Allyl Isothiocyanate: A TAS2R38
Receptor-Dependent Immune
Modulator at the Interface Between
Personalized Medicine and Nutrition
Hoai T. T. Tran
1
, Rebecca Stetter
1
, Corinna Herz
1
, Jenny Spöttel
2
, Mareike Krell
2
,
Franziska S. Hanschen
3
, Monika Schreiner
3
, Sascha Rohn
2
, Maik Behrens
4
and Evelyn Lamy
1
*
1
Molecular Preventive Medicine, University Medical Center and Faculty of Medicine—University of Freiburg, Freiburg, Germany,
2
Institute of Food Technology and Food Chemistry, Technical University of Berlin, Berlin, Germany,
3
Plant Quality and Food
Security, Leibniz Institute of Vegetable and Ornamental Crops, Großbeeren, Germany,
4
Section II: Metabolic Function,
Chemoreception & Biosignals, Leibniz-Institute for Food Systems Biology at the Technical University of Munich, Freising, Germany
Understanding individual responses to nutrition and medicine is of growing interest and
importance. There is evidence that differences in bitter taste receptor (TAS2R) genes
which give rise to two frequent haplotypes, TAS2R38-PAV (functional) and TAS2R38-AVI
(non-functional), may impact inter-individual differences in health status. We here analyzed
the relevance of the TAS2R38 receptor in the regulation of the human immune response
using the TAS2R38 agonist allyl isothiocyanate (AITC) from Brassica plants. A differential
response in calcium mobilization upon AITC treatment in leucocytes from healthy humans
confirmed a relevance of TAS2R38 functionality, independent from cation channel TRPV1
or TRPA1 activation. We further identified a TAS2R38-dependence of MAPK and AKT
signaling activity, bactericidal (toxicity against E. coli) and anti-inflammatory activity (TNF-
alpha inhibition upon cell stimulation). These in vitro results were derived at relevant human
plasma levels in the low micro molar range as shown here in a human intervention trial with
AITC-containing food.
Keywords: Brassica plants, Brassicaceae, isothiocyanates, human bitter taste receptor (TAS2R), TAS2R38,
personalized (precision) nutrition, precision medicine, precision health
INTRODUCTION
As an important constituent of precision medicine, precision nutrition seeks to develop tailored
nutritional approaches to promote and maintain health and to prevent diseases. The strategies
consider differential responses to certain individualized food-derived nutrients that arise due to the
interaction between nutrients and biological processes. Taste perception is considered as relevant
factor for modulating eating behavior and in consequence health and disease risk (1). Bitterness is
one key attribute associated with plants from the order Brassicales. This taste is thought to be
mediated by interaction of the phytochemical class of glucosinolates (GLS) and their myrosinase-
degradation product isothiocyanates (ITC) with the G protein-coupled bitter taste receptor
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 6690051
Edited by:
Harry Wichers,
Wageningen University and Research,
Netherlands
Reviewed by:
Danielle Renee Reed,
Monell Chemical Senses Center,
United States
Takumi Misaka,
The University of Tokyo, Japan
*Correspondence:
Evelyn Lamy
Specialty section:
This article was submitted to
Nutritional Immunology,
a section of the journal
Frontiers in Immunology
Received: 18 February 2021
Accepted: 29 March 2021
Published: 20 April 2021
Citation:
Tran HTT, Stetter R, Herz C, Spöttel J,
Krell M, Hanschen FS, Schreiner M,
Rohn S, Behrens M and Lamy E (2021)
Allyl Isothiocyanate: A TAS2R38
Receptor-Dependent Immune
Modulator at the Interface Between
Personalized Medicine and Nutrition.
Front. Immunol. 12:669005.
doi: 10.3389/fimmu.2021.669005
ORIGINAL RESEARCH
published: 20 April 2021
doi: 10.3389/fimmu.2021.669005
TAS2R38 on the tongue (2). In humans, the bitter taste is
perceived by a family of 25 different taste receptors (TAS2Rs)
expressed on type II taste receptor cells in the taste bud (3–5).
The TAS2R38 was found to respond quite specifically to
compounds containing a thiourea [-NH-(C=S)-NH-] or ITC
(N=C=S) moiety (6,7). By today, the TAS2R38 receptor is found
to be expressed in many different extragustatory tissues but its
physiological relevance in these is still focus for much debate.
TAS2R38 protein expression was found recently in peripheral
immune cells (neutrophils, monocytes and lymphocytes) (8–10).
What makes the receptor especially interesting in the context of
precision medicine/nutrition is the occurrence of frequent single
nucleotide polymorphisms (SNP) within the human TAS2R38
gene. These SNPs cause amino acid substitutions which result in
two common haplotypes, a functional (proline-alanine-valine,
PAV) and a non-functional (alanine-valine-isoleucine, AVI)
(11). In fact, across almost all human populations worldwide
the two alleles occur with high frequencies (12) and, typically,
about 25 to 30% of the human population represent non-tasters
(13). Sinigrin and its GLS-myrosinase product allyl ITC (AITC)
are among the most abundant phytochemicals in Brassicaceae
(14). The presence of these compounds is reported to contribute
to a bitter and pungent taste in Brassica vegetables (14,15) and
the taster and non-taster haplotypes of TAS2R38 correlate here
well with individuals’bitter sensitivities for Brassica plants (2).
As an example, sinigrin was linked with the bitter taste of cooked
Brussels sprouts and cauliflower (16,17). Individuals with a
PAV/PAV diplotype have been shown to rate the bitter intensity
of Brassicaceae vegetables significantly higher than the ones with
AVI/AVI (2).
Functional expression studies in HEK293T-Ga16gust44 cells,
transiently transfected with the 25 putatively functional ATS2Rs,
showed that both sinigrin as well as AITC selectively triggered
the taster variant of the TAS2R38 receptor (18). Wu et al. (19)
later confirmed their observations using a TAS2R38 receptor-
based biosensor. AITC is known for its health promoting
potential, including its anti-inflammatory, immune modulatory
capacity (20–23). Sinigrin/AITC-containing horseradish root
(Armoracia rusticana) is used in pharmacological remedies for
the treatment of inflammatory diseases including acute sinusitis,
bronchitis and urinary tract infection (24,25). In general, ITC
are prominent multi-target compounds interacting with a broad
range of signaling pathways and molecules (20). Whether the
immune response triggered by AITC is linked to TAS2R38
interaction has not been investigated so far.
Recent findings suggest that a functional TAS2R38 is relevant
for the respiratory innate immunity (26) and is proposed as
factor for local host defense (27). Further support on this is given
by Lee et al. (28). In their study, TAS2R38 has been found to play
a role in chronic rhinosinusitis and bacterial detection. Increased
susceptibility to chronic rhinosinusitis has also been associated
with a non-functional (AVI/AVI) diplotype (28). A non-
functional diplotype is linked in cystic fibrosis patients with
more severe symptoms (29), it is associated with an increased
risk for dental caries (30), increased risk for colorectal (31) and
gastric (32) cancer.
In the present study, the effect of AITC on the human innate
and adaptive immune system was investigated in dependence on
the functional status of the TAS2R38 receptor. Upon AITC
treatment, differential effects on calcium mobilization as
parameter for G protein-coupled receptor (GPCR) activation
were found in human peripheral blood (PBMC) subpopulations
and gave first evidence of functional TAS2R38 receptor
interaction. Based on these findings, further parameters, with
and without stimuli of innate and adaptive immune response
were investigated here. A selective bactericidal potential of
immune cells from functional TAS2R38 donors was shown
using E. coli K12 bacteria upon AITC treatment.
