of low attachment cultivation formed two separate clusters.

Interestingly, regarding the DPC subpopulations, clustered comprehensive heatmap analysis

of all expressed genes revealed the transcriptome properties of individual primary cells

with donor intrinsic expression intensities, characterized by donor-specific clustering (see

figure 3.17).

Figure 3.17:

A heatmap over relative expression levels of all expressed genes in monolayer

cultured (ML) or condensed (cond) DPCs or MSCs respectively. The color code represents the

range between minimal (blue) and maximal (red) expression based on RPM values.

3.2 Mechanisms of ectomesenchymal condensation 55

Assessment of differentially expressed genes and affected molecular and biological functions

To assign differentially expressed genes upon condensation induction the DESEQ2 al-

gorithm from the Center for Research Informatics (CRI), University of Chicago (ht-

tps://yanli.shinyapps.io/DEApp/) was applied. Comparative cluster analysis of the defined

521 regulated genes demonstrate an almost even distribution of 58.2 % up- and 41.8 %

downregulated genes.

Figure 3.18:

A heatmap over relative expression levels of all differentially expressed genes

between monolayer cultured (ML) or condensed (cond) DPCs according to DESEQ2 algorithm

(nominal P value < 0.05). 521 differentially expressed genes display even distribution of

upregulated and downregulated genes The color code represents the range between minimal

(blue) and maximal (red) relative expression based on RPM values.

To allocate affected biological processes, molecule classes and signal transduction path-

ways, a Gene Set Enrichment Analysis (GSEA) with focus on particular terms like biological

function or signal transduction pathway was performed. Induction of DPC condensation

produced mainly GO terms connected to cell differentiation, developmental processes and

cell communication in the “biological process” set of genes. According to the intensified

cell-cell contact in condensation culture, GO terms associated to anchoring junction, focal

adhesion, and gap junction formation were defined to be overrepresented within the set of

differentially expressed genes.

Several more specialized gene sets for signal transduction pathways emerged repeatedly

in the particular sub-categories and are applicable to describe cellular changes in detail.

For evaluation of the selected pathways not only the regulated genes were taken into

consideration, but also the general expression strengths was included to estimate the

activity of the pathway. The detailed results can be obtained from the appendix (see

figures 5.7 and 5.8).

56 Chapter 3 Results

The TGFß signal transduction pathway

represents a key element in regulation of

developmental processes and differentiation. The selected gene set KEGG – TGFß signaling

pathway comprises 86 genes. Cluster heatmap analysis of the expressed genes of the gene

set overruled the cluster relationship caused by the primary cell character and resulted

in a distinct ML and condensation sample cluster. The heatmap diagram reduced to the

significantly regulated genes showed a higher proportion of upregulated genes.

Figure 3.19:

Clustered heatmap for KEGG – TGFß signaling pathway. (A) Cluster analysis

of all expressed genes of the gene panel and (B) with focus on significantly regulated genes.

The color code represents the range between minimal (blue) and maximal (red) expression

based on RPM values.

The three growth factors TGFß1,TGFß and TGFß3 were significantly upregulated

along with the TGFß specific signal transducer SMAD3. Together with the downregulation

of BMP4 and the TGFß signaling specific inhibitor SMURF2 the data suggest a shift from

BMP to TGFß signaling. On the other hand, the BMP pathway specific inhibitor Noggin

(NOG) was downregulated and the member of the BMP subfamily BMP8A was upregulated.

To gain a more significant statement a recently published panel of TGFß signaling inhibitor

and enhancer molecules (Chang,2016) was included in the evaluation (see Appendix figure

5.9). Furthermore, the absolute expression strength of the pathway-associated genes was

taken into account, despite their regulation (see figure 3.20). From the 33 in this context

described regulatory molecules, 29 were found to be expressed in condensed DPCs on RNA

level with conditions to have moderate gene expression level in the DPC condensation

samples or at least a two-fold difference in the RPM values of both samples. Three further

TGFß regulatory molecules were significantly regulated according to the DESEQ2 analysis.

The TGFß signaling supporting molecule connective tissue growth factor (CTGF) displayed

down-modulated expression levels, and TGFß enhancer syndecan2 (SDC2) and the BMP

antagonist gremlin 2 (GREM2) were upregulated. Furthermore, several genes like the BMP

inhibitors biglycan (BGN), follistatin (FST) and the cysteine rich transmembrane BMP

regulator 1 (CRIM1), the TGFß inhibitor EMILIN1 as well as the bivalent acting molecules

Follistatin-like 1 (FSTL1), Glypican (GPC) and Twisted gastrulation 1 (TWSG1 ) exhibit

high expression levels, independent from the cultivation condition (see Appendix figure

5.9).

3.2 Mechanisms of ectomesenchymal condensation 57

Figure 3.20:

RPM values of TGFß signal transduction pathway-associated genes are depicted.

The KEGG gene subset comprises 86 genes. The diagram is reduced to genes with at least

moderate gene expression level in the DPC condensation samples and/or genes with an at

least two-fold difference in the RPM values of both samples, resulting in 64 genes. Dashed

line marks the level of highly expressed genes (RPM>100); dotted line marks the level of

moderately expressed genes (RPM>5). Statistical significance was calculated from DESEQ2

analysis: *** - P < 0.001; ** - P < 0.01; * - P < 0.05.

The comprehensive analysis of the expression levels of the KEGG – TGFß signaling

pathway reveals an extensive expression of molecules involved in all hierarchical levels of

the TGFß signal transduction. Figure 3.20 shows the expression of TGFß pathway-assigned

genes, subcategorized to high, moderate, and low gene expression level, while figure 3.21

pictures the genes in the context of the pathway. Both, the BMP as well the TGFß pathway

are active in DPC. However, the regulated genes and the expression levels of the regulative

gene panel drives the assumption of a BMP to TGFß signaling shift.

58 Chapter 3 Results

Figure 3.21:

The TGFß signaling pathway scheme of the KEGG database relate the particular

genes to their position and function within the signaling cascade. The pathway diagram displays

the genes with at least moderate gene expression level in the DPC condensation samples and

the genes with at least a two fold difference in the RPM values of both samples, marked with

red stars (64 genes). +p/-p: phosphorylation/dephosphorylation, +u: ubiquitinylation.

The binding of TGFß ligands to their receptor system elicits, besides the canonical

Smad2/3 pathway, two further signal transduction pathways: the MAPK pathway and

signaling by the small GTPase RhoA (see figure 3.21). MAPK kinase signaling is central

to multiple signal transduction pathways and activates or inactivates target molecules

by phosphorylation. According to the GSEA results, the

MAPK signaling pathway

represents the most significant overrepresented pathway in both the KEGG panel and the

BIOCARTA gene sets. For further analysis, the KEGG gene set MAPK Signaling Pathway

comprising 267 genes was selected. Clustered heatmap analysis of the gene set resulted in

two distinct clusters for monolayer culture and DPC condensation (see figure 3.22).

3.2 Mechanisms of ectomesenchymal condensation 59

Figure 3.22:

Clustered heatmap for KEGG – MAPK signaling pathway. (A) Cluster analysis

of all expressed genes of the gene panel and (B) with focus on significantly regulated genes.

The colour code represents the range between minimal (blue) and maximal (red) expression

based on RPM values.

Figure 3.23:

The MAPK signaling pathway scheme of the KEGG database relate the partic-

ular genes to their position and function within the signaling cascade. The pathway diagram

displays the genes with at least moderate gene expression level in the DPC condensation samples

and the genes with at least a two-fold difference in the RPM values of both samples, marked

with red stars (166 genes). +p/-p: phosphorylation/dephosphorylation, +u: ubiquitinylation.

60 Chapter 3 Results

Although 22 genes of the panel are significantly regulated, the impact on the pathway

activity is hardly predictable. To determine if the condensation resulted in decreased or

elevated activity, a specific reporter construct was generated and applied in condensation

experiments (see chapter 3.3.1). However, comparable to the TGFß signaling pathway, the

vast majority of the gene group was shown to be expressed, providing the requirements of

active MAPK signal transduction. The signaling cascade is composed of hierarchical kinase

levels, where each kinase activates the subjacent level. The expression strength analysis

evidenced the presence of members of each kinase level (see Appendix figure 5.11). The

putative activity is emphasized by the plot analysis where the particular members of the

signaling pathways are allocated to their positions within the pathway map (see figure 3.23).

The second non-canonical pathway elicited by TGFß ligand binding is mediated by the

small GTPase RhoA.

RhoA signaling

is highly associated with cytoskeletal actin reor-

ganization, which is among the enriched gene sets by GSEA. Although the RhoA signal

transduction pathway itself is not targeted by the enrichment analysis, the general presence

and thus, the principal pathway activity was analyzed. The applied gene set was generated

by merging the gene panels PID RHOA REG PATHWAY and PID RHOA PATHWAY

from the Pathway Interaction Database (PID, http://pid.nci.nih.gov) and the addition

of RhoA activating GEF (guanidine exchange factor) and inactivating GAP (GTPase

activating factor) molecules (141 genes).

Figure 3.24:

Clustered heatmap for KEGG – RHOA signaling molecules. (A) Cluster

analysis of all expressed genes of the selected gene panel and (B) with focus on significantly

regulated genes. The color code represents the range between minimal (blue) and maximal

(red) expression based on RPM values.

-0.3cm Comparable to the TGFß signaling the vast majority of the gene panel was detected

on RNA level. The 119 verified transcripts prevailed against the donor-specific differences in

expression and generated distinct clusters for monolayer cultivated cells and condensed cells.

Remarkably, the set of differentially expressed genes is characterized by downregulation

of two Rho GTPases (RND3 and RHOBTB3) as well as the transcriptional reduction of

GTPase activating guanidine exchange factor molecules ARHGEF25 and ARHGEF28 (see

figure 3.24). The Lim kinase 2 (LIMK2) phosphorylates downstream targets in the Rho

signal transduction pathway and is activated by the Rho/Rock. Significantly decreased

RNA transcript levels for LIMK2 enzyme and the downregulation of the direct Rho

axis target gene CYR61 emphasize the hypothesis of mitigated RhoA signaling activity.

3.2 Mechanisms of ectomesenchymal condensation 61

On the other hand, encompassing analysis independent of differentially expressed genes

demonstrates a broad expression of genes associated with the Rho pathway (see figure

3.25).

Figure 3.25:

RPM values of RHOA signal transduction pathway-associated genes are depicted.

The KEGG gene subset comprises 150 genes. The diagram is reduced to genes with at least

moderate gene expression level in the DPC condensation samples and/or genes with an at

least two-fold difference in the RPM values of both samples, resulting in 95 genes. Dashed

line marks the level of highly expressed genes (RPM>100); dotted line marks the level of

moderately expressed genes (RPM>5). Statistical significance was calculated from DESEQ2

analysis: *** - P < 0.001; ** - P < 0.01; * - P < 0.05.

62 Chapter 3 Results

The

Wnt signaling pathway

is known to be involved in early phases of tooth devel-

opment and emerges in the gene set enrichment analysis in the HALLMARK panel from

broad institute (http://software.broadinstitute.org/gsea/msigdb) of signal transduction

pathways. However, for optimal analysis of the WNT signaling pathway in the context of

DPC condensation, the KEGG associated panel of 151 genes KEGG WNT SIGNALING

PATHWAY was selected because of the more comprehensive gene panel.

Figure 3.26:

Clustered heatmap for KEGG – WNT signaling pathway. (A) Cluster analysis

of all expressed genes of the gene panel and (B) with focus on significantly regulated genes.

The color code represents the range between minimal (blue) and maximal (red) expression

based on RPM values.

Clustered heatmap analysis demonstrates the assembling of a monolayer and a con-

densation cluster formed by the 121 expressed genes from the WNT gene panel (see

figure 3.26). However, to draw general conclusions about the impact on pathway activity

from the regulated gene set remains challenging. Almost all of the regulated genes show

higher transcriptional activity. Among the differentially expressed genes, the transcription

factors TCF7 and NFATC2 show elevated RNA levels providing the foundation of higher

pathway activity at the downstream level of the pathway. Two extracellular suppressor

molecules from WNT signaling are found to be expressed reciprocally. Both the upregulated

secreted frizzled related peptide 4 (SFRP4), as well as the downmodulated Dickkopf 2

(DKK2), interfere with the receptor WNT ligand binding and attenuate the triggering

signal. A comprehensive analysis by taking the general expression and the expression

intensity into account validates the principal requirements of an active WNT signaling.

Molecules covering all hierarchical pathway levels are defined to be expressed (see figure

3.27), with exceptionally high abundance of RNA levels for the ligands WNT5A and

WNT5B, the receptor molecules frizzled 1 and frizzled 7 (FZD 1 and FZD7), as well as

the membrane-bound co-receptor for the canonical WNT pathway LPR5 (see Appendix

figure 5.12).

3.2 Mechanisms of ectomesenchymal condensation 63

Figure 3.27:

The WNT signaling pathway scheme of the KEGG database relate the particular

genes to their position and function within the signaling cascade. The pathway diagram displays

the genes with at least moderate gene expression level in the DPC condensation samples and

the genes with at least a two-fold difference in the RPM values of both samples, marked with

red stars ( genes). +p/-p: phosphorylation/dephosphorylation, +u: ubiquitinylation.

64 Chapter 3 Results

The

Notch signaling pathway

was deduced repeatedly by gene set enrichment analysis,

especially in the REACTOME database context. For in-depth analysis of the regulation of

Notch signal transduction, a set of genes was generated by merging the hallmark gene set

HALLMARK NOTCH SIGNALING from Broad Institute, and the gene panel derived from

Reactome database (http://www.reactome.org) REACTOME SIGNALING BY NOTCH

resulting in an assembled group of 126 genes.

Figure 3.28:

Clustered heatmap for KEGG – NOTCH signaling pathway. (A) Cluster analysis

of all expressed genes of the gene panel and (B) with focus on significantly regulated genes.

The color code represents the range between minimal (blue) and maximal (red) expression

based on RPM values.

Clustered heatmap analysis revealed the formation of a monolayer cluster and a cell

condensation cluster of the 110 expressed genes repealing the donor intrinsic clustering

(see figure 3.28). A set of 13 genes are differentially expressed according to the DESEQ2

analysis. Remarkably, both, the ligand molecules JAG1 as well as the receptor NOTCH3

were defined to be significantly higher expressed upon condensation induction and suggest

an autocrine activation of the signaling. This idea is emphasized by the downregulation

of inhibitory co-repressors Histone deacetylases (HDAC) 7 and 11 as well as the elevated

levels of transcriptional targets like HES1 and HEYL and the receptor processing molecule

FURIN. Expression analysis independent of transcriptional regulation substantiates the

Notch pathway activity. Ligand binding to the receptor activates ADAM proteases like

ADAM10 and the gamma-secretase complex (consisting of four subunit proteins). All

molecules exhibit high RNA levels (see figure 5.13). Furthermore, all molecules required to

elicit and transduce a signal upon ligand binding from the cell membrane to the nucleus

are expressed (see figure 3.29).

3.2 Mechanisms of ectomesenchymal condensation 65

Figure 3.29:

The NOTCH signaling pathway scheme of the KEGG database relate the

particular genes to their position and function within the signaling cascade. The pathway

diagram displays the genes with at least moderate gene expression level in the DPC condensation

samples and the genes with at least a two-fold difference in the RPM values of both samples,

marked with red stars (36 genes from 47).

3.2.4 In vitro live imaging of collagen deposition

Collagen transcripts have been shown to be among the most abundant transcripts in the

DPCs. All collagen isoforms together summed up to 5 % or 7.5%, respectively, of all mapped

transcripts in the RNA Seq of both donor populations. Collagen type I represented the

vast majority. T. Mammoto,A. Mammoto,Jiang et al., 2015 describe that the collagen

deposition in a mesenchymal condensate mechanically supports the cellular compaction and

thereby ensures a sustained and stabilized cytoskeletal arrangement that induces cell fate

switch by upregulation of specific transcription factors. Here, a fusion protein composed of

the collagen-binding adhesion protein 35 (CNA35, 35 kDa) and enhanced green fluorescent

protein (eGFP) was used to track collagen production of DPCs in low-attachment culture

in real time. The collagen-binding adhesion proteins represent a collagen-binding domain

of the bacterial collagen adhesin, originating from Staphylococcus aureus.S. aureus is

the most common pathogen in bacterial arthritis and acute osteomyelitis (Patti et al.,

1994). The cell surface molecule adhesin mediates the attachment of the bacteria to the

cartilage or bone tissue by specific binding to collagen motifs. The approach to use the

collagen-binding domain for in situ and in vitro experiments was first described by Krahn

et al., 2006 and has the advantage to track collagen deposition or rearrangement in living

culture systems.

Here, the recombinant CNA35-eGFP was produced in the prokaryotic system, isolated by

affinity chromatography, dialyzed and was then administered to the culture medium of

the DPCs, that were transferred into ultra-low attachment wells. Fluorescent microscopic

pictures were taken every five minutes for 12 hours. In figure 3.30, frames from different

time points are depicted. The condensation process was not perturbed by the presence

of the CNA-eGFP protein. After four hours small spots on the surface of the cells in the

condensing aggregate appeared. With time, the fluorescence signal on the surface and

pericellularily increased. After 24 hours, at higher magnification, delicate meshes or fibers

66 Chapter 3 Results

were detected (bottom left picture), although most of the fluorescence, tagging the collagen

deposition, emerged pericellularly (bottom right).

Figure 3.30:

Live in vitro-imaging of collagen synthesis of DPCs during condensation. The

two upper rows represent a kinetic of fluorescent microscopy over 12 hours detecting the

fluorescence of eGFP coupled to CNA35 (bars represent 500

m). The bottom pictures depict

the fluorescently tagged collagen arrangement after 24 hours of low-attachment culture at two

different magnifications.

3.3 Functional analyses of the in vitro model for mesenchymal condensation

3.3.1 Analysis of relevant pathways

Establishment of reporter constructs

Four different reporter constructs were cloned to analyze real-time induction of relevant

pathways during in vitro condensation. In these constructs, the open reading frame for

enhanced green fluorescent protein (eGFP) was cloned behind a minimal promoter and a

response element (RE), comprising repetitive transcription factor binding sites for a specific

pathway. Here, the activation of the pathways leads to an activation of the promoter and

subsequent eGFP expression was detected by flow cytometry and fluorescence microscopy.

To test the functionality of the constructs, first, they were transduced in human dental

pulp cells in monolayer cultures and were then stimulated with known inducers of the

3.3 Functional analyses of the in vitro model for mesenchymal condensation 67

respective pathways. The concentrations were the following:

pathway inducing agent low dose high dose

TGFß1 TGFß1 2.5 µg/ml 25 µg/ml

MAPK EGF 100 µg/ml 200 µg/ml

FoxO LY294002 20 µM 40 µM

Wnt LiCl 5 mM 50 mM

FACS analysis after transduction shows that transduction with the reporter constructs was

successful (see Appendix 5.2). The minimal promoter control exhibited a low background

eGFP signal (compared to untransduced DPCs). Without exogenous stimulation, approx-

imately 19 % of the Wnt-RE transduced cells were eGFP positive, indicating endogenous

Wnt signaling in the cultured ML. Upon stimulation with LiCl, the percentage rose to

25 % at low dose and 52 % at high dose, respectively. Furthermore, in the high dose

sample, the geometric mean fluorescence of the positively transduced cells was increased

2.5-fold (see figure 3.31). It can be concluded that the Wnt-RE-reporter vector was

functional. The DPCs in monolayer exhibited strong activation of endogenous MAPK

signaling, evidenced by the high geometric mean of fluorescence of non-stimulated cells.

By administration of EGF, the percentage of positive cells was not changed significantly.

Nevertheless, the geometric mean of the transduced cells rose to 110-120 % compared to

non-stimulated DPCs transduced with the MAPK-RE-eGFP construct (see figure 3.31).

The administration of the PI3K inhibitor LY29002 simulates starvation of growth factors

and survival signals in the cells. If no inhibitor is present, specific growth factors bind

to a PI3K-associated receptor, leading to a signaling cascade, that induces proteasomal

degradation of FoxO. Without ligand-induced receptor activation (starving signal), FoxO

is stabilized, translocates into the nucleus and promotes inhibition of cell growth and/or

apoptosis signaling. Therefore, it is not surprising that the cell count of the LY294002

treated samples for the FoxO-RE-reporter testing, dramatically diminished. Nevertheless,

the stimulated, FoxO-RE transduced cells responded to the stimulation with an increase in

eGFP expression (approximately 1.5-fold geometric mean fluorescence). The percentage of

eGFP-positive cells slightly dropped. The transduced TGFß-RE cells exhibited, unstimu-

lated, only a low endogenous activation (5 %). Upon low and high dose stimulation with

TGFß1, an increase to 44 and 40 % in eGFP-positive cells was detected. Additionally, the

stimulation enhanced the eGFP expression in the positive fraction by approximately 2-fold

(see figure 3.31).

The functionality of three reporter vectors was shown (TGFß-RE-eGFP, MAPK-RE-eGFP,

and Wnt-RE-eGFP). Thereafter, the reporter vectors were used in 3D in vitro condensa-

tion. The vectors were transduced into monolayer cultured DPCs of passage 6, and after

seven days of recovery and phenotypic expression of the transgene, cells were put into

ultra-low attachment plates (96-well). The condensation process was videomicroscopically

documented beginning with the start of the condensation (0 min). No exogenous stimuli

were added to the cells.

68 Chapter 3 Results

Figure 3.31:

Reporter construct functionality test: DPCs were transduced with the respective

reporter vector and stimulated with inducing stimuli for 24 hours. Afterwards, cells were

harvested and their reporter activity was assessed by flow cytometric measurement of the

geometric mean fluorescence (eGFP) of positive cells. This work was done within the supervised

Diploma thesis of Julia Bräunig.

MAPK-reporter vector during in vitro condensation

The goal was to identify or verify enriched pathways from the GSEA, that are involved in

the condensation process. Therefore, the transduced dental pulp cells, that were described

above (section3.3.1) were cultured in ultra-low attachment plates for several hours and

pictures were taken every 5 minutes. Thereby, the green fluorescence intensity resulting

from eGFP expression was analyzed. Since the eGFP accumulated over time, a second

control vector was included. DPCs transduced with the backbone vector pLL3.7 in which

the eGFP expression is under control of the constitutive CMV promoter, was used, to

acquire the accumulation rate of eGFP, since here, the expression cannot be influenced by

external stimuli. The mean fluorescence under the strong CMV promoter was higher so

that the exposure time was adjusted in each sample. Hence, for quantification, only the

change of mean fluorescence is of importance, but not the absolute intensity.

In figures 3.32 and 3.33 the pictures of the first 30 minutes of the kinetic from control

CMV-eGFP-vector and MAPK-responsive reporter vector are shown (1 frame per 5

minutes). Both exhibited a background eGFP-signal. The images were analyzed with

ImageJ to calculate geometric mean fluorescence of every single GFP-positive cell in the

capture. 12 000 to 13 000 cellular mean fluorescence intensities per picture resulted.

The mean of all cells of each time point in the respective culture was calculated and

plotted against time (figure 3.34). A slight increase in fluorescence intensity in the control

cells was observed. This represents the rate of accumulation of expressed eGFP under

control of a constitutive promotor. A conditionally activatable promoter, as it is in the

MAPK-responsible reporter vector, should exhibit the same accumulation rate when it is

not stimulated. In the MAPK-RE-eGFP-transduced cells, a steep and highly significant

increase of fluorescence activity was observed after five minutes of in vitro condensation.

After ten minutes the fluorescence further increased and was significantly higher than after

five minutes. Afterwards, only a slight increase was observed, transitioning after 20 minutes

3.3 Functional analyses of the in vitro model for mesenchymal condensation 69

Figure 3.32:

Kinetik of condensation with constitutively eGFP-expressing DPCs (CMV

control vector).

Figure 3.33: Kinetic of condensation with MAPK-responsive eGFP-expressing DPCs

70 Chapter 3 Results

into a constant fluorescence level. Here, no external stimuli were given to the culture at

any time point, and the increased eGFP activity resulted from upregulated MAPK activity

induced by the condensation itself.

Figure 3.34:

Graph of calculated mean fluorescence intensities (arbitray units a.u.) of the

constitutive CMV-eGFP (right)- or MAPK-RE-eGFP-reporter (left) in transduced DPCs

during in vitro condensation over a time course of 30 minutes (geometric mean of each cell per

time point in the condensation well over time). Significance was calculated by unpaired t-test:

** - P<0.01 and **** - P<0.001 from more than 12000 cells per frame.

The other reporter vectors with Wnt-RE, TGFß-RE, and FoxO-RE were also used in

the same manner. None of these vectors showed an increased activity in the early time

points. After more than one hour, the method is not applicable for measurements based

on imaging techniques. The crowding and "tissue folding" of the condensing cells in ULA

prohibited accurate measurements of fluorescence intensity per cell.

3.3.2 Inhibition of condensation with small molecules

The comprehensive analysis of the transcriptome of the in vitro condensations resulted

in specific pathways, considered for further investigations. Of particular interest was the

regulation of the cytoskeletal rearrangement. Mesenchymal condensation has been described

to be mediated by actin-p38-MAPK-SP1 pathway (T. Mammoto,A. Mammoto,Jiang

et al., 2015). This was evidenced in vivo and in vitro in a fibronectin-island model. To

show that our model of condensation resembles this process, we tested inhibitors of different

pathways. Besides an inhibitor of actin filament polymerization, cytochalasin D (2.5

M or

0.25

M), also an inhibitor of PI3K-Akt pathway (LY294002 at 10

M), and an inhibitor

of G

𝛼i

-protein-coupled receptors (25 ng/ml), pertussis toxin (PTX), were given into the

culture medium prior to initiation of condensation in the ultra-low attachment wells. After

5 and 24 hours, respectively, cell condensation was inspected microscopically. In the control

wells (containing the solvent DMSO, that was used to reconstitute the inhibitors), the cells

condensed "normally" as described above.

3.3 Functional analyses of the in vitro model for mesenchymal condensation 71

Fig. 3.35:

Inhibition of condensation by

addressing different pathways via small mo-

lecules. Pictures were taken 5 and 24 hours

after condensation induction under influence

of denoted molecules. Representative images;

N=2

After five hours, prominent cell-cell contacts

were visible, and after 24 hours all cells were

included into a single aggregate. The inhibit-

ors LY294002 and PTX had no visible effect

on this process. Also here, cells condensed as

in the control group. The inhibitor of actin

filament polymerization cytochalasin D at a

concentration of 2.5

M completely disrup-

ted the process of condensation. No cell-cell

contacts were visible between the single cells

and after 24 hours still no clustering occurred

(see figure Appendix 5.3, middle). This effect

was dose-dependent. In the culture with 0.25

M cytochalasin D, after 5 hours, smaller and

lesser cell-cell contacts were visible in compar-

ison to control (see figure Appendix 5.3, left

and right). After 24 hours, cells with low con-

centration of cytochalasin D condensed, but

to a much smaller extent than the control cul-

tures. From microscopic analyses it could not

be excluded that the cells did not condensate

due to reduced viability upon the stimulation

with cytochalasin D. Therefore, after condens-

ation of 24 hours, cells from all conditions were

harvested, stained with the cell viability dye

7-aminoactinomycin D (7-AAD) and measured

in the flow cytometer. The dye cannot enter

intact cell membranes so that viable cells ap-

peared 7-AAD negative and dying or dead cells

appear positive. The cells were all viable (see

figure Appendix 5.3) except in the positive "kill control" showing functionality of the dye.