MATERIALS AND METHODS
Chemicals
Fetal calf serum (FCS), L-glutamine and phosphate buffered
saline (PBS, without Ca and Mg), penicillin-streptomycin (P/S)
solution, RPMI-1640 and DMEM without phenol red were from
Life Technologies (Darmstadt, Germany). Hank’s Balanced Salt
Solution (HBSS) was from PAA Laboratories GmBH (Coelbe,
Germany). b-Mercaptoethanol was purchased from Fluka
(Buchs, Switzerland). Dimethyl sulfoxide (DMSO; purity >
99%) was purchased from Applichem GmbH (Darmstadt,
Germany). Nuclease-free water was from Qiagen (Hilden,
Germany). LymphoPrep™was from Alere Technologies AS
(Oslo, Norway). Ionomycin (purity ≥98%), S-Nitroso-N-
Acetyl-D (SNAP), Carboxy-PTIO (cPTIO), capsazepine and A-
967079 were from Cayman Europe (Ann Arbor, Michigan,
USA), U73122 was purchased from Enzo Life Sciences
(Lörrach, Germany). AITC, tween-20, protein standard BSA,
ammonium persulfate and lipopolysaccharide (LPS, from
Escherichia coli O11:B4) were obtained from Sigma-Aldrich
(Taufkirchen, Germany). Anti-human CD3 and CD28
functional grade purified antibodies were from eBioscience
Affymetrix (Frankfurt, Germany). DAF-FM diacetate, fluo-4-
AM and Pluronic™F-127 were from Thermo Fisher Scientific
GmBH (Darmstadt, Germany). DiBAC
4
(3) (Bis-(1,3-
dibutylbarbituric acid)trimethine oxonol) was obtained from
Biomol (Hamburg, Germany). EDTA (99%, p.a.) was
purchased from Serva GmbH (Heidelberg, Germany).
Amersham™ECL Select™and Hybond ECL Nitrocellulose
Membrane was obtained from Ge Healthcare Biosciences AB
(Uppsala, Sweden), Quick Start Bradford 1x Dye Reagent was
from BioRad Laboratories GmbH (Munich, Germany) and Page
Ruler Plus Prestained Protein ladder from Thermo Fisher
Scientific (Waltham, Massachusetts, USA). The following
primary antibodies were used for immunoblotting: anti-p-
ERK1/2 (Thr202/Tyr204, 1:500), anti-ERK1/2 (1:2000, clone
L34F12), anti-p-p38 (Thr180/Tyr182, 1:2000), anti-p-Akt
(1:2000, Ser 473, clone D9E), anti-Akt (1:1000) from Cell
Signalling (Danvers, Massachusetts, USA), and anti-beta-actin
(1:10000, clone AC-74) from Sigma-Aldrich Chemie GmbH
(Taufkirchen, Germany). The horseradish peroxidase (HRP)-
labeled secondary antibodies anti-mouse and anti-rabbit were
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 6690052
purchased from Cell Signalling (Danvers, Massachusetts, USA).
Formic acid (FA; 98%) and acetonitrile (ACN, ultra LC–MS
grade) were purchased from Carl Roth GmbH Co. KG
(Karlsruhe, Germany). Trifluoroacetic acid (TFA, 99.9%) was
from Carl Roth GmbH Co. KG (Karlsruhe, Germany) and
Applichem GmbH (GmbH (Darmstadt, Germany). C18ec solid
phase extraction cartridges (3 mL, 200 mg) were gained from
Macherey-Nagel GmbH & Co. KG (Düren, Germany). For all
aqueous solutions water of Milli-Q quality was used.
Isolation of Human PBMC
Human PBMC were isolated from fresh peripheral blood of 30
volunteers at the University Medical Center in Freiburg,
Germany. Blood was collected from volunteers using
Li-heparinized vacutainers (Sarstedt, Nümbrecht, Germany).
The volunteers (male and female, aged between 20-35 years)
had a normal BMI, were healthy and were non-smokers. PBMC
were isolated from blood within 2 h by centrifugation on a
LymphoPrep™gradient (density: 1.077 g/cm
3
) at 1200g for
13 min at room temperature, using 50 mL SepMate™
(Grenoble, France) tubes, were then washed twice with PBS
and cell viability and concentration were determined using the
trypan blue exclusion test. PBMC were used directly for
immunostaining or cultured in RPMI 1640 medium
supplemented with 10% heat-inactivated FCS, 2 mM L-
glutamine, 100 U/mL penicillin/streptomycin, at 37°C in a
humidified incubator with a 5% CO
2
/95% air atmosphere. Cell
activation was done by using functional antibodies to CD3 and
CD28, or LPS (solvent control: aqua dest).
Determination of the TAS2R38
Gene Polymorphism
DNA was isolated from 1x10
6
PBMC using the QIAamp DNA
Blood Mini Kit (Qiagen, Hilden, Germany) according to the
manufacturer’s protocol. A 831bp fragment of the TAS2R38 gene
was amplified using the following oligonucleotides at the
indicated final concentration: forward 5′ACCAATGCCTTCGT
TTTCTTGGTGA′3andreverse5′CAGCTACCAAGCCAT
CATCA ′3(33). PCR reaction was performed in a total
volume of 50 µL containing 20 ng DNA, 1 U Taq DNA
Polymerase (Life Technologies, Darmstadt, Germany), 0.5 µM
forward primer and 0.5 µM reverse primer, dNTP mix at 0.2 mM
each (Life Technologies, Darmstadt, Germany) 1.5 mM MgCl
and 1x PCR-buffer (Life Technologies, Darmstadt, Germany).
The PCR conditions were: 94°C for 3 min followed by 30 cycles
of (94°C for 45 sec, 54.2°C for 45 sec and 72°C for 90 sec) and
72°C for 10 min. PCR products were cleaned up using the
Monarch PCR & DNA Cleanup Kit (New England Biolabs,
Frankfurt am Main, Germany) according to the manufacturer’s
protocol. The PCR fragment was sequenced using reverse primer
PCR 5′CAGCTACCAAGCCATCATCA′3 to analyze the SNP
on position 145 of the gene and the forward primer 5′
GGAAGGCACATGAGGACAAT′3toanalyzetheSNPson
position 785 and position 886 by GATC (Konstanz, Germany).
The sequences were analyzed using the software Chromas 2.6.4
(Technelysium, South Brisbane, Australia). DNA concentration
was analyzed using a NanoDrop (Peq lab, Erlangen, Germany).
5 µl of PCR mix were used to visualize the PCR product in
agarose electrophoreses.
Calcium Flux Assay
PBMC staining for calcium measurement was performed as
described before (10). Each sample containing 0.5 x10
6
cells
was analyzed for 800 sec using a FACSCalibur™(BD
Biosciences, Heidelberg, Germany) flow cytometer. After 60
sec, cells were exposed to the test compounds and then
measured for another 740 sec. Data were analyzed using
FlowJo software (Ashland, Oregon, USA).
Nitric Oxide (NO) Detection by
Flow Cytometry
PBMC (0.25x10
6
) were suspended in DMEM medium and
exposed to solvent control, AITC or 100 µM of the NO-donor
SNAP (positive control) in 96-well plates for 30-270 min in a
humidified incubator (5% CO
2
, 37°C). After that, cells were then
loaded with 0.5 µM DAF-FM diacetate prepared in HBSS buffer
for another 30 min. DAF-FM loading at this low concentration
allows reducing the background fluorescence and improving the
signal to noise ratio in a single cell (34). After incubation, the
cells were washed twice with PBS, followed by 30 min. de-
esterification of the intracellular diacetates in the dark at room
temperature. Fluorescence signals (ex 488 nm, em 530± 30 nm)
were monitored using a FACSCalibur™flow cytometer. The
median fluorescence intensity (MFI) of each sample was
calculated using FlowJo software (Ashland, Oregon, USA).
DAF-FM-DA has a detection limit of about 5 nM NO (35).
Bactericidal Activity
E. coli K-12 bacteria were grown in Luria-Bertani medium at
37°C to mid-logarithmic-phase as determined by OD600. Next,
PBMC (1x10
6
/mL) were incubated with E. coli K-12 at MOI 0.5
in RPMI 1640 medium supplemented with 2% heat-inactivated
fetal calf serum and exposed to the test compounds for 120 min
in a humidify condition (5% CO
2
, 37°C). Thereafter, 1 µg/mL of
themembranepotentialdyeDiBAC
4
(3) was added and
incubated for 10 min at room temperature in the dark.
Subsequently, the cells were washed once with PBS and
centrifuged at 4500 x g for 10 min. The percentage of
depolarized bacteria was determined using a FACSCalibur™
flow cytometer with an excitation wavelength of 493 nm.
Protein Analysis by Immunoblotting
Proteins of interest were analyzed by immunoblotting as
described before (36). Densitometric analysis was done to
quantify the immunoblots using Quantity One software (Bio-
Rad, Munich, Germany) and normalized against b-actin.