3.3.3 Interaction of inductive condensates with epithelial cells

It is generally accepted that an inductive mesenchyme induces odontogenic cell fate in

dental and non-dental epithelium (Duailibi et al., 2004;Edward J. Kollar et al.,

1970a;Mina et al., 1987;Ohazama et al., 2004). Mammoto et al. show that mechanical

compaction of mesenchymal cells induces their cell fate determination and equip them

with inductive abilities (T. Mammoto,A. Mammoto,Torisawa et al., 2011). In the in

vitro condensations, described here, a self-organized mechanical compaction was induced

in the cells, with implications of the cytoskeleton rearrangement (see chapter 3.3.2), an

activation of MAPK signaling pathway and a striking activation of transcription factor

activity (see chapters 3.3.1 and 3.2.3). To show that the produced condensate from adult

dental pulp cells is indeed capable to induce interaction and differentiation in epithelial

cells, a co-culture was performed with keratinocytes from different tissue sources (skin or

gingiva).

72 Chapter 3 Results

Co-culture

After 24 hours of condensation, the dense DPC aggregates were co-cultured in ultra-low

attachment wells with suspended adult oral keratinocytes. After additional 18 hours they

showed to have been attracted by the mesenchyme (3.36 b), enwrapped it (3.36 b) and

formed densely packed aggregates consisting of the two cell types (3.36 d and e). The

keratinocytes themselves did not condense (3.36 a).

(a) (b) (c)

(d) (e)

Figure 3.36:

Interaction of gingival keratinocytes and DPC condensates in vitro in ultra-low

attachment culture over time. (a) Oral keratinocytes only. (b) Co-culture of oral keratinocytes

and DPC condensate (18h). (c) Co-culture of oral keratinocytes and DPC condensate (24h).

(d) Co-culture of oral keratinocytes and DPC condensate (4 weeks). (e) Co-culture of oral

keratinocytes and DPC condensate (4 weeks) at higher magnification.

To distinguish between the two cell types in live microscopy, the dental pulp cells

were transduced with the pLL3.7 and constitutively expressed eGFP. The skin-derived

keratinocytes were labeled with CellTracker

™

Red which retains in the cytoplasm after

labeling. Figure 3.37 shows the well distinguishable cell types under fluorescence microscope.

On the left side (a), the cells were cultured for three days in monolayer. A strong dye

intensity in the green (eGFP) and in the red (CellTrackerRed) channel was observed. Also,

the different cellular morphologies of the dental pulp cells and the gingival keratinocytes

were obvious. Three days after addition of suspended and red-labeled keratinocytes to

a mesenchymal condensate from green-fluorescent dental pulp cells, the keratinocytes

attached to the surface of the aggregate (b). Four weeks later, the two cell types were

tightly grown together with a proportion of red keratinocyte inside the condensate, or, at

least underneath the green DPCs (c).

3.3 Functional analyses of the in vitro model for mesenchymal condensation 73

(a) (b) (c)

Figure 3.37:

Co-culture of red and green labeled cells. (a) eGFP expressing DPCs in

monolayer co-culture with red-labeled gingival keratinocytes after three days. (b) 3D co-culture

after three days of red (keratinocytes) and green (DPCs in condensate) cells. (c) 3D co-culture

after four weeks of red (keratinocytes) and green (DPCs in condensate) cells.

Histological appearance of condensates

To get an insight into the cellular arrangement inside the cultured organoids, DPC con-

densates were cryosectioned, and their histological properties were analyzed. At day

four, the DPCs in the condensate showed a homogenous distribution with high cellular-

ity. Vimentin is a cytoskeletal intermediate filament of mesenchymal cells. The whole

condensate appeared Vimentin positive, evidencing the high cellular density. The two

extracellular glycoproteins Tenascin C and Fibronectin also exhibit a high fluorescence

intensity with a homogenous distribution. Collagen type I and Collagen type IV showed to

be expressed in distinct zones. The outer border showed no collagen expression. Especially

from the collagen type I pattern, the process of condensation and tissue folding or rolling

is traceable. A marker of direct mechanical stress, transmitted through cell-ECM and

cell-cell-junctions, is the localization of ß-catenin. Interestingly, here the ß-catenin signal

completely overlapped with the nuclear DAPI signal (see figure 3.38).

Figure 3.38:

Histology of 4-day condensates of DPCs alone: Depicted are an overview stain

with Hematoxylin/Eosin (H&E), and immunohistological stainings against Vimentin (VIM),

Tenascin C (TNC), Fibronectin (FN), Collagen type I (COL1), Collagen type 4 (COL4) and

ß-catenin (CTNNB1). The ß-catenin staining was counterstained with DAPI to visualize

nuclear localization.

74 Chapter 3 Results

With the addition of keratinocytes, 24 hours after condensation of the DPCs (see figure

3.39), the distribution of nuclei was still homogeneous, but there were eosin-stained pink

areas which resemble either acidophilic proteins of the cytoplasm or collagens. Sparsely

distributed pink dots in the aggregate (H&E) co-localized with the cytokeratin-positive

cells. The pink area in the center co-localized with the collagen type I staining. The

collagen type IV signal was predominantly seen at the outer border of the condensate.

The structural proteins Vimentin, Fibronectin, and Tenascin C gave a homogenous bright

signal. As a result of the preparation of the condensate for analysis, the keratinocyte outer

layer detached from the condensate. The cytokeratin antibodies against CK18, CK8/18,

CK14, and CK15 clearly mark the keratinocytes. They are much bigger in size than

the mesenchymal cells. Some epithelial cells found their way inside the mesenchymal

condensate, and it appears as if they migrate collectively. Interestingly, the cytokeratin

14 signal was more prominent than the signals of the other cytokeratins and it partially

overlapped with the mesenchyme.

Figure 3.39:

Histology of 4 day co-culture condensates. DPCs were condensated for 24

hours, skin keratinocytes were added and co-cultured for three days. Depicted is an overview

stain with Hematoxylin/Eosin (H& E), and immunohistological stainings against Fibronectin

(FN), Cytokeratin 19 (CK19), Collagen type 4 (COL4), Vimentin (VIM), Cytokeratin 8 or 18

(CK8/18), Tenascin C (TNC), Cytokeratin 14 (CK14), Collagen type I (COL1) and Cytokeratin

15 (CK15). Blue color represents nuclear counterstaining with DAPI.

When the DPCs and skin keratinocytes were co-cultured for two weeks in spheroids,

clusters of attached keratinocytes at the surface of the condensate became visible. Concord-

ant with the mRNA data, the collagen type I expression lowered and was only evident in the

center. The amount of Cytokeratin 8/18/14/15/19 positive cells inside of the condensate

increased. No obvious change in Tenascin C, Fibronectin or Vimentin expression was

observed (see figure 3.40).

3.3 Functional analyses of the in vitro model for mesenchymal condensation 75

Figure 3.40:

Histology of 2 week co-culture condensates. DPCs were condensed for 24 hours,

skin keratinocytes were added and co-cultured for thirteen days. Depicted is an overview

stain with Hematoxylin/Eosin (H& E), and immunohistological stainings against Fibronectin

(FN), Cytokeratin 19 (CK19), Collagen type 4 (COL4), Vimentin (VIM), Cytokeratin 8 or 18

(CK8/18), Tenascin C (TNC), Cytokeratin 14 (CK14), Collagen type I (COL1) and Cytokeratin

15 (CK15). Blue color represents nuclear counterstaining with DAPI.

For the next long-term experiments, the mesenchymal DPC condensates were co-cultured

with gingival keratinocytes. The keratinocytes from the oral epithelium interacted much

more with the condensates than the skin keratinocytes, observed during the cell culture

handling (data not shown). Here, they formed a sheath around the mesenchymal cells, as

indicated in figure 3.36 (c) and (d). This sheath also became visible in the histological

section (see figure 3.41). The epithelial sheath grew inwards into the mesenchyme. From

the fluorescence stainings with chosen antibodies against either mesenchymal proportion

(Collagen type I, Collagen type IV, Vimentin) or epithelial tissue (Cytokeratin 15, Cy-

tokeratin 8/18) can be concluded that the epithelium not only lined the outer border,

but also formed a cluster of cells inside the mesenchymal condensate. The center of this

cluster was acellular, but rich in extracellular matrix, which was not composed of collagen

type I or type IV as seen in the H&E overview and corresponding stainings. The inner

epithelial cells, which lined the border to the mesenchyme, arranged columnar, indicating

the formation of an epithelial basal layer (see arrowhead in bottom right high magnification

of VIM staining).

76 Chapter 3 Results

Figure 3.41:

Histology of 4 week co-culture condensates. Gingival keratinocytes were added

to 24 hour-condensate prior to 4 weeks of co-culture. Hematoxylin/Eosin (H&E) and immun-

ohistological stainings against Collagen type I (COL1), Collagen type 4 (COL4), Vimentin

(VIM) as well as against epithelial cytokeratins Cytokeratin 15 (CK15) and Cytokeratin 8/18

(CK8/18) are depicted. Inner epithelial cells arrange columnar (see arrowhead).Blue color

represents nuclear counterstaining with DAPI.

Figure 3.42 shows that after ten weeks of co-culture of gingival keratinocytes with the DPC

condensates, the organoids formed calcified "cysts" as indicated by Alizarin Red staining.

Still, the cells were alive, evidenced by the sharp nuclear signal in Hematoxylin/Eosin

staining and from the DAPI signal (bottom right). The mesenchymal cells were marked by

3.3 Functional analyses of the in vitro model for mesenchymal condensation 77

the Vimentin signal. They were located between the mostly acellular round structures and

deposited collagen type IV. Only very few CK8/18 positive cells were detected, and the

blue smear inside of the round structures indicated dead cell remnants, presumably from

the epithelial proportion, which formed these structures.

Figure 3.42:

Co-cultured aggregates were long-term cultures for 7 (upper left) or 10 weeks.

The sections were stained with Hematoxylin/Eosin (upper row), Alizarin Red for calcification

(lower left) or Rhodamine/Hoechst (lower right).

In conclusion, the histological analysis reveals interaction of the produced mesenchymal

DPC condensates with epithelial cells from skin epidermis or gingiva. Invagination-like

structures, cytodifferentiation, and matrix deposition are exhibited.

CHAPTER 4

Discussion

4.1 Characteristics of dental pulp cells

In recent years, many successful attempts for whole-tooth bioengineering have been made

in animal models. The majority of them include usage of embryonic or postnatal dental

cells. For human patients, this cell source is not applicable, and it is common sense

that only autologous cells of the patient are acceptable in ethical terms as well as for

immunological issues. For dental regenerative therapies, there are two conceivable cell

sources: mesenchymal stromal cells (MSCs) from the dental pulp or from other adult

tissues of a patient (bone marrow, skin, fat, hair). Although it has been shown that dental

pulp (stem) cells (DPCs) meet the criteria defined for mesenchymal stromal cells by the

International Society for Cellular Therapy, there are differences. Like MSCs, DPCs grow

plastic adherent in vitro and express the surface markers CD105, CD90, CD106 and lack

CD45, CD34, CD19 and CD14. Additionally, as also shown for MSCs from different tissue

sources (Krampera et al., 2013;Mafi et al., 2011;Rahman et al., 2014), they express

CD44 (hyaluronic acid receptor), CD13, and CD146.

The isolation procedure for the cells that were used in this thesis did not include a specific

sorting step. Therefore, it is likely that the obtained population is, to a certain extent,

a mixed population. The presence of endothelial cells is excluded by CD31 negativity,

as well as the presence of hematopoietic cells (CD34

, CD45

). Nevertheless, it is known,

that besides dental pulp (stem) cells, also fibroblasts and pericytes grow plastic adherent.

In recent times, the identity of the MSC was questioned (Hematti,2012). The bona

fide MSC marker has not been identified, a panel of markers and characteristics rather

identifies the cells. Interestingly, all these characteristics are also fulfilled by fibroblasts and

pericytes. In the dental pulp, fibroblasts are dispersed in the fibrous tissue and maintain

the extracellular matrix by constant turnover. Pericytes are located on the surrounding of

vessels and regulate blood flow through contractility. Both are marked by the expression

of CD146 and STRO-1 and as stated by Caplan et al., 2011, pericytes dedifferentiate

to MSCs upon injury or inflammation, proliferate, and become immunomodulatory as

marked by the expression of various secreted factors. Immunomagnetic sorting of CD146

cells from the dental pulp that were localized in situ at the outer vessel walls beforehand,

resulted in a population of dental pulp stem cells that were capable to produce dentin

and dental pulp fibrous tissue in vivo. In the exact same manner CD146

cells from

bone marrow, produced ectopic bone after transplantation in vivo (Songtao Shi et al.,

2003). Taken together, these experiments indicate, that perivascular MSCs or DPCs turn

into fibroblasts and specialized differentiated cells in vivo, to maintain or regenerate the

80 Chapter 4 Discussion

respective tissue and that they can switch between the cell fate.

Nonetheless, this experiment also emphasizes the differences between stromal cells from

different tissue source. The MSCs from bone marrow formed ectopic bone whereas the

DPCs formed dentin. Even after 20-30 population doublings of ex vivo monolayer culture,

the cells formed bone or dentin, respectively, upon implantantation (Gronthos et al.,

2000). That existence of a cellular memory is based on methylation patterns of promoter

regions of cell-type specific genes and has been shown by Kadler,2017.

When discussing the roles and differences of MSCs from various tissues, their ontogenic

origin should be taken into consideration. Dental pulp cells arise from the neuroectodermal

lineage. Unlike MSCs from e.g., bone marrow, they do not derive from the mesodermal

layer of the gastrulated embryo. Other tissues, deriving from neuroectoderm, comprise

the craniofacial structures such as facial cartilage, the retina, melanocytes, ganglia, para-

follicular cells of the thyroid, the adrenal medulla, the aorticopulmonary septum of the

prenatal heart and lung, and last but not least, the brain. Therefore, it is not surprising,

that during this work, differences between DPCs and MSCs could be shown. Firstly, the

DPCs in tissue culture are much smaller, which becomes evident under the microscope. A

confluent layer of DPCs gave about three times more cells in yield than a confluent layer of

bmMSCs. The population doubling time was about 25 hours for the DPCs. Bone marrow

MSCs have doubling time of approximately 70 hours in early passages and more than 100

hours in late passages (Jin et al., 2013;X. Li et al., 2014). Interestingly, FACS analysis

of the marker panel revealed that the bone marrow MSCs contain a significantly lower

percentage of CD146

cells than the isolated dental pulp cells (see Appendix figure 5.1 A),

indicating that many perivascular-derived mesenchymal stromal cells are abundant in the

isolated DPC populations.

The defining criteria for MSCs include multipotency. Therefore, in vitro differentiation

assays were performed to adipogenic, osteogenic and neurogenic lineage. The DPCs

were poorly able to differentiate into adipocytes. Adipogenic differentiation is marked

by deposition of large lipid vesicles in the cytoplasm. The functionality of the protocol

was evidenced by bmMSC differentiation (see Appendix figure 5.1 B). The dental pulp

cells deposited only small vesicles and gene expression analysis of adipogenic marker genes

reveals extremely low abundance of LPL and FABP4 mRNA. This result is in concordance

with literature (Struys et al., 2011). One reason could be that DPCs do not undergo

adipogenesis on any account in their lifetime in vivo. Unlike bone marrow MSCs, that

differentiate into adipocytes in the aging marrow, the aged DPC rather deposits increased

amounts of dentin in the aging pulp. By size measurement of the remaining pulpal tissue,

which narrows with age due to increased deposition of dentin, an age-estimation of an

individuum is possible. The osteogenic differentiation of DPCs (and bmMSCs) is successful.

Alizarin Red staining indicates a strong deposition of calcified matrix and the marker

genes Osteopontin (OPN) and Osteocalcin (OPN) are upregulated. Published protocols

for osteogenic and odontogenic in vitro differentiation, are overlapping or identical. In

addition, OPN and OCN are also expressed by odontoblasts and are a composite of dentin

(Papagerakis et al., 2002). Therefore, it cannot be determined here, if the observed

4.1 Characteristics of dental pulp cells 81

differentiation corresponds to the osteogenic or odontogenic lineage.

Since dental pulp cells originate from the neuroectoderm, they have a close ontogenic

relationship to neurons. Therefore, it was tested whether the isolated DPCs could differ-

entiate into neuronal cells under appropriate culture conditions. In neuronal induction

media, the cells elongate and enlarge. After two weeks of culture, they show an increased

expression of neuron-specific class III ß-Tubulin (TUJ1) as well as of Nestin (NES), which

was detected by immunocytochemistry and qRT-PCR. The DPCs’ tendency to differentiate

into neuronal-like cells has been published before, and their potential use in regenerative

therapies for neuronal disease is evaluated and passionately discussed among experts (Mead

et al., 2016). A clinical study phase I has been started in 2016 in Australia that evaluates

the use of DPCs in stroke patients (Nagpal et al., 2016).

Especially for tissue engineering purposes, a sufficient amount of cells is needed to build

an organoid. Expansion of cell number is achieved by monolayer culture when dedifferen-

tiated cells proliferate. To evaluate if dedifferentiated DPCs can be "reprogrammed" to

be odontogenic, the DPCs were expanded before use in the experiment. A set of marker

genes was selected, that are expressed during tooth initiation, tooth development, ECM

regulation, stem cell phenotype, and regeneration in the dental pulp at different stages

of development. By qRT-PCR, their basal expression in the used DPCs was monitored

during the monolayer culture and was compared to bmMSCs. The gene expression was of

exceptional interest for following induction of in vitro condensation and odontogenesis.

In literature, BMP7 is described to be mainly expressed in the dental epithelium

throughout tooth organogenesis and is only detected in the mesenchymal part during the

secretory stage in mature odontoblasts (

http://bite-it.helsinki.fi/

;Zouvelou et al.,

2009).When isolating the cells from the pulpal specimen, a mixture of cells is obtained,

containing stem cells, odontoblasts, fibroblasts, and pericytes (see figure 3.1). Since only

the odontoblasts are supposed to express BMP7 in the adult tissue, the relative expression

level of the cell mixture is rather low. Furthermore, in culture, these odontoblasts lose their

specific phenotype, by withdrawal from their natural environment. It is conceivable that

the proportion of odontoblasts in the culture dedifferentiates to mesenchymal progenitors

and acquire the characteristics of the DPCs and fibroblasts in means of morphology and

gene expression.

The TGFß1 expression is comparably higher. It is described to be expressed by secretory

odontoblasts as well as fibroblasts of the dental pulp (Vaahtokari et al., 1991). TGFß1

is known to be a regulator of growth, cytodifferentiation, and inducer of matrix deposition.

TGFß1 and TGFß2 regulate DSPP and DMP1 expression by odontoblasts as well as collagen

expression by fibroblasts in the dental pulp (Chan et al., 2005;Niwa et al., 2018). In

numerous studies, TGFß1 has been shown to maintain the mesenchymal phenotype in order

to prevent inappropriate epithelialization during tissue healing and homeostasis (Mincione

et al., 2008;Zeisberg et al., 2003;Zhu et al., 2010). Here, the TGFß1 expression declines

upon DPC monolayer culture, but compared to the BMP7 expression, it is still high. This

observation suggests that the cells still actively maintain the mesenchymal phenotype, and

presumably, the decline is a result of the dedifferentiation of odontoblasts again, that lose

82 Chapter 4 Discussion

their specific secretory phenotype in culture. Notably, the BMP family members, especially

BMP7, shift the balance of epithelial-mesenchymal transition to the epithelial phenotype

(Zeisberg et al., 2003). Therefore, the complete loss of BMP7 in the cultures is in line

with the suggested active maintenance of the mesenchymal phenotype by the DPCs in

monolayer culture.

The Activin ligands exist as dimers of ßA-ßA subunits (Activin A), of ßB-ßB subunits

(Activin B) and ßA-ßB subunits (Activin AB). Furthermore, the ßA or ßB subunit can

dimerize the

𝛼

-subunit to form Inhibin A or Inhibin B, respectively. Here, the transcript

of the ßA-subunit is measured (INHBA). As seen in the whole transcriptome analysis, no

𝛼

-subunit is expressed in the used DPCs. Thus, the ßA subunit, measured here, will only

form Activins, not Inhibins. It is known that Activin is expressed in pulpal cells, but their

role in the mature tissue has not been elucidated yet (Goldberg et al., 2004). Here, the

INHBA expression of the freshly isolated DPCs is comparably low and declines over the

culture period. Activins also play a role during early odontogenesis. Ferguson et al.,

1998 describe Activin A as "an early mesenchymal signal" expressed in the condensing

mesenchyme of the tooth germ, and mice lacking the Inhba gene exhibit a molar arrest at

bud stage.

Fibroblast growth factor (FGF2) is described to induce mesenchymal condensation in

feather, in renal, and limb development(Perantoni et al., 1995;Song et al., 2004;Su

et al., 2014). In these tissue types, the protein FGF2 can be found in the epithelium as

well as the condensing mesenchyme. Whether both tissue types express FGF2, or if it is

only the epithelial signal diffusing to the mesenchyme, is not clear. Since in this study

mesenchymal condensation was in focus, this molecule was selected in the marker panel.

The expression of FGF2 in the dental pulp cells is rather low and does not change over

the monolayer culture period.

The dentin matrix contains numerous growth factors that are deposited by the odontoblasts

during dentine formation. They function in activation of odontoblasts upon injury. When

they are released from the dentin matrix, the respective receptors on the odontoblasts are

activated, and the regenerative matrix will be produced. One of the deposited factors is

hepatocyte growth factor (HGF). Just as FGF2, HGF binds to a tyrosine-kinase receptor.

Upon ligand binding, different pathways can be activated intracellularly, most prominently

the Ras-MAPK pathway. During development, HGF and its corresponding receptor c-MET,

regulate important mesenchymal-epithelial interactions. It serves as an important growth

factor for epithelial cells and is expressed in the mesenchyme. This role becomes evident

when HGF-antisense-treated tooth germs exhibited abnormal tooth morphogenesis, an

"inside-out"-phenotype with dentin around enamel (M. Tabata et al., 1996). In adult

tissues, HGF synergizes with nerve growth factor (NGF) and acts as a survival signal for

neurons (Birchmeier et al., 1998). Putatively, the expression of HGF in the isolated

DPCs is explained by their neuron-supporting function, since the dental pulp is highly

innervated. It is not surprising that the cells down-modulate the HGF expression as a

result of the missing tissue interaction.

Collagen type I is the major organic component of the intertubular dentin (90 %), whereas

the peritubular dentin is non-collagenous. The odontoblasts secrete collagen type I, as well

as proteoglycans, that are implicated in collagen fibril formation (e.g., decorin, biglycan,

4.1 Characteristics of dental pulp cells 83

fibromodulin). The mineralization process is initiated by the deposition of DPP, a product

of DSPP, which attracts calcium ions. In the dental pulp, the fibrous tissue of the tooth,

collagen type I is also the predominant ECM molecule. With the high content of glyc-

osaminoglycans, this tissue is hydrated and not mineralized. The isolated DPCs exhibit

enormously high expression of collagen type I, that drops in monolayer culture. Still,

the expression is, compared to other analyzed genes, very high. The DSPP expression

of the freshly isolated cells, which is supposed to come from the odontoblast fraction, is

completely lost due to the dedifferentiation. These results are concordant with the decline

of TGFß1 expression since TGFß1 is described to be a positive regulator of DSPP and

COL1A1 (Niwa et al., 2018).

Two mesenchymal transcription factors were chosen for the panel, MSX1, and PAX9.

During early tooth development, they act synergistically to induce tooth initiation. As

depicted in figure 1.18 they play a role in every developmental stage. The prime odon-

togenic potential lies in the dental epithelium. With the expression of FGFs and BMPs

by the epithelium and subsequent induction of PAX9 and MSX1 in the mesenchyme, the

odontogenic potential then shifts to the dental mesenchyme. In homozygous PAX9- as

well as in MSX1-mutant mice the mesenchyme fails to condense normally (Peters et al.,

1999). Interestingly, in murine molar development, PAX9 is constantly expressed during all

developmental stages of the dental mesenchyme. Before any morphological manifestation

of tooth development, PAX9 is expressed at the prospective sites of tooth formation (but

not in between the individual site for each tooth) (Neubüser et al., 1997). This finding,

together with tooth agenesis upon Pax9 loss, concludes that PAX9 is a marker for dental

mesenchyme which is needed to transduce the incoming epithelial signals to achieve tooth

formation. It is therefore of particular interest that the PAX9 expression is not lost here

during monolayer culture, suggesting that the used cells, even if dedifferentiated, are

capable to respond to appropriate signals with dental differentiation.

The expression of MSX1 has been described to be unique for human dental pulp cells when

compared to other cell types from various tissues (Fujii et al., 2015). Therefore, this marker

has been proposed to identify dental pulp stem cells. Here, MSX1 expression is lower

than PAX9 expression and upon monolayer culture, the expression significantly declines.

Interestingly, PAX9 is not and MSX1 is barely detectable in bmMSCs. Therefore, it can

be concluded, that these markers are specific and that dedifferentiated DPCs are different

from bmMSCs. The PAX9 expression, which does not change upon dedifferentiation may

be a result of the epigenetic memory of that cell type. To verifiy that, methylation analysis

of the promoter should be conducted. The expression of both transcription factors is

described, but their role in postnatal teeth is unknown (Fujii et al., 2015).

In this context, it should be mentioned that in hair follicle morphogenesis the inductive

signal is supposed to come from the mesenchyme and the signaling between the mesen-

chymal condensate and the epithelium dictates the morphogenesis of both cell populations

and orchestrates the formation of the hair follicle (Schmidt-Ullrich et al., 2005). Both

skin appendages have the same evolutionary origin, share similar developmental processes,

and are the result of epithelial-mesenchymal tissue interactions. It is reasonable that also

in tooth development the mesenchyme bears the inductive signal to orchestrate tooth

development.

84 Chapter 4 Discussion

To summarize these findings, it can be concluded that the isolated human DPCs rep-

resent a mixture of dental cells of ectomesenchymal origin, i.e., odontoblasts, fibroblasts,

and perivascular cells. The cell population, as a whole, dedifferentiates to a mesenchymal

progenitor phenotype, regarding gene expression and morphology. The dedifferentiated

DPCs are different from cultured bone marrow MSCs, as evidenced by the expression of

PAX9 and MSX1, their differentiation capacity and their proliferative behavior. Addi-

tionally, the elevated PAX9 and MSX1 expression, compared to bmMSCs, suggests an

odontogenic memory of the cells.

4.2 Culture model for tooth development

The observation that DPCs seem to be more directed towards odontogenic lineage, com-

pared to bmMSCs, is concordant with previous studies (Hosseini et al., 2018;Tatullo

et al., 2015). Tissue-engineered structures, generated from DPCs and synthetic scaffolds

(e.g., PGLA, HA, TCP), resemble organized tubuli-traversed dentin or reparative dentin

(Hosseini et al., 2018). DPCs are also used to regenerate lost dental pulp tissue, following

root canal treatments. A recent attempt has been published by Athirasala et al., 2017,

where pre-vascularized hydrogel pulp-like tissue constructs were engineered ex vivo and

dispensed in root canals. A pilot clinical study in humans was completed, which shows

safety and efficacy of usage of autologously transplanted dental pulp cells for total pulp

regeneration (Nakashima et al., 2017). Thus, in those numerous investigations, adult

dental pulp cells have been shown to be an excellent cell source for dentin reconstruction

and regeneration.