Quantification of Cytokine Release by
Multiplex Bead Technique or ELISA Assay
PBMC (1x10
6
/mL) cultured in RPMI 1640 medium
supplemented with 10% heat-inactivated fetal calf serum,
2mML-glutamine, 100 U/ml penicillin/streptomycin were
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 6690053
stimulated with 0.5 ng/ml CD3/CD28 MAbs and exposed to the
test compounds. After 24 h, supernatants were collected and
stored at -80°C until analysis using the human MACSplex
cytokine 12-kit (Miltenyi Biotec GmbH, Bergisch Gladbach,
Germany) according to manufacturer’s protocol to quantify
cytokine secretion. Supernatants were also used for
photometric quantification by the human TNF-alpha or IL-1b
ELISA Ready-Set-Go kit from eBIoscience (Frankfurt, Germany)
according to the manufacturer’s instructions.
Human Food Intervention and Preparation
of Blood Serum Samples for
Determination of AITC Mercapturic
Acid Metabolites
AITC metabolite quantification was carried out in blood plasma
samples derived from an intervention study at the University
Medical Center in Freiburg, Germany. Samples were from 4
healthy young adults (3 females, 1 male, aged between 30-40
years) having a normal BMI, and were non-smokers. Each
subject consumed one time 10 g of a commercially available
mustard preparation (Löwensenf extra, Develey Munich,
Germany) containing 24.74 ± 1.76 µmol/g fresh weight
preformed AITC on an empty stomach with optional
consumption of white bread. The intervention was preceded by
a 48 h wash-out phase consisting of a glucosinolate/ITC-free diet.
After 30 min and optionally 60 min, blood was collected by
venipuncture in serum tubes and centrifuged at 2000g for
10 min, 4°C to obtain serum. Subsequently, TFA was added
and the samples frozen at -80°C. The preparation of serum
samples (300 µL serum and 100 µL TFA) was conducted as
described by Kühn et al. (37). The frozen samples were thawed,
vortexed (1 min) and centrifuged (4 °C, 10 min, 20.854 x g). The
supernatant was transferred to SPE cartridges. Prior to
transferring, SPE cartridges were conditioned with acetonitrile
(ACN, 3 mL) and equilibrated with water (3 mL). After sample
application, the cartridges were washed with formic acid (FA,
3 mL, 0.1% in water) and the metabolites were eluted with FA
(3 mL, 0.1% in ACN:water, 90:10, v/v). Subsequently, the eluates
were evaporated to dryness with a gentle stream of nitrogen. The
samples were re-dissolved in 100 µL FA (0.1% in ACN:water,
90:10, v/v). Sample aliquots of 5 µL were injected into the LC-
ESI-MS/MS system.
LC-ESI-MS/MS Analysis
LC-ESI-MS/MS analysis was performed on an API4000 triple
quadrupole mass spectrometer (AB Sciex Germany GmbH,
Darmstadt, Germany) equipped with an Agilent 1200 LC
system (Agilent Technologies Deutschland GmbH & Co. KG,
Waldbronn, Germany). For data acquisition and processing the
software Analyst 1.6.1 (AB Sciex Germany GmbH, Darmstadt,
Germany) was used. The analysis of the mercapturic acid
metabolites (AITC-GSH; AITC-CysGly; AITC-Cys; AITC-
NAC) was conducted according to Platz et al. (38) with minor
modifications. The separation was performed on a Kinetex C18
column (Phenomenex, 5 mm, 100 Å, 150 x 2.1 mm). The
autosampler operated at 4°C and the set temperature for the
oven was 20°C. A constant flow of 300 µL/min was used for the
mobile phase which consisted of 0.1% FA in water (A) and
0.1% FA in ACN (B). The start composition was 80% of eluent A,
being held for 1 min, then eluent B was increased from 20 to 90%
within 11 min and held for 4 min. In order to equilibrate the
column, A was increased to 90% and held for 5 min. The relevant
MS parameters include an entrance potential of -10 V, a
desolvation gas temperature of 450°C, ion spray potential of
-4.5 kV, gas 1 and gas 2 at 46 psi and a curtain gas pressure at
10 psi. The analysis was done in the negative ionization mode
and the quantitation was done by an external calibration in a
concentration range between 0.01 mMand100mMof
each metabolite.
Statistics
Data were analyzed using GraphPad Prism 6.0 software (La Jolla,
California, USA). Results are presented as means +SD. Statistical
significance was determined by paired t-test or the ordinary one-
way ANOVA followed by Bonferroni correction test. P values <
0.05 (*) were considered statistically significant and < 0.01 (**)
were considered highly statistically significant.
Study Approval
The human intervention trial and blood sampling for in vitro
experiments were conducted according to the Declaration of
Helsinki. The intervention trial was approved by the Ethics
Committee of the University of Freiburg with the ethical vote
number 54/20. The in vitro experiments on human PBMC were
approved by the ethics committee of the University of Freiburg
with the ethical vote number 597/14. All subjects provided
written informed consent before peripheral blood was collected
by venipuncture.
RESULTS
Functional Activation of the TAS2R38
Receptor by AITC
Bitter taste receptors are metabotropic G protein-coupled
receptors that can signal through intracellular calcium release
involving PLCb-2 (39). Thus, the potential of AITC to trigger
TAS2R38-dependent calcium mobilization in human PBMC was
first investigated using flow cytometry. Upon stimulation with
AITC, low-level, sustained calcium flux was detected in the
monocyte and lymphocyte subpopulation in a genotype-
dependent manner while the vehicle alone had no effect
(Figure 1). A statistically significant calcium flux in monocytes
was evident at 0.01 µM for PAV/PAV (22%), 10 µM for PAV/
AVI (18%), and 100 µM for AVI/AVI genotypes (20%). In PAV/
PAV cells, the calcium influx increased between 0.01 to 1 µM
(28% to 35%), then plateaued between 1-10 µM and further
increased between 10-100 µM (45% to 72%). Lymphocytes were
less sensitive for AITC, but still a genotype-dependent effect on
calcium influx could be seen. For AVI/AVI and PAV/AVI, this
was evident at 100 µM (24% and 21%, respectively), for PAV/
PAV at 1 µM AITC (25%).
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 6690054
Morley et al. (40) demonstrated that the solvent DMSO could
cause significant calcium release at 1%, and the authors said that
already at 0.2% some solvent effects were seen. Moreover, DMSO
represents a bona fide, albeit low potency agonist for TAS2R38-
PAV with a half maximal (50%) effective concentration (EC
50
)
shown in transfected HEK293 cells of 178 mM (~1.3% DMSO
solution) and a threshold concentration of approximately >125
mM (~0.9% DMSO solution) (41). In order to exclude that the
observed effects of AITC were triggered by the solvent, calcium
flux was assessed after cell exposure to DMSO only. At 0.1%
DMSO, the highest concentration that the solvent was used in
the present study, no effect on calcium release was detected in
human (PAV/PAV) monocytes; starting from 1.5% DMSO, a
mean calcium increase of 36% compared to untreated cells was
observed although statistical significance was, due to
considerable fluctuations of the measurements, not reached
(Figure 2A). We also questioned whether influx from the
extracellular environment could be causally involved in
the calcium signal detected after AITC treatment. Besides the
TAS2R38 receptor, also the transient receptor potential vanilloid
1 and ankyrin 1 (TRPV1 und TRPA1) membrane channels have
been reported as a target of AITC. Both, the TRPV1 and TRPA1
are calcium permeable, non-selective cation channels. They
function to depolarize the plasma membrane and influx
calcium (42). AITC has been shown to activate TRPA1 via
covalent modification of cysteine moieties within the
cytoplasmic N terminus of the channel (43), whereas activation
of TRPV1 has been reported via an interaction with the capsaicin
binding site (44). The EC
50
values for the activation of TRPA1 by
AITC vary among reports using TRPA1 overexpressing cells
from as little as 0.6 mM(45), to 1.47 mM(46) and 3–34 mM(47).
Thus, we next determined the relevance of extracellular calcium
influx for the observations made with AITC. Extra cellular
calcium content was reduced by addition of the chelating agent
EDTA at 0.5 mM before AITC exposure (Figure 2B). Our data
demonstrate that EDTA treatment did not impact calcium influx
triggered by 1 µM AITC (Figure 2B). However, at 100 µM AITC,
a significant reduction of 67% in calcium flux could be seen upon
EDTA treatment indicating a relevance of extracellular calcium
at this high AITC concentration. To investigate this further,
calcium flux assays were performed using capsazepine as TRPV1
and A-967079 as TRPA1 antagonist. The inhibitors were then
used at their reported half maximal inhibitory concentration
(IC
50
) and 10 or 100-fold higher. A reduction of AITC mediated
calcium release by capsazepine could only been detected by
pretreatment with a high concentration of 10 µM before
stimulation with 100 µM AITC. Calcium release induced by 1
µM AITC was not effected (Figure 2C). Similar results were
derived for TRPA1 inhibition. Using the IC
50
concentration of 67
nM, that has been reported in calcium assays by (48), no
reduction of calcium release upon stimulation with 1 µM
AITC was detected. Only much higher concentrations of A-
967079 blocked the calcium release. A partly reduction of 35%
was observed after pretreatment with 10 µM TRPA1 inhibitor in
ABC
DEF
FIGURE 1 | Mobilization of calcium in human PBMC with different TAS2R38 haplotypes after stimulation with AITC. PBMC were isolated and exposed to AITC or
solvent control (SC, 0.1% DMSO). Flow cytometry based measurement of calcium flux was detected in monocytes (A–C) and lymphocytes (D–E) probed with Fluor-
4AM(F
EM:516 nm
) after treatment with compounds. Baseline fluorescence was recorded for 60 sec before exposure. After exposure, fluorescence was measured for
another 740 sec. Calcium response was calculated as the ratio of the maximum peak post stimulation to basal level using FlowJo software. Dots represent mean
values ± SD, n ≥4 of cells from AVI/AVI (A,D), PAV/AVI (B,E) and PAV/PAV (C,F) subjects. Representative pictures of the gating strategy for monocytes or
lymphocytes, and calcium flux response to AITC or SC from one subject are given on the right. Significance of difference was determined using paired t-test
compared to the respective SC, *p < 0.05, **p < 0.01.
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 6690055
cells activated by 100 µM AITC (Figure 2D). These results
indicate to a specific TAS2R38 activation by AITC at
low concentrations.
Phosphoinositide-specific phospholipase C is a key enzyme in
the regulation of IP
3
-mediated calcium release. To clarify the role
of PI-PLCbin AITC-mediated calcium regulation, the PI-PLCb
inhibitor U73122 was used. As given in Figure 2E, cell
pretreatment with U73122 could almost completely block the
AITC induced calcium release.
AITC Stimulates NO Production and
Exerts Bactericidal Activity TAS2R38
Genotype Dependent
Nitric oxide (NO) is a key feature of immune cells and plays an
integral role in defending against pathogens. NO is synthesized
by the enzyme NO synthase (NOS), cNOS is constitutively
present in the cell and calcium dependent but iNOS is calcium
independent and expressed only after stimulus (49). We thus
next evaluated the potential of AITC to trigger NO production in
response to low-level intracellular calcium changes that are
known to stimulate calmodulin-dependent NOS activation (49)
using the DAF-FM probe. There was an insignificant increase in
NO in the monocyte cell population by AITC (≥10 µM) after 1h
in cells from PAV/PAV, not AVI/AVI subjects (Figure 3A).
After 5h exposure to AITC, a genotype-dependent NO
production became evident (PAV/PAV: 46% increase at 3 µM;
AVI/AVI: 41% increase at 100 µM). In contrast, there was no
differential regulation in NO production in the lymphocyte
population; NO production could only be detected after 5h
exposure to 100 µM AITC.
Human PBMC were then co-incubated with E. coli K12
bacteria at multiplicity of infection (MOI) 0.5 and membrane
potential changes quantified using DiBAC
4
(3) staining
(Figure 3B). While no effect could be seen in AITC treated
AVI/AVI cells, an increased bactericidal activity of AITC became
evident in PAV/PAV cells.
AITC Modulates the MAPK and
PI3K/AKT Signaling Pathway TAS2R38
Genotype Dependent
The mitogen-activated protein kinases (MAPKs) pathway is one
of the most widely studied signaling pathways which is essential
for processes that are central to inflammatory responses by
immune cells, e. g. MAPK signaling is involved in cellular
stress response, proliferation and differentiation (50). The
phosphatidylinositol 3-kinase (PI3K)/AKT pathway also
regulates cell metabolism, growth or survival; AKT is here a
primary mediator of the PI3K signaling cascade. In PBMC, a
quick activation (5 min. AITC exposure), followed by
dephosphorylation of p-ERK1/2 and p-p38 was evident in the
PAV/PAV group upon AITC treatment, in contrast to cells from
AVI/AVI subjects (Figure 4) as compared to control cells. The
same activation/inactivation pattern could be seen for p-Akt
upon AITC treatment in dependence of the TAS2R38 genotype
(Figure 4).
AB
CDE
FIGURE 2 | Specificity of T2R38 receptor activation by AITC. PBMC were isolated from PAV/PAV genotype subjects and exposed to (A) DMSO or were (B) pre-
treated with/without 0.5 mM EDTA for 5 min, (C) the TRPV1 antagonist capsazepine (CPZ) for 30 min, (D) the TRPA1 antagonist A-967079 for 30 min, and (E) the
PLC-b2 antagonist U73122 for 30 min before AITC exposure. FACS based measurement of calcium flux was then detected in the monocyte subpopulation probed
with Fluor-4 AM (F
EM:516 nm
). Baseline fluorescence was recorded for 60 sec. After compound exposure, fluorescence was measured for another 740 sec. Calcium
response was calculated as the ratio of the maximum peak post stimulation to basal level using FlowJo software. Dots represent mean values ± SD, n ≥3.
Significance of difference was determined using the paired t-test compared to the respective solvent control (SC, 0.1% DMSO), *p < 0.05, **p < 0.01.
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 6690056
AITC Inhibits TNF-Alpha Secretion of
Activated PBMC in a TAS2R38 Genotype
Dependent Manner
Likewise, an upregulation of p-ERK, p-p38 and p-Akt
phosphorylation was evident after 5 min. treatment with 100
pg/mL LPS and AITC in the PAV/PAV subjects (Figure 5A). We
then addressed the question of whether immune responses vary
between TAS2R38 genotype variants in terms of cytokine release.
First, we investigated whether cell signaling triggered by mere
AITC exposure could mediate cytokine release in the absence of
any further inflammatory stimulus such as LPS. However, no
change in TNF-arelease could be detected upon AITC exposure,
then (data not shown). In 3 h LPS activated PBMC, AITC
substantially suppressed TNF-asecretion (peak inhibition of
54% at 3 µM) and this was dependent on TAS2R38 receptor
functionality (Figure 5B). Prolonged incubation with AITC (24 h)
abolished the effect seen in the PAV/PAV group at all tested
concentrations, suggesting the involvement of TAS2R38 in an
early innate immune response. Release of the pro-inflammatory
cytokine IL-1b, on the other hand, was suppressed in both AVI/
AVI and PAV/PAV groups by AITC (Figure 5C). qRT-PCR
analysis revealed a strong (50%) but transient inhibition of TNF-
alpha mRNA expression in LPS stimulated PBMC from PAV/
PAV subjects by AITC (Figure 5D). Similar, but less strong effects
were seen in CD3/CD28 mAbs stimulated cells derived from PAV/
PAV haplotype subjects upon exposure to AITC. No effect on
TNF-awas observed in the AVI/AVI group after treatment with
AITC (Figure 6A). While a differential inhibition of IL-1bwas
seen in PAV/PAV vs. AVI/AVI cells, a modulation of other
pro-inflammatory (IL-2, IL-6 and IL17-A) and also anti-
A
B
FIGURE 3 | AITC stimulates NO production and exerts bactericidal activity in dependence of the TAS2R38 haplotype. PBMC were isolated from AVI/AVI or PAV/
PAV genotype subjects and (A) exposed to 0.01% DMSO (SC), AITC, the NO-donor SNAP (positive control), or the NO scavenger cPTIO for the indicated time
points. Then, 0.5 µM DAF-FM diacetate was added for 30 min. Fluorescence signals (ex 488 nm, em 530± 30 nm) were monitored using a FACSCalibur™. The
median fluorescence intensity (MFI) of each sample was calculated using FlowJo software (Ashland, Oregon, USA). A representative histogram of one PAV/PAV
subject is shown on the top, (B) incubated with E. coli K-12 at MOI 0.5 and exposed to 0.01% DMSO (SC) or AITC for 120 min at 37°C. Cell membrane potential
depolarization was determined by staining bacteria with 1 µg/ml DiBAC
4
(3) for 10 min, in the dark at room temperature. Representative scattergrams of E. coli K-12
and PBMC treated with E. coli K-12 are given. An FSC/SSC plot was first made and E. coli K-12 cells gated. The population was copied to a SSC/DiBAC
4
(3)-
scatterplot identifying the percentage of depolarized bacteria. Bars are mean value + SD, *p < 0.05, **p < 0.01. Significance of difference was calculated relative to
the respective control by one-way ANOVA.