Nevertheless, until now, no study has been published, showing that adult human dental pulp

cells give rise to whole bioengineered teeth. Moreover, for adult mouse DPCs it has been

shown, that after 24 hours of in vitro culture, they lost their tooth forming capability when

recombined with embryonic epithelium and subsequent in vivo transplantation (Zheng

et al., 2016).

The underlying hypothesis is that the inductive ability of the DPCs is locked upon mono-

layer culture due to dedifferentiation. A "liberation" of this inductivity is thought to be

achieved by introducing mechanical cues on the cell, that are sensed by the cytoskeleton

and drive cell fate switching and subsequent differentiation as proposed by T. Mammoto,

A. Mammoto and Ingber,2013. The setup to achieve this aspect of this thesis was to

recapitulate mesenchymal condensation in vitro since it represents a crucial step in tooth

development.

Mesenchymal condensation is well-studied in the context of skeletal development. Never-

theless, in many other organs, such as skin appendages, kidney, and lung, mesenchymal

condensation also constitutes a central role as being one of the first developmental steps.

Since these organs are thought be "epithelium-derived", past research was mainly focussed

on epithelial dental stem cells and their developmental stages. At the site of presumptive

tooth formation at around week 5 of human fetal development, the ectomesenchymal

cells undergo mesenchymal condensation, forming the tooth bud. It is now accepted

that after that process, the odontogenic fate lies in the mesenchymal condensate. Long

4.2 Culture model for tooth development 85

forgotten, Kollar and Baird already published between 1969 and 1970 three consecutive

papers, in which they evidenced this: When an embryonic murine dental mesenchymal

condensate was recombined with non-dental epithelium, i.e., from foot or snout pad, teeth

formed, whose morphologic appearance was specific to the tooth germ from which the

mesenchyme was harvested (Edward J. Kollar et al., 1969;Edward J. Kollar et al.,

1970a;Edward J Kollar et al., 1970b). Only later, the underlying mechanisms were

elucidated: The acquired inductive property is marked by the expression of morphogens

and inhibitors downstream of tissue-specific transcription factors. These transcription

factors are activated by cytoskeletal changes as a result of mechanical signals of the con-

densation. The cytoskeleton ensures resilience to the increasing pressure. Simultaneously,

the rearrangement of the cytoskeleton, which is directly coupled to intracellular domains

of ECM receptors and nuclear lamina structures that transduce the mechanical signal into

the nucleus, induces a change in transcriptional and enzymatic activity. The process of

cellular attraction and motility which is the motor of condensation is resembled in the

spheroid culture, here. Under standard culture conditions, the cells adhere to the plastic

and flatten. During ultra-low attachment culture, the cells seek for contact, since that is

their nature as mesenchymal cells in three-dimensional connective tissues. Thereby, they

express chemokines, show high motility, and adhere to each other via cell-cell junctions.

Traction forces are applied by and to the connected cells and long F-actin bridges form

between them in vivo (see figure 4.1)(Ray et al., 2015).

Fig. 4.1:

Mesenchymal condensa-

tion during chick columella develop-

ment exhibits strong F-actin bridges

between the condensing cells (arrow-

heads) (Ray et al., 2015).

Long cellular processes between the DPCs in ultra-

low attachment culture can be observed (see fig-

ure 3.13). The data from the RNA Seq show, that

gamma-actin as well as beta-actin are highly abund-

ant in the cells. Furthermore, from the CNA labeling

experiment, it can be excluded, that the long pro-

cesses are composed of extracellular collagen fibers

(see figure 3.30). Therefore, it is highly likely, that

the "arms" consist of actin-bridges in this condensa-

tion model. To address, whether the condensation is

indeed actin-mediated, Cytochalasin D (CytD) was

administered to the in vitro condensing cells. CytD

is a mycotoxin that inhibits F-actin polymerization

and induces depolymerization of F-actin (Casella et al., 1981) and thereby block the

formation of cortical actin fibers. Indeed, CytD entirely blocks cell-cell-attachment and

condensation at a concentration at 2.5

M. At a 10-fold lower concentration, the inhibiting

effect was still visible, resulting in a loose aggregation of cells, that did not form actin

bridges. The other inbititors pertussis toxin (PTX), an inhibitor G protein-coupled sig-

naling, and LY294002, an inhibitor of phosphoinositide 3-kinase (PI3K)–AKT signaling

pathway, did not affect the condensation process of DPCs. To my knowledge, it is the

first time, that the stage of actin bridge-forming dental pulp cells upon condensation is

resembled in vitro.

All experiments were conducted with cells from individual donors. The primary state of

86 Chapter 4 Discussion

the cells from different donors is not negligible and had an influence on the kinetics of

condensation regarding the morphology as well as gene expression. As outlined above,

a specific marker panel of gene expression was chosen to monitor the condensation and

putative differentiation. The two key transcription factors, PAX9 and MSX1, exhibited

a surprising expression profile. Within the first 24 hours of condensation, they are sig-

nificantly downregulated. In concordance with that observation, BMP4 expression also

decreases upon the first 24 hours of condensation compared to monolayer cells, since MSX1

and PAX9 are known to be synergistic regulators of the human BMP4 promoter (Liang

et al., 2012). Expression of this trio rises in the course of later culture time and their

expression level is re-established to the initial level of freshly isolated dental pulp cells.

Three more members of the TGFß superfamily, TGFß1,INHBA, and BMP7, are upregu-

lated after four days.

The loss of BMP7 expression upon 2D monolayer culture is thought to be the reason for

the loss of odontogenic potential of the dedifferentiated adult dental pulp cells. It has

been shown that human fetal dental pulp cells (FDPC) express BMP7 approximately

50-fold higher than adult dental pulp cells (ADPC). When FDPC were co-cultured with

oral keratinocytes, an amelogenic differentiation could be observed. Contrarily, ADPCs

were not able to induce the amelogenic differentiation. With the addition of BMP7 to

the culture, also the adult cells were able to transform the oral keratinocytes (Gao et al.,

2015). This effect was even more enhanced with the combined administration of BMP7

and epiregulin, a member of epidermal growth factors, that activates MAPK signaling.

Thus, the upregulation of BMP7 in the mesenchymal dental condensates can be seen here

as the acquisition of inductive abilities.

As described above, TGFß1 is considered to be a marker for differentiation, positively

regulating DSPP and COL1A1 expression (Niwa et al., 2018). Since the expression of all

these three genes increases during long-term culture (four weeks) in ultra-low attachment,

it can be assumed here that the DPCs undergo odontoblastic differentiation. Collagen

type I and Dentin Sialophophoprotein expression runs in parallel with TGFß ligands,

emphasizing their regulatory relationship. Interestingly, Activin expression exhibits a steep

rise between 24 hours and four days, and stagnates afterwards. This is in concordance

with the above-described role of Activins during the early phase of tooth development.

Taken together, it can be concluded, that a suitable culture setup was established to

allow production of singular dental mesenchymal condensates of 500

m in diameter in

vitro to resemble the human in vivo equivalent during organogenesis. In this culture model,

a self-orchestrated condensation of the DPCs was allowed to induce the mechanotrans-

ductional forces on the cells which take place during condensational processes in vivo.

During the condensation in vitro, the marker genes BMP7,TGFß1,INHBA,COL1A1 and

DSPP display a congruent transcript expression profile. Long-term culture of the condens-

ates induces the re-induction of genes that were subject to dedifferentiation, indicating a

differentiation within the condensate.

4.3 Early phase of condensation 87

4.3 Early phase of condensation

Although, the condensation seems to be the central step in organogenesis, so far no data

on the molecular events that occur during human odontogenesis have been published.

Much information about skeletal mesenchymal condensation is available, and it is valuable

knowledge that arose from those numerous studies to understand the basic principles and

pathways. Nevertheless, the exact molecules that are part of the condensation signalosome

and their spatiotemporal expression differ from organ to organ. Though, when discussing

induction of replacement teeth as regenerative therapies, these factors should be known,

and their actions understood. For odontogenesis, one approach to resemble mesenchymal

condensation in vitro, is promising, but until now, experiments were only conducted with

mouse DPCs (T. Mammoto,A. Mammoto,Jiang et al., 2015). The method is based

on high-density cell cultures of murine DPCs on fibronectin islands. Fibronectin is the

initiating and guiding ECM molecule during mesenchymal condensation (Hall et al., 2000)

and was therefore well-chosen. Similarities to the in vivo condensation are evidenced by

gene expression analysis. Nevertheless, when it comes to the handling of the condensed

cells, e.g., for transplantational purposes, this model seems to be disadvantageous.

One goal of this thesis was to validate that the presented method to induce condensation

resembles the in vivo process, and can also be considered as a model to study dental organo-

genesis. A comprehensive analysis by Next Generation Sequencing was performed to identify

the expression profile of condensing DPCs in vitro after six hours in low-attachment culture.

By analysis of the expression of all transcripts, it becomes evident that the dediffer-

entiated DPCs are substantially different from bmMSCs. In the heat map, the monolayer

population did not form a cluster (see figure 3.17). Furthermore, after six hours of DPC

condensation, the donor-specific expression intensities overruled the culture condition-

specific expression, characterized by the donor-clustering. In contrast, the bmMSCs did

not cluster donor-specific but condition-specific(ML and 24 hours condensation). It is

reasonable that this difference is explained by the longer period of condensation (6h vs. 24

h) and raises the question whether a transcriptome analysis of DPCs condensates after a

later time point gives rise to the same effect.

Based on knowledge about precartilage condensation, the mechanochemical principles

of condensation can be easily explained (Chimal-Monroy et al., 2003;Hall et al.,

2000). Fibronectin (FN) is highly abundant in mesenchymal tissues. Upon initiation of

mesenchymal condensation by TGFß1, TGFß2 and TGFß3 ligands, the mesenchymal cells

express integrins on their surface, which bind to FN. They use the FN fibers as "guiding

ropes" and migrate along them towards the TGFß morphogen gradient. The cells react on

the FN binding on the integrin receptors with cytoskeletal contraction via actin bundles

and myosin II. Thereby, they generate a tensile strain on the ECM as well as on further

cells connected to the ECM. Along with that, the activation of the integrin signaling

induces upregulation of FN itself, of collagens (COL), tenascin (TNC), and syndecans

(SDC) as well as of the cell-cell adhesion molecules N-CAM and N-Cadherin. The cells

form tight cell-cell contacts, which in turn is in a positive feedback loop with the ECM

88 Chapter 4 Discussion

proteins. The secreted ECM builds a "cage" around the condensed cells. This step is

referred to as "boundary setting" of the mesenchymal condensate. The entrapment of the

cells is of importance: The gathered cells stay in spatial proximity and unitely form the

organ by producing morphogen gradients that drive organogenesis. An important aspect

in developmental processes is proper fine-tuning. Here, a tensile strain exerted by and

on the cells is needed to generate the condensate. RhoA is a small GTPase regulating

actin assembly and stress fiber formation. It is reported, that suppression of RhoA is

indispensable for the expression of organ-fate specific transcription factors and functional

tissue properties. By release of the tensile strain via chemical suppression of RhoA, in

chondrogenic condensations in vitro, the produced cartilage had improved characterist-

ics compared to untreated pellet cultures. It was of less compact structure, but with

increased GAG and collagen content, as well as an enhanced diffusity for growth factors

was shown, which was important for the subsequent differentiation (K.

C. Wang et al.,

2018). The inhibition of RhoA activity is also seen in vivo during mesenchymal condens-

ation of murine tooth development (T. Mammoto,A. Mammoto,Torisawa et al., 2011).

The RNA Seq data suggest a RhoA inactivation in my DPC condensations. In both

conditions (ML and 6h cond) RhoA is among the highly abundant transcripts, and it

is known that stress fibers, induced by active RhoA pathway, are very prominent in

cells grown on rigid substrates, such as plastic dishes (Burridge et al., 2016). Never-

theless, RhoA functions as a molecular switch, cycling between an active GTP- and an

inactive GDP-bound state, independent from the total RhoA abundance. This cycling

is mediated by activating guanine nucleotide exchange factors (GEFs) and deactivating

GTPase-activating proteins (GAPs). Among the differentially expressed genes, are two

RhoA-specific GEFs (ARHGEF25 and ARHGEF28), both significantly downregulated.

Furthermore, two downstream targets of the RhoA pathway (CYR61 and LIMK2), which

are positively regulated by RhoA, are significantly downregulated, hence, enabling organ

fate specific transcript expression. Interestingly, FGF2 is significantly upregulated in the

DPCs in condensations. FGF2 has been reported to antagonize Rho activation, leading to

loss of stress fibers and regulating the reorganization of cortical actin (Lee et al., 2003).

Thus, the observation from the in vitro model regarding the RhoA pathway is in con-

cordance with the described mechanism of cytoskeletal transduction of mechanical cues

during mesenchymal condensation and the requirements on the cytoskeleton to allow

differentiation and ECM deposition are fulfilled. The immunohistologic analysis of the

DPC condensates at a later time point (4 days, see figure 3.38), shows a high abundance

of the condensation-specific ECM molecules fibronectin, collagen type I and collagen type

IV, suggesting that the early mechanical cue of condensation (6h) induced this specific

ECM production. The collagens exhibit a zonal expression, highest at the sites where

condensation began.

Among the morphogens, expressed by the condensing cells, and incorporated into the

ECM for availability in the subsequent steps of cytodifferentiation, i.e., odontoblast and

ameloblast differentiation, are molecules of the TGFß superfamily (Begue-Kirn et al.,

1994;Vaahtokari et al., 1991). The canonical TGFß- and BMP signaling pathway

4.3 Early phase of condensation 89

involves the action of SMADs. SMAD1/5/8 activation is specific for BMP-induced pathway

and SMAD2/3 for TGFß- or Activin-induced pathway. They both share the Co-SMAD4 as

dimerization partner, thereby interconnecting the TGFß and BMP pathway (see figure 3.21).

The balancing between the two pathways during tissue regeneration and embryogenesis and

their different outcomes are described for many organs (Oshimori et al., 2012;Xu et al.,

2009;Zeisberg et al., 2003). During tooth development, both pathways are regulated

in all steps of organogenesis. The complex sequences of spatiotemporal expression and

fine-tuning of activity, mediated by expression of inhibitory or supporting molecules, is not

elucidated yet.

The RNA Seq data suggest a strong shift of the balance to the TGFß/Activin signaling

pathway. All three TGFß ligands 1, 2, and 3 are significantly upregulated after 6 hours

of mesenchymal condensation, as well as INHBA transcripts. Being the only expressed

isoform from the Inhibin/Activin dimers, it can be concluded that only Activin, not Inhibin,

is translated. Additionally, the Activin receptor type I is significantly upregulated. The

mere existence of the transcripts is no evidence for functional ligands. The high abundance

of the TGFß1/2/3 mRNA is accompanied by a high occurrence of latent TGFß-binding

protein 1 (LTBP1). TGFß ligands are only secreted as large latent complex (LLC), com-

prising the TGFß homodimer, the latency associated peptide (LAP) as well as the LTBP.

This mechanisms allows proper mediation of the TGFß signaling, especially for paracrine

signaling. The activation of latent TGFß is mediated by conformational rearrangement of

the LTBPs to release TGFß through thrombospondins, by proteases MMPs, or by reactive

oxygen species. Matrix metalloproteinase 2 (MMP2), which is described to liberate TGFß,

is among the most abundant transcripts. Thrombospondin 1, 2, and 3 are also in the group

of highly expressed transcripts, pointing to active TGFß signaling.

Also, indications for an active BMP signaling can be drawn from the expression data

from RNA Seq. Interestingly, two main BMP antagonists, Noggin (NOG) and Gremlin

2 (GREM2) are significantly downregulated. Connective-tissue growth factor (CTGF),

a supporting factor for TGFß and antagonist of BMP4 is downregulated. BMP8A is

significantly upregulated, whereas BMP4 is significantly downregulated. The downreg-

ulation of BMP4 was unexpected at first glance. In murine tooth development, as a

transcriptional product of the PAX9/MSX1 duo, BMP4 is described to be a key molecule

for tooth initiation. It has been detected in the murine condensing mesenchyme directly

after epithelial induction of mesenchymal condensation. Here, in our model, no epithelium

is present. The condensation is induced cell-autonomously. It is reasonable, that in vivo

the BMP4 expression of the condensed mesenchyme is not a result of the mechanical cues of

condensation, but rather of the epithelial signal itself. In concordance with that hypothesis

is the observation of Ray et al., 2015 that during avian columella development "BMP

signaling is irrelevant for the process of condensation, it is required for dorsal morphology,

indicating that condensation and dorsal cell shape can be uncoupled". It is thought that

the BMP morphogen gradients rather define the axis patterning of organs and tissues,

than being involved in the promotion of the sequence of development (Bier et al., 2015).

In long-term culture, the BMP4 expression slightly increases after four weeks. Possibly,

despite skipping the step of epithelial attraction to induce mesenchymal condensation,

the self-orchestrated mesenchymal condensation and subsequent mechanical stimulation

90 Chapter 4 Discussion

was sufficient to induce odontoblast cytodifferentiation. All other measured genes of the

chosen marker panel were upregulated after long-term culture, supporting the preceding

assumption (see figure 3.14).

In general, the overall high abundance of Activin/BMP and TGFß antagonists, supports

the hypothesis, that the DPCs in my model produce the ligands, but not only for autocrine

signalling but at a large proportion for deposition in the extracellular matrix that is

produced around the condensed cells. The deposition of ligands, agonists, and antagonists

equates the establishment of morphogenic gradients. In vivo, these morphogenic gradients

are needed to produce the respective cell layers of differentiated cell types, such as secreting

odontoblasts and ameloblasts (Vaahtokari et al., 1991).

It can be assumed here, that the TGFß ligands, which are significantly upregulated in the

condensates after six hours in ultra-low attachment culture, are active and act auto- and

paracrine. As described above, TGFß expression is assigned to the mesenchymal phenotype

and induces expression of fibronectin and tenascin in murine precartilage condensation

(Chimal-Monroy et al., 2003), and activate collagen synthesis and DSPP expression,

thereby switching the cellular machinery to ECM production.

An interesting indication for active TGFß pathway is the observation that two direct

TGFß-target genes, SNAI1 and SNAI2, are both significantly upregulated during condens-

ation. In literature, the Snail genes are described to be the bona fide marker genes for

epithelial-mesenchymal transition and are implicated in metastasizing tumors. The Snail

transcription factors downregulate epithelial markers, such as E-cadherin, cytokeratins,

and desmoplakins, and upregulate the mesenchymal marker vimentin, fibronectin, and

induce RhoB activation to enhance migration. The loss of epithelial adhesion molecules and

elevated migratory capacity is associated with invasive tumors. Very few publications show

the expression of SNAI1/SNAI2 in mesenchymal condensates, e.g., in dermal condensates

of developing murine hair follicles and during palatal development of the chick (Martinez-

Alvarez et al., 2004;Sennett et al., 2015). When the murine snai gene was discovered in

1992, expression was "observed in condensing cartilage and in the mesenchymal component

of several tissues (lung, kidney, teeth, and vibrissae) that undergo epithelial-mesenchymal

inductive interactions during development." (Nogai et al., 2008;D. E. Smith et al., 1992).

Gain- and loss-of-function studies for bone development indicate a role of snai in controlling

chondrocyte proliferation and differentiation (Y. Chen et al., 2013). A literature search

did not reveal any articles on the role of Snai genes neither in tooth development nor

for other skin appendage organs. Thus, the Snail transcription factors may represent a

valuable target for further investigations.

Taken together, the data suggest induction of cytoskeletal rearrangement through regulation

of actin assembly via tuned RhoA activity. Putatively, as a consequence, the TGFß signal-

ing activity is elevated, with emphasis on TGFß1/2/3 signaling. These results show, that

the model of self-orchestrated condensation of the DPCs resembles the mechanochemical

signals that are described in vivo.

In the condensation, the most significantly overrepresented pathway resulting from Gene

Set Enrichment Analysis (GSEA), was the MAPK signaling pathway (see Appendix figure

5.8). Therefore, a detailed analysis was performed for this pathway (see figure 3.23).

4.3 Early phase of condensation 91

Multiple pathways can induce the MAPK pathway. The most prominent is the induction

via receptor tyrosine kinases (RTKs), that are activated by various growth factors. Among

those growth factors are fibroblast growth factors (FGFs), epidermal growth factors (EGFs),

platelet-derived growth factors (PDGFs), and many more. There are three main pathways,

that are elicited upon stimulation of the respective receptor: the ERK1/2 pathway (activ-

ated through classical growth factors), the p38/JNK pathway (activated through TGFß

ligands, inflammatory signals, and stress), and the ERK5 pathway (induced by growth

factors, and cytokines).

Several groups describe the involvement of the MAPK signaling in tissue morphogenesis

and condensation (T. Mammoto,A. Mammoto,Jiang et al., 2015). However, from

the RNA Seq data presented here, a prediction which MAPK module is activated or

deactivated is challenging. When taking a closer look at the superior level of the pathway,

three ligands (FGF2,TGFß1/2/3 ) are upregulated, as well as the EGF receptor, indicating

an activation of the ERK1/2 pathway. Regarding, FGF2, the qPCR and RNA Seq data

appear contradictory. After six hours, FGF2 is upregulated. However, no significant

change in expression is observed after 24 hours of mesenchymal condensation compared to

monolayer DPCs. Only after four weeks, the DPCs in the condensate exhibit a significant

increase again. This observation can be explained by complex fine-tuning of the molecule

expression. As described above, FGF2 plays a role in RhoA activity modulation. It is

likely that the downregulation after 24 hours is a result of feedback inhibition, and in later

phases, when FGF2 is upregulated, it putatively has a role in cytodifferentiation.

Almost all involved molecules of the MAPK signaling are either expressed and/or differen-

tially regulated. The ratio between up- and downregulated genes is evenly balanced after

six hours of condensation (see heatmap figure 3.22). Furthermore, the activation of almost

each molecule in the pathway depends on phosphorylation (+p in Appendix figure 3.23)

by activity of upstream kinases, that were activated by upstream kinases beforehand. To

determine, if the MAPK signaling is indeed activated during the in vitro condensation, a

MAPK-responsive reporter construct, was transduced into DPCs transferred into ultra-low

attachment culture for condensation. In the MAPK reporter vector, the TF binding

site for serum response factor (SRF) and ETS domain-containing protein (ELK1) was

cloned as 6x repeats in front of the eGFP gene. Thereby, a eGFP expression is directly

correlated with MAPK activity, through the ERK1/2, or p38 pathway. The measured

reporter activity, assessed by geometric mean fluorescence of each cell in the well on single

cell level, impressively confirms that MAPK activated genes belong to the immediate early

response genes (IEGs). IEGs are reported to be activated and transcribed within minutes

after stimulation (Bahrami et al., 2016). The majority of these genes are expressed

upon activation of MAPK signaling or RhoA activation and their expression usually peaks

between 15 to 30 minutes. The expression is described to be transient, since the gene

products are in a negative feedback loop with the receptor or associated adapter molecules.

Here, the eGFP intensity, and therefore the MAPK activity, was significantly elevated after

five minutes and was at maximum after 20 minutes. Thereafter, the expression level was

sustained, indicating an attenuation of the immediate early signaling. Due to the long

half-life of eGFP, only the activation but the the signalling decline could be analyzed.

92 Chapter 4 Discussion

Another important signaling pathway during embryonic tooth development is the Wnt

signaling pathway. The role of Wnt in dental epithelium has been extensively studied,

and a loss of epithelial LEF1 transcription factor induces arrest of development in early

bud stage. Only few studies were performed to investigate the role in the early dental

mesenchyme. Mesenchyme-specific loss of ß-catenin leads to failure of bud-to-cap-stage

transition. Therefore, the role of ß-catenin in the dental mesenchyme is more attributed

to differentiation than to mesenchymal condensation. Interestingly, the loss of nuclear

ß-catenin leads to absence of mesenchymal BMP4, independent of the presence of Msx1

which was thought to be the crucial inducer of BMP4 before. The mesenchymal BMP4 is

in turn needed to activate Shh expression in the epithelium, providing the next step of

reciprocal signaling to progress the development of the tooth (J. Chen et al., 2009). It is

likely, that the missing BMP4 expression in the early mesenchymal condensates, generated

from the ultra-low attachment culture is a result of the missing epithelium described to be

the main supplier of Wnt ligands. During in vitro condensation, it can be assumed from

the RNASeq data, that the Wnt pathway is activated or, at least "primed" after six hours

of mesenchymal condensation. The Frizzled receptor 7 (FRZ7) is highly abundant, and two

important inhibitors of Wnt ligands, DKK1 and DKK2, are downregulated. The two main

transcription factors acting synergistically as effectors of Wnt pathway, Lymphoid Enhancer

Binding Factor 1 (LEF1) and Transcription Factor 7 (TCF7 ), are upregulated. Peroxisome

Proliferator Activated Receptor Delta (PPARD), an enhancer of the TCF/LEF duo, as

well as FRAT2, a regulator of the ß-catenin degrading complex, are both significantly

upregulated. Whether the Wnt pathway is indeed active or the mesenchymal condensate is

awaiting an epithelial signal, is hard to predict from the RNA data. WNT5A and WNT5B

are highly abundant in the DPCs, which is in concordance with literature describing WNT5

ligands to be exclusively expressed in the dental mesenchyme (Sarkar et al., 1999). A

comparison of published Wnt target genes (https://web.stanford.edu/group/nusselab/cgi-

bin/wnt/target_genes) revealed no clear result if the pathway is active or not. Moreover

most described target genes are also activated upon TGFß or MAPK signaling, which

emphasizes the complex network of cross-talk between the pathways. After four days,

the DPC condensates display a complete nuclear localization of ß-catenin (see figure

3.38), suggesting an activation of the Wnt pathway at this time point. Nevertheless, ß-

catenin can also be stabilized and transferred to the nucleus via PI3K/Akt phosphorylation.

An intriguing result from the GSEA of the differentially expressed genes was the emer-

gence of "signaling by notch" with the highest significance of being enriched (False Discovery

Rate (FDR)=10

-5

) (see figure Appendix 5.8). The Notch signaling pathway is triggered by

direct cell-cell contact. The receptor Notch on the receiver cell and the ligand Delta-like

(DLL) or Jagged (JAG; Serrate) of the signaling cell are both transmembrane molecules.

When the two cells come in close proximity, DLL binds to Notch, and through the mechan-

ical stimulus on the receptive cell, proteolytic cleavage is induced. ADAM metallopeptidase

domain 17 (ADAM17)/TACE cleaves the external protein domain, and the ligand-receptor

complex is endocytosed by the ligand producing cell. The remaining intracellular receptor

domain in the target cell becomes substrate for a gamma-secretase-complex that releases

the Notch intracellular domain (NCID). NCID subsequently translocates to the nucleus to

4.3 Early phase of condensation 93

replace the repressing complex (consisting of NCoR, HDAC, and TBL) on the transcrip-

tional activator RBPJ/CSL to induce transcription of Notch target genes of the HES/HEY

family (hairy and enhancer of split), hypoxia-inducible factor 1 alpha (HIF1A), and/or

Estrogen Receptor 1 (ESR1) (Berridge,2014). The Notch pathway is highly conserved

and functions in cell-fate decision. Upon asymmetrical cell division of stem cells, one

daughter cell retains the stem cell phenotype, whereas the other adopts a new fate. Notch

is used by the later cell to signal back to the neighbor cell to suppress it from adopting a

similar cell fate. The same principle is applied by Notch during establishment of lateral

inhibition of neighboring neuronal cells. From developmental biology, it is known that

Notch plays a role in mesenchymal condensates of skeletogenesis, where Notch maintains

the mesenchymal precursors in an undifferentiated state and through lateral signaling to

the neighboring cells; the distinct developmental zones of long bone growth are established

(Hilton et al., 2008). The function of Notch is also described for mesenchymal condensates

in feather bud development and kidney (A. Li et al., 2013;Sirin et al., 2012).