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 6690057
inflammatory (IL-10) cytokines was not clearly genotype
dependent (Figure 6B).
AITC Plasma Levels in Human Volunteers
After Food Consumption
The pharmacokinetics of oral AITC dosing has been shown so
far only in rats (51). Then the peak plasma level was reached
within 0.5 h. Thus, we finally investigated AITC plasma levels in
human volunteers after single consumption of a normal portion
(10 g) mustard preparation containing 24.75 ± 1.76 µmol/g
preformed AITC as determined by GC-MS analysis. After
0.5 h, consumption resulted in a blood plasma level of 836.7 ±
67.7 nM, after 1 h of 1001.0 ± 228.3 nM AITC-NAC metabolite
(Table 1). No other AITC metabolites (AITC-GSH or AITC-
CG) could be detected at this time (data not shown).
DISCUSSION
Food and nutrition are closely linked with health; food may be
the cause and also a cure of illness. However, it is well
documented that people respond differently to plant
components and food–gene interactions may explain why
some individuals respond more favorably to food interventions
than others. Inter-individual variation in drug response among
patients is also well known and poses a serious problem in
medicine (52,53). Here, a better understanding of how diet
affects health could be achieved by providing scientific evidence
of differential responses to bioactive phytochemicals dependent
on individual genetic variations. This could present a decisive
step towards individualizing or personalizing food for reaching
better disease prevention and treatment strategies.
A single-nucleotide polymorphism in the TAS2R38 receptor
gene has decisive influence on individual bitter taste sensitivity and
beyond this, increasing evidence indicates a relevance of the
TAS2R38 receptor in innate immune defense against microbial
attack (8,26,27,54). Our data on the natural TAS2R38 receptor
agonist AITC support this hypothesis and further indicate an
additional, albeit less strong, role in the adaptive immune response.
The G protein subunit couples activated TAS2Rs to
phospholipase C activity, inositol trisphosphate, and this releases
calcium from its internal stores (55). Calcium in turn is a second
messenger that affects many cell signaling processes. Using the
PLCb-2 inhibitor U-73122, we could confirm that AITC-triggered
calcium mobilization predominantly took place through the
AITC-TAS2R38-Gabg-PLC pathway in PBMC. Further, our
A
B
FIGURE 4 | AITC mediates MAPK down-stream signaling in dependence of the TAS2R38 haplotype. (A,B) PBMC were treated with test compounds for the
indicated time points and pellets were collected for protein expression analysis. Representative immunoblots are given. Densitometric analysis was done to quantify
the immunoblots using Quantity One software (Bio-Rad, Munich, Germany) and normalized against b-actin, which was used as loading control. The graphs show
phosphorylated ERK1/2, p-38 or Akt, protein levels relative to control as quantified by pixel densitometry. Bars are mean + SD; *p < 0.05, **p < 0.01 (n ≥2).
Significance of difference was calculated relative to the corresponding solvent control determined by one-way ANOVA (SC, 0.01% DMSO).
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 6690058
A
B C
D
FIGURE 5 | In bacterial LPS stimulated PBMC, AITC triggers MAPK activation and TNF-ainhibition in dependence of the TAS2R38 genotype. PBMC were exposed
to AITC or 0.01% DMSO (SC) together with 100 pg/mL LPS. (A) Representative immunoblots are given. Densitometric analysis was done to quantify the
immunoblots using Quantity One software (Bio-Rad, Munich, Germany) and normalized against b-actin, which was used as loading control. (B,C) Cytokine secretion
at 3 and 24 h was analyzed using ELISA kits. (D) Time kinetic of TNF-amRNA expression. Results are means + SD and given as fold of the solvent control. Results
were calculated relative to the corresponding solvent control (SC, 0.01% DMSO). Significance of difference was determined compared to the respective SC by one-
way ANOVA, *p < 0.05, **p < 0.01.
AB
FIGURE 6 | In bacterial LPS stimulated PBMC, AITC triggers MAPK activation as well as TNF-arelease in dependence of the TAS2R38 genotype. PBMC were
exposed to AITC or 0.01% DMSO (SC) together with 0.5 ng/mL CD3/CD28 MAbs for 24h (A,B). Cytokine secretion was analyzed using the human MACSplex
cytokine 12-kit or ELISA kits. Results are mean values + SD and given as fold of the solvent control. Significance of difference was determined compared to the
respective SC as determined by one-way ANOVA, *p < 0.05, **p < 0.01.
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 6690059
findings indicate that the cation channels TRPV1 and TRPA1,
which are known to be also a target of AITC (46,56,57), do not
account for the observations at diet-related concentrations, but
only at supra physiological ones. In some cases, wide variations in
TAS2R38 dependent calcium release were observed.
This may relate to individual expression levels of TAS2R38,
which have been reported previously (58). Moreover, the
bitterness ratings of human volunteers for 6-n-propylthiourea
(PROP), a prototypical synthetic TAS2R38 agonist, were
correlated with the TAS2R38-PAV mRNA levels. Even though
these experiments were done in individuals heterozygous for
TAS2R38-taster and non-taster alleles, this suggests that
TAS2R38 function is directly linked to TAS2R38-PAV
expression levels (58). For the observed discrepancy between
AITC threshold concentration in monocytes (10 nM) and
published in vitro data of the heterologous expressed
TAS2R38-PAV (10 µM) (18) we have no immediate
explanation. Different experimental settings, such as different
cell types may partially account for this. Also, we assessed
calcium-dependent changes of cellular fluorescence after
prolonged exposure to AITC. This is different to the in vitro
heterologous experiments where, due to the transient nature of
calcium signals in HEK cells, peak fluorescence is reached within
seconds after substance application, although the stimulus is
usually still present. Hence, the rather long accumulation of
AITC-stimulated calcium ions might have shifted the detection
limit towards lower concentrations.
The MAPK ERK1/2 is activated preferentially by mitogenic
factors, differentiation stimuli and cytokines, while p38 MAPKs
respond to conditions of cellular stress (59). MAPK activities are
thereby subject to negative feedback control. The
dephosphorylation of MAPKs plays here a key role in
determining the magnitude and duration of kinase activation
and hence the physiological outcome of signaling. For ERK1/2, a
calcium/calmodulin/calcineurin-dependent protein inactivation
has been described before (60). In the present study, a quick
activation, followed by dephosphorylation of ERK1/2 and p38 at
their Thy/Thr phosphorylation sites and also Akt at Ser473 could
be seen upon AITC exposure but only in cells from PAV/PAV
individuals which further supports the idea of a distinct
regulation of key signal transduction pathways dependent on
TAS2R38 activation.
NO is a short-lived free radical, recognized as a highly
cytotoxic and ubiquitous biomessenger molecule. NOS is a
calmodulin binding protein and thus regulates the NO
pathway (61). In sinonasal cells, NO production was found to
be stimulated by the TAS2R38 agonist PTC in a TAS2R38
genotype dependent manner (28). Its inducible form (iNOS) is
absent from resting immune cells, and is expressed in response to
stimuli, e. g. microbial LPS. Macrophages are here considered the
prototypic iNOS expressing cells (62–64). This concurs with our
observation that AITC-mediated NO production was mainly
seen in the monocyte subpopulation of PBMC. Then, an earlier
and more intense response of PAV/PAV cells to AITC as
compared to AVI/AVI was seen. A higher NO production was
also detected in human PAV/PAV epithelial cells > PAV/AVI >
AVI/AVI upon calcium flux triggered by TAS2R38 sensitive
quorum sensing molecules or PTC. This activation then
ultimately resulted in increased bactericidal activity (26,28).
The authors thus proposed a specific role of TAS2R38-induced
NO production, which could facilitate the bactericidal action for
PAV/PAV genotypes (26,28). In our experiments such increase
in bactericidal action could be confirmed for PAV/PAV immune
cells against E. coli K12 bacteria.