Although Delta and Notch have been shown to be expressed in murine mesenchyme of

developing molar teeth (Thimios A Mitsiadis,Hirsinger et al., 1998), so far, no function

has been assigned of this pathway during tooth development, neither in the animal model,

nor in humans. Since TGFß1 and BMP4 induced the expression of DLL1 and NOTCH3 in

explant cultures of murine dental mesenchyme, a role in odontoblast differentiation was

suggested (Thimios A Mitsiadis,Hirsinger et al., 1998). The DPCs in my condensation

model clearly show upregulation of the Notch pathway on the transcriptional level. The

receptor NOTCH3 and the ligand JAG1 are significantly upregulated. FURIN, a protease

that functions in processing the pre-protein of the Notch receptor is also upregulated.

Furthermore, at least five validated target genes of the Notch signaling pathway are upregu-

lated, including HES1,HEY1,HEY2,HEYL and HIF1A1. The co-repressors of target gene

expression, HDAC11 and HDAC7 are significantly downregulated, whereas the co-activator

TLE3 is significantly upregulated indicating induction of Notch signaling.

To summarize the molecular events of the early phase of in vitro condensation, it can

be concluded, that the cytoskeleton of the condensing mesenchymal is remodeled via

regulated activity of RhoA with the involvement of reduction of stress fibers and formation

of cortical actin that support direct cell-cell-adhesion. Immediate early response on that

mechanical cues is the modulation of the MAPK activity. Furthermore, in concordance

with literature describing the key molecular pathways that drive tooth organogenesis, there

is striking evidence that the TGFß pathway is activated. Additionally, the FGF pathway

(see Appendix figure 5.10) as well as the Wnt pathway are active or primed to react on

induction (e.g., by epithelial interaction partner).

Therefore, the presented easy and practicable method to culture human dedifferenti-

ated DPCs in ultra-low attachment culture represents a suitable in vitro model to resemble

embryonic mesenchymal condensation and therefore, and is a valuable tool to elucidate the

mechanisms of molecular events without the use of animal models and embryonic cells.

94 Chapter 4 Discussion

4.4 Co-culture with epithelial cells

The next step would include a comprehensive analysis of the behavior and molecular

signature of the organoid in combination with epithelial cells. Since the dental epithelial

stem cell niche giving rise to ameloblast or successional teeth, is degenerated in the adult

human, another source of epithelial cells that interact with the DPC condensate has to be

identified. First co-culture experiments with skin or gingiva-derived keratinocytes proved

that the DPC condensate is indeed instructing on the keratinocytes. The keratinocytes

gather around the DPC aggregate and, in the case of gingiva keratinocytes, they form a

surrounding sheath. Due to the limited availabilty of gingiva as well as their short culture

period, it was not feasible to perform all co-cultures with gingiva-derived keratinocytes.

In contrast to the gingiva-derived keratinocytes, the skin keratinocytes partially detached

from the condensate and only a few cells intensely interacted with the mesenchymal cells

(see figures 3.39 and 3.40). After four days of co-culture the majority of the residual

skin keratinocytes were found at the border to the DPC condensate, nonetheless, a few

cytokeratin-positive cells were detected inside of the condensate. After two weeks, only

very few keratinocytes were detected at the surrounding. Those were tightly bound to

the cellular aggregate. At that time point, also cytokeratin-positive cells were localized

inside the mesenchymal condensate. Remarkably, in native skin section, epidermal ker-

atinocytes do not show cytopkeratin 8/18- and cytokeratin 19-positivity. Only the sweat

and sebaceous gland epithelia stain positive. Cytokeratin 19 is regarded as a marker of

ameloblast differentiation which was shown in several publications (Apellaniz et al.,

2015;Domingues et al., 2000;Heikinheimo et al., 1989;Kasper et al., 1989. The

acidic cytokeratin 19 pairs, in filament formation, with the basic cytokeratin 8. Also

cytokeratin 8, is described to be expressed in all odontoblast epithelia including the dental

lamina and the enamel organ (Heikinheimo et al., 1989;Kero et al., 2014). Cytoker-

atin 14 has been shown to physically interact with amelogenin (Ravindranath et al.,

2001) during amelogenesis and has also been proposed as an ameloblast-lineage marker

in rat cells (M. J. Tabata et al., 1996), but skin immunohistological stainings show cy-

tokeratin 14 expression by epidermal keratinocytes of human skin (see Appendix figure 5.5).

When gingival keratinocytes are co-cultured with the DPC condensates, they tightly

bind to the surface as a sheath. This sheath is maintained for the whole culture time.

After five weeks of co-culture, the organoids were histologically analyzed (see figure 3.41).

Remarkably, the keratinocytes form a multilayered sheath and are detectable in the inner

core of the condensate. Luckily, the cutting angle was chosen well, so that the H&E

staining impressively depicts the invagination that was performed by the epithelial cells

into the mesenchyme. The epithelial cells in the inside of the condensate form a columnar

epithelium around an acellular matrix deposit. The columnar arrangement can be distinctly

seen in the higher magnification of the VIM staining. This arrangement is similar-looking

to basal epithelia. The augmented collagen type IV expression between the mesenchyme

and the epithelia is a strong indication for the formation of a basal lamina. The cytokeratin

expression revealed a strong expression of CK15 in all layers of the epithelial cells, whereas

cytokeratin 8/18 is only detected in the lining epithelium of the sheath.

4.5 Conclusion and Perspectives 95

Fig. 4.2:

Gingival cysts

in an infant (Shear et al.,

2008).

After ten weeks of co-culture, the aggregates exhibit a

puzzling morphology (see figure 3.42). The cellularity is low,

and several mineralized nodules have formed inside of the

organoids. These nodules are connected by collagen type

IV/vimentin-positive cells. With very few exceptions, the

cytokeratin 8/18 expression is disapparent. The nodules

resemble keratinized cysts that occasionally emerge on the

alveolar ridge of newborns (2 weeks to 5 months after birth)

(see figure 4.2). This occurrence is common (prevalence >50%)

and harmless. The cysts develop from fragments of the dental

lamina, that degenerates during embryonic tooth formation.

Sporadically, remnants of this lamina reside in the mesen-

chyme and form cysts that are lined by odontogenic epithelium

with a keratin-filled lumen (Moda,2011). There are reports,

that upon trauma or fracture these epithelial remnants can

give rise to supernumerary teeth in adults (Anthonappa et

al., 2013), which demonstrates that adult mesenchymal cells

are capable of tooth formation in vivo when being instructed

with appropriate signals. Although, from the histological sections, it is hard to conclude

which epithelial phenotype the keratinocytes adopted by co-culture with the inductive

mesenchyme. Nonetheless, it can be summarized that a conversion of the cell type was

achieved, as marked by the cytokeratin 19 and cytokeratin 8/18 staining and that the cells

differentiated and arranged columnar. Moreover, they produced an unneglectable amount

of extracellular matrix.

The resulting structures from the co-cultures are promising, and the missing features

of proper tooth development are simply attributed to the limited conditions of a in

vitro culture. It is of interest, which morphology these organoids would arise in an in

vivo environment, as the jaw providing positional information as well as vasculature and

innervation. Moreover, the results raise the question, whether the produced mesenchymal

condensates that are instructing and most probably inductive, would act as signalling

center for tooth formation when transplanted in the adult jaw bone.

4.5 Conclusion and Perspectives

To examine the function of genes and their causative roles in crucial processes of cell

differentiation, and in the emergence of diseases, model systems are indispensable. Current

models range from living organisms, explant cultures, standard cell cultures, organoids,

and in silico models. Combining the knowledge deriving from all those models aims to the

development of meaningful pharmaceuticals and regenerative therapies.

The demands on an ideal culture model combine availability of cells (ideally adult and/or

patient-derived), practicability, and close correlation to the physiological situation.

The presented model of a three-dimensional culture of human dental pulp cells represents

a valuable tool, mimicking mesenchymal condensation on the one hand and differentiation

towards odontogenic lineage on the other. After expansion and subsequent dedifferentiation

96 Chapter 4 Discussion

of the dental pulp cells, they are cultured under non-adherent conditions to allow self-

orchestrated cell-cell-interaction. As evidenced by comprehensive gene expression analysis

and cellular behavior, this in vitro step highly correlates to the events described for mesen-

chymal condensation in vivo. Furthermore, the mechanochemical signals, cell-autonomously

induced by and, in turn, on DPCs, provoke odontogenic differentiation in the condensates

upon long-term culture. Inductive abilities are distinctive for mesenchymal condensations

in embryogenesis. The produced condensates prove to be instructing and inductive when

combined with epithelial cells. Therefore, the culture model represents the first human

model to study mechanisms of dental mesenchymal condensation and subsequent odon-

togenic differentiation, to find novel involved pathways and examine cross-talks between

pathways.

The next steps will include in-depth analyses of signalling pathways to unravel mechanisms

of human organogenesis. The reporter system for specific pathways will be enhanced. Novel

vector constructs with destabilized eGFP were already cloned and tested in monolayer

DPCs. With a half-life of one hour, the spatiotemporal resolution is enhanced and putat-

ively declining signals from feedback inhibition can be assessed. Furthermore, the vector

portfolio will be extended by a Notch signalling-responsive vector.

The whole transcriptome analysis will be repeated with additional donor samples and a

second time point, 24 hours of condensation, will be included. A comprehensive analysis of

protein level by high-throughput proteomics, comprising posttranslational modifications, is

of particular interest to evaluate the actual activation state of the signalling in DPCs upon

condensation and during differentiation.

Due to the promising results of this thesis, the Technische Universität Berlin, together

with the inventors, we decided to file a patent entitled "Method of preparing an artificial

tooth primordium in vitro and artificial tooth primordium derived therefrom". This patent

is granted, and the method is en route to a pre-clinical pilot study. A corresponding

research proposal is already prepared and will be submitted soon. The method aims to

produce tooth primordia for transplantation purposes to cure tooth loss. However, the

proof of safety and efficacy is required in advance to Advanced Therapy Medicinal Products

(ATMP) approval.

Bibliography

About,Imad (2013): ‘Dentin–pulp regeneration: the primordial role of the microenviron-

ment and its modification by traumatic injuries and bioactive materials’. Endodontic

Topics, vol. 28(1): pp. 61–89 (cit. on p. 3).

Abrahão,Ivete Jorge,Manoela Domingues Martins,Emilio Katayama,João

Humberto Antoniazzi,Angelo Segmentilli and Márcia Martins Marques

(2006): ‘Collagen analysis in human tooth germ papillae’. Brazilian dental journal, vol.

17(3): pp. 208–212 (cit. on p. 15).

Afgan,Enis,Dannon Baker,Bérénice Batut,Marius Van Den Beek,Dave

Bouvier,Martin Čech,John Chilton,Dave Clements,Nate Coraor,Björn A

Grüning et al. (2018): ‘The Galaxy platform for accessible, reproducible and collaborat-

ive biomedical analyses: 2018 update’. Nucleic acids research, vol. 46(W1): W537–W544

(cit. on p. 39).

Ahn,Youngwook,Brian W Sanderson,Ophir D Klein and Robb Krumlauf

(2010): ‘Inhibition of Wnt signaling by Wise (Sostdc1) and negative feedback from Shh

controls tooth number and patterning’. Development, vol. 137: pp. 3221–3231 (cit. on

p. 8).

Amerongen,J.P. van, Inez G. Lemmens and G.J.M. Tonino (1983): ‘The concentration,

extractability and characterization of collagen in human dental pulp’. Archives of Oral

Biology, vol. 28(4): pp. 339–345 (cit. on p. 3).

Anthonappa,R. P.,N. M. King and A. B. M. Rabie (2013): ‘Aetiology of supernu-

merary teeth: a literature review’. European Archives of Paediatric Dentistry, vol. 14(5):

pp. 279–288 (cit. on p. 95).

Apellaniz,Delmira,Sabrina Nieves,Gabriel Tapia,Alvaro Maglia,Adalberto

Mosqueda-Taylor and Ronell Bologna-Molina (2015): ‘Immunohistochemical

analysis of CK14 and CK19 in tooth germ and ameloblastoma’. ODONTOESTOMATO-

LOGIA, vol. 17(25): pp. 4–10 (cit. on p. 94).

Arakaki,Makiko,Masaki Ishikawa,Takashi Nakamura,Tsutomu Iwamoto,Aya

Yamada,Emiko Fukumoto,Masahiro Saito,Keishi Otsu,Hidemitsu Harada,

Yoshihiko Yamada and Satoshi Fukumoto (2012): ‘Role of epithelial-stem cell

interactions during dental cell differentiation’. Journal of Biological Chemistry, vol.

287(13): pp. 10590–10601 (cit. on p. 24).

Athirasala,Avathamsa,Fernanda Lins,Anthony Tahayeri,Monica Hinds,

Anthony J Smith,Christine Sedgley,Jack Ferracane and Luiz E Bertassoni

(2017): ‘A novel strategy to engineer pre-vascularized full-length dental pulp-like tissue

constructs’. Scientific reports, vol. 7(1): p. 3323 (cit. on p. 84).

98 Bibliography

B Kulkarni,Ashok,Derk Joester,John Wright,James P Simmer,Janet

Moradian-Oldak,John D Bartlett,Megan Pugach,Olivier Duverger,Ophir

D Klein,Pamela DenBesten,Rodrigo Lacruz,Sarah Millar,Thomas GH

Diekwisch and Wendy Shaw (2017): ‘Meeting report: a hard look at the state of

enamel research’. International journal of oral science, vol. 9(11): e3 (cit. on p. 13).

Bahrami,Shahram and Finn Drablos (2016): ‘Gene regulation in the immediate-early

response process’. Advances in Biological Regulation, vol. 62: pp. 37–49 (cit. on p. 91).

Begue-Kirn,C,AJ Smith,M Loriot,C Kupferle,JV Ruch and H Lesot (1994):

‘Comparative analysis of TGFßs, BMPs, IGF1, msxs, fibronectin, osteonectin and bone

sialoprotein gene expression during normal and in vitro-induced odontoblast differen-

tiation’. The International journal of developmental biology, vol. 38(3): pp. 405–420

(cit. on p. 88).

Berkovitz,Barry KB,Graham Rex Holland and Bernard J Moxham (2009):

Oral Anatomy, Histology and Embryology. 4th ed. Elsevier Mosby (cit. on pp. 3,4,15).

Berridge,Michael J. (2014): ‘Module 2: Cell Signalling Pathways’. Cell Signalling

Biology, vol. 6 (cit. on p. 93).

Bier,Ethan and Edward M. De Robertis (2015): ‘BMP gradients: A paradigm for

morphogen-mediated developmental patterning’. Science, vol. 348(6242) (cit. on p. 89).

Birchmeier,Carmen and Ermanno Gherardi (1998): ‘Developmental roles of HGF/SF

and its receptor, the c-Met tyrosine kinase’. Trends in cell biology, vol. 8(10): pp. 404–410

(cit. on p. 82).

Burridge,Keith and Christophe Guilluy (2016): ‘Focal adhesions, stress fibers and

mechanical tension’. Experimental Cell Research, vol. 343(1): pp. 14–20 (cit. on p. 88).

Caplan,Arnold I and Diego Correa (2011): ‘The MSC: an injury drugstore’. Cell

stem cell, vol. 9(1): pp. 11–15 (cit. on p. 79).

Casella,James F,Michael D. Flanagan and Shin Lin (1981): ‘Cytochalasin D

inhibits actin polymerization and induces depolymerization of actin filaments formed

during platelet shape change’. Nature, vol. 293(5830): pp. 302–305 (cit. on p. 85).

Chan,CP,WH Lan,MC Chang,YJ Chen,WC Lan,HH Chang and JH Jeng (2005):

‘Effects of TGF-ßs on the growth, collagen synthesis and collagen lattice contraction of

human dental pulp fibroblasts in vitro’. Archives of oral biology, vol. 50(5): pp. 469–479

(cit. on p. 81).

Chang,Chenbei (2016): ‘Agonists and Antagonists of TGF-ß Family Ligands’. Cold

Spring Harbor Perspectives in Biology, vol. 8: a021923 (cit. on p. 56).

Chen,Jianquan,Yu Lan,Jin-A Baek,Yang Gao and Rulang Jiang (2009):

‘Wnt/beta-catenin signaling plays an essential role in activation of odontogenic mesen-

chyme during early tooth development’. Developmental biology, vol. 334(1): pp. 174–185

(cit. on pp. 20,92).

Chen,Ying and Thomas Gridley (2013): ‘Compensatory regulation of the Snai1 and

Snai2 genes during chondrogenesis’. Journal of Bone and Mineral Research, vol. 28(6):

pp. 1412–1421 (cit. on p. 90).

Chimal-Monroy,Jesus and L Diaz De Leon (2003): ‘Expression of N-cadherin, N-CAM,

fibronectin and tenascin is stimulated by TGF-ß1, ß2, ß3 and ß5 during the formation of

precartilage condensations.’ International Journal of Developmental Biology, vol. 43(1):

pp. 59–67 (cit. on pp. 87,90).

Cho,Andrew,Naoto Haruyama,Bradford Hall,Mary Jo S. Danton,Lu Zhang,

Praveen Arany,David J. Mooney,Yassine Harichane,Michel Goldberg,

Carolyn W. Gibson and Ashok B. Kulkarni (2013): ‘TGF-ß Regulates Enamel

Mineralization and Maturation through KLK4 Expression’. PLOS ONE, vol. 8(11) (cit.

on p. 19).

Dassule,Hélène R,Paula Lewis,Marianna Bei,Richard Maas and Andrew P

McMahon (2000): ‘Sonic hedgehog regulates growth and morphogenesis of the tooth’.

Development, vol. 127(22): pp. 4775–4785 (cit. on p. 20).

Domingues,Manoela G,Márcia MM Jaege,Vera C Araújo and Ney S Araújo

(2000): ‘Expression of cytokeratins in human enamel organ’. European journal of oral

sciences, vol. 108(1): pp. 43–47 (cit. on p. 94).

Duailibi,Monica T,Silvio E Duailibi,Conan S Young,John D Bartlett,Joseph

P Vacanti and Pamela C Yelick (2004): ‘Bioengineered teeth from cultured rat tooth

bud cells’. Journal of dental research, vol. 83(7): pp. 523–528 (cit. on p. 71).

El Agha,Elie,Djuro Kosanovic,Ralph T Schermuly and Saverio Bellusci

(2016): ‘Role of fibroblast growth factors in organ regeneration and repair’. Vol. 53:

pp. 76–84 (cit. on p. 52).

Ferguson,Christine A,Abigail S Tucker,Lars Christensen,Anthony L Lau,

Martin M Matzuk and Paul T Sharpe (1998): ‘Activin is an essential early mes-

enchymal signal in tooth development that is required for patterning of the murine

dentition’. Genes & development, vol. 12(16): pp. 2636–2649 (cit. on pp. 19,82).

Fujii,Sakiko,Katsumi Fujimoto,Noriko Goto,Masami Kanawa,Takeshi Kawa-

moto,Haiou Pan,Petcharin Srivatanakul,Waralak Rakdang,Juthamas

Pornprasitwech,Tania Saskianti,Ketut Suardita,Fusanori Nishimura and

Yukio Kato (2015): ‘Characteristic expression of MSX1, MSX2, TBX2 and ENTPD1

in dental pulp cells’. Biomedical Reports, vol. 3(4): pp. 566–572 (cit. on p. 83).

Gao,Bo,Xin Zhou,Xuedong Zhou,Caixia Pi,Ruoshi Xu,Mian Wan,Jing

Yang,Yue Zhou,Chengcheng Liu,Jianxun Sun,Yan Zhang and Liwei Zheng

(2015): ‘BMP7 and EREG Contribute to the Inductive Potential of Dental Mesenchyme’.

Scientific reports, vol. 5: p. 9903 (cit. on p. 86).

Gasse,B.,E. Karayigit,E. Mathieu,S. Jung,A. GARRET,M. Huckert,S. Mork-

mued,C. Schneider,L. Vidal,J. Hemmerle,J. -Y. Sire and A. Bloch-Zupan

(2013): ‘Homozygous and compound heterozygous MMP20 mutations in amelogenesis

imperfecta’. Journal of dental research, vol. 92(7): pp. 598–603 (cit. on p. 14).

Goldberg,Michel and Anthony J Smith (2004): ‘Cells and extracellular matrices of

dentin and pulp: a biological basis for repair and tissue engineering’. Critical Reviews in

Oral Biology & Medicine, vol. 15(1): pp. 13–27 (cit. on p. 82).

Gronthos,S,M Mankani,J Brahim,P G Robey and S Shi (2000): ‘Postnatal human

dental pulp stem cells (DPSCs) in vitro and in vivo’. Proceedings of the National Academy

of Sciences of the United States of America, vol. 97(25): pp. 13625–30 (cit. on pp. 24,

80).

100 Bibliography

Gronthos,Stan,Agnieszka Arthur,P Mark Bartold and Songtao Shi (2011):

‘A Method to Isolate and Culture Expand Human Dental Pulp Stem Cells’. Methods in

molecular biology (Clifton, N.J.) Vol. 698: pp. 107–121 (cit. on p. 29).

Gurdon,JB (1971): ‘Gene activity during embryogenesis’. Triangle; the Sandoz journal

of medical science, vol. 10(1): pp. 23–28.

Hall,Brian K and Tsutomo Miyake (2000): ‘All for one and one for all: condensations

and the initiation of skeletal development’. Bioessays, vol. 22(2): pp. 138–147 (cit. on

pp. 21,87).

Hardcastle,Zoe,Rong Mo,CC Hui and Paul T Sharpe (1998): ‘The Shh signalling

pathway in tooth development: defects in Gli2 and Gli3 mutants’. Development, vol.

125(15): pp. 2803–2811 (cit. on p. 20).

Heikinheimo,Kristiina,Marketta Hormia,Göran Stenman,Ismo Virtanen and

Risto-Pekka Happonen (1989): ‘Patterns of expression of intermediate filaments in

ameloblastoma and human fetal tooth germ’. Journal of Oral Pathology & Medicine, vol.

18(5): pp. 264–273 (cit. on p. 94).

Hematti,Peiman (2012): ‘Mesenchymal stromal cells and fibroblasts: a case of mistaken

identity?’ Cytotherapy, vol. 14(5): pp. 516–521 (cit. on p. 79).

Hilton,Matthew J,Xiaolin Tu,Ximei Wu,Shuting Bai,Haibo Zhao,Tatsuya

Kobayashi,Henry M Kronenberg,Steven L Teitelbaum,F Patrick Ross,

Raphael Kopan et al. (2008): ‘Notch signaling maintains bone marrow mesenchymal

progenitors by suppressing osteoblast differentiation’. Nature medicine, vol. 14(3): p. 306

(cit. on p. 93).

Horiguchi,Kana,Takuya Shirakihara,Ayako Nakano,Takeshi Imamura,Kohei

Miyazono and Masao Saitoh (2009): ‘Role of Ras Signaling in the Induction of

Snail by Transforming Growth Factor-ß’. Journal of Biological Chemistry, vol. 284(1):

pp. 245–253.

Hosseini,Samaneh,Shahrbanoo Jahangir and Mohamadreza Baghaban Eslam-

inejad (2018): ‘Tooth tissue engineering’. Biomaterials for Oral and Dental Tissue

Engineering. Elsevier: pp. 467–501 (cit. on pp. 24,84).

Hu,L,Y Liu and S Wang (2018): ‘Stem cell-based tooth and periodontal regeneration’.

Oral diseases, vol. 24(5): pp. 696–705 (cit. on p. 24).

Huang,George T.-J.,Kristina Shagramanova and Selina W. Chan (2006): ‘Form-

ation of Odontoblast-Like Cells from Cultured Human Dental Pulp Cells on Dentin In

Vitro’. Journal of Endodontics, vol. 32(11): pp. 1066–1073 (cit. on p. 42).

Hughes,Alex J,Hikaru Miyazaki,Maxwell C Coyle,Jesse Zhang,Matthew T

Laurie,Daniel Chu,Zuzana Vavrušová,Richard A Schneider,Ophir D Klein

and Zev J Gartner (2018): ‘Engineered tissue folding by mechanical compaction of

the mesenchyme’. Developmental cell, vol. 44(2): pp. 165–178 (cit. on p. 8).

Humphrey,Linda L.,Rongwei Fu,David I. Buckley,Michele Freeman and

Mark Helfand (2008): ‘Periodontal disease and coronary heart disease incidence: A

systematic review and meta-analysis’. Journal of General Internal Medicine, vol. 23(12):

pp. 2079–2086 (cit. on p. 1).

Järvinen,Elina,Isaac Salazar-Ciudad,Walter Birchmeier,Makoto M. Taketo,

Jukka Jernvall and Irma Thesleff (2006): ‘Continuous tooth generation in mouse

101

is induced by activated epithelial Wnt/ß-catenin signaling’. Proceedings of the National

Academy of Sciences, vol. 103(49): pp. 18627–18632 (cit. on p. 20).

Jia,Shihai,Jing Zhou,Yang Gao,Jin-A Baek,James F Martin,Yu Lan and

Rulang Jiang (2013): ‘Roles of Bmp4 during tooth morphogenesis and sequential tooth

formation’. Development, vol. 140(2): pp. 423–432 (cit. on p. 20).

Jin,Hye Jin,Yun Kyung Bae,Miyeon Kim,Soon-Jae Kwon,Hong Bae Jeon,

Soo Jin Choi,Seong Who Kim,Yoon Sun Yang,Wonil Oh and Jong Wook

Chang (2013): ‘Comparative analysis of human mesenchymal stem cells from bone

marrow, adipose tissue, and umbilical cord blood as sources of cell therapy’. International

journal of molecular sciences, vol. 14(9): pp. 17986–18001 (cit. on p. 80).

Kadler,Shirin (2017): ‘Tissue engineered cartilage: how hard can it be?’ PhD thesis.

Technische Universität Berlin (cit. on p. 80).

Kasper,Michael,Uwe Karsten,Peter Stoslek and Roland Moll (1989): ‘Distri-

bution of intermediate-filament proteins in the human enamel organ: unusually complex

pattern of coexpression of cytokeratin polypeptides and vimentin’. Differentiation, vol.

40(3): pp. 207–214 (cit. on p. 94).

Kawai,R,N Ozeki,H Yamaguchi,T Tanaka,K Nakata,M Mogi and H Nakamura

(2014): ‘Mouse ES cells have a potential to differentiate into odontoblast-like cells using

hanging drop method’. Oral diseases, vol. 20(4): pp. 395–403 (cit. on p. 24).

Kero,Darko,D Kalibovic Govorko,K Vukojevic,M Cubela,V Soljic and

M Saraga-Babic (2014): ‘Expression of cytokeratin 8, vimentin, syndecan-1 and Ki-67

during human tooth development’. Journal of molecular histology, vol. 45(6): pp. 627–640

(cit. on p. 94).

Kettunen,Päivi,Bradley Spencer-Dene,Tomasz Furmanek,Inger Hals Kvinns-

land,Clive Dickson,Irma Thesleff and Keijo Luukko (2007): ‘Fgfr2b mediated

epithelial–mesenchymal interactions coordinate tooth morphogenesis and dental trigem-

inal axon patterning’. Mechanisms of development, vol. 124(11): pp. 868–883 (cit. on

p. 19).