Theimmuneresponsetopathogensinvolvestherapid
activation of pro-inflammatory and anti-inflammatory
mechanisms that serve to initiate host defense against
microbial invasion and in parallel maintain or restore tissue
homeostasis (65). TNF-ais, besides a number of other
inflammatory cytokines, pleiotropic and critical in regulating
cellular stress responses, metabolism, and even food intake (66–
68). Results in TNF-deficient mice suggest that the cytokine itself
is involved in bitter taste reception regulation (69). Treatment
with denatonium, which activates multiple TAS2Rs, triggered a
marginal change in cytokine release from sinonasal epithelial
cells (70). A marked reduction of multiple cytokine production,
including TNF-a, has been shown in LPS stimulated leukocytes
exposed to denatonium or other T2R agonists (71).
Compound concentrations that prove to be active in vitro may
not be reached in the human organism, e. g. due to a reduced
bioavailability. So far, no data of human AITC plasma levels had
been reported upon food consumption or pharmaceutical intake.
Here, we could now show that single intake of an AITC containing
food product resulted in AITC plasma levels of around one µM.
This indicates to a sufficient systemic bioavailability after normal
food intake to trigger TAS2R38-dependent immune cell responses.
Whether the in vitro findings can be translated into a clinically
relevant setting will now have to be investigated in a well-designed
randomized controlled trial.
CONCLUSION
So far, most of the available scientificevidenceinsupportof
precision nutrition is based on observational studies. Much more
research will be required before personalized nutrition can deliver
the expected benefits. The present study could now provide first
biological evidence of differential immune responses to the food-
born compound AITC dependent on a genotypic characteristic.
TABLE 1 | Quantification of AITC plasma levels [nmol/L] after single oral intake of
a conventional mustard preparation, as determined using LC-ESI-MS/MS.
Plasma sampling time
30 min. 60 min.
Volunteer A (1) genotype:
PAV/AVI
760.5
Volunteer A (2) 827.2
Volunteer B (1) genotype:
AVI/PVA
967.6
Volunteer B (2) 904.9
Volunteer C (1) genotype:
PAV/PAV
798.5 851.7
Volunteer C (2) 793.1 795.8
Volunteer D (1) genotype:
PAV/PAV
838.1 1057.6
Volunteer D (2) 804.0 1298.9
Plasma was sampled either 30 min. (N=4) or 60 min. (N=2) after intake. Each sample was
measured in duplicate.
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 66900510
Across the globe, plants from the order Brassicales are very
popular, and considered as “healthy”despite them tasting bitter
for many people. Besides food item, they are used in traditional
medicine (e. g. “mustard plasters”against bronchitis) and
pharmaceutical remedies against bacterial infection and
inflammation. Maybe in future, individuals could be identified
based on their genetically determined individual taste perception
that profit more from an AITC-containing food intervention or be
more responsive to such a medical treatment than others. This
could then guide timely alternative (therapeutic) interventions in
people who inherit nonfunctional TAS2R38 alleles. However, until
we arrive at this point clearly more research is needed.
Interestingly, in a study by Meyerhof et al. (18) AITC as well as
the structurally related phenylethyl ITC activated the TAS2R38-
PAV receptor. In contrast, another ITC, L-sulforaphane, did not.
So there seem to be some other, yet unknown factors determining
the activation capacity and one may not generalize our results on
all compounds from this class.
DATA AVAILABILITY STATEMENT
The original contributions presented in the study are included in
the article/supplementary material. Further inquiries can be
directed to the corresponding author.
ETHICS STATEMENT
The studies involving human participants were reviewed and
approved by the Ethics Committee of the University of Freiburg.
The patients/participants provided their written informed
consent to participate in this study.
AUTHOR CONTRIBUTIONS
EL designed the study and experiments. HT, RS, CH, JS, MK, and
FH designed and carried out the experiments. HT, RS, and EL
prepared the graphs and analyzed the data. FH analyzed AITC in
mustard samples. EL, SR and MS provided study materials and
reagents. EL drafted the first version of the manuscript. EL, HT,
RS, and MB wrote the paper. All authors contributed to the
article and approved the submitted version.
FUNDING
The article processing charge was partly funded by the German
Research Foundation (DFG) and the University of Freiburg in
the funding program Open Access Publishing. FH is funded by
the Leibniz-Association (Leibniz-Junior Research Group
OPTIGLUP; J16/2017).
REFERENCES
1. Drewnowski A. Taste preferences and food intake. Annu Rev Nutr (1997)
17:237–53. doi: 10.1146/annurev.nutr.17.1.237
2. Sandell M, Breslin PAS. Variability in a taste-receptor gene determines
whether we taste toxins in food. Curr Biol (2006) 16:R792–4. doi: 10.1016/
j.cub.2006.08.049
3. Chandrashekar J, Mueller KL, Hoon MA, Adler E, Feng L, Guo W, et al. T2Rs
function as bitter taste receptors. Cell (2000) 100:703–11. doi: 10.1016/s0092-
8674(00)80706-0
4. Adler E, Hoon MA, Mueller KL, Chandrashekar J, Ryba NJP, Zuker CS. A
Novel Family of Mammalian Taste Receptors. Cell (2000) 100:693–702.
doi: 10.1016/S0092-8674(00)80705-9
5. Matsunami H, Montmayeur JP, Buck LB. A family of candidate taste
receptors in human and mouse. Nature (2000) 404:601–4. doi: 10.1038/
35007072
6. Bufe B, Breslin PAS, Kuhn C, Reed DR, Tharp CD, Slack JP, et al. The
molecular basis of individual differences in phenylthiocarbamide and
propylthiouracil bitterness perception. Curr Biol (2005) 15:322–7.
doi: 10.1016/j.cub.2005.01.047
7. Kim UK, Jorgenson E, Coon H, Leppert M, Risch N, Drayna D. Positional
cloning of the human quantitative trait locus underlying taste sensitivity to
phenylthiocarbamide. Science (2003) 299:1221–5. doi: 10.1126/
science.1080190
8. Maurer S, Wabnitz GH, Kahle NA, Stegmaier S, Prior B, Giese T, et al. Tasting
Pseudomonas aeruginosa Biofilms: Human Neutrophils Express the Bitter
Receptor T2R38 as Sensor for the Quorum Sensing Molecule N-(3-
Oxododecanoyl)-l-Homoserine Lactone. Front Immunol (2015) 6:369.
doi: 10.3389/fimmu.2015.00369
9. Malki A, Fiedler J, Fricke K, Ballweg I, PfafflMW, Krautwurst D. Class I
odorant receptors, TAS1R and TAS2R taste receptors, are markers for
subpopulations of circulating leukocytes. J Leukoc Biol (2015) 97:533–45.
doi: 10.1189/jlb.2A0714-331RR
10. Tran HTT, Herz C, Ruf P, Stetter R, Lamy E. Human T2R38 Bitter Taste
Receptor Expression in Resting and Activated Lymphocytes. Front Immunol
(2018) 9:2949. doi: 10.3389/fimmu.2018.02949
11. Sollai G, Melis M, Pani D, Cosseddu P, Usai I, Crnjar R, et al. First objective
evaluation of taste sensitivity to 6-n-propylthiouracil (PROP), a paradigm
gustatory stimulus in humans. Sci Rep (2017) 7:40353. doi: 10.1038/srep40353
12. Wooding S, Kim UK, Bamshad MJ, Larsen J, Jorde LB, Drayna D. Natural
selection and molecular evolution in PTC, a bitter-taste receptor gene. Am J
Hum Genet (2004) 74:637–46. doi: 10.1086/383092
13. Guo SW, Reed DR. The genetics of phenylthiocarbamide perception. Ann
Hum Biol (2001) 28:111–42. doi: 10.1080/03014460151056310
14. Bell L, Oloyede OO, Lignou S, Wagstaff C, Methven L. Taste and Flavor
Perceptions of Glucosinolates, Isothiocyanates, and Related Compounds. Mol
Nutr Food Res (2018) 18:e1700990. doi: 10.1002/mnfr.201700990
15. Drewnowski A, Gomez-Carneros C. Bitter taste, phytonutrients, and the
consumer: a review. Am J Clin Nutr (2000) 72:1424–35. doi: 10.1093/ajcn/
72.6.1424
16. Fenwick GR, Heaney RK, Mullin WJ. Glucosinolates and their breakdown
products in food and food plants. Crit Rev Food Sci Nutr (1983) 18:123–201.
doi: 10.1080/10408398209527361
17. Engel E, Baty C, Le Corre D, Souchon I, Martin N. Flavor-active compounds
potentially implicated in cooked cauliflower acceptance. J Agric Food Chem
(2002) 50:6459–67. doi: 10.1021/jf025579u
18. Meyerhof W, Batram C, Kuhn C, Brockhoff A, Chudoba E, Bufe B, et al. The
molecular receptive ranges of human TAS2R bitter taste receptors. Chem
Senses (2010) 35:157–70. doi: 10.1093/chemse/bjp092
19. Wu C, Du L, Zou L, Zhao L, Huang L, Wang P. Recent advances in taste cell-
and receptor-based biosensors. Sens Actuators B Chem (2014) 201:75–85.
doi: 10.1016/j.snb.2014.04.021
20. Zhang Y. Allyl isothiocyanate as a cancer chemopreventive phytochemical.
Mol Nutr Food Res (2010) 54:127–35. doi: 10.1002/mnfr.200900323
21. Rajakumar T, Pugalendhi P, Jayaganesh R, Ananthakrishnan D, Gunasekaran
K. Effect of allyl isothiocyanate on NF-kappaB signaling in 7,12-dimethylbenz
(a)anthracene and N-methyl-N-nitrosourea-induced mammary
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 66900511
carcinogenesis. Breast Cancer (2018) 25:50–9. doi: 10.1007/s12282-017-
0783-y
22. Subedi L, Venkatesan R, Kim SY. Neuroprotective and Anti-Inflammatory
Activities of Allyl Isothiocyanate through Attenuation of JNK/NF-kappaB/
TNF-alpha Signaling. Int J Mol Sci (2017) 18:1423. doi: 10.3390/
ijms18071423
23. Wagner AE, Boesch-Saadatmandi C, Dose J, Schultheiss G, Rimbach G. Anti-
inflammatory potential of allyl-isothiocyanate–role of Nrf2, NF-(kappa) B
and microRNA-155. J Cell Mol Med (2012) 16:836–43. doi: 10.1111/j.1582-
4934.2011.01367.x
24. Conrad A, Kolberg T, Engels I, Frank U. In vitro study to evaluate the
antibacterial activity of a combination of the haulm of nasturtium
(Tropaeoli majoris herba) and of the roots of horseradish (Armoraciae
rusticanae radix). Arzneimittelforschung (2006) 56:842–9. doi: 10.1055/s-
0031-1296796
25. Goos KH, Albrecht U, Schneider B. Efficacy and safety profile of a herbal
drug containing nasturtium herb and horseradish root in acute sinusitis,
acute bronchitis and acute urinary tract infection in comparison with other
treatments in the daily practice/results of a prospective cohort study.
Arzneimittelforschung (2006) 56:249–57. doi: 10.1055/s-0031-1296717
26. Cohen NA. The genetics of the bitter taste receptor T2R38 in upper airway
innate immunity and implications for chronic rhinosinusitis. Laryngoscope
(2017) 127:44–51. doi: 10.1002/lary.26198
27. Gaida MM, Dapunt U, Hansch GM. Sensing developing biofilms: the bitter
receptor T2R38 on myeloid cells. Pathog Dis (2016) 74:ftw004. doi: 10.1093/
femspd/ftw004
28. Lee RJ, Xiong G, Kofonow JM, Chen B, Lysenko A, Jiang P, et al. T2R38 taste
receptor polymorphisms underlie susceptibility to upper respiratory infection.
J Clin Invest (2012) 122:4145–59. doi: 10.1172/jci64240
29. Adappa ND, Workman AD, Hadjiliadis D, Dorgan DJ, Frame D, Brooks S,
et al. T2R38 genotype is correlated with sinonasal quality of life in
homozygous DF508 cystic fibrosis patients. Int Forum Allergy Rhinol (2016)
6:356–61. doi: 10.1002/alr.21675
30. Wendell S, Wang X, Brown M, Cooper M, DeSensi R, Weyant R, et al. Taste
Genes Associatedwith Dental Caries. JDentRes(2010) 89:1198–202.
doi: 10.1177/0022034510381502
31. Carrai M, Steinke V, Vodicka P, Pardini B, Rahner N, Holinski-Feder E, et al.
Association between TAS2R38 gene polymorphisms and colorectal cancer
risk: a case-control study in two independent populations of Caucasian origin.
PloS One (2011) 6:e20464. doi: 10.1371/journal.pone.0020464
32. Yamaki M, Saito H, Isono K, Goto T, Shirakawa H, Shoji N, et al. Genotyping
Analysis of Bitter-Taste Receptor Genes TAS2R38 and TAS2R46 in Japanese
Patients with Gastrointestinal Cancers. J Nutr Sci Vitaminol (2017) 63:148–54.
doi: 10.3177/jnsv.63.148
33. Boxer EE, Garneau NL. Rare haplotypes of the gene TAS2R38 confer bitter
taste sensitivity in humans. Springerplus (2015) 4:505. doi: 10.1186/s40064-
015-1277-z
34. Leikert JF, Räthel TR, Müller C, Vollmar AM, Dirsch VM. Reliable in vitro
measurement of nitric oxide released from endothelial cells using low
concentrations of the fluorescent probe 4,5-diaminofluorescein. FEBS Lett
(2001) 506:131–4. doi: 10.1016/s0014-5793(01)02901-5
35. St Laurent CD, Moon TC, Befus AD. Measurement of nitric oxide in mast cells
with the fluorescent indicator DAF-FM diacetate. Methods Mol Biol (2015)
1220:339–45. doi: 10.1007/978-1-4939-1568-2_21
36. Herz C, Hertrampf A, Zimmermann S, Stetter N, Wagner M, Kleinhans C,
et al. The isothiocyanate erucin abrogates telomerase in hepatocellular
carcinoma cells in vitro and in an orthotopic xenograft tumour model of
HCC. J Cell Mol Med (2014) 18:2393–403. doi: 10.1111/jcmm.12412
37. Kühn C, Kupke F, Baldermann S, Klopsch R, Lamy E, Hornemann S, et al.
Diverse Excretion Pathways of Benzyl Glucosinolate in Humans after
Consumption of Nasturtium (Tropaeolum majus L.)—A Pilot Study. Mol
Nutr Food Res (2018) 18:1800588. doi: 10.1002/mnfr.201800588
38. Platz S, Kühn C, Schiess S, Schreiner M, Kemper M, Pivovarova O, et al.
Bioavailability and metabolism of benzyl glucosinolate in humans consuming
Indian cress (Tropaeolum majus L.). Mol Nutr Food Res (2016) 60:652–60.
doi: 10.1002/mnfr.201500633
39. Zhang Y, Hoon MA, Chandrashekar J, Mueller KL, Cook B, Wu D, et al.
Coding of sweet, bitter, and umami tastes: different receptor cells sharing
similar signaling pathways. Cell (2003) 112:293–301. doi: 10.1016/s0092-8674
(03)00071-0
40. Morley P, Whitfield JF. The differentiation inducer, dimethyl sulfoxide,
transiently increases the intracellular calcium ion concentration in various
cell types. JCellPhysiol(1993) 156:219–25. doi: 10.1002/jcp.1041560202
41. VerbeurgtC,VeithenA,CarlotS,TarabichiM,DumontJE,HassidS,etal.
The human bitter taste receptor T2R38 is broadly tuned for
bacterial compounds. PloS One (2017) 12:e0181302. doi: 10.1371/
journal.pone.0181302
42. Latorre R, Zaelzer C, Brauchi S. Structure-functional intimacies of transient
receptor potential channels. Q Rev Biophys (2009) 42:201–46. doi: 10.1017/
s0033583509990072
43. Hinman A, Chuang HH, Bautista DM, Julius D. TRP channel activation by
reversible covalent modification. Proc Natl Acad Sci USA (2006) 103:19564–8.
doi: 10.1073/pnas.0609598103
44. Gees M, Alpizar YA, Boonen B, Sanchez A, Everaerts W, Segal A, et al.
Mechanisms of transient receptor potential vanilloid 1 activation and
sensitization by allyl isothiocyanate. Mol Pharmacol (2013) 84:325–34.