Klein,Ophir D,David B Lyons,Guive Balooch,Grayson W Marshall,M

Albert Basson,Miroslav Peterka,Tomas Boran,Renata Peterkova and

Gail R Martin (2008): ‘An FGF signaling loop sustains the generation of differentiated

progeny from stem cells in mouse incisors’. Development, vol. 135(2): pp. 377–385 (cit. on

p. 19).

Kollar,Edward J. and Grace R. Baird (1969): ‘The influence of the dental papilla

on the development of tooth shape in embryonic mouse tooth germs’. Development, vol.

21(1): pp. 131–148 (cit. on p. 85).

–

(1970a): ‘Tissue interactions in embryonic mouse tooth germs: II. The inductive role of

the dental papilla’. Development, vol. 24(1): pp. 173–186 (cit. on pp. 71,85).

–

(1970b): ‘Tissue interactions in embryonic mouse tooth germs: I. Reorganization of the

dental epithelium during tooth-germ reconstruction’. Development, vol. 24(1): pp. 159–

171 (cit. on p. 85).

Kollar,EJ and C Fisher (1980): ‘Tooth induction in chick epithelium: expression of

quiescent genes for enamel synthesis’. Science, vol. 207(4434): pp. 993–995 (cit. on p. 8).

102 Bibliography

Krahn,Katy Nash,Carlijn V.C. Bouten,Sjoerd van Tuijl,Marc A.M.J. van

Zandvoort and Maarten Merkx (2006): ‘Fluorescently labeled collagen binding

proteins allow specific visualization of collagen in tissues and live cell culture’. Analytical

Biochemistry, vol. 350(2): pp. 177–185 (cit. on p. 65).

Krampera,Mauro,Jacques Galipeau,Yufang Shi,Karin Tarte and Luc Sensebe

(2013): ‘Immunological characterization of multipotent mesenchymal stromal cells—The

International Society for Cellular Therapy (ISCT) working proposal’. Cytotherapy, vol.

15(9): pp. 1054–1061 (cit. on p. 79).

Kratochwil,Klaus,Juan Galceran,Sabine Tontsch,Wera Roth and Rudolf

Grosschedl (2002): ‘FGF4, a direct target of LEF1 and Wnt signaling, can rescue

the arrest of tooth organogenesis in Lef1-/- mice’. Genes & development, vol. 16(24):

pp. 3173–3185 (cit. on p. 20).

Lacruz,Rodrigo S,Stefan Habelitz,J Timothy Wright and Michael L Paine

(2017): ‘Dental enamel formation and implications for oral health and disease’. Physiolo-

gical reviews, vol. 97(3): pp. 939–993 (cit. on p. 1).

Lee,Hyung Taek and EP Kay (2003): ‘FGF-2 induced reorganization and disruption

of actin cytoskeleton through PI 3-kinase, Rho, and Cdc42 in corneal endothelial cells’.

Mol Vis, vol. 9(76-78): pp. 624–634 (cit. on p. 88).

Lei,Qiubo,Yongsu Jeong,Kamana Misra,Shike Li,Alice K Zelman,Douglas J

Epstein and Michael P Matise (2006): ‘Wnt signaling inhibitors regulate the transcrip-

tional response to morphogenetic Shh-Gli signaling in the neural tube’. Developmental

cell, vol. 11(3): pp. 325–337 (cit. on p. 8).

Li,Ang,Meng Chen,Ting-Xin Jiang,Ping Wu,Qing Nie,Randall Widelitz

and Cheng-Ming Chuong (2013): ‘Shaping organs by a wingless-int/Notch/nonmuscle

myosin module which orients feather bud elongation’. Proceedings of the National

Academy of Sciences, vol. 110(16): E1452–E1461 (cit. on p. 93).

Li,Xiuying,Jinping Bai,Xiaofeng Ji,Ronggui Li,Yali Xuan and Yimin Wang

(2014): ‘Comprehensive characterization of four different populations of human mesen-

chymal stem cells as regards their immune properties, proliferation and differentiation’.

International Journal of Molecular Medicine, vol. 34(3): pp. 695–704 (cit. on p. 80).

Liang,Jia,Guangtai Song,Qing Li and Zhuan Bian (2012): ‘Novel missense mutations

in PAX9 causing oligodontia’. Archives of oral biology, vol. 57(6): pp. 784–789 (cit. on

p. 86).

Lin,Dahe,Yide Huang,Fenglei He,Shuping Gu,Guozhong Zhang,YiPing Chen

and Yanding Zhang (2007): ‘Expression survey of genes critical for tooth development

in the human embryonic tooth germ’. Developmental dynamics: an official publication of

the American Association of Anatomists, vol. 236(5): pp. 1307–1312 (cit. on p. 9).

Mafi,P,S Hindocha,R Mafi,M Griffin and WS Khan (2011): ‘Adult mesenchymal

stem cells and cell surface characterization - a systematic review of the literature’. Open

Orthop J, vol. 5(Suppl 2): pp. 253–260 (cit. on p. 79).

Main,James HP (1966): ‘Retention of potential to differentiate in long-term cultures of

tooth germs’. Science, vol. 152(3723): pp. 778–780 (cit. on p. 24).

103

Mammoto,Tadanori,Akiko Mammoto and Donald E Ingber (2013): ‘Mechanobio-

logy and developmental control’. Annual review of cell and developmental biology, vol.

29: pp. 27–61 (cit. on pp. 22,23,84).

Mammoto,Tadanori,Akiko Mammoto,Amanda Jiang,Elisabeth Jiang,Basma

Hashmi and Donald E Ingber (2015): ‘Mesenchymal condensation-dependent accumu-

lation of collagen VI stabilizes organ-specific cell fates during embryonic tooth formation’.

Developmental Dynamics, vol. 244(6): pp. 713–723 (cit. on pp. 22,65,70,87,91).

Mammoto,Tadanori,Akiko Mammoto,Yu-suke Torisawa,Tracy Tat,Ashley

Gibbs,Ratmir Derda,Robert Mannix,Marlieke de Bruijn,Chong Wing

Yung,Dongeun Huh and Donald E Ingber (2011): ‘Mechanochemical control of

mesenchymal condensation and embryonic tooth organ formation’. Developmental cell,

vol. 21(4): pp. 758–769 (cit. on pp. 19,22,23,71,88).

Martinez-Alvarez,Concepcion,Maria J Blanco,Raquel Perez,M.Angeles

Rabadan,Marta Aparicio,Eva Resel,Tamara Martinez and M.Angela Nieto

(2004): ‘Snail family members and cell survival in physiological and pathological cleft

palates’. Developmental Biology, vol. 265(1): pp. 207–218 (cit. on p. 90).

Massagué,Joan,Stacy W Blain and Roger S Lo (2000): ‘TGFß signaling in growth

control, cancer, and heritable disorders’. Cell, vol. 103(2): pp. 295–309 (cit. on p. 18).

McCollum,Melanie A and Paul T Sharpe (2001): ‘Developmental genetics and early

hominid craniodental evolution’. Bioessays, vol. 23(6): pp. 481–493 (cit. on pp. 9,10).

McGuire,J.D.,J.P. Gorski,V. Dusevich,Y. Wang and M.P. Walker (2014): ‘Type

IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy’. Journal of

Dental Research, vol. 93(10): pp. 1028–1034 (cit. on p. 3).

Mead,Ben,Ann Logan,Martin Berry,Wendy Leadbeater and Ben Scheven

(2016): ‘Dental Pulp Stem Cells: A Novel Cell Therapy for Retinal and Central Nervous

System Repair: DPSC therapy for neural and retinal repair’. STEM CELLS, vol. 35(1):

pp. 61–67 (cit. on p. 81).

Meredith,Robert W,Guojie Zhang,M Thomas P Gilbert,Erich D Jarvis

and Mark S Springer (2014): ‘Evidence for a single loss of mineralized teeth in the

common avian ancestor’. Science, vol. 346(6215): p. 1254390 (cit. on p. 8).

Metsalu,Tauno and Jaak Vilo (2015): ‘ClustVis: a web tool for visualizing clustering

of multivariate data using Principal Component Analysis and heatmap’. Nucleic acids

research, vol. 43(W1): W566–W570 (cit. on p. 39).

Mina,Mand EJ Kollar (1987): ‘The induction of odontogenesis in non-dental mes-

enchyme combined with early murine mandibular arch epithelium’. Archives of Oral

Biology, vol. 32(2): pp. 123–127 (cit. on pp. 19,24,71).

Mincione,Gabriella,Maria Carmela Di Marcantonio,Luciano Artese,Giovina

Vianale,Alessandro Piccirelli,Marcello Piccirilli,Vittoria Perrotti,

Corrado Rubini,Adriano Piattelli and Raffaella Muraro (2008): ‘Loss of

expression of TGF-ß1, TßRI, and TßRII correlates with differentiation in human oral

squamous cell carcinomas’. International journal of oncology, vol. 32(2): pp. 323–331

(cit. on p. 81).

Mitsiadis,TA and HU Luder (2011): ‘Genetic basis for tooth malformations: from mice

to men and back again’. Clinical genetics, vol. 80(4): pp. 319–329 (cit. on p. 21).

104 Bibliography

Mitsiadis,Thimios A,Yvonnick Chéraud,Paul Sharpe and Josiane Fontaine-

Pérus (2003): ‘Development of teeth in chick embryos after mouse neural crest trans-

plantations’. Proceedings of the National Academy of Sciences, vol. 100(11): pp. 6541–

6545 (cit. on p. 8).

Mitsiadis,Thimios A,Estelle Hirsinger,Urban Lendahl and Christo Goridis

(1998): ‘Delta–Notch Signaling in Odontogenesis: Correlation with Cytodifferentiation

and Evidence for Feedback Regulation’. Developmental Biology, vol. 204(2): pp. 420–431

(cit. on p. 93).

Miura,Masako,Stan Gronthos,Mingrui Zhao,Bai Lu,Larry W Fisher,Pamela

Gehron Robey and Songtao Shi (2003): ‘SHED: stem cells from human exfoliated

deciduous teeth’. Proceedings of the National Academy of Sciences, vol. 100(10): pp. 5807–

5812 (cit. on p. 30).

Moda,Aman (2011): ‘Gingival cyst of newborn’. International journal of clinical pediatric

dentistry, vol. 4(1): p. 83 (cit. on p. 95).

Montebugnoli,L,D Servidio,R A Miaton,C Prati,P Tricoci and C Melloni

(2004): ‘Poor oral health is associated with coronary heart disease and elevated systemic

inflammatory and haemostatic factors.’ Journal of clinical periodontology, vol. 31(1):

pp. 25–9 (cit. on p. 1).

Nagpal,Anjali,Karlea L Kremer,Monica A Hamilton-Bruce,Xenia Kaidonis,

Austin G Milton,Christopher Levi,Songtao Shi,Leeanne Carey,Susan

Hillier,Miranda Rose,Andrew Zacest,Parabjit Takhar and Simon A Koblar

(2016): ‘TOOTH (The Open study Of dental pulp stem cell Therapy in Humans): Study

protocol for evaluating safety and feasibility of autologous human adult dental pulp stem

cell therapy in patients with chronic disability after stroke’. International Journal of

Stroke, vol. 11(5): pp. 575–585 (cit. on p. 81).

Nakashima,Misako and Koichiro Iohara (2017): ‘Recent Progress in Translation from

Bench to a Pilot Clinical Study on Total Pulp Regeneration’. Journal of Endodontics,

vol. 43(9, Supplement): S82–S86 (cit. on p. 84).

Nanci,Antonio (2012): Ten Cate’s oral histology: Development, Structure, and Function.

8th ed. Elsevier Mosby (cit. on pp. 2,3,5,6,8,10,14,16,17).

Neubüser,Annette,Heiko Peters,Rudi Balling and Gail R Martin (1997):

‘Antagonistic Interactions between FGF and BMP Signaling Pathways: A Mechanism for

Positioning the Sites of Tooth Formation’. Cell, vol. 90(2): pp. 247–255 (cit. on p. 83).

Ning,Fang,Yunshan Guo,Juan Tang,Jing Zhou,Hongmei Zhang,Wei Lu,Yuan

Gao,Lei Wang,Duanqing Pei,Yinzhong Duan and Yan Jin (2010): ‘Differentiation

of mouse embryonic stem cells into dental epithelial-like cells induced by ameloblasts

serum-free conditioned medium’. Biochemical and biophysical research communications,

vol. 394(2): pp. 342–347 (cit. on p. 24).

Niwa,Takahiko,Yasuo Yamakoshi,Hajime Yamazaki,Takeo Karakida,Risako

Chiba,Jan C.-C. Hu,Takatoshi Nagano,Ryuji Yamamoto,James P. Simmer,

Henry C. Margolis and Kazuhiro Gomi (2018): ‘The dynamics of TGF-ß in dental

pulp, odontoblasts and dentin’. Scientific reports, vol. 8(1): p. 4450 (cit. on pp. 81,83,

86).

105

Nogai,Hendrik,Mark Rosowski,Joachim Grün,Anika Rietz,Nils Debus,Gül

Schmidt,Carola Lauster,Michal Janitz,Andrea Vortkamp and Roland

Lauster (2008): ‘Follistatin antagonizes transforming growth factorß3-induced epithelial–

mesenchymal transition in vitro: implications for murine palatal development supported

by microarray analysis’. Differentiation, vol. 76(4): pp. 404–416 (cit. on p. 90).

Ohazama,A,SAC Modino,I Miletich and PT Sharpe (2004): ‘Stem-cell-based tissue

engineering of murine teeth’. Journal of dental research, vol. 83(7): pp. 518–522 (cit. on

pp. 24,71).

Ono,Mitsuaki,Masamitsu Oshima,Miho Ogawa,Wataru Sonoyama,Emilio

Satoshi Hara,Yasutaka Oida,Shigehiko Shinkawa,Ryu Nakajima,Atsushi

Mine,Satoru Hayano,Satoshi Fukumoto,Shohei Kasugai,Akira Yamaguchi,

Takashi Tsuji and Takuo Kuboki (2017): ‘Practical whole-tooth restoration utilizing

autologous bioengineered tooth germ transplantation in a postnatal canine model’.

Scientific reports, vol. 7: p. 44522 (cit. on p. 25).

Ornitz,David M and Nobuyuki Itoh (2015): ‘The fibroblast growth factor signaling

pathway’. Wiley Interdisciplinary Reviews: Developmental Biology, vol. 4(3): pp. 215–266

(cit. on p. 19).

Oshima,Masamitsu,Mitsumasa Mizuno,Aya Imamura,Miho Ogawa,Masato

Yasukawa,Hiromichi Yamazaki,Ritsuko Morita,Etsuko Ikeda,Kazuhisa

Nakao,Teruko Takano-Yamamoto,Shohei Kasugai,Masahiro Saito and

Takashi Tsuji (2011): ‘Functional Tooth Regeneration Using a Bioengineered Tooth

Unit as a Mature Organ Replacement Regenerative Therapy’. PloS one, vol. 6(7): e21531

(cit. on pp. 24,25).

Oshimori,Naoki and Elaine Fuchs (2012): ‘Paracrine TGF-ß Signaling Counterbalances

BMP-Mediated Repression in Hair Follicle Stem Cell Activation’. Cell Stem Cell, vol.

10(1): pp. 63–75 (cit. on p. 89).

Papagerakis,P,A Berdal,M Mesbah,M Peuchmaur,L Malaval,J Nydegger,

J Simmer and M Macdougall (2002): ‘Investigation of osteocalcin, osteonectin, and

dentin sialophosphoprotein in developing human teeth’. Bone, vol. 30(2): pp. 377–385

(cit. on p. 80).

Patti,Joseph M,Tomas Bremell,Danuta Krajewska-Pietrasik,Arturo Abdel-

nour,Andrzej Tarkowski,Cecilia Rydén and M Höök (1994): ‘The Staphylococ-

cus aureus collagen adhesin is a virulence determinant in experimental septic arthritis.’

Infection and immunity, vol. 62(1): pp. 152–161 (cit. on p. 65).

Paus,R(2003): ‘Biology of hair and nail’. Dermatology, vol.: pp. 1007–1032 (cit. on p. 21).

Perantoni,Alan O,Lee F Dove and Irina Karavanova (1995): ‘Basic fibroblast

growth factor can mediate the early inductive events in renal development’. Proceedings

of the National Academy of Sciences, vol. 92(10): pp. 4696–4700 (cit. on pp. 52,82).

Peters,Heiko and Rudi Balling (1999): ‘Teeth: where and how to make them’. Trends

in Genetics, vol. 15(2): pp. 59–65 (cit. on p. 83).

Pisciotta,Alessandra,Gianluca Carnevale,Simona Meloni,Massimo Riccio,

Sara De Biasi,Lara Gibellini,Adriano Ferrari,Giacomo Bruzzesi and Anto

De Pol (2015): ‘Human Dental pulp stem cells (hDPSCs): isolation, enrichment and

106 Bibliography

comparative differentiation of two sub-populations’. BMC Developmental Biology, vol.

15(1): p. 14 (cit. on p. 42).

Rahman,M Mamunur,Jaganathan Subramani,Mallika Ghosh,Jiyeon Kim

Denninger,Kotaro Takeda,Guo-Hua Fong,Morgan E Carlson and Linda

H Shapiro (2014): ‘CD13 promotes mesenchymal stem cell-mediated regeneration of

ischemic muscle’. Frontiers in physiology, vol. 4: p. 402 (cit. on p. 79).

Ravindranath,Rajeswari MH,Wai-Yin Tam,Pablo Bringas,Valentino Santos

and Alan G Fincham (2001): ‘Amelogenin-cytokeratin 14 interaction in ameloblasts

during enamel formation’. Journal of Biological Chemistry, vol. 276(39): pp. 36586–36597

(cit. on p. 94).

Ray,Poulomi and Susan C. Chapman (2015): ‘Cytoskeletal Reorganization Drives

Mesenchymal Condensation and Regulates Downstream Molecular Signaling’. PLOS

ONE, vol. 10(8): pp. 1–24 (cit. on pp. 85,89).

Rincon,J. C.,W. G. Young and P. M. Bartold (2006): ‘The epithelial cell rests of

Malassez – a role in periodontal regeneration?’ Journal of Periodontal Research, vol.

41(4): pp. 245–252 (cit. on p. 6).

Rishikaysh,Pisal,Kapil Dev,Daniel Diaz,Wasay Mohiuddin Shaikh Qureshi,

Stanislav Filip and Jaroslav Mokry (2014): ‘Signaling Involved in Hair Follicle

Morphogenesis and Development’. International Journal of Molecular Sciences, vol. 15(1):

pp. 1647–1670 (cit. on p. 8).

Sarkar,Lena and Paul T Sharpe (1999): ‘Expression of Wnt signalling pathway genes

during tooth development’. Mechanisms of development, vol. 85(1-2): pp. 197–200 (cit. on

pp. 20,92).

Schindelin,Johannes et al. (2012): ‘Fiji: an open-source platform for biological-image

analysis’. Nature methods, vol. 9(7): p. 676 (cit. on p. 40).

Schmidt-Ullrich,Ruth and Ralf Paus (2005): ‘Molecular principles of hair follicle

induction and morphogenesis’. Bioessays, vol. 27(3): pp. 247–261 (cit. on p. 83).

Sennett,Rachel,Zichen Wang,Amélie Rezza,Laura Grisanti,Nataly Roiter-

shtein,Cristina Sicchio,Ka Wai Mok,Nicholas J Heitman,Carlos Clavel,

Avi Ma’ayan et al. (2015): ‘An integrated transcriptome atlas of embryonic hair follicle

progenitors, their niche, and the developing skin’. Developmental cell, vol. 34(5): pp. 577–

591 (cit. on p. 90).

Shear,M. and P. Speight (2008): ‘Gingival Cyst and Midpalatal Raphe Cyst of Infants’.

Cysts of the Oral and Maxillofacial Regions. John Wiley and Sons, Ltd. Chap. 2: pp. 3–5

(cit. on p. 95).

Shi,S,PM Bartold,M Miura,BM Seo,PG Robey and S Gronthos (2005):

‘The efficacy of mesenchymal stem cells to regenerate and repair dental structures’.

Orthodontics and Craniofacial Research, vol. 8(3): pp. 191–199 (cit. on p. 41).

Shi,Songtao and Stan Gronthos (2003): ‘Perivascular niche of postnatal mesenchymal

stem cells in human bone marrow and dental pulp’. Journal of bone and mineral research,

vol. 18(4): pp. 696–704 (cit. on p. 79).

Shin,Kunyoo,John Lee,Nini Guo,James Kim,Agnes Lim,Lishu Qu,Indira

U Mysorekar and Philip A Beachy (2011): ‘Hedgehog/Wnt feedback supports

107

regenerative proliferation of epithelial stem cells in bladder’. Nature, vol. 472(7341):

pp. 110–114 (cit. on p. 8).

Sirin,Yasemin and Katalin Susztak (2012): ‘Notch in the kidney: development and

disease’. The Journal of pathology, vol. 226(2): pp. 394–403 (cit. on p. 93).

Sloan,Alastair J and Rachel J Waddington (2009): ‘Dental pulp stem cells: what,

where, how?’ International Journal of Paediatric Dentistry, vol. 19(1): pp. 61–70 (cit. on

p. 24).

Smith,David E,F Franco Del Amo and THOMAS Gridley (1992): ‘Isolation of

Sna, a mouse gene homologous to the Drosophila genes snail and escargot: its expression

pattern suggests multiple roles during postimplantation development’. Development, vol.

116(4): pp. 1033–1039 (cit. on p. 90).

Smith,Elizabeth E,Weibo Zhang,Nathan R Schiele,Ali Khademhosseini,

Catherine K Kuo and Pamela C Yelick (2017): ‘Developing a biomimetic tooth bud

model’. Journal of tissue engineering and regenerative medicine, vol. 11(12): pp. 3326–

3336 (cit. on p. 24).

Song,Hee-Kyung,So-Hyung Lee and Paul F Goetinck (2004): ‘FGF-2 signaling is

sufficient to induce dermal condensations during feather development’. Developmental

dynamics: an official publication of the American Association of Anatomists, vol. 231(4):

pp. 741–749 (cit. on pp. 52,82).

Sonoyama,Wataru,Takayoshi Yamaza,Stan Gronthos and Songtao Shi (2007):

‘Multipotent Stem Cells in Dental Pulp’. Culture of Human Stem Cells. John Wiley and

Sons, Inc.: pp. 187–206.

Struys,Tom,Marjan Moreels,Wendy Martens,Raf Donders,Esther Wolfs

and Ivo Lambrichts (2011): ‘Ultrastructural and immunocytochemical analysis of

multilineage differentiated human dental pulp-and umbilical cord-derived mesenchymal

stem cells’. Cells Tissues Organs, vol. 193(6): pp. 366–378 (cit. on p. 80).

Su,Nan,Min Jin and Lin Chen (2014): ‘Role of FGF/FGFR signaling in skeletal

development and homeostasis: Learning from mouse models’. Bone Research, vol. 2:

p. 14003 (cit. on p. 82).

Subramanian,Aravind,Pablo Tamayo,Vamsi K. Mootha,Sayan Mukherjee,Ben-

jamin L. Ebert,Michael A. Gillette,Amanda Paulovich,Scott L. Pomeroy,

Todd R. Golub,Eric S. Lander and Jill P. Mesirov (2005): ‘Gene set enrichment

analysis: A knowledge-based approach for interpreting genome-wide expression profiles’.

Proceedings of the National Academy of Sciences, vol. 102(43): pp. 15545–15550 (cit. on

p. 39).

Suchánek,Jakub,Tomáš Soukup,Romana Ivančaková,Jana Karbanová,Věra

Hubková,Robert Pytlik and Lenka Kučerová (2007): ‘Human Dental Pulp Stem

Cells – Isolation and Long Term Cultivation’. Acta Medica (Hradec Kralove, Czech

Republic), vol. 50(3): pp. 195–201 (cit. on p. 42).

Suchánek,Jakub,Tomáš Soukup,Benjamin Visek,Romana Ivančaková,Lenka

Kučerová and Jaroslav Mokry (2009): ‘Dental pulp stem cells and their characteriz-

ation’. Biomedical Papers, vol. 153(1): pp. 31–35.

108 Bibliography

Sun,Xin,Erik N Meyers,Mark Lewandoski and Gail R Martin (1999): ‘Targeted

disruption of Fgf8 causes failure of cell migration in the gastrulating mouse embryo’.

Genes & development, vol. 13(14): pp. 1834–1846 (cit. on p. 19).

Tabata,Makoto J,Tatsushi Matsumura,Ji-Guang Liu,Satoshi Wakisaka and

Kojiro Kurisu (1996): ‘Expression of cytokeratin 14 in ameloblast-lineage cells of the

developing tooth of rat, both in vivo and in vitro’. Archives of oral biology, vol. 41(11):

pp. 1019–1027 (cit. on p. 94).

Tabata,Makoto,K Kim,J G Liu,K Yamashita,T Matsumura,J Kato,Mitsumasa

Iwamoto,Satoshi Wakisaka,Kunio Matsumoto,T Nakamura,M Kumegawa

and K Kurisu (1996): ‘Hepatocyte growth factor is involved in the morphogenesis of

tooth germ in murine molars’. Development, vol. 122(4): pp. 1243–1251 (cit. on p. 82).

Takahashi,Kazuto,Yoshiaki Kishi and Syngcuk Kim (1982): ‘A scanning electron

microscope study of the blood vessels of dog pulp using corrosion resin casts’. Journal of

endodontics, vol. 8(3): pp. 131–135 (cit. on p. 4).

Takigawa-Imamura,Hisako,Ritsuko Morita,Takafumi Iwaki,Takashi Tsuji

and Kenichi Yoshikawa (2015): ‘Tooth germ invagination from cell–cell interaction:

Working hypothesis on mechanical instability’. Journal of theoretical biology, vol. 382:

pp. 284–291 (cit. on p. 9).

Tatullo,M,G Falisi,M Amantea,C Rastelli,F Paduano and M Marrelli (2015):

‘Dental pulp stem cells and human periapical cyst mesenchymal stem cells in bone tissue

regeneration: comparison of basal and osteogenic differentiated gene expression of a

newly discovered mesenchymal stem cell lineage’. J Biol Regul Homeost Agents, vol.

29(3): pp. 713–8 (cit. on p. 84).

Thesleff,Irma (2018): ‘From understanding tooth development to bioengineering of

teeth’. European journal of oral sciences, vol. 126(Suppl.1): pp. 67–71 (cit. on p. 17).

Thomas,Bethan L,Jen Kuei Liu,JL Rubenstein and Paul T Sharpe (2000):

‘Independent regulation of Dlx2 expression in the epithelium and mesenchyme of the

first branchial arch’. Development, vol. 127(2): pp. 217–224 (cit. on p. 19).

Tsunematsu,Takaaki et al. (2016): ‘Human odontogenic epithelial cells derived from

epithelial rests of Malassez possess stem cell properties’. Laboratory Investigation, vol.

96(10): pp. 1063–1075 (cit. on p. 6).

Vaahtokari,A.,S. Vainio and I. Thesleff (1991): ‘Associations between transforming

growth factor beta 1 RNA expression and epithelial-mesenchymal interactions during

tooth morphogenesis’. Development, vol. 113(3): pp. 985–994 (cit. on pp. 81,88,90).

Vainio,Seppo,Irina Karavanova,Adrian Jowett and Irma Thesleff (1993a):

‘Identification of BMP-4 as a signal mediating secondary induction between epithelial

and mesenchymal tissues during early tooth development’. Cell, vol. 75(1): pp. 45–58

(cit. on p. 19).