doi: 10.1124/mol.113.085548
45. Narukawa M, Koizumi K, Iwasaki Y, Kubota K, Watanabe T. Galangal
pungent component, 1’-acetoxychavicol acetate, activates TRPA1. Biosci
Biotechnol Biochem (2010) 74:1694–6. doi: 10.1271/bbb.100133
46. Koizumi K, Iwasaki Y, Narukawa M, Iitsuka Y, Fukao T, Seki T, et al. Diallyl
sulfides in garlic activate both TRPA1 and TRPV1. Biochem Biophys Res
Commun (2009) 382:545–8. doi: 10.1016/j.bbrc.2009.03.066
47. Bessac BF, Jordt SE. Breathtaking TRP channels: TRPA1 and TRPV1 in
airway chemosensation and reflex control. Physiology (2008) 23:360–70.
doi: 10.1152/physiol.00026.2008
48. Chen Y, Yang C, Wang ZJ. Proteinase-activated receptor 2 sensitizes
transient receptor potential vanilloid 1, transient receptor potential
vanilloid 4, and transient receptor potential ankyrin 1 in paclitaxel-
induced neuropathic pain. Neuroscience (2011) 193:440–51.
doi: 10.1016/j.neuroscience.2011.06.085
49. Xue Q, Yan Y, Zhang R, Xiong H. Regulation of iNOS on Immune Cells
and Its Role in Diseases. Int J Mol Sci (2018) 19:3805. doi: 10.3390/
ijms19123805
50. Jeffrey KL, Camps M, Rommel C, Mackay CR. Targeting dual-specificity
phosphatases: manipulating MAP kinase signalling and immune responses.
Nat Rev Drug Discov (2007) 6:391–403. doi: 10.1038/nrd2289
51.KimYJ,LeeDH,AhnJ,ChungWJ,JangYJ,SeongKS,etal.
Pharmacokinetics, Tissue Distribution, and Anti-Lipogenic/Adipogenic
Effects of Allyl-Isothiocyanate Metabolites. PloS One (2015) 10:e0132151.
doi: 10.1371/journal.pone.0132151
52. Dormann H, Neubert A, Criegee-Rieck M, Egger T, Radespiel-Troger M,
Azaz-Livshits T, et al. Readmissions and adverse drug reactions in internal
medicine: the economic impact. J Intern Med (2004) 255:653–63. doi: 10.1111/
j.1365-2796.2004.01326.x
53. Budnitz DS, Pollock DA, Weidenbach KN, Mendelsohn AB, Schroeder TJ,
Annest JL. National surveillance of emergency department visits for
outpatient adverse drug events. Jama (2006) 296:1858–66. doi: 10.1001/
jama.296.15.1858
54. Lee RJ, Cohen NA. Role of the bitter taste receptor T2R38 in upper respiratory
infection and chronic rhinosinusitis. Curr Opin Allergy Clin Immunol (2015)
15:14–20. doi: 10.1097/ACI.0000000000000120
55. Deshpande DA, Wang WCH, McIlmoyle EL, Robinett KS, Schillinger RM, An
SS, et al. Bitter taste receptors on airway smooth muscle bronchodilate by
localized calcium signaling and reverse obstruction. Nat Med (2010) 16:1299–
304. doi: 10.1038/nm.2237
56. Jordt SE, Bautista DM, Chuang HH, McKemy DD, Zygmunt PM, Hogestatt
ED, et al. Mustard oils and cannabinoids excite sensory nerve fibres through
the TRP channel ANKTM1. Nature (2004) 427:260–5. doi: 10.1038/
nature02282
57. Kang K, Pulver SR, Panzano VC, Chang EC, Griffith LC, Theobald DL, et al.
Analysis of Drosophila TRPA1 reveals an ancient origin for human chemical
nociception. Nature (2010) 464:597–600. doi: 10.1038/nature08848
58. Lipchock SV, Mennella JA, Spielman AI, Reed DR. Human bitter perception
correlates with bitter receptor messenger RNA expression in taste cells. Am J
Clin Nutr (2013) 98:1136–43. doi: 10.3945/ajcn.113.066688
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 66900512
59. Owens DM, Keyse SM. Differential regulation of MAP kinase signalling by
dual-specificity protein phosphatases. Oncogene (2007) 26:3203–13.
doi: 10.1038/sj.onc.1210412
60. Agell N, Bachs O, Rocamora N, Villalonga P. Modulation of the Ras/Raf/
MEK/ERK pathway by Ca(2+), and calmodulin. Cell Signal (2002) 14:649–54.
doi: 10.1016/s0898-6568(02)00007-4
61. Dasgupta M, Honeycutt T, Blumenthal DK. The gamma-subunit of skeletal
muscle phosphorylase kinase contains two noncontiguous domains that act in
concert to bind calmodulin. J Biol Chem (1989) 264:17156–63. doi: 10.1016/
S0021-9258(18)71472-5
62. Bogdan C, Rollinghoff M, Diefenbach A. The role of nitric oxide in innate
immunity. Immunol Rev (2000) 173:17–26. doi: 10.1034/j.1600-
065x.2000.917307.x
63. Reiling N, Kröncke R, Ulmer AJ, Gerdes J, Flad H-D, Hauschildt S. Nitric
oxide synthase: expression of the endothelial, Ca2+/calmodulin-dependent
isoform in human B and T lymphocytes. Eur J Immunol (1996) 26:511–6.
doi: 10.1002/eji.1830260302
64. Stuehr DJ, Cho HJ, Kwon NS, Weise MF, Nathan CF. Purification and
characterization of the cytokine-induced macrophage nitric oxide synthase:
an FAD- and FMN-containing flavoprotein. Proc Natl Acad Sci USA (1991)
88:7773–7. doi: 10.1073/pnas.88.17.7773
65. Iyer SS, Cheng G. Role of interleukin 10 transcriptional regulation in
inflammation and autoimmune disease. Crit Rev Immunol (2012) 32:23–63.
doi: 10.1615/critrevimmunol.v32.i1.30
66. Cabal-Hierro L, Lazo PS. Signal transduction by tumor necrosis factor receptors.
Cell Signal (2012) 24:1297–305. doi: 10.1016/j.cellsig.2012.02.006
67. Silke J. The regulation of TNF signalling: what a tangled web we weave. Curr
Opin Immunol (2011) 23:620–6. doi: 10.1016/j.coi.2011.08.002
68. Wajant H, Pfizenmaier K, Scheurich P. Tumor necrosis factor signaling. Cell
Death Differ (2003) 10:45–65. doi: 10.1038/sj.cdd.4401189
69. Feng P, Jyotaki M, Kim A, Chai J, Simon N, Zhou M, et al. Regulation of bitter
taste responses by tumor necrosis factor. Brain Behav Immun (2015) 49:32–
42. doi: 10.1016/j.bbi.2015.04.001
70. Lee RJ, Kofonow JM, Rosen PL, Siebert AP, Chen B, Doghramji L, et al. Bitter
and sweet taste receptors regulate human upper respiratory innate immunity.
J Clin Invest (2014) 124:1393–405. doi: 10.1172/JCI72094
71. Orsmark-Pietras C, James A, Konradsen JR, Nordlund B, Söderhäll C,
Pulkkinen V, et al. Transcriptome analysis reveals upregulation of bitter
taste receptors in severe asthmatics. Eur Respir J (2013) 42:65. doi: 10.1183/
09031936.00077712
Conflict of Interest: A part of the study was financed by a grant from Repha
gmbh, Langenhagen, Germany. Repha GmbH was not involved in the study
design, interpretation of the results or writing of the manuscript.
The authors declare that the research was conducted in the absence of any
commercial or financial relationships that could be constructed as a potential
conflict of interest.
Copyright © 2021 Tran, Stetter, Herz, Spöttel, Krell, Hanschen, Schreiner, Rohn,
Behrens and Lamy. This is an open-access article distributed under the terms of the
Creative Commons Attribution License (CC BY). The use, distribution or
reproduction in other forums is permitted, provided the original author(s) and the
copyright owner(s) are credited and that the original publication in this journal is
cited, in accordance with accepted academic practice. No use, distribution or
reproduction is permitted which does not comply with these terms.
Tran et al. TAS2R38 Activation by Allyl Isothiocyanate
Frontiers in Immunology | www.frontiersin.org April 2021 | Volume 12 | Article 66900513