–

(1993b): ‘Identification of BMP-4 as a signal mediating secondary induction between

epithelial and mesenchymal tissues during early tooth development’. Cell, vol. 75(1):

pp. 45–58.

Volponi,Ana Angelova,Lucia K Zaugg,Vitor Neves,Yang Liu and Paul T

Sharpe (2018): ‘Tooth Repair and Regeneration’. Current Oral Health Reports, vol. 5(4):

pp. 295–303 (cit. on pp. 23,25).

109

Wang,Kuo-Chen,Thomas T. Egelhoff,Arnold I. Caplan,Jean F. Welter

and Harihara Baskaran (2018): ‘ROCK Inhibition Promotes the Development of

Chondrogenic Tissue by Improved Mass Transport’. Tissue Engineering Part A, vol.

24(15-16): pp. 1218–1227 (cit. on p. 88).

Wang,Xiu-Ping,Marika Suomalainen,Szabolcs Felszeghy,Laura C Zelarayan,

Maria T Alonso,Maksim V Plikus,Richard L Maas,Cheng-Ming Chuong,

Thomas Schimmang and Irma Thesleff (2007): ‘An integrated gene regulatory

network controls stem cell proliferation in teeth’. PLoS biology, vol. 5(6): e159 (cit. on

p. 19).

Wang,Xiu-Ping,Marika Suomalainen,Carolina J Jorgez,Martin M Matzuk,

Sabine Werner and Irma Thesleff (2004): ‘Follistatin regulates enamel patterning

in mouse incisors by asymmetrically inhibiting BMP signaling and ameloblast differenti-

ation’. Developmental cell, vol. 7(5): pp. 719–730 (cit. on p. 19).

Xu,Jian,Samy Lamouille and Rik Derynck (2009): ‘TGF-ß-induced epithelial to

mesenchymal transition’. Cell research, vol. 19(2): p. 156 (cit. on p. 89).

Yoshida,Mitsuyoshi and Yasumasa Akagawa (2011): ‘The relationship between tooth

loss and cerebral stroke’. Japanese Dental Science Review, vol. 47(2): pp. 157–160 (cit. on

p. 1).

Young,Conan S,Harutsugi Abukawa,Rose Asrican,Michael Ravens,Maria J

Troulis,Leonard B Kaban,Joseph P Vacanti and Pamela C Yelick (2005):

‘Tissue-engineered hybrid tooth and bone’. Tissue engineering, vol. 11(9-10): pp. 1599–

1610 (cit. on p. 24).

Zeisberg,Michael,Jun-ichi Hanai,Hikaru Sugimoto,Tadanori Mammoto,David

Charytan,Frank Strutz and Raghu Kalluri (2003): ‘BMP-7 counteracts TGF-ß1–

induced epithelial-to-mesenchymal transition and reverses chronic renal injury’. Nature

medicine, vol. 9(7): p. 964 (cit. on pp. 18,81,82,89).

Zhang,Siyuan,Patricia Buttler-Buecher,Bernd Denecke,Victor E Arana-

Chavez and Christian Apel (2018): ‘A comprehensive analysis of human dental pulp

cell spheroids in a three-dimensional pellet culture system’. Archives of oral biology, vol.

91: pp. 1–8 (cit. on p. 23).

Zhang,Weibo,B Vazquez,D Oreadi and PC Yelick (2017): ‘Decellularized tooth

bud scaffolds for tooth regeneration’. Journal of dental research, vol. 96(5): pp. 516–523

(cit. on p. 25).

Zhao,Hu,Jifan Feng,Kerstin Seidel,Songtao Shi,Ophir Klein,Paul Sharpe

and Yang Chai (2014): ‘Secretion of shh by a neurovascular bundle niche supports

mesenchymal stem cell homeostasis in the adult mouse incisor’. Cell stem cell, vol. 14(2):

pp. 160–173 (cit. on p. 20).

Zheng,Yunfei,Jinglei Cai,Andrew Paul Hutchins,Lingfei Jia,Pengfei Liu,

Dandan Yang,Shubin Chen,Lihong Ge,Duanqing Pei and Shicheng Wei (2016):

‘Remission for Loss of Odontogenic Potential in a New Micromilieu In Vitro’. PLOS

ONE, vol. 11(4): pp. 1–16 (cit. on p. 84).

Zhu,Yihong,Mikael Nilsson and Karin Sundfeldt (2010): ‘Phenotypic plasticity of

the ovarian surface epithelium: TGF-ß1 induction of epithelial to mesenchymal transition

(EMT) in vitro’. Endocrinology, vol. 151(11): pp. 5497–5505 (cit. on p. 81).

110 Bibliography

Zouvelou,Vasiliki,Hans-Ulrich Luder,Thimios A. Mitsiadis and Daniel Graf

(2009): ‘Deletion of BMP7 affects the development of bones, teeth, and other ectodermal

appendages of the orofacial complex’. Journal of Experimental Zoology Part B: Molecular

and Developmental Evolution, vol. 312B(4): pp. 361–374 (cit. on p. 81).

List of Figures

1.1 Tooth anatomy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

1.2 Schematic representation of odontoblasts . . . . . . . . . . . . . . . . . . . . 2

1.3 Histologic overview of pulp tissue . . . . . . . . . . . . . . . . . . . . . . . . 3

1.4 Capillary network in the pulp . . . . . . . . . . . . . . . . . . . . . . . . . . 4

1.5 Schematic of periodontium . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

1.6 Alveolar bone lining the tooth socket . . . . . . . . . . . . . . . . . . . . . . 6

1.8 Histologic image of the dental placode . . . . . . . . . . . . . . . . . . . . . 8

1.9 Bud-to-cap transition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

1.10 Odontogenic homeobox code . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

1.11 Histologic image of the dental bell stage . . . . . . . . . . . . . . . . . . . . 10

1.12 Histologic image of the cervical loop . . . . . . . . . . . . . . . . . . . . . . 11

1.13 Histologic images from human late bell stage . . . . . . . . . . . . . . . . . 12

1.14 Schematic illustration of enamel development . . . . . . . . . . . . . . . . . 13

1.15 Ultrastructural features of human enamel . . . . . . . . . . . . . . . . . . . 14

1.16 Section showing the region of mineralized dentin . . . . . . . . . . . . . . . 15

1.17 Schematic representation of tooth formation in the jaw . . . . . . . . . . . . 16

1.18 Regulation of tooth formation by reciprocal interactions . . . . . . . . . . . 17

1.19 Mechanochemical control of condensation . . . . . . . . . . . . . . . . . . . 23

1.20 Vision of autologous tooth regeneration . . . . . . . . . . . . . . . . . . . . 25

3.1 Histological overview of used pulp tissue . . . . . . . . . . . . . . . . . . . . 41

3.2 Isolation of DPCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42

3.3 CFSE profile of DPCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42

3.4 Surface Marker Expression . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43

3.5 Surface Marker Profile . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43

3.6 Gene expression profile of DPCs over passages . . . . . . . . . . . . . . . . . 44

3.7 Marker gene expression of adipogenic differentiation . . . . . . . . . . . . . 46

3.8 Oil Red O staining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46

3.9 Marker gene expression of osteogenic differentiation . . . . . . . . . . . . . . 47

3.10 Alizarin Red staining . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47

3.11 Marker gene expression of neurogenic differentiation . . . . . . . . . . . . . 48

3.12 Staining for NESTIN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

3.13 Time-lapse video of in vitro condensation . . . . . . . . . . . . . . . . . . . 50

3.14 Transcript levels of marker genes during in vitro condensation ........ 51

3.15 Gene expression of marker genes during early phase of condensation . . . . 53

3.16 Quality of the RNA Seq data . . . . . . . . . . . . . . . . . . . . . . . . . . 54

111

112 List of Figures

3.17 Heatmap of all expressed genes . . . . . . . . . . . . . . . . . . . . . . . . . 54

3.18 Heatmap of all differentially expressed genes . . . . . . . . . . . . . . . . . . 55

3.19 Clustered heatmap for KEGG – TGFß signaling pathway. . . . . . . . . . 56

3.20 KEGG – TGFß signaling pathway gene panel . . . . . . . . . . . . . . . . . 57

3.21 KEGG – TGFß signaling pathway map . . . . . . . . . . . . . . . . . . . . 58

3.22 Clustered heatmap for KEGG – MAPK signaling pathway . . . . . . . . . . 59

3.23 KEGG – MAPK signaling pathway map . . . . . . . . . . . . . . . . . . . . 59

3.24 Clustered heatmap for RHOA signaling molecules . . . . . . . . . . . . . . . 60

3.25 RHOA signaling pathway gene panel . . . . . . . . . . . . . . . . . . . . . . 61

3.26 Clustered heatmap for KEGG –WNT signaling pathway. . . . . . . . . . . 62

3.27 KEGG – WNT signaling pathway map . . . . . . . . . . . . . . . . . . . . . 63

3.28 Clustered heatmap for KEGG –NOTCH signaling pathway. . . . . . . . . . 64

3.29 KEGG – NOTCH signaling pathway map . . . . . . . . . . . . . . . . . . . 65

3.30 Live-imaging of collagen production . . . . . . . . . . . . . . . . . . . . . . 66

3.31 Reporter construct functionality test . . . . . . . . . . . . . . . . . . . . . . 68

3.32 Kinetik of condensation with constitutively eGFP-expressing DPCs (CMV

control vector) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69

3.33 Kinetic of condensation with MAPK-responsive eGFP-expressing DPCs . . 69

3.34

Graphs of fluorescence intensities of MAPK-reporter vector and control vector

3.35 Inhibition of condensation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71

3.36 Co-culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72

3.37 Co-culture of red and green labeled cells . . . . . . . . . . . . . . . . . . . . 73

3.38 Histology of 4-day condensates . . . . . . . . . . . . . . . . . . . . . . . . . 73

3.39 Histology of 4 day co-culture condensates . . . . . . . . . . . . . . . . . . . 74

3.40 Histology of 2 week co-culture condensates . . . . . . . . . . . . . . . . . . . 75

3.41 Histology of 4 week co-culture condensates . . . . . . . . . . . . . . . . . . . 76

3.42 Long-term culture of co-culture aggregates . . . . . . . . . . . . . . . . . . . 77

4.1 F-actin bridges in mesenchymal condensation . . . . . . . . . . . . . . . . . 85

4.2 Gingival cysts in an infants . . . . . . . . . . . . . . . . . . . . . . . . . . . 95

5.1 Comparison of DPCs with MSCs . . . . . . . . . . . . . . . . . . . . . . . . 115

5.2 FACS analysis of reporter . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116

5.3 Higher magnification of condensation with CytD administration . . . . . . . 117

5.4 Viability of condensated cells in inhibition experiment . . . . . . . . . . . . 118

5.5 Expression of cytokeratins in human skin . . . . . . . . . . . . . . . . . . . 118

5.6 Vector maps of reporter assay constructs . . . . . . . . . . . . . . . . . . . . 123

5.7 GSEA on the classical GO terms and hallmark gene panel . . . . . . . . . . 124

5.8 GSEA on specific pathway gene panels . . . . . . . . . . . . . . . . . . . . . 125

5.9 TGF-ß signaling agonists and antagonists . . . . . . . . . . . . . . . . . . . 126

5.10 KEGG – FGF signaling pathway gene panel . . . . . . . . . . . . . . . . . . 126

5.11 KEGG – MAPK signaling pathway gene panel . . . . . . . . . . . . . . . . 127

5.12 KEGG – WNT signaling pathway gene panel . . . . . . . . . . . . . . . . . 128

5.13 KEGG – NOTCH signaling pathway gene panel . . . . . . . . . . . . . . . . 129

List of Tables

2.1 Materials for cell culture applications . . . . . . . . . . . . . . . . . . . . . . 27

2.2 Materials for molecular biology applications . . . . . . . . . . . . . . . . . . . 28

2.3 Antibodies for immunhistochemistry . . . . . . . . . . . . . . . . . . . . . . . 34

2.4 Primer pairs used for qPCR . . . . . . . . . . . . . . . . . . . . . . . . . . . 37

5.1 Differentially expressed genes . . . . . . . . . . . . . . . . . . . . . . . . . . . 130

113

CHAPTER 5

Appendix A

5.1 Supplemental figures

Figure 5.1:

Comparison of MSC characteristics between bone marrow mesenchymal cells

(bmMSCs) and dental pulp cells (DPCs). (A) Expression profile of MSC surface markers

revealed that both cell population exhibited the same profile except for the expression of CD146,

the perivascular marker, which was higher in DPCs (N=4). (B) Representative images of

adipogenic and osteogenic differentiation of bmMSC (negative control in bottom right corner),

assessed by Oil Red O and Alizarin Red staining, respectively (N=4).

115

116 Chapter 5 Appendix A

Figure 5.2:

FACS analysis on reporter functionality. DPCs in monolayer were transduced

with the respective reporter constructs and stimulated with the denoted stimuli at two different

concentrations. Percentage of positive cells, as well as their geometric mean fluorescence of the

eGFP signal was measured.

5.1 Supplemental figures 117

Figure 5.3:

Microscopic analysis at higher magnifcation after 5 hours of condensation with

administration of Cytochalasin D at high concentration (2.5

M; middle) or low concentration

(0.25 µM; right) compared to control culture (left). Representative images, N=2

118 Chapter 5 Appendix A

Figure 5.4:

Viability analysis of cell after 24 hours of condensation. Depicted are the FSC-

A/SSC-A gate as well as the 7-AAD (PerCP-Vio700-A) gate to measure viabiltiy. Viable cells

do not take up the 7-AAD label and appear negative in the FACS plot. In this experiment,

cells were treated with three different small molecular inhibitors (Cytochalasin D, LY294002,

PTX), no inhibitor as control or with ethanol directly before FACS measurement to show

functionality of the 7-AAD dye. Representative plots, N=2

Figure 5.5:

Human skin biopses were immunohistologically stained for CK8/18, CK19, CK15

and CK14. Blue colour represents DAPI nuclear counterstaining. These pictures were kindly

provided by Anna-Klara Amler

5.1 Supplemental figures 119

120 Chapter 5 Appendix A

5.1 Supplemental figures 121

122 Chapter 5 Appendix A

5.1 Supplemental figures 123

Figure 5.6: Vector maps of reporter assay constructs

124 Chapter 5 Appendix A

Figure 5.7:

Differentially expressed genes were analyzed by Gene Set enrichment analysis.

The top 20 over-represented gene ontology (GO) terms for each top level term as well as for

the hall mark gene set is depicted. The diagrams plot the total number of genes overlapping

in the differentially expressed genes and the ontology list (upper x-axis, # genes, black bars).

Furthermore, the percentage of overlap (related to the group size to the GO term) is shown

(lower x-axis, red dots) is depicted.

5.1 Supplemental figures 125

Figure 5.8:

Differentially expressed genes were analyzed by Gene Set enrichment analysis. The

top 20 over-represented pathway terms acoording to KEGG, Reactome, Biocarta or canonical

pathway gene panel is depicted. The diagrams plot the total number of genes overlapping

in the differentially expressed genes and the gene panel (upper x-axis, # genes, black bars).

Furthermore, the percentage of overlap (related to the respective group size) is shown (lower

x-axis, red dots) is depicted.

126 Chapter 5 Appendix A

Figure 5.9:

TGF-ß signaling agonists and antagonists. RPM values of inhibiting and

supporting molecules of the TGF-ß signal transduction pathway are depicted. The gene set

is reduced to genes with at least moderate gene expression level in the DPC condensation

samples and the by genes with an at least two fold difference in the RPM values of both

samples. Dashed line marks the level of highly expressed genes (RPM>100); dotted line marks

the level of moderately expressed genes (RPM>5). Statistical significance was calculated from

DESEQ2 analysis: *** - P < 0.001; ** - P < 0.01; * - P < 0.05.

Figure 5.10:

RPM values of key molecules of FGF signal transduction pathway are depicted.

Gene set was reduced to lignads, receptors and adaptor molecules that elicit multiple signaling

pathways . . Dashed line marks the level of highly expressed genes (RPM>100); dotted line

marks the level of moderately expressed genes (RPM>5). Statistical significance was calculated

from DESEQ2 analysis: *** - P < 0.001; ** - P < 0.01; * - P < 0.05.

5.1 Supplemental figures 127

Figure 5.11:

RPM values of MAPK signal transduction pathway-associated genes are depicted.

The KEGG gene subset comprises 267 genes. The diagram is reduced to genes with at least

moderate gene expression level in the DPC condensation samples and/or genes with an at

least two-fold difference in the RPM values of both samples, resulting in 166 genes. Dashed

line marks the level of highly expressed genes (RPM>100); dotted line marks the level of

moderately expressed genes (RPM>5). Statistical significance was calculated from DESEQ2

analysis: *** - P < 0.001; ** - P < 0.01; * - P < 0.05.

128 Chapter 5 Appendix A

Figure 5.12:

RPM values of WNT signal transduction pathway-associated genes are depicted.

The KEGG gene subset comprises 151 genes. The diagram is reduced to genes with at least

moderate gene expression level in the DPC condensation samples and/or genes with an at

least two-fold difference in the RPM values of both samples, resulting in 100 genes. Dashed

line marks the level of highly expressed genes (RPM>100); dotted line marks the level of

moderately expressed genes (RPM>5). Statistical significance was calculated from DESEQ2

analysis: *** - P < 0.001; ** - P < 0.01; * - P < 0.05.

5.1 Supplemental figures 129

Figure 5.13:

RPM values of NOTCH signal transduction pathway-associated genes are

depicted. The diagram is reduced to genes with at least moderate gene expression level in

the DPC condensation samples and/or genes with an at least two-fold difference in the RPM

values of both samples. Dashed line marks the level of highly expressed genes (RPM>100);

dotted line marks the level of moderately expressed genes (RPM>5). Statistical significance

was calculated from DESEQ2 analysis: *** - P < 0.001; ** - P < 0.01; * - P < 0.05.

130 Chapter 5 Appendix A

5.2 Supplemental videos

Supplemental videos are available on the attached CD-ROM.

Z28P4_30h_low:

Video of ultra-low attachment condensation of DPCs (time-lapse of 30 hours)

CNA_15h:

Condensing DPCs with CNA-eGFP administered to the medium (time-lapse of 15 hours)

pll3.7_Z38P4_16h:

Condensing DPCs transduced with pLL3.7 (time-lapse of 16 hours)

WNT_Z38P7_24h:

Condensing DPCs transduced with pLL3.7-WNT-RE (time-lapse of 24 hours)

TGF_Z38P6_22h:

Condensing DPCs transduced with pLL3.7-TGFß-RE (time-lapse of 22 hours)

MAPK_Z38P6_24h:

Condensing DPCs transduced with pLL3.7-MAPK-RE (time-lapse of 24 hours)

5.3 List of differentially expressed genes

Table 5.1:

Differentially expressed genes between human DPCs in monolayer (ML) or six

hours in condensation (6h) according to DESeq2 algorithm (

|𝐹 𝐶| ≥

5, nominal P value<

0.05). Two biological replicates were performed. Upregulated genes are highlighted in red and

downregulated in blue.

Reads per Million (RPM)

GeneID Gene Symbol ZZ29ML ZZ29 6h ZZ31ML ZZ31 6h log2FC Pvalue adj.Pvalue

7043 TGFB3 12.578 397.953 0.000 330.028 3.891 9.00E-17 3.08E-13

2847 MCHR1 0.000 80.365 0.000 69.663 3.354 1.46E-11 3.00E-08

1909 EDNRA 4.193 110.381 0.000 82.725 3.241 2.41E-11 4.13E-08

50509 COL5A3 129.977 1572.446 97.270 1565.674 3.184 1.03E-17 5.28E-14

4071 TM4SF1 28.301 506.397 38.709 459.775 3.183 2.12E-16 5.45E-13

10221 TRIB1 2.096 71.651 5.955 102.753 2.909 1.32E-09 1.69E-06

57801 HES4 2.096 50.349 2.978 82.725 2.836 9.45E-09 9.71E-06

54498 SMOX 102.723 1222.906 45.657 560.787 2.670 2.56E-09 2.92E-06

4773 NFATC2 2.096 54.222 0.000 40.927 2.647 1.94E-07 9.80E-05

3400 ID4 29.350 336.953 34.739 235.112 2.541 4.71E-10 6.92E-07

3696 ITGB8 9.434 63.905 7.940 146.292 2.480 1.37E-07 7.80E-05

84632 AFAP1L2 8.386 87.143 9.925 103.624 2.462 5.59E-08 4.10E-05

4741 NEFM 11.530 152.016 3.970 62.697 2.453 5.48E-07 2.45E-04

3720 JARID2 18.868 151.048 13.896 141.938 2.427 1.69E-08 1.45E-05

57561 ARRDC3 16.771 172.349 34.739 271.685 2.417 1.46E-08 1.36E-05

8877 SPHK1 44.024 444.429 27.791 203.764 2.393 6.83E-08 4.68E-05

112399 EGLN3 0.000 20.333 1.985 69.663 2.374 4.66E-06 1.84E-03

5139 PDE3A 2.096 61.000 0.000 21.770 2.313 8.23E-06 2.68E-03

84959 UBASH3B 15.723 134.587 14.888 108.848 2.273 2.00E-07 9.80E-05

51129 ANGPTL4 46.121 509.302 8.933 148.034 2.240 7.20E-06 2.55E-03

6542 SLC7A2 10.482 45.508 11.911 191.573 2.211 6.05E-06 2.22E-03

5.3 List of differentially expressed genes 131

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

56895 AGPAT4 25.157 119.095 12.903 168.933 2.174 9.14E-07 3.91E-04

340075 ARSI 0.000 48.413 3.970 29.607 2.164 2.49E-05 6.40E-03

57471 ERMN 2.096 26.143 0.000 37.444 2.162 3.01E-05 7.53E-03

6303 SAT1 71.277 344.699 68.486 502.444 2.144 2.19E-08 1.73E-05

100499467 LINC00673 8.386 82.302 18.858 122.781 2.127 3.06E-06 1.26E-03

84935 MEDAG 2.096 118.127 0.000 6.966 2.119 5.23E-05 1.12E-02

2247 FGF2 85.952 574.175 87.344 402.303 2.063 1.06E-07 6.71E-05

8835 SOCS2 31.446 168.476 10.918 136.713 2.053 7.52E-06 2.58E-03

9077 DIRAS3 17.819 114.254 1.985 80.983 2.040 4.43E-05 9.90E-03

23551 RASD2 0.000 6.778 1.985 94.916 2.039 9.95E-05 1.89E-02

26207 PITPNC1 63.940 316.619 58.560 350.927 2.025 1.11E-07 6.71E-05

9945 GFPT2 13.627 138.460 22.829 90.562 1.991 8.55E-06 2.68E-03

196740 VSTM4 67.085 367.937 33.747 233.371 1.969 5.71E-06 2.17E-03

643837 LINC01128 12.578 61.000 11.911 100.140 1.951 2.20E-05 5.81E-03

55326 AGPAT5 6.289 34.857 10.918 104.494 1.941 8.12E-05 1.66E-02

3754 KCNF1 4.193 29.048 3.970 47.022 1.910 1.58E-04 2.80E-02

84627 ZNF469 54.506 272.080 25.806 177.640 1.871 2.20E-05 5.81E-03

6615 SNAI1 10.482 66.810 8.933 54.860 1.845 9.32E-05 1.84E-02

392617 ELFN1 11.530 104.572 3.970 29.607 1.845 2.87E-04 4.46E-02

26508 HEYL 0.000 14.524 0.000 28.736 1.819 5.17E-04 6.72E-02

5376 PMP22 25.157 170.413 27.791 97.528 1.787 4.66E-05 1.02E-02

25861 WHRN 19.916 95.857 4.963 67.051 1.779 2.68E-04 4.38E-02

29923 HILPDA 7.337 52.286 10.918 55.730 1.768 2.06E-04 3.41E-02

1407 CRY1 6.289 48.413 7.940 41.798 1.755 3.30E-04 4.91E-02

3280 HES1 4.193 50.349 1.985 15.674 1.749 7.83E-04 9.46E-02

19 ABCA1 50.314 196.556 49.627 236.854 1.724 1.12E-05 3.19E-03

79870 BAALC 30.398 158.794 53.598 207.247 1.695 3.92E-05 9.15E-03

353500 BMP8A 2.096 21.302 4.963 38.315 1.688 1.07E-03 1.17E-01

10171 RCL1 6.289 16.460 2.978 64.438 1.684 1.12E-03 1.20E-01

83716 CRISPLD2 46.121 296.286 13.896 72.275 1.663 8.54E-04 9.74E-02

26353 HSPB8 2.096 12.587 3.970 47.893 1.653 1.54E-03 1.52E-01

50700 RDH8 0.000 17.429 0.000 17.416 1.636 1.78E-03 1.66E-01

3624 INHBA 51.362 234.318 25.806 123.652 1.632 3.06E-04 4.69E-02

220323 OAF 111.109 293.381 51.613 419.719 1.630 1.26E-04 2.27E-02

54541 DDIT4 201.254 888.858 72.456 409.270 1.621 4.27E-04 5.93E-02

182 JAG1 34.591 100.698 9.925 120.169 1.593 7.37E-04 9.12E-02

3554 IL1R1 274.628 1098.001 386.102 1311.405 1.592 8.87E-06 2.68E-03

5054 SERPINE1 801.872 2897.987 704.710 2586.236 1.583 9.80E-06 2.88E-03

9419 CRIPT 0.000 19.365 1.985 17.416 1.577 2.61E-03 2.12E-01

169792 GLIS3 50.314 175.254 8.933 137.584 1.574 1.25E-03 1.31E-01

3638 INSIG1 17.819 139.429 17.866 40.056 1.571 1.28E-03 1.33E-01

132 Chapter 5 Appendix A

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

387763 C11ORF96 76.518 235.286 54.590 269.073 1.564 8.26E-05 1.66E-02

1942 EFNA1 0.000 7.746 1.985 35.702 1.559 2.89E-03 2.23E-01

145581 LRFN5 0.000 7.746 1.985 35.702 1.559 2.89E-03 2.23E-01

6932 TCF7 37.735 93.921 30.769 194.185 1.558 3.58E-04 5.18E-02

8553 BHLHE40 57.651 301.127 63.523 168.933 1.555 1.97E-04 3.33E-02

166647 adgra3 50.314 161.699 48.635 215.084 1.553 9.85E-05 1.89E-02

1846 DUSP4 9.434 68.746 3.970 19.157 1.540 2.78E-03 2.22E-01

284018 C17orf58 5.241 38.730 9.925 40.056 1.539 1.84E-03 1.66E-01

4216 MAP3K4 31.446 125.873 23.821 96.657 1.536 4.03E-04 5.75E-02

3775 KCNK1 5.241 25.175 3.970 32.219 1.526 2.83E-03 2.22E-01

2012 EMP1 462.255 2153.399 515.133 1311.405 1.523 7.24E-05 1.52E-02

7223 TRPC4 0.000 21.302 5.955 30.478 1.514 3.62E-03 2.62E-01

7779 SLC30A1 44.024 164.603 27.791 118.427 1.513 4.74E-04 6.40E-02

5163 PDK1 18.868 53.254 24.814 134.972 1.503 1.16E-03 1.23E-01

8013 NR4A3 13.627 74.556 1.985 26.994 1.498 3.73E-03 2.64E-01

83786 FRMD8 68.133 337.921 64.516 162.837 1.496 4.82E-04 6.40E-02

26035 GLCE 19.916 61.000 38.709 195.927 1.495 1.49E-03 1.49E-01

7378 UPP1 11.530 62.937 3.970 25.253 1.483 3.61E-03 2.62E-01

9052 GPRC5A 0.000 11.619 0.000 19.157 1.483 4.48E-03 2.90E-01

114088 TRIM9 0.000 13.556 0.000 16.545 1.479 4.60E-03 2.95E-01

136 ADORA2B 3.145 16.460 0.000 21.770 1.464 5.19E-03 3.15E-01

467 ATF3 9.434 45.508 3.970 26.994 1.460 4.01E-03 2.75E-01

56937 PMEPA1 49.265 218.826 69.478 187.219 1.448 2.77E-04 4.44E-02

6424 SFRP4 11.530 50.349 15.881 60.955 1.440 2.00E-03 1.76E-01

5142 PDE4B 35.639 107.476 9.925 87.949 1.427 2.82E-03 2.22E-01

10184 LHFPL2 47.169 152.016 68.486 244.691 1.420 4.86E-04 6.40E-02

6383 SDC2 138.362 312.746 167.741 761.067 1.419 5.99E-04 7.65E-02

85463 ZC3H12C 28.301 105.540 17.866 70.534 1.414 1.85E-03 1.66E-01

10579 TACC2 13.627 61.000 7.940 34.831 1.413 3.99E-03 2.75E-01

54852 PAQR5 10.482 38.730 22.829 102.753 1.410 3.50E-03 2.59E-01

23313 KIAA0930 109.013 259.492 77.419 366.601 1.399 4.12E-04 5.79E-02

6095 RORA 24.109 90.048 19.851 70.534 1.394 1.78E-03 1.66E-01

10560 SLC19A2 2.096 16.460 2.978 20.899 1.392 7.80E-03 4.20E-01

29116 MYLIP 8.386 46.476 17.866 57.472 1.379 3.79E-03 2.67E-01

94031 HTRA3 95.386 194.619 98.262 470.225 1.376 1.04E-03 1.16E-01

23401 FRAT2 3.145 28.079 0.000 9.579 1.369 8.91E-03 4.53E-01

23413 NCS1 85.952 295.318 110.173 313.483 1.364 2.85E-04 4.46E-02

4291 MLF1 0.000 21.302 5.955 22.640 1.351 9.69E-03 4.76E-01

7803 PTP4A1 55.555 195.587 61.538 174.157 1.351 6.29E-04 7.88E-02

23254 KAZN 16.771 40.667 10.918 67.921 1.346 4.71E-03 2.97E-01

6446 SGK1 36.687 133.619 23.821 79.242 1.345 2.77E-03 2.22E-01

5.3 List of differentially expressed genes 133

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

406 ARNTL 4.193 39.698 9.925 25.253 1.344 8.06E-03 4.27E-01

80018 NAA25 4.193 43.571 16.873 43.539 1.323 7.87E-03 4.21E-01

2903 GRIN2A 0.000 24.206 0.000 5.225 1.323 1.04E-02 4.93E-01

687 KLF9 41.928 115.222 26.799 111.461 1.314 2.27E-03 1.93E-01

9586 CREB5 4.193 22.270 1.985 16.545 1.312 1.21E-02 5.31E-01

10570 DPYSL4 16.771 50.349 27.791 106.236 1.301 4.83E-03 2.99E-01

23704 KCNE4 6.289 57.127 0.000 5.225 1.300 1.28E-02 5.39E-01

2114 ETS2 41.928 143.302 6.948 67.051 1.299 9.76E-03 4.77E-01

153478 PLEKHG4B 0.000 22.270 7.940 26.994 1.298 1.28E-02 5.39E-01

51312 SLC25A37 81.759 241.095 45.657 168.933 1.295 2.46E-03 2.07E-01

55 ACPP 2.096 13.556 0.000 14.803 1.293 1.33E-02 5.49E-01

92104 TTC30A 2.096 13.556 5.955 32.219 1.288 1.36E-02 5.59E-01

7090 TLE3 26.205 99.730 42.680 114.944 1.280 2.58E-03 2.12E-01

57464 STRIP2 4.193 21.302 3.970 20.899 1.278 1.38E-02 5.64E-01

89797 NAV2 14.675 85.206 46.650 120.169 1.277 5.51E-03 3.26E-01

11138 TBC1D8 40.880 117.159 15.881 80.983 1.271 6.41E-03 3.62E-01

10808 HSPH1 81.759 288.540 76.426 184.607 1.270 1.79E-03 1.66E-01

85450 ITPRIP 88.049 336.953 67.493 152.388 1.267 3.70E-03 2.64E-01

6591 SNAI2 67.085 154.921 63.523 236.854 1.265 1.56E-03 1.52E-01

23462 HEY1 0.000 5.810 0.000 20.899 1.260 1.45E-02 5.73E-01

64131 XYLT1 95.386 297.254 112.158 290.843 1.253 8.47E-04 9.74E-02

84870 RSPO3 2.096 30.984 0.000 3.483 1.246 1.58E-02 6.00E-01

5159 PDGFRB 569.172 1950.065 515.133 1146.826 1.245 1.43E-03 1.45E-01

10758 TRAF3IP2 25.157 94.889 9.925 37.444 1.239 1.22E-02 5.33E-01

51010 EXOSC3 6.289 21.302 0.000 20.899 1.237 1.81E-02 6.44E-01

7042 TGFB2 100.627 308.873 109.180 278.652 1.235 1.08E-03 1.17E-01

4783 NFIL3 37.735 104.572 11.911 70.534 1.234 9.95E-03 4.84E-01

1956 EGFR 78.615 245.937 45.657 138.455 1.233 4.88E-03 3.00E-01

24145 PANX1 124.736 377.619 101.240 269.944 1.232 1.86E-03 1.66E-01

10397 NDRG1 198.109 595.477 121.091 350.927 1.228 3.33E-03 2.51E-01

2774 GNAL 2.096 5.810 0.000 24.382 1.226 1.82E-02 6.44E-01

23186 RCOR1 25.157 62.937 27.791 101.882 1.225 5.49E-03 3.26E-01

3717 JAK2 8.386 40.667 23.821 71.405 1.224 1.13E-02 5.17E-01

2300 FOXL1 6.289 24.206 5.955 26.994 1.221 1.66E-02 6.13E-01

6515 SLC2A3 25.157 119.095 44.665 89.691 1.221 5.06E-03 3.09E-01

57214 CEMIP 271.483 908.223 98.262 324.803 1.219 9.64E-03 4.76E-01

84803 GPAT3 0.000 14.524 0.000 8.708 1.218 1.82E-02 6.44E-01

55647 RAB20 0.000 13.556 1.985 12.191 1.218 1.94E-02 6.63E-01

1832 DSP 3.145 25.175 11.911 36.573 1.214 1.75E-02 6.28E-01

64651 CSRNP1 12.578 65.841 18.858 38.315 1.207 1.14E-02 5.19E-01

25799 ZNF324 4.193 19.365 0.993 13.933 1.204 2.15E-02 7.03E-01

134 Chapter 5 Appendix A

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

23446 SLC44A1 123.687 259.492 116.128 411.882 1.203 1.86E-03 1.66E-01

114880 OSBPL6 2.096 22.270 7.940 23.511 1.198 2.10E-02 6.96E-01

85027 SMIM3 34.591 138.460 44.665 91.433 1.197 5.23E-03 3.16E-01

55893 ZNF395 85.952 177.191 101.240 357.893 1.194 3.40E-03 2.53E-01

6533 SLC6A6 107.964 329.207 47.642 155.000 1.189 9.19E-03 4.61E-01

3570 IL6R 11.530 53.254 2.978 14.803 1.188 2.24E-02 7.06E-01

23433 RHOQ 37.735 141.365 61.538 136.713 1.188 3.91E-03 2.73E-01

4163 MCC 49.265 129.746 38.709 121.910 1.188 4.25E-03 2.82E-01

57509 MTUS1 0.000 12.587 0.000 9.579 1.185 2.14E-02 NA

9700 ESPL1 12.578 36.794 10.918 42.669 1.184 1.42E-02 5.70E-01

7539 ZFP37 2.096 13.556 1.985 13.933 1.179 2.41E-02 7.43E-01

6197 RPS6KA3 51.362 142.333 87.344 246.433 1.171 4.77E-03 2.97E-01

864 RUNX3 56.603 169.445 48.635 124.522 1.170 4.77E-03 2.97E-01

201501 ZBTB7C 0.000 15.492 0.000 6.966 1.169 2.28E-02 NA

57596 BEGAIN 0.000 10.651 1.985 13.933 1.168 2.46E-02 7.44E-01

481 ATP1B1 8.386 23.238 8.933 39.185 1.154 2.11E-02 6.96E-01

2043 EPHA4 10.482 29.048 25.806 95.787 1.154 1.95E-02 6.64E-01

8609 KLF7 2.096 23.238 8.933 23.511 1.151 2.66E-02 7.80E-01

9695 EDEM1 63.940 124.905 66.501 236.854 1.147 5.53E-03 3.26E-01

285958 SNHG15 0.000 11.619 0.000 9.579 1.146 2.56E-02 NA

80853 KDM7A 4.193 23.238 11.911 36.573 1.143 2.46E-02 7.44E-01

8531 YBX3 94.338 263.365 101.240 246.433 1.143 2.59E-03 2.12E-01

9394 HS6ST1 104.820 287.572 61.538 177.640 1.140 7.68E-03 4.15E-01

6376 CX3CL1 2.096 29.048 1.985 3.483 1.139 2.77E-02 7.93E-01

9261 MAPKAPK2 187.627 461.858 159.800 438.006 1.138 2.24E-03 1.92E-01

9781 RNF144A 14.675 68.746 62.531 175.899 1.134 1.92E-02 6.63E-01

114299 PALM2 2.096 16.460 3.970 14.803 1.128 3.13E-02 8.38E-01

196527 ANO6 76.518 267.238 129.031 261.236 1.122 4.10E-03 2.76E-01

57132 CHMP1B 169.808 457.016 74.441 242.079 1.121 1.21E-02 5.31E-01

55818 KDM3A 18.868 72.619 52.605 134.101 1.116 1.53E-02 5.89E-01

55197 RPRD1A 19.916 52.286 14.888 51.376 1.116 1.65E-02 6.10E-01

285203 EOGT 29.350 49.381 28.784 121.910 1.112 1.53E-02 5.89E-01

221830 TWISTNB 20.964 62.937 22.829 60.955 1.111 1.33E-02 5.49E-01

171546 SPTSSA 39.832 86.175 29.776 105.365 1.111 9.62E-03 4.76E-01

160760 PPTC7 28.301 122.000 41.687 70.534 1.109 1.26E-02 5.39E-01

6792 CDKL5 0.000 4.841 0.993 17.416 1.105 3.02E-02 NA

283209 PGM2L1 14.675 26.143 11.911 59.213 1.093 2.58E-02 7.65E-01

81792 ADAMTS12 8.386 38.730 13.896 31.348 1.092 2.63E-02 7.74E-01

10123 ARL4C 81.759 297.254 22.829 59.213 1.092 3.06E-02 8.28E-01

54910 SEMA4C 63.940 239.159 57.568 94.045 1.091 1.52E-02 5.89E-01

6659 SOX4 100.627 209.143 231.264 736.685 1.091 1.75E-02 6.28E-01

5.3 List of differentially expressed genes 135

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

51582 AZIN1 134.169 372.778 226.301 529.438 1.090 4.69E-03 2.97E-01

6482 ST3GAL1 88.049 254.651 72.456 161.096 1.088 8.38E-03 4.35E-01

3589 IL11 33.542 476.381 13.896 60.955 1.086 3.05E-02 8.28E-01

8808 IL1RL2 0.000 9.683 3.970 19.157 1.086 3.78E-02 9.18E-01

56925 LXN 12.578 23.238 26.799 107.978 1.085 3.03E-02 8.28E-01

84365 NIFK 2.096 28.079 10.918 21.770 1.085 3.65E-02 9.10E-01

157506 RDH10 109.013 289.508 295.780 829.860 1.080 1.71E-02 6.26E-01

10788 IQGAP2 0.000 6.778 1.985 16.545 1.079 3.66E-02 9.10E-01

50640 PNPLA8 16.771 62.937 24.814 52.247 1.076 1.88E-02 6.56E-01

83641 FAM107B 41.928 161.699 63.523 108.848 1.074 1.10E-02 5.09E-01

3566 IL4R 102.723 259.492 44.665 148.034 1.073 1.72E-02 6.27E-01

4007 PRICKLE3 5.241 24.206 4.963 15.674 1.071 3.93E-02 9.33E-01

57181 SLC39A10 2.096 19.365 13.896 40.927 1.068 3.93E-02 9.33E-01

1195 CLK1 20.964 67.778 40.695 97.528 1.067 1.65E-02 6.10E-01

2150 F2RL1 4.193 23.238 35.732 125.393 1.059 4.11E-02 9.45E-01

90627 STARD13 73.374 196.556 104.218 237.725 1.057 6.35E-03 3.62E-01

2013 EMP2 59.747 130.714 63.523 177.640 1.057 8.15E-03 4.27E-01

79656 BEND5 0.000 5.810 1.985 17.416 1.056 4.02E-02 9.38E-01

3755 KCNG1 14.675 39.698 21.836 62.697 1.051 2.47E-02 7.46E-01

57647 DHX37 30.398 69.714 18.858 64.438 1.048 2.10E-02 6.96E-01

93145 OLFM2 57.651 97.794 18.858 120.169 1.047 2.45E-02 7.44E-01

7074 TIAM1 4.193 16.460 13.896 47.022 1.044 4.25E-02 9.52E-01

121642 ALKBH2 4.193 11.619 1.985 18.287 1.043 4.66E-02 1.00E+00

5641 LGMN 30.398 61.968 25.806 86.208 1.040 1.84E-02 6.51E-01

6781 STC1 270.435 1834.843 38.709 792.416 1.039 4.08E-02 9.43E-01

10194 TSHZ1 24.109 89.079 28.784 51.376 1.039 2.27E-02 7.09E-01

116987 AGAP1 63.940 161.699 47.642 119.298 1.038 1.33E-02 5.49E-01

100133941 CD24 4.193 1.937 8.933 69.663 1.037 4.70E-02 1.00E+00

10435 CDC42EP2 12.578 51.318 1.985 11.320 1.036 4.78E-02 1.00E+00

6018 RLF 12.578 27.111 13.896 51.376 1.036 3.34E-02 8.66E-01

254170 FBXO33 15.723 48.413 12.903 33.961 1.036 3.16E-02 8.42E-01

30811 HUNK 6.289 37.762 9.925 16.545 1.035 4.34E-02 9.65E-01

55422 ZNF331 13.627 44.540 12.903 32.219 1.034 3.27E-02 8.58E-01

81831 NETO2 13.627 11.619 11.911 80.112 1.033 4.50E-02 9.85E-01

54793 KCTD9 36.687 129.746 54.590 96.657 1.030 1.50E-02 5.86E-01

56180 MOSPD1 2.096 8.714 3.970 20.899 1.028 4.95E-02 1.00E+00

23268 DNMBP 41.928 122.000 31.762 68.792 1.022 2.23E-02 7.06E-01

6461 SHB 44.024 101.667 33.747 94.045 1.022 1.65E-02 6.10E-01

3269 HRH1 14.675 34.857 3.970 27.865 1.021 4.56E-02 9.93E-01

153443 SRFBP1 2.096 13.556 0.000 7.837 1.020 4.77E-02 NA

3099 HK2 63.940 225.603 68.486 105.365 1.020 1.91E-02 6.63E-01

136 Chapter 5 Appendix A

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

164284 APCDD1L 56.603 112.318 15.881 93.174 1.018 3.23E-02 8.50E-01

10116 FEM1B 51.362 108.445 58.560 160.225 1.017 1.27E-02 5.39E-01

83930 STARD3NL 20.964 64.873 31.762 69.663 1.015 2.23E-02 7.06E-01

5128 CDK17 16.771 65.841 30.769 57.472 1.014 2.63E-02 7.74E-01

10746 MAP3K2 26.205 59.064 24.814 72.275 1.013 2.25E-02 7.06E-01

665 BNIP3L 150.941 395.048 241.189 518.118 1.012 7.42E-03 4.04E-01

8819 SAP30 9.434 38.730 15.881 33.090 1.009 3.86E-02 9.28E-01

2034 EPAS1 420.327 1016.668 188.584 534.663 1.007 2.20E-02 7.06E-01

57597 BAHCC1 98.531 267.238 108.188 215.955 1.007 9.07E-03 4.57E-01

8497 PPFIA4 12.578 17.429 12.903 62.697 1.007 4.56E-02 9.93E-01

22856 CHSY1 66.036 188.810 85.359 167.191 1.006 1.06E-02 4.98E-01

23132 RAD54L2 16.771 67.778 30.769 54.860 1.005 2.81E-02 7.95E-01

79720 VPS37B 44.024 116.191 48.635 106.236 0.999 1.53E-02 5.89E-01

5045 FURIN 227.459 445.397 167.741 479.803 0.999 8.28E-03 4.32E-01

1130 LYST 17.819 60.032 31.762 66.180 0.998 2.71E-02 7.84E-01

4088 SMAD3 146.748 389.238 180.644 357.893 0.998 6.96E-03 3.86E-01

254531 LPCAT4 16.771 45.508 32.754 84.466 0.995 3.21E-02 8.46E-01

6566 SLC16A1 47.169 104.572 45.657 117.556 0.989 1.61E-02 6.04E-01

23235 SIK2 68.133 127.810 42.680 142.809 0.989 1.85E-02 6.51E-01

64764 CREB3L2 97.482 329.207 145.905 231.629 0.988 1.28E-02 5.39E-01

9587 MAD2L1BP 22.012 35.825 6.948 50.506 0.986 4.72E-02 1.00E+00

23387 SIK3 40.880 128.778 52.605 94.045 0.985 1.93E-02 6.63E-01

7422 VEGFA 759.944 1595.684 474.438 1289.635 0.985 1.16E-02 5.20E-01

59277 NTN4 29.350 76.492 26.799 62.697 0.980 2.69E-02 7.84E-01

55790 CSGALNACT1 100.627 260.461 61.538 136.713 0.977 2.54E-02 7.59E-01

50999 TMED5 42.976 122.000 43.672 85.337 0.977 2.18E-02 7.06E-01

4854 NOTCH3 128.928 297.254 132.009 293.455 0.977 8.79E-03 4.52E-01

23516 SLC39A14 263.098 602.254 105.210 325.674 0.975 2.97E-02 8.28E-01

6513 SLC2A1 214.881 674.874 335.482 552.079 0.971 9.98E-03 4.84E-01

25963 TMEM87A 60.795 129.746 55.583 141.067 0.968 1.60E-02 6.04E-01

6535 SLC6A8 30.398 42.603 24.814 101.011 0.964 3.77E-02 9.18E-01

3732 CD82 190.772 382.461 122.084 339.607 0.960 1.54E-02 5.89E-01

63893 UBE2O 45.073 111.349 44.665 98.399 0.960 2.10E-02 6.96E-01

29969 MDFIC 87.000 128.778 51.613 206.376 0.959 2.39E-02 7.39E-01

51186 TCEAL9 68.133 183.968 95.285 183.736 0.956 1.44E-02 5.73E-01

8728 ADAM19 26.205 91.984 81.389 172.416 0.951 3.80E-02 9.20E-01

23336 SYNM 24.109 45.508 38.709 113.202 0.950 4.00E-02 9.38E-01

121260 SLC15A4 36.687 90.048 33.747 74.017 0.931 3.12E-02 8.38E-01

286343 LURAP1L 35.639 68.746 19.851 67.051 0.928 4.15E-02 9.45E-01

5069 PAPPA 114.254 184.937 29.776 181.124 0.919 4.98E-02 1.00E+00

7461 CLIP2 123.687 326.302 205.458 383.146 0.917 1.62E-02 6.06E-01

5.3 List of differentially expressed genes 137

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

256987 SERINC5 52.410 87.143 85.359 238.596 0.914 4.03E-02 9.38E-01

90 ACVR1 81.759 160.730 79.404 192.444 0.912 1.92E-02 6.63E-01

131578 LRRC15 81.759 134.587 77.419 221.180 0.911 2.38E-02 7.38E-01

7040 TGFB1 343.809 583.858 264.018 735.815 0.910 1.46E-02 5.73E-01

490 ATP2B1 47.169 119.095 34.739 70.534 0.904 4.17E-02 9.45E-01

483 ATP1B3 83.856 172.349 76.426 175.899 0.902 2.11E-02 6.96E-01

9188 DDX21 71.277 186.873 108.188 196.798 0.896 2.22E-02 7.06E-01

7035 TFPI 83.856 144.270 41.687 141.938 0.887 4.01E-02 9.38E-01

3572 IL6ST 626.823 883.048 482.379 1507.332 0.881 2.19E-02 7.06E-01

5209 PFKFB3 163.519 416.350 140.942 236.854 0.878 3.12E-02 8.38E-01

10867 TSPAN9 148.844 290.476 156.823 346.573 0.875 1.79E-02 6.40E-01

10458 BAIAP2 37.735 68.746 30.769 84.466 0.871 4.48E-02 9.83E-01

23710 GABARAPL1 87.000 190.746 78.411 156.742 0.859 3.06E-02 8.28E-01

205 AK4 28.301 66.810 38.709 79.242 0.855 4.87E-02 1.00E+00

4814 NINJ1 199.158 453.143 150.867 281.264 0.851 3.54E-02 8.99E-01

84255 SLC37A3 32.494 77.460 41.687 81.854 0.850 4.65E-02 1.00E+00

60485 SAV1 54.506 121.032 51.613 101.882 0.841 4.18E-02 9.45E-01

23541 SEC14L2 38.783 75.524 36.724 86.208 0.839 4.90E-02 1.00E+00

57403 RAB22A 34.591 97.794 50.620 81.854 0.837 4.96E-02 1.00E+00

55603 FAM46A 75.470 148.143 103.225 219.438 0.833 3.54E-02 8.99E-01

9689 BZW1 105.868 156.857 101.240 275.169 0.831 3.79E-02 9.18E-01

5467 PPARD 66.036 141.365 73.449 143.680 0.830 3.58E-02 8.99E-01

9804 TOMM20 67.085 143.302 88.337 170.674 0.819 3.74E-02 9.18E-01

54477 PLEKHA5 66.036 113.286 71.464 168.933 0.816 4.29E-02 9.57E-01

23481 PES1 58.699 127.810 67.493 128.006 0.816 4.15E-02 9.45E-01

57003 CCDC47 103.772 213.984 103.225 200.281 0.816 3.34E-02 8.66E-01

5151 PDE8A 89.097 184.937 64.516 132.360 0.814 4.99E-02 1.00E+00

1910 EDNRB 158.278 234.318 194.540 472.837 0.789 4.84E-02 1.00E+00

3091 HIF1A 231.652 375.683 276.921 621.742 0.788 3.69E-02 9.15E-01

8662 EIF3B 163.519 252.715 126.054 313.483 0.772 4.48E-02 9.83E-01

1983 EIF5 132.073 289.508 153.845 256.011 0.771 4.04E-02 9.38E-01

7291 TWIST1 115.302 224.635 111.165 208.989 0.762 4.61E-02 9.98E-01

23243 ANKRD28 93.290 192.683 133.002 238.596 0.759 4.87E-02 1.00E+00

80381 CD276 171.905 344.699 205.458 351.798 0.736 4.43E-02 9.81E-01

960 CD44 933.945 1610.208 690.814 1421.995 0.733 4.85E-02 1.00E+00

966 CD59 538.774 1139.636 723.568 1141.601 0.723 4.11E-02 9.45E-01

7162 TPBG 263.098 177.191 325.556 147.163 -0.745 4.80E-02 1.00E+00

2316 FLNA 3367.861 2115.637 4362.253 2223.989 -0.750 3.05E-02 8.28E-01

56731 SLC2A4RG 160.374 89.079 166.748 87.949 -0.766 4.83E-02 1.00E+00

57674 RNF213 448.629 243.032 329.526 166.320 -0.793 4.61E-02 9.98E-01

4641 MYO1C 488.460 295.318 571.708 270.815 -0.801 2.64E-02 7.74E-01

138 Chapter 5 Appendix A

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

283078 MKX 105.868 48.413 124.069 69.663 -0.811 4.71E-02 1.00E+00

440275 EIF2AK4 114.254 68.746 145.905 64.438 -0.813 4.24E-02 9.51E-01

8573 CASK 99.579 43.571 120.098 67.921 -0.818 4.81E-02 1.00E+00

254102 EHBP1L1 278.821 148.143 282.876 146.292 -0.821 2.73E-02 7.84E-01

80332 ADAM33 132.073 68.746 135.979 68.792 -0.821 3.85E-02 9.28E-01

6938 TCF12 166.664 91.984 212.405 103.624 -0.824 3.18E-02 8.45E-01

311 ANXA11 287.206 162.667 266.003 120.169 -0.832 3.19E-02 8.46E-01

5156 PDGFRA 896.210 523.826 1184.111 559.045 -0.839 1.75E-02 6.28E-01

8476 CDC42BPA 100.627 64.873 162.778 65.309 -0.839 3.98E-02 9.38E-01

142 PARP1 123.687 70.683 141.934 61.826 -0.845 3.48E-02 8.91E-01

122953 JDP2 113.205 51.318 99.255 53.989 -0.850 3.89E-02 9.29E-01

10512 SEMA3C 337.520 187.841 245.160 94.045 -0.851 4.47E-02 9.83E-01

59 ACTA2 67.085 28.079 63.523 33.961 -0.860 4.95E-02 1.00E+00

152503 SH3D19 118.446 61.968 111.165 49.635 -0.865 3.58E-02 8.99E-01

3667 IRS1 244.230 118.127 278.906 145.421 -0.869 2.01E-02 6.74E-01

5865 RAB3B 126.832 75.524 181.636 74.888 -0.872 2.80E-02 7.95E-01

1848 DUSP6 140.459 86.175 313.645 128.876 -0.874 3.71E-02 9.15E-01

57060 PCBP4 89.097 31.952 153.845 79.242 -0.887 4.64E-02 1.00E+00

71 ACTG1 2637.267 1092.191 4142.899 2222.247 -0.888 2.40E-02 7.39E-01

23264 ZC3H7B 515.714 301.127 638.209 271.685 -0.889 1.40E-02 5.68E-01

4141 MARS 174.001 88.111 133.002 56.601 -0.892 3.33E-02 8.66E-01

115207 KCTD12 535.629 275.953 968.728 450.197 -0.895 2.22E-02 7.06E-01

64780 MICAL1 81.759 27.111 113.151 61.826 -0.900 4.15E-02 9.45E-01

23211 ZC3H4 47.169 19.365 63.523 29.607 -0.903 4.69E-02 1.00E+00

81603 TRIM8 268.339 125.873 279.899 141.938 -0.910 1.44E-02 5.73E-01

3275 PRMT2 136.266 77.460 157.815 60.955 -0.911 2.32E-02 7.23E-01

51564 HDAC7 123.687 64.873 181.636 79.242 -0.912 2.24E-02 7.06E-01

678 ZFP36L2 138.362 77.460 146.897 55.730 -0.913 2.48E-02 7.46E-01

23576 DDAH1 53.458 34.857 173.696 60.955 -0.914 4.91E-02 1.00E+00

440 ASNS 33.542 17.429 50.620 17.416 -0.925 5.00E-02 1.00E+00

400550 FENDRR 143.603 84.238 226.301 87.949 -0.928 1.89E-02 6.58E-01

54862 CC2D1A 46.121 14.524 36.724 20.028 -0.930 4.97E-02 1.00E+00

1841 DTYMK 56.603 22.270 42.680 20.028 -0.931 4.43E-02 9.81E-01

221 ALDH3B1 95.386 30.984 35.732 22.640 -0.941 5.00E-02 1.00E+00

16 AARS 210.688 91.984 146.897 72.275 -0.942 2.17E-02 7.06E-01

51115 RMDN1 48.217 23.238 57.568 21.770 -0.942 3.77E-02 9.18E-01

22836 RHOBTB3 84.904 51.318 116.128 37.444 -0.947 2.57E-02 7.65E-01

26227 PHGDH 107.964 40.667 89.329 47.893 -0.957 2.25E-02 7.06E-01

4171 MCM2 85.952 28.079 35.732 20.899 -0.960 4.46E-02 9.83E-01

1969 EPHA2 89.097 55.191 149.875 49.635 -0.962 2.15E-02 7.03E-01

64859 NABP1 50.314 36.794 151.860 45.281 -0.963 3.57E-02 8.99E-01

5.3 List of differentially expressed genes 139

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

7402 UTRN 76.518 40.667 259.055 94.045 -0.964 3.91E-02 9.32E-01

81563 C1ORF21 37.735 26.143 86.352 23.511 -0.966 3.75E-02 9.18E-01

9400 RECQL5 29.350 13.556 36.724 11.320 -0.973 4.61E-02 9.98E-01

8989 TRPA1 101.675 43.571 61.538 23.511 -0.974 3.40E-02 8.77E-01

152573 SHISA3 0.000 0.000 20.844 0.000 -0.976 4.77E-02 NA

5921 RASA1 105.868 56.159 213.398 81.854 -0.978 2.02E-02 6.75E-01

653513 LOC653513 14.675 0.000 2.978 0.000 -0.979 4.94E-02 NA

359845 RFLNB 95.386 54.222 288.832 102.753 -0.979 3.03E-02 8.28E-01

388650 FAM69A 57.651 30.016 67.493 21.770 -0.980 2.89E-02 8.12E-01

114876 OSBPL1A 45.073 21.302 66.501 24.382 -0.981 3.06E-02 8.28E-01

11234 HPS5 37.735 15.492 28.784 8.708 -0.984 4.68E-02 1.00E+00

54858 PGPEP1 27.253 11.619 41.687 13.933 -0.991 4.18E-02 9.45E-01

29028 ATAD2 36.687 23.238 68.486 17.416 -0.995 3.38E-02 8.72E-01

23179 RGL1 79.663 18.397 54.590 36.573 -0.995 3.05E-02 8.28E-01

55619 DOCK10 58.699 24.206 95.285 39.185 -0.999 2.43E-02 7.44E-01

93627 TBCK 16.771 5.810 41.687 13.062 -1.003 4.92E-02 1.00E+00

523 ATP6V1A 71.277 43.571 136.972 42.669 -1.004 1.97E-02 6.64E-01

79924 ADM2 13.627 0.000 3.970 0.000 -1.005 4.49E-02 NA

134957 STXBP5 40.880 22.270 47.642 10.449 -1.005 3.70E-02 9.15E-01

55901 THSD1 4.193 0.000 13.896 0.000 -1.008 4.46E-02 NA

84162 KIAA1109 89.097 42.603 127.046 49.635 -1.008 1.50E-02 5.86E-01

727800 RNF208 14.675 0.968 4.963 1.742 -1.009 4.79E-02 NA

64770 CCDC14 42.976 15.492 58.560 24.382 -1.009 2.92E-02 8.21E-01

6563 SLC14A1 340.664 131.683 117.121 34.831 -1.011 3.88E-02 9.29E-01

10827 FAM114A2 20.964 7.746 24.814 6.966 -1.013 4.69E-02 1.00E+00

4013 VWA5A 75.470 28.079 248.137 92.303 -1.014 3.42E-02 8.79E-01

81493 SYNC 72.326 21.302 25.806 13.933 -1.015 4.02E-02 9.38E-01

79885 HDAC11 28.301 1.937 27.791 14.803 -1.020 4.89E-02 1.00E+00

3516 RBPJ 171.905 63.905 260.048 121.039 -1.020 1.27E-02 5.39E-01

10602 CDC42EP3 59.747 42.603 126.054 30.478 -1.021 2.25E-02 7.06E-01

54532 USP53 27.253 11.619 63.523 20.899 -1.022 3.56E-02 8.99E-01

79690 GAL3ST4 25.157 7.746 28.784 10.449 -1.025 4.07E-02 9.43E-01

79890 RIN3 32.494 7.746 21.836 10.449 -1.027 4.15E-02 9.45E-01

388963 C2ORF81 12.578 1.937 12.903 3.483 -1.028 4.94E-02 1.00E+00

374393 FAM111B 25.157 2.905 11.911 6.966 -1.030 4.88E-02 1.00E+00

2139 EYA2 19.916 5.810 38.709 13.062 -1.032 4.16E-02 9.45E-01

5860 QDPR 42.976 11.619 31.762 15.674 -1.032 3.29E-02 8.60E-01

421 ARVCF 4.193 3.873 32.754 3.483 -1.033 4.83E-02 1.00E+00

64388 GREM2 319.700 150.079 186.599 26.124 -1.033 3.53E-02 8.99E-01

55103 RALGPS2 30.398 10.651 88.337 30.478 -1.033 3.59E-02 9.01E-01

6574 SLC20A1 278.821 114.254 162.778 67.051 -1.037 1.61E-02 6.04E-01

140 Chapter 5 Appendix A

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

25802 LMOD1 12.578 3.873 44.665 12.191 -1.038 4.53E-02 9.91E-01

154091 SLC2A12 10.482 0.968 6.948 0.000 -1.042 3.93E-02 NA

5257 PHKB 40.880 11.619 51.613 22.640 -1.045 2.73E-02 7.85E-01

221895 JAZF1 11.530 7.746 54.590 11.320 -1.046 4.23E-02 9.51E-01

6773 STAT2 278.821 99.730 154.838 80.983 -1.046 1.29E-02 5.39E-01

83660 TLN2 58.699 20.333 158.808 59.213 -1.048 2.72E-02 7.84E-01

6935 ZEB1 124.736 57.127 248.137 94.916 -1.048 1.29E-02 5.39E-01

3985 LIMK2 38.783 11.619 32.754 13.933 -1.048 3.04E-02 8.28E-01

57484 RNF150 46.121 20.333 59.553 20.028 -1.050 2.16E-02 7.03E-01

23536 ADAT1 24.109 5.810 20.844 7.837 -1.054 3.95E-02 9.34E-01

6742 SSBP1 18.868 3.873 15.881 5.225 -1.059 4.21E-02 9.49E-01

5905 RANGAP1 286.158 126.841 326.549 137.584 -1.061 4.13E-03 2.76E-01

5063 PAK3 22.012 1.937 11.911 6.096 -1.062 4.26E-02 9.52E-01

79960 JADE1 47.169 12.587 86.352 35.702 -1.064 2.51E-02 7.52E-01

330 BIRC3 94.338 32.921 34.739 5.225 -1.066 3.76E-02 9.18E-01

85379 KIAA1671 25.157 6.778 11.911 1.742 -1.067 4.17E-02 9.45E-01

80169 CTC1 6.289 0.968 20.844 3.483 -1.067 4.01E-02 9.38E-01

390 RND3 469.593 237.222 428.781 129.747 -1.071 8.12E-03 4.27E-01

144363 ETFRF1 4.193 1.937 21.836 1.742 -1.073 3.78E-02 9.18E-01

114796 PSMG3-AS1 20.964 6.778 17.866 3.483 -1.074 3.88E-02 9.29E-01

9569 GTF2IRD1 52.410 12.587 28.784 15.674 -1.075 2.72E-02 7.84E-01

11046 SLC35D2 13.627 7.746 49.627 10.449 -1.077 3.53E-02 8.99E-01

2825 GPR1 23.060 7.746 27.791 7.837 -1.083 3.21E-02 8.46E-01

9577 BRE 16.771 5.810 23.821 5.225 -1.084 3.61E-02 9.01E-01

115557 ARHGEF25 89.097 30.016 75.434 34.831 -1.084 1.19E-02 5.27E-01

862 RUNX1T1 8.386 0.000 9.925 0.000 -1.085 3.28E-02 NA

5783 PTPN13 159.326 81.333 262.033 90.562 -1.085 6.04E-03 3.46E-01

91624 NEXN 23.060 11.619 88.337 23.511 -1.091 2.83E-02 7.98E-01

219285 SAMD9L 78.615 31.952 54.590 15.674 -1.094 1.95E-02 6.64E-01

10669 CGREF1 14.675 1.937 6.948 0.000 -1.094 3.36E-02 NA

84939 MUM1 81.759 22.270 88.337 42.669 -1.105 1.19E-02 5.27E-01

60686 C14ORF93 10.482 2.905 15.881 1.742 -1.112 3.35E-02 8.68E-01

388115 C15ORF52 56.603 22.270 35.732 4.354 -1.117 2.80E-02 7.95E-01

57523 NYNRIN 37.735 15.492 52.605 15.674 -1.117 1.75E-02 6.28E-01

6339 SCNN1D 15.723 0.000 15.881 5.225 -1.124 3.20E-02 8.46E-01

55793 FAM63A 20.964 5.810 18.858 4.354 -1.125 3.00E-02 8.28E-01

84795 PYROXD2 29.350 3.873 34.739 14.803 -1.128 2.61E-02 7.72E-01

55614 KIF16B 16.771 6.778 21.836 1.742 -1.129 3.08E-02 8.30E-01

29128 UHRF1 59.747 12.587 48.635 25.253 -1.131 1.58E-02 6.00E-01

2027 ENO3 12.578 0.000 6.948 0.000 -1.132 2.63E-02 NA

23051 ZHX3 98.531 44.540 114.143 36.573 -1.133 6.68E-03 3.73E-01

5.3 List of differentially expressed genes 141

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

55388 MCM10 19.916 4.841 11.911 0.000 -1.134 3.03E-02 8.28E-01

4061 LY6E 32.494 11.619 23.821 0.871 -1.135 2.99E-02 8.28E-01

7791 ZYX 236.893 98.762 353.347 135.843 -1.139 3.10E-03 2.38E-01

596 BCL2 14.675 1.937 13.896 3.483 -1.139 2.97E-02 8.28E-01

5021 OXTR 19.916 1.937 5.955 1.742 -1.140 2.81E-02 7.95E-01

387758 FIBIN 33.542 9.683 39.702 13.933 -1.140 1.87E-02 6.56E-01

79443 FYCO1 149.892 54.222 195.532 80.983 -1.141 4.28E-03 2.82E-01

10245 TIMM17B 20.964 6.778 30.769 7.837 -1.141 2.44E-02 7.44E-01

291 SLC25A4 27.253 4.841 21.836 8.708 -1.143 2.53E-02 7.57E-01

84171 LOXL4 63.940 24.206 43.672 10.449 -1.150 1.71E-02 6.26E-01

9223 MAGI1 47.169 17.429 68.486 22.640 -1.156 1.13E-02 5.17E-01

5137 PDE1C 32.494 5.810 7.940 1.742 -1.157 2.73E-02 7.84E-01

5828 PEX2 42.976 15.492 66.501 21.770 -1.157 1.23E-02 5.34E-01

54899 PXK 41.928 14.524 65.508 21.770 -1.158 1.27E-02 5.39E-01

23022 PALLD 176.097 95.857 328.534 94.916 -1.162 3.71E-03 2.64E-01

3306 HSPA2 48.217 23.238 78.411 20.028 -1.167 1.02E-02 4.90E-01

23371 TNS2 107.964 28.079 70.471 36.573 -1.168 7.94E-03 4.23E-01

5939 RBMS2 77.567 24.206 74.441 30.478 -1.174 7.04E-03 3.89E-01

2115 ETV1 37.735 13.556 128.039 36.573 -1.179 1.57E-02 6.00E-01

81848 SPRY4 47.169 23.238 70.471 15.674 -1.180 1.06E-02 4.99E-01

9260 PDLIM7 227.459 98.762 423.818 140.197 -1.207 2.48E-03 2.07E-01

2992 GYG1 38.783 7.746 29.776 12.191 -1.208 1.45E-02 5.73E-01

24139 EML2 48.217 10.651 43.672 18.287 -1.210 1.08E-02 5.04E-01

10507 SEMA4D 17.819 1.937 8.933 1.742 -1.217 1.97E-02 6.64E-01

55504 TNFRSF19 202.302 120.064 303.720 49.635 -1.218 5.30E-03 3.19E-01

27147 DENND2A 71.277 15.492 34.739 17.416 -1.218 1.11E-02 5.09E-01

10611 PDLIM5 102.723 56.159 253.100 65.309 -1.219 4.68E-03 2.97E-01

84189 SLITRK6 19.916 2.905 9.925 1.742 -1.221 1.97E-02 6.64E-01

57724 EPG5 73.374 24.206 64.516 21.770 -1.233 5.62E-03 3.28E-01

60 ACTB 2728.460 1067.985 3786.574 1397.612 -1.241 4.68E-04 6.40E-02

171024 SYNPO2 29.350 24.206 111.165 13.933 -1.241 1.16E-02 5.20E-01

1958 EGR1 127.880 45.508 474.438 135.843 -1.241 8.88E-03 4.53E-01

1902 LPAR1 546.111 200.429 530.021 205.506 -1.241 6.04E-04 7.65E-02

64750 SMURF2 165.615 36.794 138.957 70.534 -1.242 3.18E-03 2.42E-01

7846 TUBA1A 312.363 101.667 856.570 276.039 -1.247 5.66E-03 3.28E-01

64221 ROBO3 28.301 9.683 52.605 13.062 -1.252 1.02E-02 4.90E-01

154796 AMOT 32.494 20.333 155.830 31.348 -1.254 1.04E-02 4.93E-01

112574 SNX18 150.941 45.508 199.502 77.500 -1.258 1.98E-03 1.75E-01

147495 APCDD1 78.615 38.730 198.510 49.635 -1.271 3.99E-03 2.75E-01

8507 ENC1 62.892 25.175 75.434 18.287 -1.279 4.36E-03 2.84E-01

23677 SH3BP4 137.314 53.254 157.815 48.764 -1.279 1.42E-03 1.44E-01

142 Chapter 5 Appendix A

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

4329 ALDH6A1 13.627 3.873 25.806 3.483 -1.280 1.41E-02 5.70E-01

54328 GPR173 12.578 3.873 24.814 2.612 -1.282 1.42E-02 5.72E-01

6869 TACR1 30.398 5.810 12.903 1.742 -1.289 1.38E-02 5.64E-01

57761 TRIB3 56.603 9.683 25.806 12.191 -1.293 9.08E-03 4.57E-01

92154 MTSS1L 235.845 93.921 247.145 73.146 -1.298 8.49E-04 9.74E-02

5393 EXOSC9 15.723 2.905 26.799 5.225 -1.305 1.21E-02 5.31E-01

9742 IFT140 63.940 16.460 61.538 21.770 -1.315 3.61E-03 2.62E-01

2491 CENPI 8.386 1.937 19.851 0.000 -1.316 1.15E-02 5.20E-01

4857 NOVA1 20.964 1.937 18.858 5.225 -1.318 1.16E-02 5.20E-01

116832 RPL39L 19.916 3.873 27.791 6.096 -1.322 1.02E-02 4.90E-01

9241 NOG 12.578 0.000 13.896 1.742 -1.328 1.08E-02 5.04E-01

2250 FGF5 32.494 14.524 134.987 27.865 -1.332 6.57E-03 3.69E-01

323 APBB2 31.446 11.619 39.702 5.225 -1.343 7.17E-03 3.92E-01

26230 TIAM2 25.157 3.873 20.844 5.225 -1.353 8.72E-03 4.50E-01

4008 LMO7 109.013 82.302 459.550 74.017 -1.354 3.35E-03 2.51E-01

10641 NPRL2 20.964 0.000 12.903 3.483 -1.359 9.49E-03 4.73E-01

6218 RPS17 32.494 3.873 77.419 20.899 -1.360 7.09E-03 3.90E-01

64900 LPIN3 27.253 9.683 43.672 6.966 -1.369 5.81E-03 3.36E-01

158056 MAMDC4 33.542 7.746 36.724 8.708 -1.405 4.35E-03 2.84E-01

9020 MAP3K14 22.012 5.810 25.806 2.612 -1.411 6.41E-03 3.62E-01

1265 CNN2 272.532 103.603 671.956 174.157 -1.414 8.14E-04 9.61E-02

9659 PDE4DIP 101.675 27.111 78.411 24.382 -1.427 1.10E-03 1.19E-01

5924 RASGRF2 56.603 19.365 76.426 16.545 -1.429 1.58E-03 1.52E-01

9760 TOX 6.289 0.000 23.821 0.000 -1.435 5.66E-03 3.28E-01

22874 PLEKHA6 42.976 10.651 30.769 5.225 -1.435 4.11E-03 2.76E-01

25959 KANK2 361.628 121.032 517.118 155.000 -1.442 1.14E-04 2.10E-02

9079 LDB2 33.542 12.587 59.553 8.708 -1.458 2.63E-03 2.13E-01

347902 AMIGO2 11.530 3.873 72.456 8.708 -1.493 4.05E-03 2.75E-01

84962 AJUBA 42.976 4.841 63.523 17.416 -1.531 1.80E-03 1.66E-01

57608 KIAA1462 281.965 106.508 320.593 54.860 -1.540 1.98E-04 3.33E-02

79633 FAT4 129.977 25.175 93.300 33.090 -1.553 3.15E-04 4.76E-02

3790 KCNS3 12.578 1.937 31.762 2.612 -1.603 2.18E-03 1.88E-01

23566 LPAR3 16.771 0.000 17.866 1.742 -1.609 2.13E-03 1.86E-01

2353 FOS 18.868 13.556 204.465 19.157 -1.621 1.56E-03 1.52E-01

54510 PCDH18 805.016 140.397 871.458 304.775 -1.623 4.21E-05 9.61E-03

22861 NLRP1 27.253 4.841 25.806 1.742 -1.663 1.31E-03 1.35E-01

27123 DKK2 27.253 3.873 39.702 6.096 -1.700 7.60E-04 9.29E-02

10129 FRY 6.289 0.000 38.709 0.000 -1.718 1.00E-03 1.13E-01

79094 CHAC1 27.253 0.968 13.896 1.742 -1.754 8.14E-04 9.61E-02

113146 AHNAK2 32.494 1.937 49.627 8.708 -1.808 3.56E-04 5.18E-02

10290 SPEG 116.350 16.460 150.867 37.444 -1.814 3.30E-05 8.08E-03

5.3 List of differentially expressed genes 143

Table 5.1 continued from previous page

Reads per Million (RPM)

GeneID Gene Symbol ZZ29 ML ZZ29 6h ZZ31 ML ZZ31 6h log2FC P value adj.P value

55784 MCTP2 73.374 20.333 146.897 21.770 -1.825 3.92E-05 9.15E-03

79640 C22ORF46 35.639 5.810 36.724 2.612 -1.888 1.90E-04 3.30E-02

4739 NEDD9 10.482 0.000 46.650 0.871 -2.032 1.06E-04 1.97E-02

89795 NAV3 105.868 8.714 42.680 8.708 -2.110 1.45E-05 4.03E-03

64283 ARHGEF28 34.591 5.810 64.516 1.742 -2.238 8.84E-06 2.68E-03

652 BMP4 63.940 6.778 69.478 5.225 -2.421 3.30E-07 1.54E-04

1490 CTGF 170.856 52.286 1006.445 16.545 -2.599 1.55E-07 8.39E-05

3491 CYR61 684.473 16.460 1222.820 8.708 -4.862 3.86E-31 3.97E-27

Publications

Patent

Technische Universität Berlin, 2018.

Method of preparing an artificial tooth primordium in vitro and artificial tooth primordium

derived therefrom

Inventors: Roland Lauster, Jennifer Binder, Mark Rosowski, Uwe Marx.

Granted 01.08.2018. EP2633870B1

Scientific publications

Rosowski, J., Bräunig, J., Strietzel, F., Lauster, R. & Rosowski, M. (in preparation)

Emulating the early phases of human tooth development in vitro

Drzymala, S. S. *, Binder, J.* , Brodehl, A., Penkert, M., Rosowski, M., Garbe, L. A., &

Koch, M. (2015). (* Co-first authors)

Estrogenicity of novel phase I and phase II metabolites of zearalenone and cis-zearalenone.

Toxicon, 105, 10-12.

Presentations

Dechema Conference on 3D Cell Culture 2014 in Freiburg, Germany

"Tooth formation in vivo and in vitro"

Oral presentation

Gordon Research Seminar on Craniofacial Morphogenesis and Tissue Regeneration 2014

in Lucca, Italy

"Tooth formation in vivo and in vitro"

Oral presentation

Gordon Research Conference on Craniofacial Morphogenesis and Tissue Regeneration 2014

in Lucca, Italy

"Tooth formation in vivo and in vitro"

Poster presentation

4th BSRT Symposium on Regenerative Medicine 2013, Berlin, Germany

"Mesenchymal Condensation of Dental Pulp Stem Cells"

Speed talk & Poster presentation, 2nd poster prize

Conference on Stem Cells in Development ans Disease 2013, MDC Berlin, Germany

"Formation of mesenchymal dental tissue from human adult DPCs in vitro"

Poster presentation

145

Danksagung

An dieser Stelle möchte ich mich bei den vielen Menschen bedanken, die mich bei der

Entstehung dieser Arbeit unterstützt haben.

Zunächst gilt mein Dank Roland Lauster, der seine Visionen und seine Begeister-

ung für das Thema mit mir geteilt hat, für umfangreiche wissenschaftliche Diskussionen,

für die Freiheit der Selbstverwirklichung und für sein großes Herz für Gemeinschaft und

Gemeinsamkeit.

Für die Begutachtung meiner Arbeit möchte ich Prof. Dr.-Ing. Claudia Fleck

und Prof. Dr. Juri Rappsilber danken, sowie Prof. Dr.-Ing. Vera Meyer für den Vorsitz

meines Promotionsverfahrens.

Herrn PD Dr. Frank Strietzel möchte ich ebenfalls für die Begutachtung meiner

Arbeit danken, sowie für die hervorragende Zusammenarbeit und die Versorgung mit

Zahnkeimen. Ebenfalls möchte ich in diesem Sinne Dr. Gülseren Köksal und dem

Praxisteam von Herrn Hans-Uwe Amler danken. Vielen Dank an Anna-Klara Amler für

die Vermittlung und viele spontane Einsätze.

Uwe Marx und Silke Hoffmann möchte ich ganz besonders für die große Unter-

stützung bei Erstellung und Betreuung des Patents und des Antrags danken. Von euch

habe ich sehr viel gelernt!

Meiner Arbeitsgruppe aus der GMA möchte ich ganz herzlich für die außerordent-

lich schöne Atmosphäre danken. Jedes Mitglied mit seinen Eigenheiten und besonderen

Fähigkeiten ist dort Teil eines lebendigen, funktionierenden und glücklichen Organismus.

Erfolge werden ehrlich miteinander geteilt und gefeiert, große oder kleine Niederlagen

aufgefangen. Agnes, die alles zusammenhält und mit ihrer hilfsbereiten Art einfach eine

wunderbar liebenswerte Person ist. Hinter jeder erfolgreichen Doktorarbeit steht eine starke

Luzie. Wenn alles schiefging, musste Luzie ran und hat es gerichtet mit ihrer langjährigen

Erfahrung und ihren Zaubertricks. Während meiner Vorlesung in der Elternzeit hat sie sich

liebevoll um meine Kinder gekümmert und sie hat als Labormama stets mit einem offenen

Ohr für den Seelenfrieden gesorgt. Meinen ehemaligen Studenten Julia und Sandro möchte

ich ganz besonders dafür danken, dass sie mich experimentell, produktiv und konstruktiv bei

vielen Teilen dieser Arbeit unterstützt haben und dass sie so wunderbar liebe Menschen sind.

147

148

Ein großer Dank geht auch an unser Büro. An das osmanische Trio, Özlem, Kübrah und

Zehra für die wunderbare Endphase meiner Promotion inklusive der Vorbereitung des

grandiosen LabQuiz. Ich danke natürlich auch den "alten Hasen", Marielle und Stefan

sowie Karolina. Auch von euch konnte ich viel lernen. Meiner liebsten Kollegin Shirin

möchte ich für so vieles danken. Sie hat mich stets in allem unterstützt, hat mir Mut

gemacht, hat mir meine Stärken aufgezeigt und die richtigen Fragen gestellt. Ohne dich

und deinen Einsatz beim Akkord-Korrekturlesen wäre diese Arbeit nicht möglich gewesen

und ich danke dir von ganzem Herzen dafür!

Meinen Freunden möchte ich dafür danken, dass sie mich stets emotional unter-

stützt haben, für ihr Verständnis und für die Verlässlichkeit, obwohl uns oft viele Kilometer

trennen. Sarah, Steffi und Chrissi möchte ich für die schönste Zeit im (Studenten)-Leben

danken. Franzi, Gwenni und Flo möchte ich danken, dass sie mich täglich motiviert und

mir Energie gegeben haben!

Zu guter Letzt danke ich meiner Familie. Ich kann nicht ausdrücken, wie dank-

bar ich meinen Eltern für ihr Vertrauen in mich, ihr Verständnis für meine Arbeit und

ihre bedingungslose Wärme und Liebe bin. Sie haben mich in jeder Phase mit vollem

Einsatz unterstützt und ich weiß das sehr zu schätzen. Ihr meine großen Vorbilder! Meinen

Kindern danke ich dafür, dass sie mir jahrelang den Schlaf abtrainiert haben, was vor

allem beim Schreiben außerordentlich hilfreich war. Mit euch zusammen kann ich Kraft

tanken und den Moment leben und dafür liebe ich euch! Meinem Mann gilt der größte

Dank. Als hervorragender Wissenschaftler hat er mich mit konstruktiven Gesprächen

motiviert und vorangebracht. Er hat sich mit mir durch die Datensätze gequält und mit

mir alle Interpretationen diskutiert. In der stressigsten Zeit hat er unsere beiden Rebellen

in Schach gehalten. Er hat einen maßgeblichen Anteil an dieser Arbeit, indem er mich

jeden Tag unterstützt und mental getragen hat.

DANKE!

Erklärung der Selbstständigkeit

Hiermit erkläre ich, dass mir die geltende Promotionsordung der TU Berlin vom 23.

Oktober 2006, zuletzt geändert mit der Änderungssatzung vom 15. Januar 2014, bekannt

ist. Hiermit erkläre ich an Eides statt, dass ich die Dissertation selbstständig verfasst habe.

Alle benutzen Quellen und Hilfsmittel sind aufgeführt.

Hiermit erkläre ich, dass diese Dissertation noch keiner anderen Fakultät oder Universität

zur Prüfung vorgelegt wurde. Veröffentlichungen von irgendwelchen Teilen der vorliegenden

Dissertation sind von mir wie folgt vorgenommen worden:

Patent:

Technische Universität Berlin, 2018

„Method of preparing an artificial tooth primordium in vitro and artificial tooth primordium

derived therefrom“ EP2633870B1

Erfinder: Roland Lauster, Jennifer Binder, Mark Rosowski, Uwe Marx

Erteilt am 1.08.2018

Ort, Datum